WO2000063369A2 - Gene therapy - Google Patents

Abstract

The invention relates to genetic modification of target cells, e.g. vascular cells, to inhibit excessive proliferation thereof, comprising transferring to the cells or progenitors thereof, a DNA sequence encoding a soluble form of FasR or FGFR-1 or a biologically active fragment or derivative thereof.

Description

Gene Therapy

The invention provides improvements in the field of gene therapy. In its broad aspect it is concerned with genetic modification of target cells, e.g. vascular cells or graftable cells, to render such cells less susceptible to accelerated apoptosis and proliferative stimuli; it is further concerned with genetic modification of vascular cells, e.g. endotheiial cells (EC) or smooth muscle cells (SMC), to inhibit the SMC proliferation. In particular embodiments, the invention relates to methods of treating vascular occlusive diseases associated with vascular cell proliferation, e.g. accelerated graft arteriosclerosis or other forms of vascular stenosis (e.g. arterial or vein graft stenosis).

SMC proliferation occurs in response to a number of stimuli, including surgically-induced injuries, e.g. coronary angioplasty or organ transplantation. Despite major advances in organ transplantation in the past decades, accelerated graft arteriosclerosis (AGA) remains a major obstacle for the long-term survival of patients with solid organ grafts. AGA seems to be a multifactorial process characterized by e.g. the proliferation of smooth muscle cells (SMC) within the intima of the vessel wall of transplanted organs, which results in the compromise of the blood flow to downstream tissues.

It will be appreciated that there is a great need in the medical community for means to inhibit either early apoptosis of target cells, e.g. graftable cells, or excessive proliferation of vascular cells, e.g. vascular SMC, or to prevent, attenuate or inhibit vascular occlusion or to prolong cells, tissue or organ graft survival.

It has now been found that excessive proliferation of cells, for example injury-induced or immune-driven proliferation of cells, e.g. vascular cells or other graftable cells, particularly the development of AGA, can be prevented or retarded by the inhibition of accelerated Fas- mediated death of the cells or by the inhibition of Fibroblast Growth Factor (FGF) receptors mediated signal transduction in vivo.

Fas antigen or receptor (FasR) is a member of a family of death receptor molecules that can be found on the surface of many activated cells, whereas FasL expression is limited to the surface of cytolytic T cells (CTL) and a few other immune privileged tissues in the body. The interaction of the cell membrane protein FasR with its ligand, FasL, induces apoptosis of susceptible FasR-bearing cells. In the early events of AGA, it is conceivable that the immune system of the host is activated by allo-antigens and upregulates the expression of FasL on the surface of cytolytic cells, which then bind to FasR-bearing target cells resulting in their accelerated apoptosis.

Activated EC elaborate growth factors including e.g. acidic fibroblast growth factor (FGF-1) and basic FGF (FGF-2). FGF receptors appear to mediate the effects of the various FGFs on the cells.

Accordingly, the invention provides a method of genetically modifying mammalian target cells, e.g. vascular cells or other graftable cells, to inhibit excessive proliferation thereof which comprises transferring to the cells, or progenitors thereof, a DNA sequence encoding a soluble form of either FasR or FGFR-1 (type 1 receptor for FGF) or a biologically active fragment or derivative thereof.

When the encoded receptor is soluble FasR, the target cells are preferably vascular cells, e.g. EC or SMC; or other graftable cells, e.g. stem, neuronal or islet cells. When the encoded receptor is soluble FGFR-1 , the target cells are preferably vascular cells, e.g. vascular EC or SMC.

It will be understood that any nucleic acid sequence encoding a soluble form of FasR, preferably a soluble form of human FasR, or any nucleic acid sequence encoding a soluble form of FGFR-1 , preferably a soluble form of human FGFR-1 , regardless of the tissue source, is a candidate for utilization in the present invention, for example, gene therapy of vascular occlusive diseases or disorders.

For example, it may include a FasR sequence with a modified or truncated region thereof in order to become a soluble form, e.g. a FasR sequence with a truncated transmembrane domain and absent cytoplasmic domain, that retains the FasL binding and apoptosis blocking properties. It will be further understood by the skilled person that any nucleic acid sequence which encodes a biologically active form of a soluble form of FasR, preferably of human origin, including but not limited to a genomic or cDNA sequence or functionally equivalent variant or mutant thereof or a fragment thereof which encodes a biologically active protein fragment or derivative which blocks apoptosis mediated by the Fas pathway, may be utilized in the present invention. A soluble form of FasR suitable for use in the invention will be referred to hereinafter as "sFasR".

Preferred nucleic acid sequence for use in the invention is a soluble form of rat or human FasR which is lacking the transmembrane and cytoplasmic domain of the FasR and which can block apoptosis mediated by the Fas pathway, e.g. as disclosed in SEQ. ID No. 1 (rat) and in SEQ. ID No. 3 (human). The corresponding amino acid sequences encoded by such DNA sequences are indicated in SEQ. ID. No. 2 (rat) and Seq. ID. No. 4 (human). SEQ. ID. No. 3 comprises a mutation in position 28: the naturally occurring Phe is replaced by Ser.

For FGFR-1 , it may for example include a FGFR-1 sequence with a modified or truncated region thereof in order to become a soluble form, e.g. a FGFR-1 sequence comprising a modified transmembrane region, that retains binding to the growth factor ligand and inhibits signalling. It will be further understood by the skilled person that any nucleic acid sequence which encodes a biologically active form of a soluble form of FGFR-1 , preferably of human origin, including but not limited to a genomic or cDNA sequence or functionally equivalent variant or mutant thereof or a fragment thereof which encodes a biologically active protein fragment or derivative which binds to the growth factor ligand and inhibits signalling, may be utilized in the present invention. A soluble form of FGFR-1 suitable for use in the invention will be referred to hereinafter as "sFGFR-1".

FGFR-1 , a cell-surface receptor tyrosine kinase, is expressed as multiple isoforms that are produced through variations in RNA splicing (Johnson et al., Adv. Cancer Res., 60, 1-41, 1993). The extracellular domain of full-length FGFR-1 contains either three (α-isoform) or two (β-isoform) immunoglobulin-like (Ig-like) loops. Preferred nucleic acid sequence for use in the invention is a soluble form of rat or human FGFR-1 which is lacking the transmembrane and cytoplasmic domain of the FGFR-1 or which comprises only the ectodomain of the FGFR-1 and which can bind to the growth factor ligand and inhibit signalling, e.g. as disclosed in SEQ. ID No. 7 (rat) and in SEQ. ID No. 5 (human). The corresponding amino acid sequences encoded by such DNA sequences are indicated in SEQ. ID. No. 8 (rat) and Seq. ID. No. 6 (human). ln a series of specific or alternative embodiments, the present invention also provides:

1.1 A method of controlling or reducing apoptosis of target cells, particularly graftable cells or vascular cells, e.g. controlling or reducing excessive proliferation of graftable or vascular cells, in a mammalian suject in need of such therapy, which comprises transferring to the targets cells a DNA sequence encoding a soluble form of FasR or a biologically active fragment or derivative thereof.

1.2 A method of controlling, reducing or inhibiting vascular cells, e.g. vascular SMC proliferation or intimal cell proliferation in a mammalian subject in need of such therapy, which comprises transferring to the vascular cells, e.g. SMC and/or EC, a DNA sequence encoding a soluble form of the type I receptor for FGF (FGFR-1 ) or a biologically active fragment or derivative thereof.

The methods can be practiced in vitro, ex vivo or in vivo.

In another aspect, the invention provides:

1.3 A method of preventing or treating vascular occlusive diseases or disorders by increasing local inhibition of Fas/FasL interactions, through targeting of mammalian vascular cell populations, e.g. by transferring to the cells, respectively, a DNA sequence encoding a soluble form of sFasR or a biologically active fragment or derivative thereof.

1.4 A method of preventing or treating vascular occlusive diseases or disorders by increasing local inhibition of FGF-1/ FGFR-1 or FGF-2/FGFR-1 interactions, through targeting of mammalian vascular cell populations, e.g. by transferring to the cells, respectively, a DNA sequence encoding a soluble form of the type I receptor for FGF (FGFR-1) or a biologically active fragment or derivative thereof.

It is also within the scope of the invention to use sFasR-expressing vascular cells, e.g. vascular SMC, EC or stem cells that can substitute, or a combination thereof, to repopulate a diseased vessel or to seed a vascularized tissue or organ graft. sFGFR-1 expressing vascular cells, e.g. vascular SMC and/or EC that can substitute to repopulate a diseased vessel or a vascularized tissue or organ graft, may also be used.

