WO2000060085A1 - Facteur de croissance 20 des fibroblastes - Google Patents

Facteur de croissance 20 des fibroblastes Download PDF

Info

Publication number
WO2000060085A1
WO2000060085A1 PCT/US2000/008076 US0008076W WO0060085A1 WO 2000060085 A1 WO2000060085 A1 WO 2000060085A1 US 0008076 W US0008076 W US 0008076W WO 0060085 A1 WO0060085 A1 WO 0060085A1
Authority
WO
WIPO (PCT)
Prior art keywords
fgf
nucleic acid
protein
polypeptide
seq
Prior art date
Application number
PCT/US2000/008076
Other languages
English (en)
Inventor
Rory A. J. Curtis
Nicholas C. Wrighton
Original Assignee
Millennium Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Millennium Pharmaceuticals, Inc. filed Critical Millennium Pharmaceuticals, Inc.
Priority to AU39243/00A priority Critical patent/AU3924300A/en
Publication of WO2000060085A1 publication Critical patent/WO2000060085A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/50—Fibroblast growth factors [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • Fibroblast growth factor was initially characterized as a fibroblast mitogen (Gospodarawicz, D. (1975) J. Biol. Chem., 250:2515-2520).
  • the FGF family currently comprises at least 19 structurally and functionally related proteins, including acidic and basic FGF, FGF-1 and FGF-2 respectively.
  • FGF family members are oncogene products int2 (FGF-3), hst (FGF-4),
  • FGF-5 FGF-5
  • FGF-6 FGF-6
  • FGF-7 keratinocyte growth factor
  • FGF-8 androgen- induced growth factor
  • FGF-9 glia-activating factor
  • FGF-10 is preferentially expressed in the adult lung (Yamasaki, M. et al. (1996) J. Biol. Chem., 271:15918-15921).
  • FGFs 11-14 also referred to as FGF homologous factors (FHFs) appear to be involved in the development and function of the nervous system (Smallwood, P.M. et al. (1996) Proc. Natl. Acad. Sci. USA, 93:9850-9857).
  • FGF- 15 displays a regionally restricted and dynamic pattern of expression in the developing nervous system (McWhirter, J.R. et al. ( 991) Development, 124:3221-3232).
  • FGF- 16 is predominantly expressed in rat embryonic brown adipose tissue and in the adult heart.
  • FGF-17 displays preferential expression in the neuroepithelia of the isthmus and septum of the embryonic brain (Hoshikawa, M. et al.
  • FGF- 18 is expressed primarily in the lungs and kidneys, and stimulates hepatic and intestinal proliferation (Hu, M.C.T. et al. (1998) Mol. Cell. Biol, 18:6063-6074).
  • FGF-19 is expressed in the fetal brain (Nishimura, T. et al. (1999) Biochim Biophys Ada, 1444J48-151).
  • Target cell responses are mediated, in part, by the binding of FGF ligands to cognate FGF receptors (FGFR) that possess intrinsic tyrosine kinase activity.
  • FGF receptors FGF receptors
  • a given FGFR can bind different members of the FGF family with varying degrees of specificity.
  • the structure of the FGFR consists of an extracellular region with three immunoglobulin-like domains, a transmembrane region, and a cytosolic tyrosine kinase domain that is activated upon ligand binding.
  • FGF binding causes dimerization of the receptors, resulting in receptor autophosphorylation on tyrosine residues and the activation of intracellular signal transduction cascades.
  • the action of FGF appears to depend on interactions with heparan sulfate proteoglycans in the extracellular matrix.
  • proteoglycans include protection from proteolysis, localization, storage, and internalization of growth factors (Faham, S. et al. (1998) Curr. Opin. Struct.
  • Heparan sulfate proteoglycans may serve as low affinity FGF receptors that act to present FGF to its cognate FGFR, and/or to facilitate receptor oligomerization (Galzie, Z. et al. (1997) Biochem. Cell. Biol, 75:669-685).
  • the present invention is based, at least in part, on the discovery of novel fibroblast growth factor (FGF) family members, referred to herein as "Fibroblast Growth Factor 20" or "FGF-20" nucleic acid and protein molecules.
  • FGF fibroblast growth factor
  • the FGF-20 molecules of the present invention are useful as modulating agents to regulate a variety of cellular processes, including cell proliferation, differentiation, and directed migration.
  • this invention provides isolated nucleic acid molecules encoding FGF-20 proteins or biologically active portions thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection of FGF-20- encoding nucleic acids.
  • an FGF-20 nucleic acid molecule of the invention is at least 32.2%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or more identical to the nucleotide sequence (e.g., to the entire length of the nucleotide sequence) shown in SEQ ID NO: 1 or 3 or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a complement thereof.
  • an FGF-20 nucleic acid molecule of the invention is at least
  • nucleotide sequence e.g., to the entire length of the nucleotide sequence shown in SEQ ID NO:4, 6, 7 or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a complement thereof.
  • the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO: 1 or 3, or a complement thereof.
  • the nucleic acid molecule includes SEQ ID NO:3 and nucleotides 533-805 of SEQ ID NOJ .
  • the nucleic acid molecule consists of the nucleotide sequence shown in SEQ ID NOJ or 3.
  • the nucleic acid molecule includes a fragment of at least 107 nucleotides (e.g., 107 contiguous nucleotides) of the nucleotide sequence of SEQ ID NOJor 3, or a complement thereof.
  • the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:4 or 6, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:6 and nucleotides 1-325 of SEQ ID NO:4. In another embodiment, the nucleic acid molecule includes SEQ ID NO:6
  • nucleic acid molecule consists of the nucleotide sequence shown in SEQ ID NO:4 or 6.
  • nucleic acid molecule includes a fragment of at least 2329 nucleotides (e.g., 2329 contiguous nucleotides) of the nucleotide sequence of SEQ ID NO:4 or 6, or a complement thereof.
  • the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:7 or 9, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:9 and nucleotides 1-1070 of SEQ ID NO:7. In another embodiment, the nucleic acid molecule includes SEQ ID NO:9 and nucleotides 1605-1973 of SEQ ID NO:7. In another preferred embodiment, the nucleic acid molecule consists of the nucleotide sequence shown in SEQ ID NO:7 or 9.
  • the nucleic acid molecule includes a fragment of at least 1156 nucleotides (e.g., 1156 contiguous nucleotides) of the nucleotide sequence of SEQ ID NO:7 or 9, or a complement thereof.
  • an FGF-20 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO:2 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • an FGF-20 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence at least 30%), 35%, 40%).
  • an FGF-20 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO: 5 or 8, or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • an FGF-20 nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence at least 29.6%), 30%, 35%, 40%), 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the entire length of the amino acid sequence of SEQ ID NO: 5 or 8, or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession
  • an isolated nucleic acid molecule encodes the amino acid sequence of monkey or human FGF-20.
  • the nucleic acid molecule includes a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO:2, 5, or 8, or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession
  • the nucleic acid molecule is at least 107 nucleotides in length. In a further preferred embodiment, the nucleic acid molecule is at least 107 nucleotides in length and encodes a protein having an FGF-20 activity (as described herein). In yet another preferred embodiment, the nucleic acid molecule is at least 1156 nucleotides in length. In a further preferred embodiment, the nucleic acid molecule is at least 1156 nucleotides in length and encodes a protein having an FGF-20 activity (as described herein).
  • nucleic acid molecules preferably FGF-20 nucleic acid molecules, which specifically detect FGF-20 nucleic acid molecules relative to nucleic acid molecules encoding non-FGF-20 proteins.
  • a nucleic acid molecule is at least 107, 107-150, 150- 200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, or 550-600, 600-650, 650-700, 700-750, 750-800 or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NOJ, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a complement thereof.
  • such a nucleic acid molecule is at least 1156, 1156-1200, 1200-1400, 1400-1600, 1600-1800, 1800-2000, 2000-2200, 2200-2328, 2329, 2329-2350, 2350- 2400, 2400-2450, 2450-2500, 2500-2550, 2550-2600, 2600-2650, 2650-2700 or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO:4 or 7, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as
  • the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 1-24, 168-189, 296-301, 552-579, 630-683, or 795-805 of SEQ ID NOJ.
  • the nucleic acid molecules comprise nucleotides 1-24, 168-189, 296-301, 552-579, 630-683, or 795-805 of SEQ ID NOJ.
  • the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number , wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NOJ or 3 under stringent conditions.
  • the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:5 or 8, or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number , wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:4, 6, 7, or 9, under stringent conditions.
  • Another embodiment of the invention provides an isolated nucleic acid molecule which is antisense to an FGF-20 nucleic acid molecule, e.g., the coding strand of an FGF-20 nucleic acid molecule.
  • Another aspect of the invention provides a vector comprising an FGF-20 nucleic acid molecule.
  • the vector is a recombinant expression vector.
  • the invention provides a host cell containing a vector of the invention.
  • the invention provides a host cell containing a nucleic acid molecule of the invention.
  • the invention also provides a method for producing a protein, preferably an FGF-20 protein, by culturing in a suitable medium, a host cell, e.g., a mammalian host cell such as a non-human mammalian cell, of the invention containing a recombinant expression vector, such that the protein is produced.
  • a host cell e.g., a mammalian host cell such as a non-human mammalian cell
  • the isolated protein preferably an FGF- 20 protein
  • the isolated protein, preferably an FGF-20 protein includes at least one fibroblast growth factor domain.
  • the isolated protein, preferably an FGF-20 protein includes a beta trefoil structure.
  • the isolated protein preferably an FGF-20 protein, includes at least one fibroblast growth factor domain and a beta trefoil structure.
  • the protein, preferably an FGF-20 protein includes at least one fibroblast growth factor domain and has an amino acid sequence at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence of SEQ ID NO:2, 5, or 8, or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • the protein preferably an FGF-20 protein, includes a beta trefoil structure and has an amino acid sequence at least about 30%, 35%, 40%, 45%), 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence of SEQ ID NO:2, 5, or 8, or the amino acid sequence encoded by the DNA insert of the plasmids deposited with ATCC as Accession Numbers .
  • the protein preferably an FGF-20 protein, includes at least one fibroblast growth factor domain and a beta trefoil structure and has an amino acid sequence at least about 30%), 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence of SEQ ID NO:2, 5, or 8, or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • the protein, preferably an FGF-20 protein includes at least one fibroblast growth factor domain and plays a role in cell growth, e.g., the regulation of cell proliferation and/or differentiation.
  • the protein preferably an FGF-20 protein
  • the protein includes a beta trefoil structure and plays a role in cell growth, e.g., the regulation of cell proliferation and/or differentiation.
  • the protein, preferably an FGF-20 protein includes at least one fibroblast growth factor domain and a beta trefoil structure and plays a role in cell growth, e.g., the regulation of cell proliferation and/or differentiation.
  • the protein preferably an FGF-20 protein, includes at least one fibroblast growth factor domain and is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOJ , 3, 4, 6, 7, or 9.
  • the protein, preferably an FGF-20 protein includes a beta trefoil structure and is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9.
  • the protein preferably an FGF-20 protein, includes at least one fibroblast growth factor domain and a beta trefoil structure and is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 4, 6, 7, or 9.
  • the invention features fragments of the protein having the amino acid sequence of SEQ ID NO:2, 5, or 8, wherein the fragment comprises at least 15 amino acids (e.g., contiguous amino acids) of the amino acid sequence of SEQ ID NO:2, 5, or 8, or an amino acid sequence encoded by the DNA insert of the plasmid deposited with the ATCC as Accession Number .
  • the protein preferably an FGF-20 protein, has the amino acid sequence of SEQ ID NO:2, 5, or 8.
  • the invention features an isolated protein, preferably an FGF-20 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence at least about 32.2%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%), 85%, 90%, 95%, 98% or more identical to a nucleotide sequence of SEQ ID NOJ or 3, or a complement thereof.
  • This invention further features an isolated protein, preferably an FGF-20 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOJ or 3, or a complement thereof.
  • the invention features an isolated protein, preferably an FGF-20 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%), 90%), 95%, 98%> or more identical to a nucleotide sequence of SEQ ID NO:4, 6, 7, or 9, or a complement thereof.
  • This invention further features an isolated protein, preferably an FGF-20 protein, which is encoded by a nucleic acid molecule consisting of a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4, 6, 7, or 9, or a complement thereof.
  • the proteins of the present invention or portions thereof e.g., biologically active portions thereof, can be operatively linked to a non-FGF-20 polypeptide (e.g., heterologous amino acid sequences) to form fusion proteins.
  • the invention further features antibodies, such as monoclonal or polyclonal antibodies, that specifically bind proteins of the invention, preferably FGF-20 proteins.
  • the FGF-20 proteins or biologically active portions thereof can be incorporated into pharmaceutical compositions, which optionally include pharmaceutically acceptable carriers.
  • the present invention provides a method for detecting the presence of an FGF-20 nucleic acid molecule, protein or polypeptide in a biological sample by contacting the biological sample with an agent capable of detecting an FGF- 20 nucleic acid molecule, protein or polypeptide such that the presence of an FGF-20 nucleic acid molecule, protein or polypeptide is detected in the biological sample.
  • the present invention provides a method for detecting the presence of FGF-20 activity in a biological sample by contacting the biological sample with an agent capable of detecting an indicator of FGF-20 activity such that the presence of FGF-20 activity is detected in the biological sample.
  • the invention provides a method for modulating FGF-20 activity comprising contacting a cell capable of expressing FGF-20 with an agent that modulates FGF-20 activity such that FGF-20 activity in the cell is modulated.
  • the agent inhibits FGF-20 activity.
  • the agent stimulates FGF-20 activity.