In another embodiment of the present invention, vascular cells, e.g. vascular SMC or EC or a combination of both are targeted for in situ infection or transfection with a DNA sequence encoding either sFasR or sFGFR-1 or a biologically active fragment or derivative thereof so as to promote increased local inhibition of, respectively, FasR/FasL or FGF-1/ FGFR-1 or FGF-2/FGFR-1 interactions or to inhibit cell proliferation. Other target cells may also be infected or transfected ex-vivo with a DNA sequence encoding sFasR or a biologically active fragment or derivative thereof so as to promote increased local inhibition of FasR/FasL interactions.

In a more specific embodiment, the invention provides:

2.1 A method of preventing or treating vascular occlusive diseases or disorders in a subject in need of such therapy comprising introducing an appropriate gene vehicle containing either a sFasR gene or a sFGFR-1 gene or a biologically active fragment or derivative thereof, operably linked to an expression control element into the vascular cells of such a subject.

2.2 A method of preventing or treating vascular occlusive diseases or disorders in a subject in need of such therapy comprising overexpressing either sFasR or sFGFR-1 or a biologically active fragment or derivative thereof in the vascular cells of such a subject by introducing, respectively, either a sFasR gene or a sFGFR-1 gene or a biologically active fragment or derivative thereof, operably linked to an expression control element.

An operable linkage as used herein refers to the position, orientation and linkage between a structural gene and expression control element(s) such that the structural gene can be expressed in any host cell. The term "expression control elemenf includes promoters, enhancers, ribosome binding sites etc.

In an alternative embodiment, the invention provides

3.1 A method for preventing or treating chronic rejection in a recipient of organ or tissue allo- or xenotransplant, comprising the step of introducing an appropriate gene vehicle containing either a sFasR gene or a sFGFR-1 gene or a biologically active fragment or derivative thereof, operably linked to an expression control element into the target cells, particularly the vascular cells, of the transplant.

3.2 A method for preventing or treating acute rejection in a recipient of a cellular or tissue syn-, allo- or xenotransplant, comprising the step of introducing an appropriate gene vehicle containing a sFasR gene or a biologically active fragment or derivative thereof, operably linked to an expression control element into the cells of the transplant. 3.3 A method for preventing or treating chronic rejection in a recipient of organ or tissue allo- or xenotransplant, comprising the step of overexpressing either sFasR or sFGFR- 1 or a biologically active fragment or derivative thereof in the cells, particularly the vascular cells, of the transplant by introducing, respectively either a sFasR gene or sFGFR-1 or a biologically active fragment or derivative thereof, operably linked to an expression control element.

3.4 A method for preventing or treating acute rejection in a recipient of a cellular or tissue syn-, allo- or xenotransplant, comprising the step of overexpressing sFasR or a biologically active fragment or derivative thereof in the cells of the transplant by introducing a sFasR gene or a biologically active fragment or derivative thereof, operably linked to an expression control element.

In a particular embodiment, a DNA sequence encoding either sFasR or sFGFR-1 or a biologically active fragment thereof is inserted into an appropriate gene delivery vehicle for use in gene therapy. Appropriate gene delivery vehicle utilized in the present invention include, but are not limited to viral vectors, e.g. retroviral vectors; adenovirus vectors; adeno-associated vectors; picornavirus vectors; lentivirus vectors; and non viral vectors.

The term vector refers herein to a plasmid, virus or other DNA molecule which provides an appropriate nucleic acid environment for a transfer of a gene of interest into a host cell. A vector may be further characterized in terms of endonuclease restriction sites where the vector may be cut in a determinable fashion. The vector may also comprise a marker suitable for use in identifying cells transformed with the cloning vector.

Retroviral gene transfer vectors are retroviruses that have been rendered non-pathogenic by removal or alteration of viral genes so that little or no viral proteins are made in cells infected with the vector. Viral replication functions are provided through the use of packaging cells that produce viral protein but not infectious virus. Following infection of packaging cells with a retroviral vector, virions are produced that can infect target cells, but no further viral spread occurs. The major advantages of retroviral vectors for gene therapy include a high efficiency of gene transfer into replicating cells, the precise integration of the transferred genes into cellular DNA, and the lack of further spread of the sequences following transduction. For a more detailed discussion of retroviral gene transfer vectors, see Miller, Nature 357: 455-60 (1992). Liposome mediated gene or vector transfer can also be used with commercially available liposomes. The efficacy of gene transfer can be increased by combining the liposome with e.g. the Sendai (HVJ) virus, or a targeting antibody, peptide or fragment thereof.

Adenovirus gene transfer vectors are normally replication defective. These gene transfer vectors have the capacity to carry large segments of DNA, up to 8-1 Okb. The adenovirus genome is about 36 kb in size. Other advantages include a very high titre (10¹¹ ml^'1), the ability to infect non replicating cells, and the ability to infect tissues in situ. Moreover, adenovirus gene transfer vectors do not integrate into the target chromosomal DNA.

According to the invention, a DNA sequence encoding either sFasR or sFGFR-1 or a biologically active fragment thereof may be subcloned into an adenovirus viral vector. Any adenovirus (Av) vector system that will promote expression of sFasR or sFGFR-1 in the target cell of interest may be utilized. An adenovirus gene transfer vector typically contains expression regulatory sequences such as promoters and enhancers. Any number of eukaryotic promoters available to one of ordinary skill in the art may be used in constructing an adenovirus sFasR gene therapy vector or an adenovirus sFGFR-1 gene therapy vector. Therefore, any eukaryotic promoter and/or enhancer sequences available to the skilled artisan which are known to control expression of the nucleic acid of interest may be used in Av vector constructs, including but not limited to a cytomegalovirus (CMV) promoter, a Rous Sarcoma (RSV) promoter, a Murine Leukemia (MLV) promoter, a β-actin promoter, as well as any additional tissue specific or signal specific regulatory sequence that induces expression in the target cell or tissue of interest. The sFasR gene or the sFGFR-1 gene is then inserted into a plasmid containing appropriate regulatory elements using standard recombinant DNA techniques such that the regulatory elements are operably linked to the sFasR gene or sFGFR-1 gene. This expression cassette can then be inserted into a vector containing Av sequences that permit homologous recombination with the Av genome. This plasmid can then be cotransfected with a vector comprising the full-length Av genome into a suitable host cell, which include transformed human embryonic kidney cells, containing an integrated copy of the left most 12% of the adenovirus 5 genome. The vector comprising the full-length Av genome preferably may contain an insert within the genome in order to reach the packaging limit for Av. By way of example, a suitable adenoviral shuttle plasmid is e.g. pAvsβa (commercially available) or pBsitrloxnMCS (e.g. as disclosed in Example 5 hereinafter, e.g a bluescript based plasmid that contains the AdδlTR, the lox site and multiple cloning site).

Construction of recombinant Av vectors is not only possible through homologous recombination in a suitable cell line, but also through direct in vitro ligation of fragments containing virion DNA and the recombinant viral vector. Suitable host cells for the cotransformation include human embryonic kidney cells, 911 cells and PER 6 cells (Introgene). Alternatively, Av vectors showing decreased immunogenicity can also be used, e.g the so-called gut-less vectors, e.g vectors wherein more or less all the adenoviral genome has been deleted (except for the ITRs) and replaced by some stuffer DNA to compensate the reduced size.

Homologous recombination between the sFasR containing plasmid or the sFGFR-1 containing plasmid and the plasmid containing the Av genome results in an Av genome of packageable size where the sFasR gene or the sFGFR-1 has replaced a portion of the Av genome necessary for viral replication. For example, the Av early region 1 may be replaced by the cloned chimeric gene, rendering the virus replication defective. The resulting virus can be used as a gene transfer vector for the sFasR gene or the sFGFR-1 gene. Alternatively or additionally, adenoviruses with disruptions in some regions, e.g. deletions in the early regions 1 and/or 2(E2 or E2a) and/or 3 (E3), or second generation adenoviral vectors with insertions into the early gene 2 (E2 or E2a) or early gene 4 (E4) regions can be used for gene transfer purposes.

It may be suitable to use a DNA sequence encoding sFGFR-1 or a biologically active fragment or derivative thereof and a further peptide, e.g. attached at the N-terminus, to facilitate identification of sFGFR-1. Such peptides include for example poly-His or the FLAG^R peptide (DYKDDDDK) which provides an epitope reversibly bound by a specific monoclonal antibody enabling rapid assay and facile purification of the expressed recombinant protein. It is also possible to modify or substitute leader sequence of sFGFR-1 such that it can be secreted more efficiently.

It may also be possible to use a chimeric DNA sequence encoding sFGFR-1 or a biologically fragment or derivative thereof and constant regions of the immunoglobulin (Ig) heavy chain at the carboxy terminus. Making a chimeric protein containing at its carboxy terminal end the Ig heavy chains enables stability of the sFGFR-1 protein to be enhanced and its half-life to be prolonged.

Preferably a DNA sequence encoding hsFasR or hsFGFR-1 or a biologically active fragment or derivative thereof with an appropriate signal peptide, preferably hydrophobic, as commonly used for expression, e.g. an endogenous signal peptide is employed.

In an alternative embodiment of the invention, a DNA sequence encoding sFasR or sFGFR- 1 or a biologically active fragment thereof may be subcloned into an adeno-associated viral vector (AAV). As mentioned above, the DNA sequence encoding sFGFR-1 or a biologically active fragment thereof may preferably also comprise a tag encoding sequence. In contrast to retroviral terminal repeat sequences, AAV terminal repeat sequences do not contain regulatory sequences which promote foreign gene expression. As discussed above for Av vectors, any eukaryotic promoter and/or enhancer sequences available to the skilled artisan which are known to control expression of the nucleic acid of interest may be used in AAV vector constructs, including but not limited to a cytomegalovirus (CMV) promoter, a Rous Sarcoma (RSV) promoter, a Murine Leukemia (MLV) promoter, a β-actin promoter, as well as any additional tissue specific or signal specific regulatory sequence that induces expression in the target cell or tissue of interest.

In addition to the hereinbefore described use of viral vectors to infect target cells, any known non-viral vector that is capable of expression upon transfection of a specified eukaryotic target cell may be utilized to practice the present invention. Such non-viral based vectors include, but are not solely limited to, plasmid DNA.

One of ordinary skill in the art will be guided by the literature to choose an appropriate DNA plasmid vector for use in the present invention. As discussed above for recombinant Av and AAV vectors, any eukaryotic promoter and/or enhancer sequences available to the skilled artisan which are known to control expression of the nucleic acid of interest may be used in plasmid vector constructs.

An appropriate recombinant vector, e.g. a viral vector, e.g. an Av sFasR, AAV sFasR, Av sFGFR-1 or AAV sFGFR-1 vector, can be utilized to directly infect in vitro cultured vascular cells, e.g vascular SMC and/or EC. The infected vascular cells can then be delivered to the specific tissue target utilizing methods known in the art, including but not limited to catheterization or direct injection techniques. A recombinant AAV sFasR or AAV sFGFR-1 vector may also be delivered to the target cell through association with liposome microcapsules. A transfection protocol utilizing a hybrid liposome: AAV construct involves using an AAV vector (most likely with both ITR's present) comprising a sFasR DNA or sFGFR-1 DNA sequence. This construct is cotransfected into target vascular cells with a plasmid containing the rep gene of AAV. Transient expression of the rep protein enhances stable integration of the recombinant AAV sFasR or AAV sFGFR-1 genome into the vascular cell genome.

A viral vector of the invention, e.g. Av sFasR, Av sFGFR-1 , AAV sFasR or AAV sFGFR-1 vector, may also be used to directly infect ex-vivo cells, removed from the subject in need of gene therapy or from a donor and coincubated in vitro; the infected cells are then (re)introduced in the subject, e.g. by means as disclosed above for the in vitro infected cells according to the cell transplantation techniques. Suitable cells include vascular cells, e.g. vascular EC or SMC in the case of ex vivo infection with a viral vector promoting expression of sFGFR-1; in the case of sFasR, suitable cells include vascular cells, e.g. vascular SMC or EC or other transplanted cells, e.g. islets or neuronal cells or stem cells (ECs). The viral vector may also be administered in situ or in vivo: in the case of e.g. a vascularized solid organ by infusion of the gene delivery vehicle or for example direct injection in situ in e.g. the case of muscle tissue. Time, temperature and amount of gene delivery vehicle will be adapted depending by e.g. on the target tissue, expected expression level, transfection efficiencies etc. An indicated amount of gene delivery vehicle is, e.g. in the range of from 10⁹to 5.10¹² particles/kg.

A preferred gene delivery vehicle is an Av vector encoding a biologically active sFasR protein or protein fragment, e.g. an Av vector with deletions in the early region 1 , 2a and 3 (e.g. as disclosed in Gorziglia et al., J. Virol., 1996, 70, 4173-4178, the contents thereof being incorporated herein by reference), the deletion in the early region 1 being preferably replaced by the desired sFasR DNA sequence, e.g. Av 3hsFasR, preferably such a vector wherein the promoter is RSV. A preferred gene delivery vehicle for sFGFR-1 is an Av vector encoding a biologically active sFGFR-1 protein or protein fragment, e.g. an Av vector with deletions in the early region 1 , 2a and 3 (e.g. as disclosed in Gorziglia et al.,supra, the contents thereof being incorporated herein by reference), the deletion in the early region 1 being replaced by the desired sFGFR-1 DNA sequence, e.g. Av 3hsFGFR-1 , preferably such a vector wherein the promoter is RSV or RSV derived.

The invention further provides:

4.1 Use of a sFasR or a sFGFR-1 gene or a biologically active fragment or derivative thereof in allo- or xenotransplantaiton, e.g. in a method as herein disclosed;

4.2 Use of a sFasR or a sFGFR-1 gene or a biologically active fragment or derivative thereof, operably linked to an expression control element, in any method as herein defined;

4.3 Use of a sFasR or a sFGFR-1 gene delivery vehicle in any method as herein disclosed;

4.4 Use of a sFasR or sFGFR-1 gene or a biologically active fragment or derivative thereof in the manufacture of a gene delivery vehicle, e.g. as herein disclosed, or of a medicament, e.g. for use in any method as herein disclosed;

4.5 Use of a sFasR or sFGFR-1 gene delivery vehicle, e.g. as herein disclosed, in the manufacture of a tissue or organ composition, e.g. for use in any method as herein defined;

5.1 A pharmaceutical composition comprising either a sFasR or a sFGFR-1 gene or a biologically active fragment or derivative thereof operably linked to an expression control element and a means for transducing said gene into target cells, e.g. vascular cells, e.g. as disclosed above, e.g. for use in a method as defined above; for example, a pharmaceutical composition comprising a sFasR or sFGFR-1 gene delivery vehicle, e.g. an Av vector encoding either a biologically active sFasR or sFGFR-1 , e.g. as herein disclosed, together with one or more pharmaceutically acceptable carrier.

These pharmaceutical compositions are indicated for use in any method as hereinbefore disclosed.

5.2 A tissue or organ fluid comprising a sFasR or a sFGFR-1 gene delivery vehicle, e.g. as herein disclosed, e.g. in a non-cytotoxic iso- or hyper-osmotic medium, preferably buffered, e.g. for use in the ex vivo treatment of a tissue or organ prior to transplantation, e.g. in a method as herein disclosed. Vascular occlusive diseases or disorders associated with vascular cell proliferation to which is directed the present invention, in particular the sFasR gene delivery vectors or the sFGFR-1 gene delivery vectors of the invention, include e.g. acute graft rejection, AGA or chronic graft rejection, vascular proliferation and migration following venous or arterial surgery or other forms of vascular injuries, e.g. angioplasty or post-operative occlusive complications which commonly occur following vascular bypass procedures, vein graft stenosis, or acute or chronic restenosis.

The organ or vascularized tissue transplantation may be performed from a donor to a recipient of a same (syn- or allograft) or different species (xenograft). Among such transplanted organs, tissues or cells are given illustratively heart, liver, kidney, spleen, lung, small bowel, pancreas, trachea, oesophagus, muscle or vessels; in the case of sFasR gene therapy, further examples include e.g. pancreatic islets, neuronal or stem cells or a combination of any of the foregoing.