  • the agent is an antibody that specifically binds to an FGF-20 protein.
  • the agent modulates expression of FGF-20 by modulating transcription of an FGF-20 gene or translation of an FGF-20 mRNA.
  • the agent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of an FGF-20 mRNA or an FGF-20 gene.
  • the methods of the present invention are used to treat a subject having a disorder characterized by aberrant or unwanted FGF-20 protein or nucleic acid expression or activity by administering an agent which is an FGF-20 modulator to the subject.
  • the FGF-20 modulator is an FGF-20 protein.
  • the FGF-20 modulator is an FGF-20 nucleic acid molecule.
  • the FGF-20 modulator is a peptide, peptidomimetic, or other small molecule.
  • the disorder characterized by aberrant or unwanted FGF-20 protein or nucleic acid expression is a disorder associated with deregulated cell growth such as a proliferative or differentiative disorder, including cancer, e.g., carcinoma, sarcoma, or leukemia; tumor angiogenesis and metastasis; skeletal dysplasia; neuronal deficiencies resulting from impaired neural induction and patterning; neurodegenerative disorders, e.g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Jakob-Creutzfieldt disease, or AIDS related dementia; hepatic disorders; cardiovascular disorders; and hematopoietic and/or myeloproliferative disorders.
  • a proliferative or differentiative disorder including cancer, e.g., carcinoma, sarcoma, or leukemia; tumor
  • the present invention also provides diagnostic assays for identifying the presence or absence of a genetic alteration characterized by at least one of (i) aberrant modification or mutation of a gene encoding an FGF-20 protein; (ii) mis-regulation of the gene; and (iii) aberrant post-translational modification of an FGF-20 protein, wherein a wild-type form of the gene encodes a protein with an FGF-20 activity.
  • the invention provides methods for identifying a compound that binds to or modulates the activity of an FGF-20 protein, by providing an indicator composition comprising an FGF-20 protein having FGF-20 activity, contacting the indicator composition with a test compound, and determining the effect of the test compound on FGF-20 activity in the indicator composition to identify a compound that modulates the activity of an FGF-20 protein.
  • Figure 1 depicts the cDNA sequence and predicted amino acid sequence of monkey FGF-20.
  • the nucleotide sequence corresponds to nucleic acids 1 to 805 of SEQ ID NO: 1.
  • the amino acid sequence corresponds to amino acids 1 to 177 of SEQ ID NO: 2.
  • the coding region without the 3' untranslated region of the monkey FGF-20 gene is shown in SEQ ID NO:3.
  • Figure 2 depicts a structural, hydrophobicity, and antigenicity analysis of the monkey FGF-20 protein.
  • Figure 3 depicts the results of a search which was performed against the HMM database in which a "Fibroblast growth factor (FGF) domain" was identified in the monkey FGF-20 protein.
  • FGF Fibroblast growth factor
  • Figure 4 depicts a global alignment of the monkey FGF-20 nucleic acid sequence with the Mus musculus mRNA (Accession Number AA175629) using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 32.2% identity between the two sequences.
  • Figure 5 depicts a global alignment of the monkey FGF-20 protein with the mouse fibroblast growth factor 15 (FGF-15) protein using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 14.1% identity between the two sequences.
  • Figure 6 depicts a global alignment of the monkey FGF-20 protein with the human fibroblast growth factor 19 (FGF- 19) protein using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 17.4% identity between the two sequences.
  • Figure 7 depicts a local alignment of the monkey FGF-20 protein with the mouse fibroblast growth factor 15 (FGF- 15) protein using the LALIGN program (version 2.0u54), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 35.1% identity between the two sequences over amino acid residues 9-80 of SEQ ID NO:2.
  • Figure 8 depicts a local alignment of the monkey FGF-20 protein with the human fibroblast growth factor 19 (FGF- 19) protein using the LALIGN program (version 2.0u54), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 39.7% identity between the two sequences over amino acid residues 9-85 of SEQ ID NO:2.
  • Figure 9 depicts the nucleic acid sequence and predicted amino acid sequence of human FGF-20 as identified within the Homo sapiens 12pl3 BAC RPCI11-388F6 genomic fragment (Accession Number AC008012) by homology searching with monkey FGF-20.
  • the nucleotide sequence corresponds to nucleic acids 1 to 2749 of SEQ ID NO:4.
  • the amino acid sequence corresponds to amino acids 1 to 178 of SEQ ID NO: 5.
  • the coding region without the 5' and 3' untranslated regions of the human FGF-20 gene is shown in SEQ ID NO:6.
  • Figure 10 depicts the cDNA sequence and predicted amino acid sequence of human FGF-20.
  • the nucleotide sequence corresponds to nucleic acids 1 to 1973 of SEQ ID NO:7.
  • the amino acid sequence corresponds to amino acids 1 to 178 of SEQ ID NO: 8.
  • the coding region without the 5' and 3' untranslated regions of the human FGF- 20 gene is shown in SEQ ID NO:9.
  • Figure 11 depicts an alignment of the human FGF-20 cDNA sequence with the human FGF-20 nucleic acid sequence identified within the Homo sapiens 12pl3 BAC RPCI11-388F6 genomic fragment (Accession Number AC008012), using the CLUSTAL W (1.74) multiple sequence alignment program.
  • Figure 12 depicts an alignment of the human FGF-20 protein with the human FGF-20 protein sequence predicted from the Homo sapiens 12pl3 BAC RPCI11-388F6 genomic fragment (Accession Number AC008012), using the CLUSTAL W (1.74) multiple sequence alignment program.
  • Figure 13 depicts a structural, hydrophobicity, and antigenicity analysis of the human FGF-20 protein.
  • Figure 14 depicts the results of a search which was performed against the HMM database in which a "Fibroblast growth factor (FGF) domain" was identified in the human FGF-20 protein, and the local alignment of the human FGF-20 protein with ProDom entry 549.
  • FGF Fibroblast growth factor
  • Figure 15 depicts a global alignment of the human FGF-20 protein with the human fibroblast growth factor- 19 (FGF- 19) protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 29.6% identity between the two sequences.
  • Figure 16 depicts a global alignment of the human FGF-20 protein with the mouse fibroblast growth factor- 15 (FGF-15) protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 22.3% identity between the two sequences.
  • Figure 7 depicts a global alignment of the human FGF-20 nucleic acid sequence with the monkey FGF-20 nucleic acid sequence using the GAP program in the GCG software package, using a nwsgapdna matrix a gap weight of 12 and a length weight of 4. The results showed a 94.5% identity between the two sequences.
  • Figure 18 depicts a global alignment of the human FGF-20 protein with the monkey FGF-20 protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 93.8%) identity between the two sequences.
  • the present invention is based, at least in part, on the discovery of novel Fibroblast Growth Factor (FGF) family members, referred to herein as "Fibroblast growth factor 20" or “FGF-20” nucleic acid and protein molecules.
  • FGF molecules modulate the proliferation, motility, differentiation, and survival of a variety of cells of mesodermal, neuroectodermal, ectodermal, and endodermal origin, including fibroblasts, chondrocytes, myoblasts, endothelial cells, astrocytes, neuroblasts, keratinocytes, osteoblasts, and smooth muscle cells (Burgess, W.H. et al. (1989) Ann. Rev.
  • FGF molecules display a broad range of biological activities as mitogens, motogens, angiogenic factors, neurotropic factors, differentiation factors, and oncogenes (Galzie, Z. et al. (1997) Biochem. Cell. Biol, 75:669-685). These proteins are important in developmental processes including limb formation, mesoderm induction, and induction and patterning of neural tissues, as well as in the maintenance of tissues and in wound healing and repair.
  • the FGF-20 molecules of the present invention may also be growth regulatory proteins that function to modulate cell proliferation, differentiation, and motility.
  • the FGF-20 molecules of the present invention may play a role in cellular growth signaling mechanisms.
  • cellular growth signaling mechanisms includes signal transmission from cell receptors, e.g., growth factor receptors, which regulates 1) cell transversal through the cell cycle, 2) cell differentiation, 3) cell survival, and/or 4) cell migration and patterning.
  • cell receptors e.g., growth factor receptors, which regulates 1) cell transversal through the cell cycle, 2) cell differentiation, 3) cell survival, and/or 4) cell migration and patterning.
  • cell fate and activity is determined, in part, by extracellular and intracellular stimuli, e.g., growth factors, cytokines, hormones, neurotropic factors, angiogenic factors, and chemotactic factors.
  • the FGF-20 molecules of the present invention may be involved in the initiation of cellular signal transduction pathways that modulate cell growth and differentiation.
  • the FGF-20 molecules by participating in cellular growth signaling mechanisms, may modulate cell behavior and act as targets and therapeutic agents for controlling cellular proliferation and differentiation.
  • a "cellular proliferative disorder” includes a disorder, disease, or condition characterized by a deregulated, e.g., upregulated or downregulated, growth response.
  • a “cellular differentiative disorder” includes a disorder, disease, or condition characterized by aberrant or deficient cellular differentiation.
  • the FGF-20 molecules may act as novel diagnostic targets and therapeutic agents for controlling cellular proliferative and/or differentiative disorders, including cancer, e.g., carcinoma (e.g., colon), sarcoma, leukemia (e.g., erythroleukemia); tumor angiogenesis and metastasis; skeletal dysplasia; hematopoietic and/or myeloproliferative disorders, e.g., anemias (e.g., hemoglobinuria, myelodysplastic syndromes, red cell aplasia, thalassemia), erythrocytosis, neutropenia, neutrophilia, chronic granulomatous disease, eosinophilia, basophilia, monocytosis, histiocytosis, mastocytosis, lymphocytosis, lymphocytopenia, plasmacytosis, thrombocytopenia, thrombocytosis, and lymphoma; hepatic disorders,
  • FGF-20-associated or related disorders also include disorders of tissues in which FGF-20 is expressed, e.g., heart, liver, peripheral nervous system (e.g., trigeminal ganglion), and bone marrow.
  • tissues in which FGF-20 is expressed e.g., heart, liver, peripheral nervous system (e.g., trigeminal ganglion), and bone marrow.
  • the FGF-20 molecules of the present invention were identified from a dorsal root ganglion cDNA library. As the dorsal root ganglion contains the cell bodies of sensory neurons involved in pain responses, the FGF-20 molecules of the present invention may also be involved in pain responses. Accordingly, the FGF-20 molecules may also act as novel diagnostic targets and therapeutic agents for controlling pain in a variety of disorders, diseases, or conditions which are characterized by a deregulated, e.g., upregulated or downregulated, pain response.
  • a deregulated e.g., upregulated or downregulated
  • the FGF-20 molecules may provide novel diagnostic targets and therapeutic agents for controlling the exaggerated pain response elicited during various forms of tissue injury, e.g., inflammation, infection, and ischemia, usually referred to as hyperalgesia (described in, for example, Fields, H.L. (1987) Pain, New York:McGraw-Hill).
  • the FGF- 20 molecules may provide novel diagnostic targets and therapeutic agents for controlling pain, e.g., chronic pain, associated with muscoloskeletal disorders, e.g., joint pain; tooth pain; headaches; neuralgia; pain associated with malignancies, pain associated with surgery, or neuropathic pain.
  • the FGF-20 molecules of the present invention may also act as novel diagnostic targets and therapeutic agents in cardiovascular disorders such as arteriosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular pacing, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic bending, coronary artery ligation, vascular heart disease, atrial fibrilation, long-QT syndrome, congestive heart failure, sinus node disfunction, angina, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm, or arrhythmia.
  • cardiovascular disorders such as arteriosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular pacing, coronary microembolism, tachycardia, bradycardia
  • family when referring to the protein and nucleic acid molecules of the invention is intended to mean two or more proteins or nucleic acid molecules having a common structural domain or motif and having sufficient amino acid or nucleotide sequence homology as defined herein.
  • family members can be naturally or non- naturally occurring and can be from either the same or different species.
  • a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or alternatively, can contain homologues of non-human origin, e.g., monkey proteins.
  • Members of a family may also have common functional characteristics.
  • Beta trefoil structure includes a protein tertiary (i.e., three dimensional) structure that preferably has twelve antiparallel beta strands linked to form a structure with three-fold internal symmetry. This structure consists of three copies of a basic four-stranded antiparallel beta sheet. Beta trefoil structures are described in, for example, Zhu, X. et al. (1991) Science, 251 :90-93, the contents of which are incorporated herein by reference.
  • an FGF-20 molecule of the present invention is identified based on the presence of a "fibroblast growth factor domain" in the protein or corresponding nucleic acid molecule.
  • fibroblast growth factor domain includes a protein domain having an amino acid sequence of about 20-100 amino acid residues and having a bit score for the alignment of the sequence to the fibroblast growth factor domain (HMM) of at least 20.
  • a fibroblast growth factor domain includes at least about 20-80, or more preferably about 20-60 amino acid residues, and has a bit score for the alignment of the sequence to the fibroblast growth factor domain (HMM) of at least 25, 30, 35, 50 or greater.
  • the fibroblast growth factor domain has been assigned the PFAM Accession PF00167 (http://genome.wustl.edu/Pfam/.html).
  • PF00167 http://genome.wustl.edu/Pfam/.html.
  • the amino acid sequence of the protein is searched against a database of HMMs (e.g., the Pfam database, release 2J) using the default parameters (http://www.sanger.ac.uli/Software/Pfam/HMM_search).
  • a database of HMMs e.g., the Pfam database, release 2J
  • a description of the Pfam database can be found in Sonhammer et al.
  • the fibroblast growth factor domain is characterized by conserved cysteine residues, and in one embodiment comprises the following signature pattern:
  • Human FGF-20 has such a signature pattern at about amino acids 27 to 51 of SEQ ID NO:5 or 8.
  • the fibroblast growth factor domain comprises a conserved cysteine residue at about amino acid residue 14 of SEQ ID NO: 12.
  • Monkey FGF-20 has such a conserved cysteine at about amino acid 39 of SEQ ID NO:2.
  • Human FGF-20 has such a conserved cysteine residue at about amino acid 40 of SEQ ID NO: 5 or 8.
  • a fibroblast growth factor domain includes at least about 20-80, or more preferably about 20-60 amino acid residues, and has at least 50-60% homology, preferably about 60-70%, more preferably about 70-80%, or about 80-90% homology with a fibroblast growth factor domain of monkey FGF-20 (residues 1-55 of SEQ ID NO:2) or human FGF-20 (residues 2-56 of SEQ ID NO:5 or 8).
  • FGF-20 proteins having at least 50-60% homology, preferably about 60-70%, more preferably about 70-80%, or about 80-90% homology with a fibroblast growth factor domain of monkey or human FGF-20 are within the scope of the invention.
  • Isolated proteins of the present invention preferably FGF-20 proteins, have an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO:2, 5, or 8 or are encoded by a nucleotide sequence sufficiently identical to SEQ ID NOJ, 3, 4, 6, 7, or 9.
  • the term "sufficiently identical” refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., an amino acid residue which has a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences share common structural domains or motifs and/or a common functional activity.
  • amino acid or nucleotide sequences which share common structural domains have at least 30%, 40%, or 50% homology, preferably 60% homology, more preferably 70%-80%, and even more preferably 90-95% homology across the amino acid sequences of the domains and contain at least one and preferably two structural domains or motifs, are defined herein as sufficiently identical.
  • amino acid or nucleotide sequences which share at least 30%, 40%, or 50%, preferably 60%), more preferably 70-80%), or 90-95% homology and share a common functional activity are defined herein as sufficiently identical.
  • an "FGF-20 activity”, “biological activity of FGF-20” or “functional activity of FGF-20”, refers to an activity exerted by an FGF-20 protein, polypeptide or nucleic acid molecule on an FGF-20 responsive cell or tissue, or on an FGF-20 protein substrate, as determined in vivo, or in vitro, according to standard techniques.
  • an FGF-20 activity is a direct activity, such as an association with an FGF-20-target molecule.
  • a “target molecule” or “binding partner” is a molecule with which an FGF-20 protein binds or interacts in nature, such that FGF-20-mediated function is achieved.
  • An FGF-20 target molecule can be a non-FGF-20 molecule or an FGF-20 protein or polypeptide of the present invention.
  • an FGF-20 target molecule is an FGF-20 substrate, e.g., a FGF receptor or heparan sulfate proteoglycan.
  • an FGF- 20 activity is an indirect activity, such as a cellular signaling activity mediated by interaction of the FGF-20 protein with an FGF-20 substrate, e.g., a FGF receptor or heparan sulfate proteoglycan.
  • an FGF-20 activity is the ability to act as a growth regulatory factor and to modulate cell proliferation, differentiation, and/or migration.
  • FGF-20 proteins and polypeptides having an FGF-20 activity are FGF-20 proteins having at least one fibroblast growth factor domain, and, preferably, an FGF-20 activity.
  • FGF-20 proteins having at least one fibroblast growth factor domain and a beta trefoil structure and, preferably, an FGF-20 activity are preferred proteins having at least one fibroblast growth factor domain and a beta trefoil structure and, preferably, an FGF-20 activity.
  • Additional preferred proteins have at least one fibroblast growth factor domain and/or a beta trefoil structure, and are, preferably, encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9.
  • the nucleotide sequence of the isolated monkey FGF-20 cDNA and the predicted amino acid sequence of the monkey FGF-20 polypeptide are shown in Figure 1 and in SEQ ID NOsJ and 2, respectively.
  • a plasmid containing the nucleotide sequence encoding monkey FGF-20 was deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, V A 20110-2209, on and assigned Accession Number . This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the partial monkey FGF-20 gene which is approximately 805 nucleotides in length, encodes a protein having a molecular weight of approximately 20 kD and which is approximately 177 amino acid residues in length.
  • the nucleotide sequence of the isolated human FGF-20 cDNA and the predicted amino acid sequence of the human FGF-20 polypeptide are shown in Figures 9 and 10 and in SEQ ID NOs:4 and 5, and SEQ ID NOs: 7 and 8, respectively.
  • a plasmid containing the nucleotide sequence encoding human FGF-20 was deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209, on and assigned Accession Number . This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the human FGF-20 gene which is approximately 1973 nucleotides in length, encodes a protein having a molecular weight of approximately 20 kD and which is approximately 178 amino acid residues in length.
  • nucleic acid molecules that encode FGF-20 proteins or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify FGF-20-encoding nucleic acid molecules (e.g., FGF-20 mRNA) and fragments for use as PCR primers for the amplification or mutation of FGF-20 nucleic acid molecules.
  • nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
  • the nucleic acid molecule can be single-stranded or double- stranded, but preferably is double-stranded DNA.
  • isolated nucleic acid molecule includes nucleic acid molecules which are separated from other nucleic acid molecules which are present in the natural source of the nucleic acid.
  • isolated includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated.
  • an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated FGF-20 nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0J kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • a nucleic acid molecule of the present invention e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein.
  • FGF-20 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
  • nucleic acid molecule encompassing all or a portion of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number can be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of SEQ ID NO: 1, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • PCR polymerase chain reaction
  • a nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • oligonucleotides corresponding to FGF-20 nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO: 1.
  • the sequence of SEQ ID NOJ corresponds to the monkey FGF-20 cDNA.
  • This cDNA comprises sequences encoding the monkey FGF-20 protein (i.e., "the coding region", from nucleotides 2- 532), as well as 3' untranslated sequences (nucleotides 533-805).
  • the nucleic acid molecule can comprise only the coding region of SEQ ID NOJ (e.g., nucleotides 2-532, corresponding to SEQ ID NO:3).
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:4.
  • sequence of SEQ ID NO:4 corresponds to the predicted human FGF-20 cDNA, as identified within the Homo sapiens 12pl3 BAC RPCIl 1-388F6 genomic fragment (Accession Number AC008012) by homology searching with monkey FGF-20.
  • This cDNA comprises sequences encoding the human FGF-20 protein (i.e., "the coding region", from nucleotides 326-862), as well as 5' untranslated sequences (nucleotides 1-325) and 3' untranslated sequences (nucleotides 863-2749).
  • the nucleic acid molecule can comprise only the coding region of SEQ ID NO:4 (e.g., nucleotides 326-862, corresponding to SEQ ID NO:6).
  • an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:7.
  • the sequence of SEQ ID NO: 7 corresponds to the human FGF-20 cDNA.
  • This cDNA comprises sequences encoding the human FGF-20 protein (i.e., "the coding region", from nucleotides 1071-1604), as well as 5' untranslated sequences (nucleotides 1-1070) and 3' untranslated sequences (nucleotides 1605-1973).
  • the nucleic acid molecule can comprise only the coding region of SEQ ID NO:7 (e.g., nucleotides 1071- 1604, corresponding to SEQ ID NO:9).
  • an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of the nucleotide sequence shown in SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a portion of any of these nucleotide sequences.
  • Accession Number is one which is sufficiently complementary to the nucleotide sequence shown in SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , such that it can hybridize to the nucleotide sequence shown in SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as
  • an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 32.2%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the entire length of the nucleotide sequence shown in SEQ ID NOJ or 3, or the entire length of the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a portion of any of these nucleotide sequences.
  • an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the entire length of the nucleotide sequence shown in SEQ ID NO:4, 6, 7, or 9, or the entire length of the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or a portion of any of these nucleotide sequences.
  • the nucleic acid molecule of the invention can comprise only a portion of the nucleic acid sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , for example, a fragment which can be used as a probe or primer or a fragment encoding a portion of an FGF-20 protein, e.g., a biologically active portion of an FGF- 20 protein.
  • the nucleotide sequence determined from the cloning of the FGF-20 gene allows for the generation of probes and primers designed for use in identifying and/or cloning other FGF-20 family members, as well as FGF-20 homologues from other species.
  • the probe/primer typically comprises substantially purified oligonucleotide.
  • the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12 or 15, preferably about 20 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, or 75 consecutive nucleotides of a sense sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , of an anti-sense sequence of SEQ ID NO : 1 , 3 , 4, 6, 7 or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , or of a naturally occurring allelic variant or mutant of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • a nucleic acid molecule of the present invention comprises a nucleotide sequence which is greater than 107, 107-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, or more nucleotides in length and hybridizes under stringent hybridization conditions to a nucleic acid molecule of SEQ ID NOJ or 3, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • a nucleic acid molecule of the present invention comprises a nucleotide sequence which is greater than 1156, 1156-1200, 1200-1400, 1400-1600, 1600-1800, 1800-2000, 2000-2200, 2200-2328, 2329, 2329-2350, 2350-2400, 2400-2450, 2450- 2500, 2500-2550, 2550-2600, 2600-2650, 2650-2700, or more nucleotides in length and hybridizes under stringent hybridization conditions to a nucleic acid molecule of SEQ ID NO:4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • Probes based on the FGF-20 nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins.
  • the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
  • Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress an FGF-20 protein, such as by measuring a level of an FGF- 20-encoding nucleic acid in a sample of cells from a subject e.g., detecting FGF-20 mRNA levels or determining whether a genomic FGF-20 gene has been mutated or deleted.
  • a nucleic acid fragment encoding a "biologically active portion of an FGF-20 protein” can be prepared by isolating a portion of the nucleotide sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , which encodes a polypeptide having an FGF-20 biological activity (the biological activities of the FGF-20 proteins are described herein), expressing the encoded portion of the FGF-20 protein (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of the FGF-20 protein.
  • the invention further encompasses nucleic acid molecules that differ from the nucleotide sequence shown in SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , due to degeneracy of the genetic code and thus encode the same FGF-20 proteins as those encoded by the nucleotide sequence shown in SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO:2, 5, or 8.
  • DNA sequence polymorphisms that lead to changes in the amino acid sequences of the FGF-20 proteins may exist within a population (e.g., the human population).
  • Such genetic polymorphism in the FGF-20 genes may exist among individuals within a population due to natural allelic variation.
  • the terms “gene” and “recombinant gene” refer to nucleic acid molecules which include an open reading frame encoding an FGF-20 protein, preferably a mammalian FGF-20 protein, and can further include non-coding regulatory sequences, and introns.
  • Allelic variants of monkey and human FGF-20 include both functional and nonfunctional FGF-20 proteins.
  • Functional allelic variants are naturally occurring amino acid sequence variants of the monkey or human FGF-20 proteins that maintain the ability to bind an FGF-20 ligand or substrate and/or modulate cell proliferation and/or migration mechanisms. Functional allelic variants will typically contain only conservative substitution of one or more amino acids of SEQ ID NO:2, 5, or 8, or substitution, deletion or insertion of non-critical residues in non-critical regions of the protein.
  • Non-functional allelic variants are naturally occurring amino acid sequence variants of the monkey or human FGF-20 proteins that do not have the ability to either bind an FGF-20 ligand or substrate and/or modulate cell proliferation and/or migration mechanisms.
  • Non-functional allelic variants will typically contain a non-conservative substitution, a deletion, or insertion or premature truncation of the amino acid sequence of SEQ ID NO:2, 5, or 8, or a substitution, insertion or deletion in critical residues or critical regions.
  • the present invention further provides non-monkey and non-human orthologues of the monkey and FGF-20 proteins.
  • Orthologues of the monkey and human FGF-20 proteins are proteins that are isolated from non-monkey and non-human organisms and possess the same FGF-20 ligand binding and/or modulation of cell proliferation and/or migration mechanisms of the monkey or human FGF-20 proteins. Orthologues of the monkey or human FGF-20 proteins can readily be identified as comprising an amino acid sequence that is substantially identical to SEQ ID NO:2, 5, or 8.
  • nucleic acid molecules encoding other FGF-20 family members and, thus, which have a nucleotide sequence which differs from the FGF-20 sequences of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number are intended to be within the scope of the invention.
  • another FGF-20 cDNA can be identified based on the nucleotide sequence of monkey or human FGF-20.
  • nucleic acid molecules encoding FGF-20 proteins from different species and which, thus, have a nucleotide sequence which differs from the FGF-20 sequences of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with
  • a mouse FGF-20 cDNA can be identified based on the nucleotide sequence of a monkey or human FGF-20.
  • Nucleic acid molecules conesponding to natural allelic variants and homologues of the FGF-20 cDNAs of the invention can be isolated based on their homology to the FGF-20 nucleic acids disclosed herein using the cDNAs disclosed herein, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • Nucleic acid molecules corresponding to natural allelic variants and homologues of the FGF-20 cDNAs of the invention can further be isolated by mapping to the same chromosome or locus as the FGF-20 gene.
  • an isolated nucleic acid molecule of the invention is at least 15, 20, 25, 30 or more nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number .
  • the nucleic acid is at least 30, 50, 100, 107, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 1000, 1156, 1200, 1400, 1600, 1800, 2000, 2200, 2329, 2400, or more nucleotides in length.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% identical to each other typically remain hybridized to each other.
  • the conditions are such that sequences at least about 70%), more preferably at least about 80%, even more preferably at least about 85% or 90% identical to each other typically remain hybridized to each other.
  • stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • a preferred, non- limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50°C, preferably at 55°C, more preferably at 60°C, and even more preferably at 65°C.
  • SSC 6X sodium chloride/sodium citrate
  • 0.1% SDS 0.1% SDS at 50°C, preferably at 55°C, more preferably at 60°C, and even more preferably at 65°C.