In the case of tissue or organ transplantation, e.g. heart, the tissue or organ is removed from the donor and flushed or perfused with cold preservation fluid (e.g. UW, Columbia University, Krebs-Ringer, Eurocoliins preservation solution). The donor tissue or organ may be immersed or bathed in or injected, perfused or infused with a preservation fluid containing a therapeutically effective and safe amount of a gene delivery vector according to the invention. The donor tissue or organ may also be treated with the gene delivery vehicle of the invention in situ in the donor. Preferably the tissue or organ is retro-infused via a vessel, e.g. an artery, e.g. aorta in case of heart, with the preservation fluid containing either the sFasR or the sFGFR-1 delivery vector, the unused vessel, e.g. the pulmonary artery, being clamped during infusion. More preferably, infusion of the tissue or organ is performed by antrograde perfusion. Immersion, bathing or infusion may be performed on ice or at a temperature from 4 to 37°C. After an incubation period appropriate to obtain a high transduction rate, e.g. minimally 20 min, preferably at a temperature from 4° to 37°C, e.g. at 4°C, the vector is flushed from the tissue or organ with cold preservation fluid and then transplanted. The infusion of the tissue or organ with the sFasR or sFGFR-1 gene delivery vector and optionally the incubation period may also be performed under a low pressure, e.g. from 10 to 150 mm Hg. ln a more specific embodiment, the invention further provides:

6.1 A tissue or organ for transplant which has been treated with a sFasR or a sFGFR-1 gene delivery vehicle containing solution, e.g. a tissue or organ fluid according to 5.2;

6.2 A method for transducing a tissue or organ for transplant with a sFasR or a sFGFR-1 gene delivery vehicle, comprising treating the donor tissue or organ at a temperature of from 4 to 37°C, optionally under a low pressure, with a sFasR or a sFGFR-1 gene delivery vehicle containing solution, e.g. a tissue or organ fluid according to 5.2;

The recipient of donor cells, tissue or organ treated according to the invention may be submitted to a conventional immunomodulating or immunosuppressive regimen, e.g. mono-, di- or tritherapy comprising drugs selected from cyclosporin A, FK 506, rapamycin, 40-O-(2- hydroxy)ethyl-rapamycin, corticosteroids, cyclophosphamide, azathioprine, methotrexate, mizoribine, mycophenolic acid, mycophenolate mofetil, 15-deoxyspergualine or a derivative thereof, an immunosuppressive monoclonal antibodies, e.g. monoclonal antibodies to leukocyte receptors, e.g. to MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD58, CD80 or CD86 or to their ligands. Depending on the immunosuppressive therapy selected, the administration of the immunosuppressant may already start prior to the transplantation, e.g. in the case of monoclonal antibody treatment, e.g. with anti-CD 25 Mabs.

In case of the method of the invention relating to the prevention or treatment of vascular cell proliferation following vessel injuries such as angioplasty with or without replacement of any blood vessel, the sFasR delivery vectors or the sFGFR-1 delivery vectors of the invention may be used to infect cultured vascular cells, e.g. vascular SMC or EC, in vitro; the resulting transduced or infected vascular SMC or EC or a combination of both may then be transferred to specific segments of diseased vessels within a patient, e.g. using a double balloon catheter. A sFasR delivery vector or a sFGFR-1 delivery vector of the invention may also be administered in vivo by arterial artery, e.g. selectively delivered through a double balloon catheter to the angioplasty site of a patient or a stent so as to promote in situ transfection or infection of EC and/or vascular SMC.

The invention also provides a non-human transgenic or somatic recombinant mammal comprising in its cells a DNA sequence encoding either sFasR or sFGFR-1 or a biologically active fragment or derivative thereof, and such cells, tissue and organs per se; and a method of preparing such non-human transgenic or somatic recombinant mammal. Such non-human transgenic or somatic animals are particularly of the porcine species. Heterologous genes can be inserted into germ cells (e.g. ova) to produce transgenic animals bearing the gene which is then passed on to offspring. For example, DNA encoding sFasR or sFGFR-1 can be inserted into the animal or an ancestor of the animal at the single-cell or the early morula stage. The preferred stage is the single-cell stage although the process may be carried out between the two and eight cell stages. Methods of preparing transgenic pigs are discussed in W.L. Fodor and S.P.Squinto, Xeno, 3 (1995) 23- 26 and the references cited therein. The gene may also be inserted into somatic/body cells of the donor animal to provide a somatic recombinant animal, from whom the DNA construct is capable of being passed on to offspring, preferably the inserted DNA sequence is incorporated into the genome of the cell. The transgenic pigs may also be produced by nuclear transfer technology using adult porcine cells.

The following Examples are illustrative only and not limitative of the invention.

Example 1 : Construction of adenoviral vectors

For the recombinant sFasR plasmid, the full-length rat Fas cDNA as disclosed in SEQ. ID. No. 1 is used as a template for PCR amplification of the extracellular domain of rat Fas from base 56 to 565, using the GeneAmp PCR amplification Kit (Perkin Elmer, Foster City, CA). This 510 bp region is amplified using a 5'-sense oligonucleotide primer containing a Xbal restriction site and a Kozak sequence adjacent to the start codon: 5'- gagctctagagccaccatgctgtggatcatggctgt-3' and a 3'-antisense oligonucleotide primer containing an EcoRV restriction site and a stop codon, TGA, after bp 565: 5'-- ggccgatatctcacttataattggaactttg-3'. An amplified product of the expected size is obtained. The 539bp sFas PCR fragment is digested with Xbal and EcoRV and cloned into pbluescript SK(+) (Strategene, La Jolla, CA). The PCR insert is sequenced and a single base pair change (T to C) is detected at bp 83, which changes amino acid 28 from a phenylalanine to a serine. The rat sFasR consensus sequence is 513 bp and encodes for a 170 aminoacid protein of approximatively 18,700 molecular weight. The rat sFasR cDNA is then transferred into the adenoviral shuttle plasmid, pAvsβa using Xbal and EcoRV to create pAvrsFasR. Three replication-deficient recombinant adenoviral vectors, encoding β-galactosidase (Av3nBg), rat sFasR (Av3rsFasR) and one lacking a cDNA insert (Av3null), are constructed, expanded and purified. The construction and characterization of Av3nBg encoding β- galactosidase has been described (Gorziglia et al. J. Virol. 1996, 70, 4173-4178). The rat sFasR cDNA is incorporated into the Av3nBg genome, an adenoviral genomic backbone with E1, E2a, and E3-deletion, rendering it replication deficient, by homologous recombination between Av3nBg and the shuttle plasmid pAvrsFasR to generate Av3rsFasR. AE1-2a cells (Gorziglia et al., supra) are cultured in improved minimal essential medium (IMEM) containing 10% heat inactivated fetal bovine serum (FBS) as described by Gorziglia et al. Transient transfections of the AE1-2a cells are performed with 5μg of pAvrsFasR and 2μg of Clal-digested Av3nBg genomic DNA that contains adenoviral termination proteins using the calcium phosphate mammalian transfection system (Promega Corporation, Madison, Wl). The AE1-2a cells are incubated with the calcium phosphate- DNA precipitate at 37⁹C for 16 hours. The precipitate is removed and the monolayers are washed with PBS. The transfected cell monolayers are overlaid with 1% SeaPlaque agarose in MEM supplemented with 7.5% HIFBS, 2mM glutamine, 50U/ml penicillin, 50 μg/ml streptomycin sulfate, 1% amphoterycin B, and 0.5 μM dexamethasone. Recombinant plaques are isolated after approximately 10 days. Individual plaques are expanded and genomic DNA is isolated and screened for the presence of the rat sFasR cDNA by restriction enzyme digestion. The recombinant Av3rsFasR vector is plaque purified and a large-scale preparation seedlot is generated. An additional control vector, Av3null is also prepared which does not contain a transgene within the expression cassette. The adenovirus vector titers (particles/ml) are determined spectrophotometrically and compared with the biological titer (pfu/ml) determined with AE1-2a cell monolayers as described by Mittereder et al.,(J. Virol., 70_* 7498-7509, 1996). The ratio of total particles to infectious particles (particles/pfu) is then calculated. The average ratio of all vector preparations used in these studies is 25.6 ± 4.3 (mean ± standard deviation).