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NOJ, 3, 4, 6, 7, or 9 conesponds to a naturally-occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
  • allelic variants of the FGF-20 sequences that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , thereby leading to changes in the amino acid sequence of the encoded FGF-20 proteins, without altering the functional ability of the FGF-20 proteins.
  • amino acid substitutions such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non- essential amino acid residues.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
  • beta-branched side chains e.g., threonine, valine, isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
  • a predicted nonessential amino acid residue in an FGF-20 protein is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of an FGF- 20 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for FGF-20 biological activity to identify mutants that retain activity. Following mutagenesis of SEQ ID NOJ, 3, 4, 6, 7, or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number , the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
  • coding region refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the coding region of monkey FGF-20 corresponds to SEQ ID NO: 3 and the coding region of human FGF-20 corcesponds to SEQ ID NO:6 or 9).
  • the antisense nucleic acid molecule is antisense to a "noncoding region" of the coding strand of a nucleotide sequence encoding FGF-20.
  • noncoding region refers to 5' and 3' sequences which flank the coding region that are not translated into amino acids (i.e., also refened to as 5' and 3' untranslated regions). Given the coding strand sequences encoding FGF-20 disclosed herein (e.g., SEQ ID NO: 3 and the coding region of human FGF-20 corcesponds to SEQ ID NO:6 or 9).
  • the antisense nucleic acid molecule is antisense to a "noncoding region" of the
  • antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of FGF-20 mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of FGF-20 mRNA.
  • the antisense oligonucleotide can be complementary to the region sirrrounding the translation start site of FGF-20 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • an antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.
  • the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
  • the antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an FGF-20 protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation.
  • antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein.
  • vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are prefened.
  • the antisense nucleic acid molecule of the invention is an ⁇ -anomeric nucleic acid molecule.
  • An ⁇ -anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641).
  • the antisense nucleic acid molecule can also comprise a 2'-o- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).
  • a ribozyme having specificity for an FGF-20-encoding nucleic acid can be designed based upon the nucleotide sequence of an FGF-20 cDNA disclosed herein (i.e., SEQ ID NOJ, 3, 4, 6, 7 or 9, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number ).
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an FGF- 20-encoding mRNA. See, e.g., Cech et al. U.S. Patent No.
  • FGF-20 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W. (1993) Science 261:1411-1418.
  • FGF-20 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the FGF-20 (e.g., the FGF-20 promoter and/or enhancers; e.g., residues 1-325 of SEQ ID NO:4 or residues 1-1070 of SEQ ID NO:7) to form triple helical structures that prevent transcription of the FGF-20 gene in target cells.
  • nucleotide sequences complementary to the regulatory region of the FGF-20 e.g., the FGF-20 promoter and/or enhancers; e.g., residues 1-325 of SEQ ID NO:4 or residues 1-1070 of SEQ ID NO:7
  • the FGF-20 promoter and/or enhancers e.g., residues 1-325 of SEQ ID NO:4 or residues 1-1070 of SEQ ID NO:7
  • the FGF-20 promoter and/or enhancers e.g., residues 1-325 of SEQ ID NO:4 or residues 1-1070 of SEQ
  • the FGF-20 nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
  • the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23).
  • peptide nucleic acids refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
  • the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
  • the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-675.
  • PNAs of FGF-20 nucleic acid molecules can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation anest or inhibiting replication.
  • PNAs of FGF-20 nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping); as 'artificial restriction enzymes' when used in combination with other enzymes, (e.g., SI nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra; Perry-O'Keefe supra).
  • PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup B. (1996) supra).
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup B. (1996) supra and Finn PJ. et al. (1996) Nucleic Acids Res. 24 (17): 3357-63.
  • a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5' end of DNA (Mag, M. et al. (1989) Nucleic Acid Res. 17: 5973-88). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn PJ. et al. (1996) supra).
  • chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser, K.H. et al. (1975) Bioorganic Med. Chem. Lett. 5: 1119-11124).
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134).
  • peptides e.g., for targeting host cell receptors in vivo
  • agents facilitating transport across the cell membrane see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Aca
  • oligonucleotides can be modified with hybridization- triggered cleavage agents (See, e.g., Krol et al. (1988) Bio-Techniques 6:958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549).
  • the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).
  • an “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the FGF-20 protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • the language “substantially free of cellular material” includes preparations of FGF-20 protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
  • the language "substantially free of cellular material” includes preparations of FGF-20 protein having less than about 30%) (by dry weight) of non-FGF-20 protein (also refened to herein as a "contaminating protein"), more preferably less than about 20%> of non-FGF-20 protein, still more preferably less than about 10% of non-FGF-20 protein, and most preferably less than about 5% non-FGF-20 protein.
  • FGF-20 protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5%> of the volume of the protein preparation.
  • a "biologically active portion" of an FGF-20 protein includes a fragment of an FGF-20 protein which participates in an interaction between an FGF-20 molecule and a non-FGF-20 molecule.
  • Biologically active portions of an FGF-20 protein include peptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the FGF-20 protein, e.g., the amino acid sequence shown in SEQ ID NO:2, 5, or 8, which include less amino acids than the full length FGF-20 proteins, and exhibit at least one activity of an FGF-20 protein.
  • biologically active portions comprise a domain or motif with at least one activity of the FGF-20 protein, e.g., modulating cell proliferation mechanisms.
  • a biologically active portion of an FGF-20 protein comprises at least one fibroblast growth factor domain, and/or at least one beta trefoil structure. It is to be understood that a preferred biologically active portion of an FGF-
  • the FGF-20 protein has an amino acid sequence shown in SEQ ID NO:2, 5, or 8.
  • the FGF-20 protein is substantially identical to SEQ ID NO:2, 5, or 8, and retains the functional activity of the protein of SEQ ID NO:2, 5, or 8, yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above.
  • the FGF-20 protein is a protein which comprises an amino acid sequence at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%), 98%) or more identical to SEQ ID NO:2, 5, or 8.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps 5 can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at
  • the length of the reference sequence e.g., when aligning a second sequence to the FGF-20 amino acid sequence of SEQ ID NO:2 having 177 amino acid residues, at least 53, preferably at least 71, more preferably at least 89, even more preferably at least 106, and even more preferably at least 124, 142 or 159 amino acid residues are aligned.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid "homology”).
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • Gapped BLAST can be utilized as described in Altschul et al, (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • the invention also provides FGF-20 chimeric or fusion proteins.
  • an FGF-20 "chimeric protein" or “fusion protein” comprises an FGF-20 polypeptide operatively linked to a non-FGF-20 polypeptide.
  • an “FGF-20 polypeptide” refers to a polypeptide having an amino acid sequence conesponding to FGF-20
  • a “non- FGF-20 polypeptide” refers to a polypeptide having an amino acid sequence conesponding to a protein which is not substantially homologous to the FGF-20 protein, e.g., a protein which is different from the FGF-20 protein and which is derived from the same or a different organism.
  • the FGF-20 polypeptide can conespond to all or a portion of an FGF-20 protein.
  • an FGF-20 fusion protein comprises at least one biologically active portion of an FGF-20 protein.
  • the FGF-20 fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject in vivo.
  • the FGF-20 fusion proteins can be used to affect the bioavailability of an FGF-20 substrate.
  • Use of FGF-20 fusion proteins may be useful therapeutically for the treatment of disorders caused by, for example, (i) abenant modification or mutation of a gene encoding an FGF- 20 protein; (ii) mis-regulation of the FGF-20 gene; and (iii) abenant post-translational modification of an FGF-20 protein.
  • the FGF-20-fusion proteins of the invention can be used as immunogens to produce anti-FGF-20 antibodies in a subject, to purify FGF-20 ligands and in screening assays to identify molecules which inhibit the interaction of FGF-20 with an FGF-20 substrate.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
  • An FGF-20- encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the FGF-20 protein.
  • the present invention also pertains to variants of the FGF-20 proteins which function as either FGF-20 agonists (mimetics) or as FGF-20 antagonists.
  • Variants of the FGF-20 proteins can be generated by mutagenesis, e.g., discrete point mutation or truncation of an FGF-20 protein.
  • An agonist of the FGF-20 proteins can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of an FGF-20 protein.
  • An antagonist of an FGF-20 protein can inhibit one or more of the activities of the naturally occurring form of the FGF-20 protein by, for example, competitively modulating an FGF-20-mediated activity of an FGF-20 protein.
  • specific biological effects can be elicited by treatment with a variant of limited function.
  • treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the FGF-20 protein.
  • variants of an FGF-20 protein which function as either FGF-
  • agonists or as FGF-20 antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of an FGF-20 protein for FGF-20 protein agonist or antagonist activity.
  • a variegated library of FGF-20 variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library.
  • a variegated library of FGF-20 variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential FGF-20 sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of FGF-20 sequences therein.
  • a degenerate set of potential FGF-20 sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of FGF-20 sequences therein.
  • libraries of fragments of an FGF-20 protein coding sequence can be used to generate a variegated population of FGF-20 fragments for screening and subsequent selection of variants of an FGF-20 protein.
  • a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an FGF-20 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S 1 nuclease, and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the FGF-20 protein.
  • Recrusive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify FGF-20 variants (Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 59:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331 ).
  • cell based assays can be exploited to analyze a variegated FGF-20 library.
  • a library of expression vectors can be transfected into a cell line, e.g., an endothelial cell line, which ordinarily responds to FGF-20 in a particular FGF-20 substrate-dependent manner.
  • the transfected cells are then contacted with FGF-20 and the effect of expression of the mutant on signaling by the FGF-20 substrate can be detected, e.g., by monitoring intracellular calcium, IP3, or diacylglycerol concentration, phosphorylation profile of intracellular proteins, cell proliferation and/or migration, or the activity of an FGF-20-regulated transcription factor.
  • Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of signaling by the FGF-20 substrate, and the individual clones further characterized.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as FGF-20.
  • immunologically active portions of immunoglobulin molecules include F(ab) and F(ab')2 fragments which can be generated by treating the antibody with an enzyme such as pepsin.
  • the invention provides polyclonal and monoclonal antibodies that bind FGF-20.
  • monoclonal antibody or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of FGF-20.
  • a monoclonal antibody composition thus typically displays a single binding affinity for a particular FGF-20 protein with which it immunoreacts.
  • Polyclonal anti-FGF-20 antibodies can be prepared as described above by immunizing a suitable subject with an FGF-20 immunogen. The anti-FGF-20 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized FGF-20.
  • ELISA enzyme linked immunosorbent assay
  • the immortal cell line e.g., a myeloma cell line
  • the immortal cell line is derived from the same mammalian species as the lymphocytes.
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line.
  • Prefened immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine.
  • Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and improductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
  • Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supematants for antibodies that bind FGF-20, e.g., using a standard ELISA assay.
  • a monoclonal anti-FGF-20 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with FGF-20 to thereby isolate immunoglobulin library members that bind FGF- 20.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01 ; and the Stratagene SurfZAPTM Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al.
  • recombinant anti-FGF-20 antibodies such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention.
  • Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184, 187; Taniguchi, M., European Patent Application 171 ,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No.
  • Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ -galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I,
  • vectors e.g., non-episomal mammalian vectors
  • Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively linked.
  • Such vectors are refened to herein as "expression vectors".
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and vector can be used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno- associated viruses), which serve equivalent functions.
  • the recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
  • operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein.
  • Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • the FGF-20 expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerivisae include pYepSecl (Baldari, et al, (1987) Embo J.
  • FGF-20 proteins can be expressed in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al. (1983) Mol. Cell Biol.
  • a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBOJ. 6:187-195).
  • the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovims and Simian Vims 40.
  • the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al.
  • mammary gland-specific promoters e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264, 166.
  • Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Grass (1990) Science 249:374-379) and the ⁇ -fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).
  • a transcriptionally silent, endogenous FGF-20 gene may be activated by insertion of a promiscuous regulatory element that works across cell types.
  • a heterologous regulatory element may be inserted into a stable cell line or cloned microorganism, such that it is operatively linked with an endogenous FGF-20 gene, using techniques, such as targeted homologous recombination, which are well known to those of skill in the art, and described, e.g., in Chappel, U.S. Patent No. 5,272,071; PCT publication No. WO 91/06667, published May 16, 1991.
  • the invention further provides a recombinant expression vector comprising a
  • DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to FGF-20 mRNA.
  • Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • an FGF-20 protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
  • bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells).
  • mammalian cells such as Chinese hamster ovary cells (CHO) or COS cells.
  • Other suitable host cells are known to those skilled in the art.
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, D ⁇ A ⁇ -dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.
  • a host cell of the invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) an FGF-20 protein.
  • the invention further provides methods for producing an FGF-20 protein using the host cells of the invention.
  • the method comprises culturing the host cell of the invention (into which a recombinant expression vector encoding an FGF-20 protein has been introduced) in a suitable medium such that an FGF-20 protein is produced.
  • the method further comprises isolating an FGF-20 protein from the medium or the host cell.
  • the host cells of the invention can also be used to produce non-human transgenic animals.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which FGF-20-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous FGF-20 sequences have been introduced into their genome or homologous recombinant animals in which endogenous FGF-20 sequences have been altered. Such animals are useful for studying the function and/or activity of an FGF-20 and for identifying and/or evaluating modulators of FGF-20 activity.
  • a "transgenic animal” is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene.
  • transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like.
  • a transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous FGF-20 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • a transgenic animal of the invention can be created by introducing an FGF-20- encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • the FGF-20 cDNA sequence of SEQ ID NO: 1 , 4, or 7 can be introduced as a transgene into the genome of a non-human animal.
  • a nonhuman homologue of a human FGF-20 gene such as a mouse or rat FGF-20 gene, can be used as a transgene.
  • FGF-20 transgene to direct expression of an FGF-20 protein to particular cells.
  • Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Patent No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals.
  • a vector which contains at least a portion of an FGF-20 gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrapt, the FGF-20 gene.
  • the FGF- 20 gene can be a monkey gene (e.g., the cDNA of SEQ ID NO:3) or a human gene (e.g., the cDNA of SEQ ID NO:6 or 9), but more preferably, is a non-human homologue of a monkey or human FGF-20 gene (e.g., a cDNA isolated by stringent hybridization with the nucleotide sequence of SEQ ID NOJ, 4, or 7).
  • a mouse FGF-20 gene can be used to construct a homologous recombination nucleic acid molecule, e.g., a vector, suitable for altering an endogenous FGF-20 gene in the mouse genome.
  • a homologous recombination nucleic acid molecule e.g., a vector
  • the homologous recombination nucleic acid molecule is designed such that, upon homologous recombination, the endogenous FGF-20 gene is functionally disrupted (i.e., no longer encodes a functional protein; also refened to as a "knock out" vector).
  • the homologous recombination nucleic acid molecule can be designed such that, upon homologous recombination, the endogenous FGF-20 gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous FGF-20 protein).
  • homologous recombination nucleic acid molecule typically, several kilobases of flanking DNA (both at the 5' and 3' ends) are included in the homologous recombination nucleic acid molecule (see, e.g., Thomas, K.R. and Capecchi, M. R. (1987) Cell 51:503 for a description of homologous recombination vectors).
  • the homologous recombination nucleic acid molecule is introduced into a cell, e.g., an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced FGF-20 gene has homologously recombined with the endogenous FGF-20 gene are selected (see e.g., Li, E. et al.
  • the selected cells can then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.
  • homologous recombination nucleic acid molecules e.g., vectors, or homologous recombinant animals are described further in Bradley, A. (1991) Current Opinion in Biotechnology 2:823-829 and in PCT International Publication Nos.: WO 90/11354 by Le Mouellec et al; WO 91/01140 by Smithies et al; WO 92/0968 by Zijlstra et al; and WO 93/04169 by Berns et al.
  • transgenic non-human animals can be produced which contain selected systems which allow for regulated expression of the transgene.
  • a system is the cre/loxP recombinase system of bacteriophage P 1.
  • Cre/loxP recombinase system of bacteriophage P 1.
  • FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355.
  • a cre/loxP recombinase system is used to regulate expression of the transgene
  • animals containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the constmction of "double" transgenic animals, e.g., by mating two transgenic animals,- one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385:810-813 and PCT International Publication Nos.
  • a cell e.g., a somatic cell
  • the quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
  • the reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transfened to pseudopregnant female foster animal.
  • the offspring bome ofthis female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated.
  • FGF-20 antibodies (also refened to herein as "active compounds") of the invention can be incorporated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of admimstration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • chelating agents such as ethylenediaminetetraacetic acid
  • buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • phrases suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a fragment of an FGF-20 protein or an anti-FGF-20 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the active compound e.g., a fragment of an FGF-20 protein or an anti-FGF-20 antibody
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the prefened methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic admimstration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical canier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50%> of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Compounds which exhibit large therapeutic indices are prefened. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • a therapeutically effective amount of protein or polypeptide ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0J to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
  • an effective dosage ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0J to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
  • treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or, preferably, can include a series of treatments.
  • a subject is treated with antibody, protein, or polypeptide in the range of between about 0J to 20 mg/kg body weight, one time per week for between about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks.
  • the effective dosage of antibody, protein, or polypeptide used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays as described herein.
  • heteroorganic and organometallic compounds having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. It is understood that appropriate doses of small molecule agents depends upon a number of factors within the ken of the ordinarily skilled physician, veterinarian, or researcher.
  • the dose(s) of the small molecule will vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the small molecule to have upon the nucleic acid or polypeptide of the invention.
  • Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxombicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
  • the conjugates of the invention can be used for modifying a given biological response, the drag moiety is not to be constmed as limited to classical chemical therapeutic agents.
  • the drag moiety may be a protein or polypeptide possessing a desired biological activity.
  • proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, .alpha.-interferon, .beta.
  • IL-1 interleukin-1
  • IL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophase colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980.
  • the nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors.
  • Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Patent 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3054- 3057).
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • compositions can be included in a container, pack, or dispenser together with instmctions for administration.
  • nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in one or more of the following methods: a) screening assays; b) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenetics); and c) methods of treatment (e.g., therapeutic and prophylactic).
  • the isolated nucleic acid molecules of the invention can be used, for example, to express FGF-20 protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect FGF-20 mRNA (e.g., in a biological sample) or a genetic alteration in an FGF-20 gene, and to modulate FGF-20 activity, as described further below.
  • FGF-20 proteins can be used to treat disorders characterized by insufficient or excessive production of an FGF-20 substrate or production of FGF-20 inhibitors.
  • the invention provides assays for screening candidate or test compounds which are substrates of an FGF-20 protein or polypeptide or biologically active portion thereof. In another embodiment, the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of an FGF-20 protein or polypeptide or biologically active portion thereof.
  • the test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. (1997) Anticancer Drug Des. 12:145).
  • Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Canell et al.
  • an assay is a cell-based assay in which a cell which expresses an FGF-20 protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate FGF-20 activity is determined. Determining the ability of the test compound to modulate FGF-20 activity can be accomplished by monitoring, for example, intracellular calcium, IP3, or diacylglycerol concentration, phosphorylation profile of intracellular proteins, cell proliferation and/or migration, or the activity of an FGF-20-regulated transcription factor.
  • the cell for example, can be of mammalian origin, e.g., an endothelial cell.
  • the ability of the test compound to modulate FGF-20 binding to a substrate or to bind to FGF-20 can also be determined. Determining the ability of the test compound to modulate FGF-20 binding to a substrate can be accomplished, for example, by coupling the FGF-20 substrate with a radioisotope or enzymatic label such that binding of the FGF-20 substrate to FGF-20 can be determined by detecting the labeled FGF-20 substrate in a complex. Alternatively, FGF-20 could be coupled with a radioisotope or enzymatic label to monitor the ability of a test compound to modulate FGF-20 binding to a FGF-20 substrate in a complex.
  • Determining the ability of the test compound to bind FGF-20 can be accomplished, for example, by coupling the compound with a radioisotope or enzymatic label such that binding of the compound to FGF-20 can be determined by detecting the labeled FGF-20 compound in a complex.
  • a radioisotope or enzymatic label such that binding of the compound to FGF-20 can be determined by detecting the labeled FGF-20 compound in a complex.
  • compounds e.g., FGF-20 substrates
  • the radioisotope detected by direct counting of radioemmission or by scintillation counting can be accomplished, for example, by coupling the compound with a radioisotope or enzymatic label such that binding of the compound to FGF-20 can be determined by detecting the labeled FGF-20 compound in a complex.
  • compounds e.g., FGF-20 substrates
  • the radioisotope detected by direct counting of radioemmission or by scintillation counting can be direct counting of radioe
  • compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • a microphysiometer can be used to detect the interaction of a compound with FGF-20 without the labeling of either the compound or the FGF-20. McConnell, H. M. et al. (1992) Science 257:1906-1912.
  • a "microphysiometer” e.g., Cytosensor
  • LAPS light-addressable potentiometric sensor
  • an assay is a cell-based assay comprising contacting a cell expressing an FGF-20 target molecule (e.g., an FGF-20 substrate) with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the FGF-20 target molecule. Determining the ability of the test compound to modulate the activity of an FGF-20 target molecule can be accomplished, for example, by determining the ability of the FGF-20 protein to bind to or interact with the FGF-20 target molecule.
  • an FGF-20 target molecule e.g., an FGF-20 substrate
  • Determining the ability of the test compound to modulate the activity of an FGF-20 target molecule can be accomplished, for example, by determining the ability of the FGF-20 protein to bind to or interact with the FGF-20 target molecule.
  • an assay of the present invention is a cell-free assay in which an FGF-20 protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the FGF-20 protein or biologically active portion thereof is determined.
  • Prefened biologically active portions of the FGF-20 proteins to be used in assays of the present invention include fragments which participate in interactions with non-FGF-20 molecules, e.g., fragments with high surface probability scores (see, for example, Figures 2 and 13). Binding of the test compound to the FGF-20 protein can be determined either directly or indirectly as described above.
  • the assay includes contacting the FGF-20 protein or biologically active portion thereof with a known compound which binds FGF- 20 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an FGF-20 protein, wherein determining the ability of the test compound to interact with an FGF-20 protein comprises determining the ability of the test compound to preferentially bind to FGF-20 or biologically active portion thereof as compared to the known compound.
  • the assay is a cell-free assay in which an FGF-20 protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the FGF-20 protein or biologically active portion thereof is determined.
  • Determining the ability of the test compound to modulate the activity of an FGF-20 protein can be accomplished, for example, by determining the ability of the FGF-20 protein to bind to an FGF-20 target molecule by one of the methods described above for determining direct binding. Determining the ability of the FGF-20 protein to bind to an FGF-20 target molecule can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA). Sjolander, S.
  • BIOS Biomolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • determining the ability of the test compound to modulate the activity of an FGF-20 protein can be accomplished by determining the ability of the FGF-20 protein to further modulate the activity of a downstream effector of an FGF-20 target molecule. For example, the activity of the effector molecule on an appropriate target can be determined or the binding of the effector to an appropriate target can be determined as previously described.
  • binding of a test compound to an FGF-20 protein, or interaction of an FGF-20 protein with a target molecule in the presence and absence of a candidate compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix.
  • an FGF-20 protein or an FGF-20 target molecule can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated FGF-20 protein or target molecules can be prepared from biotin-NHS (N- hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies reactive with FGF-20 protein or target molecules but which do not interfere with binding of the FGF-20 protein to its target molecule can be derivatized to the wells of the plate, and unbound target or FGF- 20 protein trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the FGF-20 protein or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the FGF-20 protein or target molecule.
  • modulators of FGF-20 expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of FGF-20 mRNA or protein in the cell is determined. The level of expression of FGF-20 mRNA or protein in the presence of the candidate compound is compared to the level of expression of FGF-20 mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of FGF-20 expression based on this comparison. For example, when expression of FGF-20 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of FGF-20 mRNA or protein expression.
  • FGF-20-binding proteins proteins which bind to or interact with FGF-20
  • FGF-20-binding proteins proteins which bind to or interact with FGF-20
  • FGF-20-binding proteins are also likely to be involved in the propagation of signals by the FGF-20 proteins or FGF-20 targets as, for example, downstream elements of an FGF-20-mediated signaling pathway.
  • FGF-20-binding proteins are likely to be FGF-20 inhibitors.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • the gene that codes for an FGF-20 protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4).
  • a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey" or "sample” is fused to a gene that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the FGF-20 protein.
  • a reporter gene e.g., LacZ
  • Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the FGF-20 protein.
  • the invention pertains to a combination of two or more of the assays described herein.
  • an agent identified as described herein e.g., an FGF-20 modulating agent, an antisense FGF-20 nucleic acid molecule, an FGF-20-specific antibody, or an FGF-20-binding partner
  • an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • cDNA sequences identified herein can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. These applications are described in the subsections below.
  • this sequence can be used to map the location of the gene on a chromosome.
  • This process is called chromosome mapping.
  • portions or fragments of the FGF-20 nucleotide sequences, described herein can be used to map the location of the FGF-20 genes on a chromosome.
  • the mapping of the FGF-20 sequences to chromosomes is an important first step in conelating these sequences with genes associated with disease. Briefly, FGF-20 genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the FGF-20 nucleotide sequences.
  • Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose human chromosomes in random order, but retain the mouse chromosomes.
  • each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. (D'Eustachio P. et al. (1983) Science 220:919-924). Somatic cell hybrids containing only fragments of human chromosomes can also be produced by using human chromosomes with translocations and deletions.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the FGF-20 nucleotide sequences to design oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes. Other mapping strategies which can similarly be used to map an FGF-20 sequence to its chromosome include in situ hybridization (described in Fan, Y. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6223-27), pre- screening with labeled flow-sorted chromosomes, and pre-selection by hybridization to chromosome specific cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step.
  • Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical such as colcemid that disrupts the mitotic spindle.
  • the chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually.
  • the FISH technique can be used with a DNA sequence as short as 500 or 600 bases.
  • clones larger than 1 ,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • 1,000 bases, and more preferably 2,000 bases will suffice to get good results at a reasonable amount of time.
  • Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents conesponding to noncoding regions of the genes actually are prefened for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.
  • differences in the DNA sequences between individuals affected and unaffected with a disease associated with the FGF-20 gene can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms.
  • the FGF-20 sequences of the present invention can also be used to identify individuals from minute biological samples.
  • the United States military for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymorphism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification.
  • This method does not suffer from the cunent limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the sequences of the present invention are useful as additional DNA markers for RFLP (described in U.S. Patent 5,272,057).
  • sequences of the present invention can be used to provide an alternative technique which determines the actual base-by-base DNA sequence of selected portions of an individual's genome.
  • the FGF-20 nucleotide sequences described herein can be used to prepare two PCR primers from the 5' and 3' ends of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it. Panels of conesponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences.
  • the sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue.
  • the FGF-20 nucleotide sequences of the invention uniquely represent portions of the human genome.
  • allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases.
  • Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification pu ⁇ oses. Because greater numbers of polymo ⁇ hisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals.