Example 2: Cell culture and in vitro assays

Mouse aortic endothelial cells (MAEC) are cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS). The vascular cells are either exposed to adenovirus suspension vehicle only or transfected with recombinant adenoviruses, Av3null or Av3nBg at a pfu per cell ratio of 250, or with Av3rsFasR at pfu per cell ratio of 125, 250 or 500, for 2hr, in DMEM with 0.1% FBS, then changed to 10% FBS in fresh medium. RNA from MAEC and MASMCs is isolated from control or infected cells at 48hrs after transfection, using Rneasy Mini kit (Quiagen). RT-PCR is then performed using the sFasR-specific primers which do not hybridize with endogenous FasR (defining a fragment of 566 base pairs): sense (base pairs 1024 to 1045) 5'-CTG TGG ATC ATG GCT GTC CTG-3', and antisense (basepairs 1666- 1590) 5'-TTT GTA ACC ATT ATA AGC TGC AAT-3'. For detection of endogenous FasR, the primers are (defining a fragment 969 base pairs): sense (base pairs 59-79) 5'-CTG TGG ATC ATG GCT GTC CTG-3', and antisense (base pairs 1006 to 1027) 5'-CTC CAG ACT TTT GTC CTT CAT T-3'. The RT-PCR reaction is subjected to 1% agarose gel electrophoresis and the DNA fragments are visualized by staining in ethidium bromide. Only cells that have been transfected with Av3rsFasR express detectable sFasR mRNA, while MAECs transfected with Av3nBg, Av3null and control cells have no transcript for sFasR. In contrast all MAECs had transcripts for endogenous FasR. No PCR bands are detected in the absence of reverse transcriptase. To ensure that the positive mRNA data obtained with Av3rsFasR are not due to rearrangement of the endogenous FasR gene resulting from adenovirus infection, SMCs explanted and grown from MRL (Fas^lpr) mouse aorta (MASMCs) have been transfected. Again, only MASMCs that have been transfected with Av3rsFasR contain sFasR transcripts, while control SMCs and SMCs transfected with Av3nBg and Av3null do not. Consistent with the lack of FasR mRNA in MRL (Fas^lpr) mice, mRNA for endogenous FasR is nearly undetectable in these SMCs.

Primary cultures of human aortic SMCs (HASMCs), in culture medium (SmBM) (Clonetics Corp., San Diego, CA. HASMCs) are seeded on 6 well plates and grown to generate 70% confluent monolayers, washed twice with PBS, then either exposed to one of the same three adenoviruses or to vehicle without vectors, at pfu per cell ratio of 500 for 2h at 37^SC in 10% FCS/SmBM. The cells are washed with PBS, then incubated in medium for two days, and then exposed to human recombinant soluble FasL (100ng/ml) and an enhancer (1μg/ml) as instructed by the manufacturer (Alexis Corp., San Diego, CA), to induce apoptosis.

Apoptosis is measured after six hours by flow cytometric assay (FACS calibur, Becton Dickinson) on suspended cells stained with FITC-annexin V and propidium iodide (PI) using an apoptosis detection kit and following the manufacturer's instructions (R&D system, Minneapolis, MN), with 10⁵ cells analyzed per condition. With non-transfected SMCs, in the absence of FasL, the mean percentage of Annexin positive cells is 2.3%, while in the presence of human FasL and enhancer for 6h, it is 7.6%. FasL-mediated SMC apoptosis is significantly inhibited by Av3rsFas transfection (3.4%), while transfection with Av3null (10.2%) and Av3nBg (10.9%) increases SMC apoptosis.

Example 3: AorticTransplantation

Male DA (RT1a) and PVG (RT1c) rats, weighing 180-250g and 2 months of age, are purchased from Jackson laboratories (Bar Harbor, ME). The DA-to-PVG strain combination is used for all aortic allogeneic transplantation procedures; DA-to-DA isografts served as syngeneic controls.

Sixty-five aorta transplants are performed and divided into five groups. (1) Syngeneic control aorta isografts are exposed to the vehicle used for adenovirus suspensions; (2) Allografts, exposed to vehicle; (3) Allografts, transfected with Av3rsFas; (4) Allografts, transfected with Av3nbG; (5) Allografts, transfected with Av3null. Rats are anesthetized with methoxyflurane (Metofane) inhalation. The grafts are harvested from donor animals by excising the abdominal aorta from below the renal arteries to just above the aortic bifurcation, yielding a 1.2 to 1.8 cm aorta segment. Branches are ligated with 8-0 prolene suture (Ethicon). Heparin is administered intravenously (200U) before perfusion. The aorta grafts are gently flushed free of blood via left renal artery with 2 ml of chilled lactated Ringer's solution and aspirated, then the two ends of the segment of aorta are cross clamped.

A total of 25-30 μl of saline, Av3rsFasR, Av3nBg or Av3null (6 x 10 pfu/ml) are infused into the lumen of the abdominal aorta and allowed to incubate in situ for 20 minutes at room temperature. Then the segments of aorta with the two end clamped are removed and preserved in a bath of Ringer's solution for 20-30 minutes (0-4^gC or 0 to 37°C in order to optimize transduction) until transplanted. The viral particles are then aspirated to allow for a total vector transfection time of approximately 40 to 50 minutes. After removing the recipient's native infrarenal aorta, grafts are sutured in the orthotopic position in an end-to- end fashion using 10-0 Prolene continuous sutures. Total ischemia time from clamping of donor aorta to perfusion of grafts in the recipient is approximately 70 to 80 minutes. All transplant recipients receive Cyclosporine A (CyA) at 5mg/kg/day for 5 days i.m. The grafts are harvested at 5, 18, 30, 60 days after transplantation for further studies. At the time of sacrifice, the aortic grafts are divided into two segments; one-third of the entire graft is stored in OCT medium (Miles laboratories, INC., Elkhart, IN) and snap frozen in liquid nitrogen, while the other two-thirds are fixed in 10% buffered formaldehyde and processed to be embedded in paraffin. The latter section is then divided into three segments and preserved in paraffin block for slide preparation.

Detection of transαene expression in grafted aortas

RT-PCR assay for sFasR. A set of aortic grafts is harvested at POD5 following transplantation and snap frozen for assessment of gene expression. Groups of three grafts from syngeneic, allogenic controls, Av3rsFasR, Av3null and Av3nbG transfected allografts, and non-transplanted abdominal aortas are pooled. For RT-PCR, the aortic tissues are placed in denaturing solution and homogenized with a polytron homogenizer. Total RNA is extracted using RneasyTM minipreps Total RNA Purification Kit (Quiagen Inc., Chatsworth, CA). Total RNA is quantitated by spectrophotometry at 260nm in preparation for RT-PCR assays.

β-galactosidase assay. Aortic allografts POD5, control or Av3nBg transfected, are assayed for β-galactosidase activity by immersion of fixed 5-μm aortic cross-sections in X-gal (5- bromo-4-chloro-3-indolyl (-D-galactopyranoside) reagent (Sigma) for 16 hours at 37^eC, counterstained with eosin and examined by light microscopy.

Immunohistochemistry-assay for Fas. Fresh segments of aortic grafts at POD 5, 18 and 60, are fixed with 10% formalin for 16h then embedded with paraffin. After deparaffinization, 5μm cross sections are blocked with goat serum, then incubated with a monoclonal mouse anti-Fas antibody (Transduction laboratories, Lexington, KY, the antibody does not distinguish endogenous Fas from sFas), diluted 1:200 in 1%BSA-PBS for overnight (4^SC), then with a goat anti-mouse Ig antibody (Sigma chemical Co, diluted 1 : 2000) for 60 min. Immunostaining is then carried out using VECTASTAIN ABC peroxidase Kit ( Vector Laboratories, Burlingame, CA), on slides counterstained using hematoxylin, mounted with Permont and examined by light microscopy.

As with cultured cells, sFas mRNA is detected only in Av3rsFasR transfected aortas. Fas expression is upregulated in all aorta allografts compared to untransplanted aorta or to isograft controls. However, staining for Fas is markedly increased in grafts that have been transfected with Av3rsFasR. Extensive Fas staining is observed in Av3rsFasR transfected vessel segments, including few ECs and parenchymal cells in adventitia, as well as in SMCs as compared to allograft controls, with or without Av3null or Av3nBg transfection.

Assay for apoptosis

Terminal dUTP Nick End Labeling (TUNEL) assay is used to detect apoptotic cells, using the TACSTM TdT(DAB) In Situ Apoptosis Detection Kit (Trevigen INC, Gaithersburg, MD). Graft tissues are studied for apoptosis, using TACSTM TdT(DAB) In Situ Apoptosis Detection Kit (Trevigen INC, Gaithersburg, MD).

TUNEL positive staining at POD18 is observed in SMCs, infiltrating leukocytes, parenchymal cells, and some ECs. TUNEL positive staining is generally less in sFas expressing vessels compared to mock-transfected or Av3nBg-transfected grafts. At POD60, however, fewer apoptotic cells are detected in all groups, with no significant difference of TUNEL positivity amongst the various treatment groups. These findings suggest that apoptosis associated with allograft rejection mostly takes place at the early period after transplantation.

Computer-assisted morphometrical quantification of AGA

Six cross sections are surveyed from each of 5 aortic grafts per group surveyed at POD60. Cross sections perpendicular to the long axis of the graft are sliced starting from the center of the graft to avoid the artifacts of the suture line. Each section is 5μm in thickness, and the sections spaced by 150-200 μm to be representative of the entire graft. Sections are stained with hematoxylin-eosin, Masson trichrome, or for elastin (Van Gieson). The thickness and surface area of intima and media of aorta is measured using a computerized data analysis system. Each cross section is scanned in full color at a resolution of 1.7 microns using a Leaf Microlumina digital scanner. The images are transferred to a Silicon Graphics Indy R5000 computer. The luminal border, internal elastic lamina (I EL) and external elastic lamina (EEL) are manually identified and stored using a custom software- drawing package. The intimal area is calculated by subtracting the luminal area from the area enclosed by the IEL. The medial area is calculated by subtracting the area enclosed by the IEL from the area by the EEL. Average intimal and medial thicknesses are calculated by dividing the IEL length into 100 equally spaced segments, and the average of one hundred intimal thickness values defines the average intimal thickness for the section. Similar measurements are obtained for the media thickness.

Statistical Analysis. The data (six sections spanning the length of the vessel) are analyzed using StatView TM Program (Abacus Concepts, Inc., Berkeley, CA) and the Statistical Analysis System (SAS, Cary N.C.). The data are compared using analysis of variance for the five groups: control isografts, control allografts, and three treatment groups. A post test, Dunnett's two-tailed T, is used to compare the 3 treatment groups with the control allograft group. Data are presented as mean±SEM. A P value of <0.05 is considered statistically significant.

Effects of sFas gene transfer on AGA assessed at POD60

Survival of graft recipients to POD60 is >95% recipients, with no signs of systemic toxicity associated with adenovirus transfection in any treatment group. The appearance of aortic isografts is within normal limits. At POD60, 2 of 7 control allografts, 2 of 5 Av3nbG transfected grafts, 5 of 7 Av3rsFas transfected grafts, 2 of 7 Av3null, develop small ectasia at the level of one or both suture lines. The syngeneic control group displays essentially normal aortic tissues, with very little inflammation of intima, media and adventitia, minimal to absent intima lesions, intact media and elastic lamina. The allograft controls show a 66-fold increase in intima thickness (58.8±10.3μm vs. syngeneic 8.9± 0.7μm, P<0.01); demonstrating that the alloimmune response is the dominating factor initiating intimal hypeφlasia. In allografts, the media is essentially acellular with a markedly disrupted elastic lamina and reduced thickness (18%) relative to the media in isograft controls. Hyperplasia is also found in allografts transfected with Av3nBg (71.7±20.9μm) or Av3null (69.4±4.7μm). The Av3nBg transfected grafts display more severe media necrosis and damage to the elastic lamina, as well as intense inflammation of the adventitia, even when compared to Av3null suggesting that the β-galactosidase transgene product might enhance the alloreactive process. In contrasts, intima thickening and media damage are significantly reduced in Av3rsFasR transfected grafts (19.5± 1.6μm vs. Control allografts 58.8±10.3μm, P<0.05). In the presence of sFasR overexpression, media SMC loss is lessened, and, the elastic lamina and media thickness are remarkably preserved (91.1± 2.8μm vs. allograft controls 69.2± 11.Oμm, P<0.05), and not detectably different from control isografts (vs. 84.5±1.7μm, P>0.05). The extent of inflammation within the adventitia is not affected by Av3rsFasR transfection. Av3hsFasR is constructed in a similar manner as disclosed above for the Av3rsFasR, the hsFasR DNA sequence corresponding to SEQ. ID.3. Aorta transplantation in the same animal model is performed in a similar manner as disclosed above, Av3hsFasR being infused into the lumen of the abdominal aorta. Beneficial effects on the intima and media are also observed with Av3rsFasR.

Example 4

1. A cDNA encoding only the ectodomain of FGFR-1 (sFGFR-1 ) is generated by PCR, using the cloned rat FGFR-1 cDNA (cDNA first produced under NIH grant DK 50764) as template, cloned into an eukaryotic expression plasmid, e.g. pcDNA3 and stably expressed in cultured rat aortic endothelial cells (RAE). Transcript expression is demonstrated by Northern blot analysis. Expression is driven by the CMV promoter. The supernatant of RAE cells stably transfected with sFGFR-1 cDNA contains a protein that binds [¹²⁵l]FGF-2 specifically and with high affinity. This FGF-2 binding protein is absent from the supernatant of RAE cells stably transfected with vector alone. The supernatant of RAE cells stably transfected with the sFGFR-1 cDNA inhibits FGF-2 stimulated 3T3 fibroblast proliferation, an effect not observed with supernatant of RAE cells transfected with vector alone.

2. Western blot analysis and Immunocvtochemistrv of flaq-sFGFR-1.

A coding sequence for the epitope tag "Flag" is added to the N-terminus of the sFGFR-1 cDNA by deleting the sFGFR-1 signal peptide sequence, and cloning the remaining sFGFR- 1 cDNA in frame into the pCMV1-flag vector (Hindlll-BamH1)(Kodak), which contains the preprotrypsin signal peptide sequence upstream of flag. After sequencing the complete cDNA (SEQ. ID. No. 9; preprotrypsin: starting with the nucleotide at position 1 and ending with the nucleotide at position 45; Flag: starting with the nucleotide at position 46 and ending with the nucleotide at position 69; rsFGFR-1: starting with the nucleotide at position 70 and ending with the nucleotide at position 915)) to verify in-frame cloning and to rule out mutations, the cDNA is transiently expressed in Cos-7. Expression of flag-sFGFR-1 in Cos- 7 cell lysates 48 hours after transfection is shown in a Western Blot. Secretion of the protein into the supernatant is also shown by Western Blot, at 3 different time points. The Western Blot is negative for supematants of cells transfected with empty vector. Immunocytochemical analysis of Cos-7 cells demonstrates that cells expressing flag- sFGFR-1 (SEQ. ID. No. 10) can be detected by anti-flag antibodies while staining is absent from cells transfected with empty vector. 3. In vitro expression and function of Av3flag-sFGFR-1.

The flag-sFGFR-1 construct is next subcloned into Av3, and virus is generated with a titer of 3.4 X 10¹⁰ pfu/ml. Expression of Av3sFGFR-1 is evaluated in Cos-7, HEK293, RAE and in 3T3 cells. After subcloning the promoter is RSV.

To demonstrate specific interaction of the expressed sFGFR-1 crosslinking experiments with radiolabeled FGF are performed. Supernatants from RAE cells infected with Av3-flag- sFGFR-1 are concentrated, incubated with [¹²⁵l]FGF-2 in the absence or presence of a 100-fold excess unlabeled FGF-2. After 90 min incubation, bound [¹²⁵l]FGF-2 is covalently crosslinked to flag-sFGFR-1 , partially purified with WGA, separated electrophoretically by size from free [¹²⁵l]FGF-2, and subjected to autoradiography. Supernatants from cells infected with null virus serve as controls. Specific binding of [¹²⁵l]FGF-2 to a ~ 70kDa band is evident in the supernatants of cells infected with Av3-flag-sFGFR1 , but not in supernatants of cells infected with null virus.

4. Expression of LacZ and flaq-sFGFR-1 in rat aorta in vivo

To define the approximate viral titer required for effective transduction of rat aorta in vivo, two separate experiments are performed in which aorta is infected with increasing doses of Av3-LacZ. Two days later, aortae are examined for transduction efficiency after isolation between two atraumatic vascular clamps and being washed free of blood with saline. Virus is then instilled into the aorta at increasing concentrations in a total volume of 50μl, followed by incubation in situ for 20 min. Circulation is then reestablished, any bleeding is stopped by applying light pressure. The aortae are harvested 2 days later and examined for LacZ staining. The most effective dose is 10⁹. Expression is predominantly in the adventitia, though at the highest dose, endothelial cell expression is also observed.