  • the noncoding sequences of SEQ ID NOJ, 4 or 7 can comfortably provide positive individual identification with a panel of perhaps 10 to 1,000 primers which each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ ID NO:3, 6 or 9 are used, a more appropriate number of primers for positive individual identification would be 500-2,000.
  • DNA-based identification techniques can also be used in forensic biology. Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a pe ⁇ etrator of a crime.
  • PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, or semen found at a crime scene. The amplified sequence can then be compared to a standard, thereby allowing identification of the origin of the biological sample.
  • sequences of the present invention can be used to provide polynucleotide reagents, e.g., PCR primers, targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another "identification marker" (i.e. another DNA sequence that is unique to a particular individual).
  • an "identification marker” i.e. another DNA sequence that is unique to a particular individual.
  • actual base sequence information can be used for identification as an accurate alternative to patterns formed by restriction enzyme generated fragments.
  • Sequences targeted to noncoding regions of SEQ ID NOJ, 4, or 7 are particularly appropriate for this use as greater numbers of polymo ⁇ hisms occur in the noncoding regions, making it easier to differentiate individuals using this technique.
  • polynucleotide reagents include the FGF-20 nucleotide sequences or portions thereof, e.g., fragments derived from the noncoding regions of SEQ ID NO: 1 , 4, or 7, having a length of at least 20 bases, preferably at least 30 bases.
  • the FGF-20 nucleotide sequences described herein can further be used to provide polynucleotide reagents, e.g., labeled or labelable probes which can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such FGF-20 probes can be used to identify tissue by species and/or by organ type.
  • polynucleotide reagents e.g., labeled or labelable probes which can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such FGF-20 probes can be used to identify tissue by species and/or by organ type.
  • these reagents e.g., FGF-20 primers or probes can be used to screen tissue culture for contamination (i.e. screen for the presence of a mixture of different types of cells in a culture).
  • FGF-20 primers or probes can be used to screen tissue culture for contamination (i.e. screen for the presence of a mixture of different types of cells in a culture).
  • the present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) pu ⁇ oses to thereby treat an individual prophylactically.
  • diagnostic assays for determining FGF-20 protein and/or nucleic acid expression as well as FGF-20 activity, in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant or unwanted FGF-20 expression or activity.
  • a biological sample e.g., blood, serum, cells, tissue
  • the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with FGF-20 protein, nucleic acid expression or activity. For example, mutations in an FGF- 20 gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive pu ⁇ ose to thereby prophylactically treat an individual prior to the onset of a disorder characterized by or associated with FGF-20 protein, nucleic acid expression or activity.
  • Another aspect of the invention pertains to monitoring the influence of agents (e.g., drags, compounds) on the expression or activity of FGF-20 in clinical trials.
  • agents e.g., drags, compounds
  • An exemplary method for detecting the presence or absence of FGF-20 protein or nucleic acid in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting FGF-20 protein or nucleic acid (e.g., mRNA, or genomic DNA) that encodes FGF-20 protein such that the presence of FGF-20 protein or nucleic acid is detected in the biological sample.
  • a prefened agent for detecting FGF-20 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to FGF-20 mRNA or genomic DNA.
  • the nucleic acid probe can be, for example, the FGF-20 nucleic acid set forth in SEQ ID NO: 1 , 3, 4, 6, 7, or 9, or the DNA insert of the plasmid deposited with ATCC as
  • probes for use in the diagnostic assays of the invention are described herein.
  • a prefened agent for detecting FGF-20 protein is an antibody capable of binding to FGF-20 protein, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) can be used.
  • the term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled.
  • Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin.
  • biological sample is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect FGF-20 mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo.
  • in vitro techniques for detection of FGF-20 mRNA include Northern hybridizations and in situ hybridizations.
  • In vitro techniques for detection of FGF-20 protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • In vitro techniques for detection of FGF-20 genomic DNA include Southern hybridizations.
  • in vivo techniques for detection of FGF- 20 protein include introducing into a subject a labeled anti-FGF-20 antibody.
  • the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
  • the biological sample contains protein molecules from the test subject.
  • the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
  • a prefened biological sample is a serum sample isolated by conventional means from a subject.
  • the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting FGF-20 protein, mRNA, or genomic DNA, such that the presence of FGF-20 protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of FGF-20 protein, mRNA or genomic DNA in the control sample with the presence of FGF-20 protein, mRNA or genomic DNA in the test sample.
  • kits for detecting the presence of FGF-20 in a biological sample can comprise a labeled compound or agent capable of detecting FGF-20 protein or mRNA in a biological sample; means for determining the amount of FGF-20 in the sample; and means for comparing the amount of FGF-20 in the sample with a standard.
  • the compound or agent can be packaged in a suitable container.
  • the kit can further comprise instructions for using the kit to detect FGF-20 protein or nucleic acid.
  • the diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a disease or disorder associated with abenant or unwanted FGF-20 expression or activity.
  • the term "abenant” includes an FGF-20 expression or activity which deviates from the wild type FGF-20 expression or activity.
  • Abenant expression or activity includes increased or decreased expression or activity, as well as expression or activity which does not follow the wild type developmental pattern of expression or the subcellular pattern of expression.
  • abenant FGF-20 expression or activity is intended to include the cases in which a mutation in the FGF-20 gene causes the FGF-20 gene to be under-expressed or over-expressed and situations in which such mutations result in a non-functional FGF-20 protein or a protein which does not function in a wild-type fashion, e.g., a protein which does not interact with an FGF-20 substrate, e.g., a FGF receptor or heparan sulfate proteoglycan, or one which interacts with a non-FGF-20 substrate, e.g. a non-FGF receptor or heparan sulfate proteoglycan.
  • the term "unwanted” includes an unwanted phenomenon involved in a biological response such as cellular proliferation.
  • the term unwanted includes an FGF-20 expression or activity which is undesirable in a subject.
  • the assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation in FGF-20 protein activity or nucleic acid expression, such as a proliferative disorder, a differentiative disorder, a pain disorder, or a cardiovascular disorder.
  • the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation in FGF-20 protein activity or nucleic acid expression, such as a proliferative disorder.
  • the present invention provides a method for identifying a disease or disorder associated with abenant or unwanted FGF-20 expression or activity in which a test sample is obtained from a subject and FGF-20 protein or nucleic acid (e.g., mRNA or genomic DNA) is detected, wherein the presence of FGF-20 protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with abenant or unwanted FGF-20 expression or activity.
  • a test sample refers to a biological sample obtained from a subject of interest.
  • a test sample can be a biological fluid (e.g., serum), cell sample, or tissue.
  • the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drag candidate) to treat a disease or disorder associated with abenant or unwanted FGF-20 expression or activity.
  • an agent e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drag candidate
  • such methods can be used to determine whether a subject can be effectively treated with an agent for a proliferative disorder, a differentiative disorder, or a pain disorder.
  • the present invention provides methods for determining whether a subject can be effectively treated with an agent for a disorder associated with abenant or unwanted FGF-20 expression or activity in which a test sample is obtained and FGF-20 protein or nucleic acid expression or activity is detected (e.g., wherein the abundance of FGF-20 protein or nucleic acid expression or activity is diagnostic for a subject that can be administered the agent to treat a disorder associated with abenant or unwanted FGF- 20 expression or activity).
  • the methods of the invention can also be used to detect genetic alterations in an FGF-20 gene, thereby determining if a subject with the altered gene is at risk for a disorder characterized by misregulation in FGF-20 protein activity or nucleic acid expression, such as a proliferative disorder.
  • the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic alteration characterized by at least one of an alteration affecting the integrity of a gene encoding an FGF-20-protein, or the mis-expression of the FGF-20 gene.
  • such genetic alterations can be detected by ascertaining the existence of at least one of 1) a deletion of one or more nucleotides from an FGF-20 gene; 2) an addition of one or more nucleotides to an FGF-20 gene; 3) a substitution of one or more nucleotides of an FGF-20 gene, 4) a chromosomal rearrangement of an FGF-20 gene; 5) an alteration in the level of a messenger RNA transcript of an FGF-20 gene, 6) abenant modification of an FGF-20 gene, such as of the methylation pattern of the genomic DNA, 7) the presence of a non- wild type splicing pattern of a messenger RNA transcript of an FGF-20 gene, 8) a non-wild type level of an FGF-20-protein, 9) allelic loss of an FGF-20 gene, and 10) inappropriate post-translational modification of an FGF-20- protein.
  • assays known in the art which can be used for detecting alterations in an FGF-20 gene.
  • This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to an FGF-20 gene under conditions such that hybridization and amplification of the FGF-20-gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • nucleic acid e.g., genomic, mRNA or both
  • Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al, (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al, ( 1989) Proc. Natl. Acad. Sci. USA 86: 1173- 1177), Q-Beta Replicase (Lizardi, P.M. et al. (1988) Bio-Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
  • mutations in an FGF-20 gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.
  • sequence specific ribozymes see, for example, U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • genetic mutations in FGF-20 can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density anays containing hundreds or thousands of oligonucleotides probes (Cronin, M.T. et al. (1996) Human Mutation 1: 244-255; Kozal, MJ. et al. (1996) N ⁇ twre Medicine 2: 753- 759).
  • genetic mutations in FGF-20 can be identified in two dimensional anays containing light-generated D ⁇ A probes as described in Cronin, M.T. et al. supra.
  • a first hybridization anay of probes can be used to scan through long stretches of D ⁇ A in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected.
  • Each mutation anay is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the FGF-20 gene and detect mutations by comparing the sequence of the sample FGF-20 with the conesponding wild-type (control) sequence.
  • sequencing reactions include those based on techniques developed by Maxam and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA 74:5463). It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and Griffin et al. (1993) Appl Biochem. Biotechnol. 38 : 147- 159).
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al. (1992) Methods Enzymol. 217:286-295.
  • the control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in FGF-20 cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • a probe based on an FGF-20 sequence e.g., a wild-type FGF-20 sequence
  • a cDNA or other DNA product from a test cell(s).
  • the duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility will be used to identify mutations in FGF-20 genes.
  • single strand conformation polymo ⁇ hism may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (orita et al. (1989) Proc Natl. Acad. Sci USA: 86:2766, see also Cotton (1993) Mutat. Res. 285:125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79).
  • Single-stranded DNA fragments of sample and control FGF-20 nucleic acids will be denatured and allowed to renature.
  • the secondary stmcture of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labeled or detected with labeled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary stmcture is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).
  • DGGE denaturing gradient gel electrophoresis
  • DGGE DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265: 12753).
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al. (1989) Proc. Natl Acad. Sci USA 86:6230).
  • Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238).
  • amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • the methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving an FGF- 20 gene.
  • any cell type or tissue in which FGF-20 is expressed may be utilized in the prognostic assays described herein.
  • Monitoring the influence of agents (e.g., drags) on the expression or activity of an FGF-20 protein can be applied not only in basic drag screening, but also in clinical trials.
  • agents e.g., drags
  • the effectiveness of an agent determined by a screening assay as described herein to increase FGF-20 gene expression, protein levels, or upregulate FGF-20 activity can be monitored in clinical trials of subjects exhibiting decreased FGF-20 gene expression, protein levels, or downregulated FGF-20 activity.
  • the effectiveness of an agent determined by a screening assay to decrease FGF-20 gene expression, protein levels, or downregulate FGF-20 activity can be monitored in clinical trials of subjects exhibiting increased FGF-20 gene expression, protein levels, or upregulated FGF-20 activity.
  • an FGF-20 gene and preferably, other genes that have been implicated in, for example, an FGF-20-associated disorder can be used as a "read out" or markers of the phenotype of a particular cell.
  • genes, including FGF-20 that are modulated in cells by treatment with an agent (e.g., compound, drag or small molecule) which modulates FGF-20 activity (e.g., identified in a screening assay as described herein) can be identified.
  • cells can be isolated and RNA prepared and analyzed for the levels of expression of FGF-20 and other genes implicated in the FGF- 20-associated disorder, respectively.
  • the levels of gene expression e.g., a gene expression pattern
  • the levels of gene expression can be quantified by northern blot analysis or RT-PCR, as described herein, or alternatively by measuring the amount of protein produced, by one of the methods as described herein, or by measuring the levels of activity of FGF-20 or other genes.
  • the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before, and at various points during treatment of the individual with the agent.
  • the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drag candidate identified by the screening assays described herein) including the steps of (i) obtaining a pre-administration sample from a subject prior to administration of the agent; (ii) detecting the level of expression of an FGF-20 protein, mRNA, or genomic DNA in the preadministration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the FGF-20 protein, mRNA, or genomic DNA in the post-administration samples; (v) comparing the level of expression or activity of the FGF-20 protein, mRNA, or genomic DNA in the pre-administration sample with the FGF-20 protein, mRNA, or genomic DNA in the post administration sample or samples; and (vi) altering the administration of the agent to the subject accordingly.
  • an agent e.g.
  • increased administration of the agent may be desirable to increase the expression or activity of FGF-20 to higher levels than detected, i.e., to increase the effectiveness of the agent.
  • decreased administration of the agent may be desirable to decrease expression or activity of FGF-20 to lower levels than detected, i.e. to decrease the effectiveness of the agent.
  • FGF-20 expression or activity may be used as an indicator of the effectiveness of an agent, even in the absence of an observable phenotypic response.
  • the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted FGF-20 expression or activity, e.g. a proliferative disorder, a differentiative disorder, a pain disorder.
  • a proliferative disorder e.g. a proliferative disorder, a differentiative disorder, a pain disorder.
  • a pain disorder e.g. a proliferative disorder, a differentiative disorder, a pain disorder.
  • such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.