Aortas of DA rats are infected with Av3-flag-sFGFR-1 using the same protocol as that described for Av2LacZ. Control rats are infected with null virus, or sham-infected with buffer alone. At the end of the incubation period, each aorta is dissected free of the retroperitoneum, and the segment that had been crossclamped is implanted as an aortic inteφosition graft into PVG rats. Postoperatively, these rats are treated with cyclosporine 5 mg/kg/day for 5 days to prevent acute rejection. Aortas are harvested on day 5 and snap- frozen in liquid nitrogen for subsequent analysis by RT-PCR, some are fixed in ethanol, and examined by immunocytochemistry for flag-sFGFR-1 expression. For RT-PCR, RNA is isolated, primers are designed to amplify only the flag-sFGFR-1 , not endogenous FGFR-1. Expression of flag-sFGFR1 in 4 aortas infected with Av3 flag-sFGFR-1 is shown. No expression is observed in aortas infected with null virus or in aortae sham-infected with buffer alone. In aortae infected with Av3 flag-sFGFR-1 , no expression is observed in the absence of reverse transcriptase, demonstrating that the observed signal represents mRNA expression, not the introduced cDNA. By immunocytochemistry, anti-flag antibodies detect flag-sFGFR-1 protein expression predominantly in the adventitia and endothelium of aortae infected with the Av3-flag-sFGFR-1 construct, but not in aortae infected with Av3 null virus or sham-infected with buffer.

5. Effect of Av3 flao-sFGFR-1 infection

Aortic infection with Av3-flag-sFGFR-1 , Av3-Null, or buffer is performed as described above. Aortae are harvested 30, 60 or 90-100 days after transplantation. All rats are treated with cyclosporine (5 mg/kg/day) for 5 days after transplantation.

Aortas from three rats infected with Av3Null, 5 rats infected with Av-flag-sFGFR1 , and 3 buffer controls are examined 30 days after transplantation. In saline controls, the neointima consisted predominantly of endothelial and inflammatory cells on day 30. In one animal, focal neointimal smooth muscle is observed. Similarly, in aortas from rats infected with null virus, intimal endothelialitis is observed in two rats, and in one there is significant neointimal smooth muscle. In all of the Av3-flag-sFGFR-1 infected rats, intimal endothelialitis is observed 30 days after transplantation. This is very mild in 3, and more significant in 2 aortas.

Aortas from four rats infected with Av3Null, 6 rats infected with Av-flag-sFGFR-1, and 3 buffer controls are examined 60 days after transplantation. In two of three saline controls, there is extensive loss of medial smooth muscle. In one of the saline controls, medial smooth muscle is preserved. In the two saline treated rats with medial smooth muslce cell loss, extensive neointimal smooth muscle is observed. In the rat with preserved medial smooth muscle intimal fibrin and endothelialitis are seen. In the 4 rats infected with Av3Null, medial smooth muscle cell loss is similar to that observed in the saline controls. In all Av3Null infected rats, a neointima consisting of myofibroblast smooth muscle is observed. In two cases, this neoitima is very thick, in two it is less extensive. In the 6 rats infected with Av3-flag-sFGFR-1, medial smooth muscle cell loss is observed in every case, and is similar to that seen in the other two groups. In the two cases of Av3-flag-sFGFR-1 infected aortae, neointima is absent, in the other 4 cases mild to moderate neointima formation is observed.

Aortas from four rats infected with Av3Null, 4 rats infected with Av-flag-sFGFR-1 , and 8 buffer controls are examined 90-100 days after transplantation. At this point, there is uniform medial smooth muscle cell loss. A moderate to large neointima is formed in all saline controls and in all Av3Null infected rats. In all four of the Av3-f lag-sFGFR-1 infected rats, the neointima is much thinner than that observed in the controls.

For quantitative analysis of vessel damage, aorta crossections from day 30, 60 and 90 are stained for elastin to clearly identify the medial layer. To estimate intimal and medial area, stereology (point-counting) by a technician blinded to the experiment was used. By two-way Anova, treatment with Av3 flag sFGFR-1 afforded significant protection from the development of neointima as compared to Av3 Null treatment (p = 0.0I33), or when compared to pooled controls (Av3 Null and Saline) (p = 0.004). Hence, it can be concluded that transduction with Av3 flag sFGFR-1 of rat aorta just prior to transplantation from DA to PVG rats protects against the development of AGA, an effect that is most evident 90 days after transplantation.

Example 5: Av3hsFGFR-1

1. Generation of hsFGFR-1 shuttle vector construct

The first Ig domain of hFGFR-1 is removed using overlap PCR. A full length 3 Ig domain containing clone purchsed from ATCC is used as template (ATCC # 80043; genbank #

M34641 )to amplify 2 fragments which overlap by 30 nucleotides. Using primers # 485 and

#490 a 115bp 5' fragment is amplified. Using primers # 486 and # 489 a 1058 bp 3' fragment is amplified. The 2 fragments are gel purified and mixed in a 1:1 ration and used as template for reamplification using primers # 485 and # 486, yielding a 1143 bp fragment. this fragment is digested using Xbal, gel purified and ligated to Xbal digested, dephosphorylated pBSITRIoxnMCS. XL1 -blue cells are electroporated with the iigation mix and colonies PCR screened using primer#485 and primer#328, which lies 5' of the cloning site in pBSItrloxnMCS. Several positive colonies are grown up, plasmid DNA is extracted and the sequence verified using an ABI sequencer. oligonucleotides: Xbal

# 485, 5' primer: GC TCT AGA ATGTGGAGCTGGAAGTGCCTC

#490, 3' internal primer: GGAGGGGAGAGCATCTTGTTCAGGCAAGGTCGGGGAC

Xbal

# 486, 3' primer: GC TCT AGA CTACTWAGGTACAGGGWGA

# 489, 5' internal primer: GACCTTGCCTGAACAAGATGCTCTCCCCTCCTCGGAGG

In step two a two amino acid insertion (Arg;Met) at position 59/60 is generated using the QuikChangeTM Site-Directed Mutagenesis Kit from Stratagene following the manufacturers instructions. The basic procedure utilizes a supercoiled double-stranded DNA (dsDNA) vector with an insert of interest and two synthetic oligonucleotide primers containing the desired mutation The oligonucleotide primers, each complementary to opposite strands of the vector, are extended during temperature cycling by using PfuTurbo DNA polymerase. Incoφoration of the oligonucleotide primers generates a mutated plasmid containing staggered nicks. Following temperature cycling, the product is treated with Dpn 1. The Dpn 1 endonuclease (target sequence: 5'-Gm6ATC-3') is specific for methylated and hemimethylated DNA and is used to digest the parental DNA template and to select for mutation-containing synthesized DNA. DNA isolated from almost all Escherichia coli strains is dam methylated and therefore susceptible to Dpn 1 digestion. The nicked vector DNA incoφorating the desired mutations is then transformed into Epicurian Colie^R XL1 -Blue supercompetent cells. The small amount of starting DNA template required to perform this method, the high fidelity of the PfuTurbo DNApolymerase, and the low number of PCR cycles all contribute to the high mutation efficiency and decreased potential for random mutations during the reaction. The sequence of the primers used is as follows: primer # 495 (coding strand): CACCAAACCAAACCGTATGCCCGTAGCTCCATAT primer # 496 (non coding strand): ATATGGAGCTACGGGCATACGGTTTGGTTTGGTG primer # 497: AATATGGAGCTACGGGCATAC

The PCR reaction is phenol/chloroform extracted, the buffer excahnged with TE using spinX columns and XL1 -blue cells electropolated. Colonies are PCR screened using primer # 497 and primer # 328, which lies 5' of the cloning site in pBSITRIoxnMCS. Several positive colonies are grown up, plasmid DNA is extracted and the sequence berified using an ABI sequencer.

The PCR reaction is phenol/chloroform extracted, the buffer exchanged with TE using spinX columns and XL1 -blue cells electropolated. As it is not possible to PCR screen for this point mutationseveral colonies are grown up, miniprep DNA prepared and the inserts sequenced using ABI sequencer. The sequence corresponds to SEQ. ID. No.5.