  • “Pharmacogenomics” refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drags in clinical development and on the market.
  • the term refers the study of how a patient's genes determine his or her response to a drag (e.g., a patient's "drag response phenotype", or "drug response genotype”.)
  • a drag response genotype e.g., a patient's "drag response phenotype", or "drug response genotype”.
  • another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the FGF-20 molecules of the present invention or FGF-20 modulators according to that individual's drag response genotype.
  • Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drag-related side effects. 1.
  • the invention provides a method for preventing in a subject, a disease or condition associated with an abenant or unwanted FGF-20 expression or activity, by administering to the subject an FGF-20 or an agent which modulates FGF- 20 expression or at least one FGF-20 activity.
  • Subjects at risk for a disease which is caused or contributed to by aberrant or unwanted FGF-20 expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the FGF-20 abenancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
  • an FGF-20, FGF-20 agonist or FGF-20 antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.
  • the modulatory method of the invention involves contacting a cell with an FGF-20 or agent that modulates one or more of the activities of FGF-20 protein activity associated with the cell.
  • An agent that modulates FGF-20 protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring target molecule of an FGF-20 protein (e.g., an FGF-20 substrate), an FGF-20 antibody, an FGF-20 agonist or antagonist, a peptidomimetic of an FGF-20 agonist or antagonist, or other small molecule.
  • the agent stimulates one or more FGF-20 activities.
  • stimulatory agents include active FGF-20 protein and a nucleic acid molecule encoding FGF-20 that has been introduced into the cell.
  • the agent inhibits one or more FGF-20 activities.
  • inhibitory agents include antisense FGF-20 nucleic acid molecules, anti-FGF-20 antibodies, and FGF-20 inhibitors.
  • the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that modulates (e.g., upregulates or downregulates) FGF-20 expression or activity.
  • an agent e.g., an agent identified by a screening assay described herein
  • the method involves administering an FGF-20 protein or nucleic acid molecule as therapy to compensate for reduced, abenant, or unwanted FGF-20 expression or activity.
  • Stimulation of FGF-20 activity is desirable in situations in which FGF-20 is abnormally downregulated and/or in which increased FGF-20 activity is likely to have a beneficial effect.
  • inhibition of FGF-20 activity is desirable in situations in which FGF-20 is abnormally upregulated and/or in which decreased FGF-20 activity is likely to have a beneficial effect.
  • FGF-20 molecules of the present invention as well as agents, or modulators which have a stimulatory or inhibitory effect on FGF-20 activity (e.g., FGF-20 gene expression) as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) FGF-20-associated disorders (e.g., proliferative disorders) associated with aberrant or unwanted FGF-20 activity.
  • FGF-20-associated disorders e.g., proliferative disorders
  • pharmacogenomics i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drag
  • Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drag.
  • a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer an FGF-20 molecule or FGF-20 modulator as well as tailoring the dosage and/or therapeutic regimen of treatment with an FGF-20 molecule or FGF-20 modulator.
  • Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drag disposition and abnormal action in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol 23(10-11): 983-985 and Linder, M.W. et al. (1997) Clin. Chem. 43(2):254-266.
  • two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drags act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drags (altered drag metabolism). These pharmacogenetic conditions can occur either as rare genetic defects or as naturally-occurring polymo ⁇ hisms.
  • G6PD glucose-6-phosphate dehydrogenase deficiency
  • oxidant drags anti-malarials, sulfonamides, analgesics, nitrofurans
  • a genome-wide association relies primarily on a high-resolution map of the human genome consisting of already known gene-related markers (e.g., a "bi-allelic” gene marker map which consists of 60,000-100,000 polymo ⁇ hic or variable sites on the human genome, each of which has two variants.)
  • gene-related markers e.g., a "bi-allelic” gene marker map which consists of 60,000-100,000 polymo ⁇ hic or variable sites on the human genome, each of which has two variants.
  • Such a high-resolution genetic map can be compared to a map of the genome of each of a statistically significant number of patients taking part in a Phase II/III drag trial to identify markers associated with a particular observed drug response or side effect.
  • such a high resolution map can be generated from a combination of some ten-million known single nucleotide polymo ⁇ hisms (SNPs) in the human genome.
  • SNPs single nucleotide polymo ⁇ hisms
  • a "SNP" is a common alteration that occurs in a single nucleotide base in a stretch of
  • a SNP may occur once per every 1000 bases of DNA.
  • a SNP may be involved in a disease process, however, the vast majority may not be disease- associated.
  • individuals Given a genetic map based on the occunence of such SNPs, individuals can be grouped into genetic categories depending on a particular pattern of SNPs in their individual genome. In such a manner, treatment regimens can be tailored to groups of genetically similar individuals, taking into account traits that may be common among such genetically similar individuals.
  • a method termed the "candidate gene approach” can be utilized to identify genes that predict drag response.
  • a gene that encodes a drags target e.g., an FGF-20 protein of the present invention
  • all common variants of that gene can be fairly easily identified in the population and it can be determined if having one version of the gene versus another is associated with a particular drag response.
  • the activity of drag metabolizing enzymes is a major determinant of both the intensity and duration of drag action.
  • the discovery of genetic polymo ⁇ hisms of drag metabolizing enzymes e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYP2C19
  • NAT 2 N-acetyltransferase 2
  • CYP2D6 and CYP2C19 cytochrome P450 enzymes
  • These polymo ⁇ hisms are expressed in two phenotypes in the population, the extensive metabolizer (EM) and poor metabolizer (PM). The prevalence of PM is different among different populations.
  • the gene coding for CYP2D6 is highly polymo ⁇ hic and several mutations have been identified in PM, which all lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C19 quite frequently experience exaggerated drag response and side effects when they receive standard doses. If a metabolite is the active therapeutic moiety, PM show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6- formed metabolite mo ⁇ hine. The other extreme are the so called ultra-rapid metabolizers who do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.
  • a method termed the "gene expression profiling" can be utilized to identify genes that predict drag response.
  • a drug e.g., an FGF-20 molecule or FGF-20 modulator of the present invention
  • the gene expression of an animal dosed with a drug can give an indication whether gene pathways related to toxicity have been turned on.
  • Information generated from more than one of the above pharmacogenomics approaches can be used to determine appropriate dosage and treatment regimens for prophylactic or therapeutic treatment an individual. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with an FGF-20 molecule or FGF-20 modulator, such as a modulator identified by one of the exemplary screening assays described herein.
  • the invention is based, at least in part, on the discovery of a monkey gene and a human gene encoding a novel protein, refened to herein as FGF-20.
  • a clone was originally identified from a macaque dorsal root ganglion cDNA library using SEQUENCE EXPLORERTM software. The entire sequence of the monkey clone was determined and found to contain an open reading frame termed monkey "FGF-20.” The nucleotide sequence encoding the monkey FGF-20 protein is shown in
  • Figure 1 is set forth as SEQ ID NO: 1.
  • the protein encoded by this nucleic acid comprises about 177 amino acids and has the amino acid sequence shown in Figure 1 and set forth as SEQ ID NO:2.
  • the coding region (open reading frame) of SEQ ID NOJ is set forth as SEQ ID NO:3.
  • Clone jlkxb019e05, comprising the partial coding region of monkey FGF-20 was deposited with the American Type Culture Collection
  • the protein encoded by this nucleic acid comprises about 178 amino acids and has the amino acid sequence shown in Figure 9 and set forth as SEQ ID NO:5.
  • the coding region (open reading frame) of SEQ ID NO:4 is set forth as SEQ ID NO:6.
  • a human fetal heart cDNA library was screened using a 394 bp probe conesponding to a fragment of human FGF-20, generated by PCR using the following primers derived from the human genomic sequence:
  • forward primer GCCTTCCTGCCAGGCATGAACC
  • reverse primer CTTTCCCATCCTCGGAACGTCAAGG
  • the library screening resulted in the identification of a positive clone (clone fbh.38777) which was then sequenced.
  • the human FGF-20 cDNA sequence is shown in Figure 10 and is set forth as SEQ ID NO:7.
  • the protein encoded by this nucleic acid comprises about 178 amino acids and has the amino acid sequence shown in Figure 10 and set forth as SEQ ID NO:8.
  • the coding region (open reading frame) of SEQ ID NO:7 is set forth as SEQ ID NO:9.
  • monkey FGF-20 is similar to the mouse FGF-15 protein (Accession Number AF007268) and the Human FGF- 19 protein (Accession Number AB018122).
  • the monkey FGF-20 protein is 38% identical to the mouse FGF- 15 protein (Accession Number AF007268) over amino acid residues 9 to 68 and 42% identical to the human FGF- 19 protein (Accession Number AB018122) over amino acid residues 9 to 69.
  • the monkey FGF-20 nucleic acid molecule is 74% identical to Mus musculus cDNA clone 619448 (Accession Number AA175629) over nucleotides 580 to 629.
  • the monkey FGF-20 nucleic acid molecule is 60%> identical to Mycobacterium tuberculosis H37Rv complete genome; segment 126/162 (Accession Number Z74024) over nucleotides 302 to 397.
  • the monkey FGF-20 nucleic acid sequence was globally aligned with the Mus musculus mRNA (Accession Number AA 175629) using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 32.2%> identity (see Figure 4).
  • the monkey FGF-20 protein was globally aligned with the mouse fibroblast growth factor 15 (FGF-15) protein using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 14.7% identity (see Figure 5).
  • the monkey FGF-20 protein was globally aligned with the human fibroblast growth factor 19 (FGF-19) protein using the ALIGN program (version 2.0), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 11.4% identity (see Figure 6).
  • the monkey FGF-20 protein was also locally aligned with the mouse fibroblast growth factor 15 (FGF- 15) protein using the LALIGN program (version 2.0u54), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 35.1% identity in a 74 amino acid overlap (see Figure 7).
  • monkey FGF-20 protein was locally aligned with the human fibroblast growth factor 19 (FGF- 19) protein using the LALIGN program (version 2.0u54), using a PAM120 scoring matrix, a gap length penalty of 12 and a gap penalty of 4. The results showed a 39.1% identity over a 78 amino acid overlap (see Figure 8).
  • the human FGF-20 protein is 40%> identical to the human FGF- 19 protein (Accession Number ABO 18122) over translated nucleotides 353 to 535 and 35% identical to the mouse FGF-15 protein (Accession Number AF007268) over translated nucleotides 353 to 532.
  • the human FGF-20 nucleic acid molecule is also 100% identical to residues 133644-135971 of Homo sapiens 12pl3 BAC RPCI11- 388F6 (Accession Number AC008012) over nucleotides 422-2749.
  • the human FGF-20 gene comprises sequences within nucleotide residues 131413-135971 of the Homo sapiens 12pl3 BAC RPCI11-388F6 genomic fragment (Accession Number AC008012), with an intron present at about residues 131834-133643.
  • Analysis of the Homo sapiens 12pl3 BAC RPCI11-388F6 genomic sequence identified a consensus splice donor site sequence (GTGAGT) at nucleotide residues 131834-131839, a consensus splice acceptor site (TCCAG) at nucleotide residues 133639-133643, and a polyadenylation signal sequence (AATAAA) at residues 135950-135955.
  • GTGAGT consensus splice donor site sequence
  • TCCAG consensus splice acceptor site
  • AATAAA polyadenylation signal sequence
  • the human FGF-20 protein is predicted to have at least one cAMP and cGMP dependent protein kinase phosphorylation site, at about amino acid residues 102-105 of SEQ ID NO:5 or 8.
  • the human FGF-20 protein is predicted to have at least one protein kinase C phosphorylation site, at about amino acid residues 17-19, 86-88 and 112-1 14 of SEQ ID NO:5 or 8.
  • the human FGF-20 protein is predicted to have at least one casein kinase II phosphorylation site, at about amino acid residues 107-110. 112-115, 139-142 and 166- 169 of SEQ ID NO:5 or 8.
  • the human FGF-20 protein was globally aligned with the human fibroblast growth factor- 19 (FGF- 19) protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 29.6% identity (see Figure 15). Also indicated was the presence of a conserved cysteine residue in human FGF-20, at about amino acid 40 of SEQ ID NO:5 or 8, which conesponds to cysteine 120 of human FGF-19.
  • the human FGF-20 protein was globally aligned with the mouse fibroblast growth factor- 15 (FGF-15) protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4.
  • the human FGF-20 nucleic acid sequence was globally aligned with the monkey fibroblast growth factor-20 (FGF-20) nucleic acid sequence using the GAP program in the GCG software package, using a nwsgapdna matrix and a gap weight of 12 and a length weight of 4. The results showed a 94.5% identity between the two sequences (see Figure 17).
  • the human FGF-20 protein was globally aligned with the monkey fibroblast growth factor-20 (FGF-20) protein using the GAP program in the GCG software package, using a Blosum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 93.8%> identity (see Figure 18).
  • This example describes the tissue distribution of FGF-20 mRNA, as was determined by Polymerase Chain Reaction (PCR) on cDNA libraries using oligonucleotide primers specific to the human FGF-20 sequence.
  • the human FGF-20 gene is expressed in human fetal heart and heart tissue from a subject suffering from congestive heart failure, fetal liver, trigeminal ganglion, bone manow, as well as in human tumors (e.g., colon to liver metastases and erythroleukemia cells).
  • FGF-20 is expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli and the fusion polypeptide is isolated and characterized. Specifically, FGF-20 is fused to GST and this fusion polypeptide is expressed in E. coli, e.g., strain PEB199. Expression of the GST-FGF-20 fusion protein in PEB 199 is induced with IPTG. The recombinant fusion polypeptide is purified from crude bacterial lysates of the induced PEB 199 strain by affinity chromatography on glutathione beads. Using polyacrylamide gel electrophoretic analysis of the polypeptide purified from the bacterial lysates, the molecular weight of the resultant fusion polypeptide is determined.