2. Generation of recombinant Adenovirus

5x10^s A30 cells per well are seeded onto 6 well plates and induced with dexamethasone (0.5μM). The following day the cells are transfected using Clal, and 1 μg of the isolated ITR- FGFR-1-loxP fragment (isolated with Notl/Pstl and gel purified). The cells are incubated in 1 ml RPMI, 10% FCS, Glu/P/S, Dex. 0.5μM overnight. The following day 3ml of above used medium is added. After 8 days the cells are scraped and subjected to 4 cycles of freeze- thawing. The supernatant is distributed onto 3.5cm petri dishes containing 80% confluent Dex induced A30 cells and incubated for 4 days. After 4 cycles of freeze thawing the supernatant is added to 10 cm petri dish containing 80% confluent Dex induced A30 cells and incubated for 3 days, cells are again subjected to above described procedure and the supernatant used to transduce a 300cm² flask. After 3 days cells are scraped and centrifuged for 15 min. at 1.5 krpm at 4°C. The supematnat is applied to 6 well plates seeded with A30 cells and incubated at 37°C o/n. The following day cells are overlaid with Seaplaque agarose. 7 days post overlay plaques are picked and propagated. DNA of several clones is prepared and analysed in the same way as described above, yielding a CVLobtained from approx 8x10⁷ transduced cells.

The in vitro expression of hsFGFR-1 is confirmed using RT-PCR analysis of transduced A30 cells. Production of the hsFGFR-1 protein (SEQ. ID. No. 6) is confirmed using Western Blot analysis of supernatants of A30 cells transduced with Av3 hsFGFR-1.

Example 6

1. AAV-rsFGFR-1 expression in-vitro

Using a similar gene construct as for the generation of recombinant Adenovirus, an adeno associated virus is generated. A viral titer of approx 10⁹/ml is produced. Expression of sFGFR protein is demonstrated by Western Blot analysis. To demonstrate functional activity 3T3 fibroblasts are infected with AAV-rsFGFR-1, AAV-LacZ (particlexell ratio = ~ 500:1) or buffer. 24 h after infection, the cells are placed into medium with 0.5% serum to make them quiescent and 48 hours later, the cells are stimulated with bFGF (0.3 ng/ml) or PDGF (3 ng/ml). 18 hours later, ³H-thymidine incoφoration is measured.

Cells not infected or infected with AAV-LacZ virus showed a 9.1 or 9.6 fold increase in thymidine incorporation in response to bFGF indicating that AAV infection itself does not alter the bFGF response. In cells infected with AAV-sFGFR-1 , bFGF stimulated thymidine incoφoration is almost completely blocked (1.5 fold of basal levels). AAV-sFGFR-1 also inhibits the PDGF response from 5.7 to 2.4 fold. It is concluded: 1) AAV-Lac Z does not alter the DNA synthesis response of 3T3 cells to bFGF. 2) AAV-sFGFR-1 inhibits the 3T3- cell DNA synthesis response to bFGF by 84%. 3) AAV-sFGFR-1 inhibits the 3T3-cell DNA synthesis response to PDGF by 58%.

2. AAV flaα-rsFGFR-1 transduction in aorta transplantation.

Rat aortas have been transplanted comparing buffer vs. AAV-flag rsFGFRI . At 7 days 5 animals in each group are sacrificed for expression studies.

3. AAV-rsFGFR-1 in cardiac transplantation

A total of 8 rat hearts are transduced with buffer (4) or AAV-rsFGFR-1 (4) prior to transplantation. Of these one animal in each group is sacrificed at day 14 to determine whether flag-sFGFR-1 is expressed. Using a monoclonal anti-flag antibody, expression of fiag-sFGFR-1 is observed in blood vessels. Staining with anti-flag antibody is negative in the buffer transfected control heart.

Control rats (non-transduced hearts) and rats transplanted with sham-transduced hearts rejected by day 60 whereas the animals with AAV-flag-sFGFR-1 transduced hearts did not reject.

Example 7: Chronic Rejection

1. sFasR gene delivery vehicle is tested in a monkey kidney transplantation model representative for chronic rejection. The kidney is subjected to 24h cold ischemia and then transplanted in a unilaterally nephrectomized cynomolgus recipient. The immunsuppressive regimen is based on 150mg/kg/day for 14 days and then 100 mg/kg/day p.o. Control animals develop chronic rejection whereas the cynomolgus receiving kidneys transduced with the gene delivery vehicle to be tested show interesting results. The transduction is performed by infusion for 5 to 10 min and incubation for 30 min at a dose of e.g. 10¹⁰ particles/kg.

2. sFasR gene delivery vehicle is also tested in an orthotopic concordant heart xenograft-cynomolgus-to-baboon model representative for heart chronic rejection. The transplanted animals (control and sFasR transduced xenografts) receive following immunosuppressive regimen: Intra-operatively: 30mg/kg CysA i.v., 4mg/kg Azathioprine i.v., 125 mg/kg Solumedrol i.v.; and post-operatively:50 mg/kg/day CysA, 4 mg/kg/day Azathioprine, 1 mg/kg/day prednisone. The transduction of the hearts with the gene delivery vehicle is performed via the antrograde approach at 4°C, without pressure, at a dose of e.g. 10¹⁰ pfu/kg (infusion for 5 to 10 min. and incubation for 30 min.). Animals are sacrificed starting at day 30 and up to 100 days post transplantation. Av3 hsFasR has a beneficial effect in this model.

These transplantation models are repeated using a shFGFR-1 gene delivery vehicle.

Example 8:

The donor organ will be harvested according to established routine sterile surgicals protocol and dispatched to the medical center where the recipient is awaiting transplantation.

While the recipient patient is undergoing surgical preparation for the transplantation process, the vessels of the donor's organ (which is kept on ice) will be flushed with melting- ice cold preservation solution. Next, an appropriate volume (e.g. 50 ml for a human heart) of a suspension of gene vector, e.g adenoviral vector, for example Av3hsFasR or Av3hsFGFR-1 (which is sterile except for the presence of the relevant adenovirus), in preservation solution (e.g. 10⁹ pfu/ml) will be injected at low pressure in the main vessel(s) of the donor heart. After 20 min incubation on melting ice or at 37°C, the viral suspension will be flushed out of the vessels of the donor's organ using cardioplegic solution. The transfected donor's organ is then ready for use according to the standard transplant protocol used for non-transfected organs. The transfection should not impact upon the cold ischemia time, nor the warming time of the organ.

Claims

1. A method of genetically modifying mammalian target cells to inhibit excessive proliferation thereof which comprises transferring to the cells, or progenitors thereof, a DNA sequence encoding a soluble form of either FasR or FGFR-1 (type 1 receptor for FGF) or a biologically active fragment or derivative thereof, the DNA sequence encoding a soluble form of FasR having the sequence as indicated in SEQ. ID. 3.

2. A gene delivery vehicle containing a DNA sequence encoding a soluble form of FGFR-1 or a biologically active fragment or derivative thereof, operably linked to an expression control element.

3. A recombinant adenovirus or adenovirus-associated vector containing a DNA sequence encoding a soluble form of FGFR-1 or a biologically active fragment or derivative thereof.

4. A recombinant adenovirus vector comprising an adenoviral genomic backbone having E1, E2a and/or E3 deletions and a DNA sequence encoding a soluble form of FGFR-1 or a biologically active fragment or derivative thereof or a soluble form of FasR as defined in SEQ. ID. No.3 or a biologically active fragment or derivative thereof.

5. A vector according to claim 4 which is Av3hsFasR or Av3hsFGFR-1.

6. Use of a soluble form of FGFR-1 or a biologically active fragment or derivative thereof in the manufacture of a sFGFR-1 gene delivery vehicle for use in allo- or xenotransplantation.

7. Use of a soluble form of FasR or FGFR-1 or a biologically active fragment or derivative thereof in the manufacture of a sFasR or FGFR-1 gene delivery vehicle for use in the prevention or treatment of vascular occlusive diseases or disorders.

8. A vector according to claim 4 or 5 for use in allo- or xenotransplantation.

9. A vector according to claim 4 or 5 for use in the prevention or treatment of vascular occlusive diseases or disorders.

10. A vector according to claim 4 or 5 for use to express of overexpress sFasR or sFGFR- 1 or a biologically active fragment or derivative thereof, in the vascular cells of a subject needing a prophylactic or curative treatment of vascular occlusive diseases or disorders.

11. A vector according to claim 4 or 5 for use in the prevention or treatment of acute or chronic rejection in a recipient of organ or tissue allo- or xenotransplant.

12. A fluid for tissue or organs to be transplanted comprising a sFasR or a sFGFR-1 gene delivery vehicle.

13. A tissue or organ for transplant treated with a fluid according to claim 12.

14. A pharmaceutical composition comprising a sFasR or sFGFR-1 gene delivery vehicle together with one or more pharmaceutically acceptable carrier.