  • GST glutathione-S-transferase
  • the pcDNA/Amp vector by Invitrogen Co ⁇ oration (San Diego, CA) is used.
  • This vector contains an SV40 origin of replication, an ampicillin resistance gene, an E. coli replication origin, a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire FGF-20 protein and an HA tag (Wilson et al. (1984) Cell 37:767) or a FLAG tag fused in-frame to its 3' end of the fragment is cloned into the polylinker region of the vector, thereby placing the expression of the recombinant protein under the control of the CMV promoter.
  • the FGF-20 DNA sequence is amplified by PCR using two primers.
  • the 5' primer contains the restriction site of interest followed by approximately twenty nucleotides of the FGF-20 coding sequence starting from the initiation codon; the 3' end sequence contains complementary sequences to the other restriction site of interest, a translation stop codon, the HA tag or FLAG tag and the last 20 nucleotides of the FGF-20 coding sequence.
  • the PCR amplified fragment and the pCDNA/Amp vector are digested with the appropriate restriction enzymes and the vector is dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, MA).
  • the two restriction sites chosen are different so that the FGF-20 gene is inserted in the conect orientation.
  • the ligation mixture is transformed into E. coli cells (strains HB101, DH5 , SURE, available from Stratagene Cloning Systems, La Jolla, CA, can be used), the transformed culture is plated on ampicillin media plates, and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the conect fragment.
  • COS cells are subsequently transfected with the FGF-20-pcDNA/Amp plasmid DNA using the calcium phosphate or calcium chloride co-precipitation methods, DEAE- dextran-mediated transfection, lipofection, or electroporation.
  • Other suitable methods for transfecting host cells can be found in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
  • the expression of the FGF-20 polypeptide is detected by radiolabelling ( 35 S-methionine or 35 S-cysteine available from NEN, Boston, MA, can be used) and immunoprecipitation (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988) using an HA specific monoclonal antibody. Briefly, the cells are labelled for 8 hours with 35 S-methionine (or 35 S-cysteine). The culture media are then collected and the cells are lysed using detergents (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both the cell lysate and the culture media are precipitated with an HA specific monoclonal antibody. Precipitated polypeptides are then analyzed by SDS-PAGE.
  • DNA containing the FGF-20 coding sequence is cloned directly into the polylinker of the pCDNA/Amp vector using the appropriate restriction sites.
  • the resulting plasmid is transfected into COS cells in the manner described above, and the expression of the FGF-20 polypeptide is detected by radiolabelling and immunoprecipitation using an FGF-20 specific monoclonal antibody.

Abstract

L'invention concerne des molécules d'acides nucléiques isolées, appelées molécules d'acides nucléiques du facteur de croissance 20 (FGF-20) des fibroblastes, qui codent pour de nouveaux éléments de la famille FGF. L'invention concerne également des molécules d'acides nucléiques antisens, des vecteurs d'expression de recombinaison contenant des molécules d'acides nucléiques de FGF-20, des cellules hôtes dans lesquelles on a introduit lesdits vecteurs d'expression, et des animaux transgéniques non humains dans lesquels un gène de FGF-20 a été introduit ou interrompu. L'invention concerne, en outre, des protéines isolées de FGF-20, des protéines de fusion, des peptides antigènes et des anticorps d'anti-FGF-20. L'invention concerne enfin de techniques utilisant les compositions de l'invention.
PCT/US2000/008076 1999-04-02 2000-03-27 Facteur de croissance 20 des fibroblastes WO2000060085A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU39243/00A AU3924300A (en) 1999-04-02 2000-03-27 Fibroblast growth factor-20

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US12753499P 1999-04-02 1999-04-02
US60/127,534 1999-04-02
US45447099A 1999-12-03 1999-12-03
US09/454,470 1999-12-03

Publications (1)

Publication Number Publication Date
WO2000060085A1 true WO2000060085A1 (fr) 2000-10-12

Family

ID=26825728

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/008076 WO2000060085A1 (fr) 1999-04-02 2000-03-27 Facteur de croissance 20 des fibroblastes

Country Status (2)

Country Link
AU (1) AU3924300A (fr)
WO (1) WO2000060085A1 (fr)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001061007A2 (fr) * 2000-02-15 2001-08-23 Amgen, Inc. Molecules du facteur 23 de croissance de fibroblastes et procedes d'utilisation correspondants
WO2001066596A2 (fr) * 2000-03-08 2001-09-13 Chiron Corporation Gene humain fgf-23 et produits d'expression genique
WO2001066595A2 (fr) * 2000-03-08 2001-09-13 Chiron Corporation Gene humain fgf-23 et produits d'expression associes
WO2002046424A2 (fr) * 2000-12-08 2002-06-13 Schering Aktiengesellschaft Nouveaux facteurs de croissance du fibroblaste
US6716626B1 (en) 1999-11-18 2004-04-06 Chiron Corporation Human FGF-21 nucleic acids
US6797695B1 (en) 1999-10-22 2004-09-28 Kyoto University Human FGF-20 gene and gene expression products
WO2005019427A3 (fr) * 2003-08-20 2005-04-21 Curagen Corp Methodes permettant de diagnostiquer et de traiter des affections qui modifient le transport du phosphate chez les mammiferes
EP1947182A1 (fr) * 2000-02-15 2008-07-23 Amgen Inc. Molécules 23 à facteur de croissance de fibroblaste et utilisations associées
US7883705B2 (en) 2007-02-14 2011-02-08 Kyowa Hakko Kirin Co., Ltd. Anti FGF23 antibody and a pharmaceutical composition comprising the same
US7923012B2 (en) 2001-12-28 2011-04-12 Kyowa Hakko Kirin Co., Ltd. Antibody against fibroblast growth factor-23
US7981419B2 (en) 2000-08-11 2011-07-19 Kyowa Hakko Kirin Co., Ltd. Method for treating hypophosphatemic bone diseases using FGF-23 antibody
US8546078B2 (en) 2005-11-08 2013-10-01 Euclid Diagnostics Llc Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US9089525B1 (en) 2011-07-01 2015-07-28 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject
US9273107B2 (en) 2012-12-27 2016-03-01 Ngm Biopharmaceuticals, Inc. Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
US9290557B2 (en) 2012-11-28 2016-03-22 Ngm Biopharmaceuticals, Inc. Compositions comprising variants and fusions of FGF19 polypeptides
US9925242B2 (en) 2012-12-27 2018-03-27 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis
US9963494B2 (en) 2012-11-28 2018-05-08 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject
US10093735B2 (en) 2014-01-24 2018-10-09 Ngm Biopharmaceuticals, Inc. Beta-klotho binding proteins
US10369199B2 (en) 2013-10-28 2019-08-06 Ngm Biopharmaceuticals, Inc. Methods of using variants of FGF19 polypeptides for the treatment of cancer
US10398758B2 (en) 2014-05-28 2019-09-03 Ngm Biopharmaceuticals, Inc. Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions
US10434144B2 (en) 2014-11-07 2019-10-08 Ngm Biopharmaceuticals, Inc. Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders
US10456449B2 (en) 2014-06-16 2019-10-29 Ngm Biopharmaceuticals, Inc. Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
US10517929B2 (en) 2014-10-23 2019-12-31 Ngm Biopharmaceuticals, Inc. Pharmaceutical compositions comprising FGF19 variants
US10744185B2 (en) 2015-11-09 2020-08-18 Ngm Biopharmaceuticals, Inc. Methods of using variants of FGF19 polypeptides for the treatment of pruritus
US10800843B2 (en) 2015-07-29 2020-10-13 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins
US11370841B2 (en) 2016-08-26 2022-06-28 Ngm Biopharmaceuticals, Inc. Methods of treating fibroblast growth factor 19-mediated cancers and tumors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039509A1 (fr) * 1995-06-05 1996-12-12 Human Genome Sciences, Inc. Facteur 15 de croissance des fibroblastes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996039509A1 (fr) * 1995-06-05 1996-12-12 Human Genome Sciences, Inc. Facteur 15 de croissance des fibroblastes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NISHIMURA ET AL: "Structure and expression of a novel human FGF, FGF-19, expressed in fetal brain", BIOCHIMICA ET BIOPHYSICA ACTA,NL,AMSTERDAM, vol. 1444, no. 1444, 18 January 1999 (1999-01-18), pages 148 - 151-51, XP002099435, ISSN: 0006-3002 *
ZHAO S. ET AL.: "Use of BAC End Sequences from Library RPCI-11 for Sequence-Ready Map Building", EMBL DATABASE ; ACCESSION NUMBER AQ412342, 25 March 1999 (1999-03-25), XP002141756 *

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6797695B1 (en) 1999-10-22 2004-09-28 Kyoto University Human FGF-20 gene and gene expression products
US7259248B2 (en) 1999-11-18 2007-08-21 Chiron Corporation Human FGF-21 polypeptides
US6716626B1 (en) 1999-11-18 2004-04-06 Chiron Corporation Human FGF-21 nucleic acids
US7723297B2 (en) 1999-11-18 2010-05-25 Kyoto University Human FGF-21 gene and gene expression products
WO2001061007A3 (fr) * 2000-02-15 2002-03-14 Amgen Inc Molecules du facteur 23 de croissance de fibroblastes et procedes d'utilisation correspondants
WO2001061007A2 (fr) * 2000-02-15 2001-08-23 Amgen, Inc. Molecules du facteur 23 de croissance de fibroblastes et procedes d'utilisation correspondants
EP1947182A1 (fr) * 2000-02-15 2008-07-23 Amgen Inc. Molécules 23 à facteur de croissance de fibroblaste et utilisations associées
WO2001066596A2 (fr) * 2000-03-08 2001-09-13 Chiron Corporation Gene humain fgf-23 et produits d'expression genique
WO2001066595A2 (fr) * 2000-03-08 2001-09-13 Chiron Corporation Gene humain fgf-23 et produits d'expression associes
WO2001066596A3 (fr) * 2000-03-08 2002-03-28 Chiron Corp Gene humain fgf-23 et produits d'expression genique
WO2001066595A3 (fr) * 2000-03-08 2002-04-18 Chiron Corp Gene humain fgf-23 et produits d'expression associes
US7981419B2 (en) 2000-08-11 2011-07-19 Kyowa Hakko Kirin Co., Ltd. Method for treating hypophosphatemic bone diseases using FGF-23 antibody
WO2002046424A3 (fr) * 2000-12-08 2003-11-27 Schering Ag Nouveaux facteurs de croissance du fibroblaste
WO2002046424A2 (fr) * 2000-12-08 2002-06-13 Schering Aktiengesellschaft Nouveaux facteurs de croissance du fibroblaste
US7923012B2 (en) 2001-12-28 2011-04-12 Kyowa Hakko Kirin Co., Ltd. Antibody against fibroblast growth factor-23
US7259144B2 (en) 2003-02-21 2007-08-21 Curagen Corporation Methods for diagnosing and treatment of hyperphosphatemic conditions using FGF20 polypeptides
WO2005019427A3 (fr) * 2003-08-20 2005-04-21 Curagen Corp Methodes permettant de diagnostiquer et de traiter des affections qui modifient le transport du phosphate chez les mammiferes
US8546078B2 (en) 2005-11-08 2013-10-01 Euclid Diagnostics Llc Materials and method for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US9290569B2 (en) 2007-02-14 2016-03-22 Kyowa Hakko Kirin Co., Ltd. Anti FGF23 antibody and a pharmaceutical composition comprising the same
US7883705B2 (en) 2007-02-14 2011-02-08 Kyowa Hakko Kirin Co., Ltd. Anti FGF23 antibody and a pharmaceutical composition comprising the same
US10202446B2 (en) 2007-02-14 2019-02-12 Kyowa Hakko Kirin Co., Ltd. Anti FGF23 antibody and a pharmaceutical composition comprising the same
US9751924B2 (en) 2011-07-01 2017-09-05 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising fusion variants of FGF19 polypeptides for reducing glucose levels in a subject
US9580483B2 (en) 2011-07-01 2017-02-28 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of diabetes
US9670260B2 (en) 2011-07-01 2017-06-06 Ngm Biopharmaceuticals, Inc. Compositions comprising fusion variants of FGF19 polypeptides
US11065302B2 (en) 2011-07-01 2021-07-20 Ngm Biopharmaceuticals, Inc. Compositions comprising fusion variants of FGF19 polypeptides
US9089525B1 (en) 2011-07-01 2015-07-28 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject
US10413590B2 (en) 2011-07-01 2019-09-17 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants of FGF19 polypeptides for reducing body mass in a subject
US9290557B2 (en) 2012-11-28 2016-03-22 Ngm Biopharmaceuticals, Inc. Compositions comprising variants and fusions of FGF19 polypeptides
US11066454B2 (en) 2012-11-28 2021-07-20 Ngm Biopharmaceuticals, Inc. Compositions comprising variants and fusions of FGF19 polypeptides
US10758590B2 (en) 2012-11-28 2020-09-01 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF 19 polypeptides for treating diabetes
US9963494B2 (en) 2012-11-28 2018-05-08 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for reducing glucose levels in a subject
US9878008B2 (en) 2012-12-27 2018-01-30 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having bile acid diarrhea or bile acid malabsorption
US9889177B2 (en) 2012-12-27 2018-02-13 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having primary sclerosing cholangitis
US9974833B2 (en) 2012-12-27 2018-05-22 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having pregnancy intrahepatic cholestasis
US9889178B2 (en) 2012-12-27 2018-02-13 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having nonalcoholic steatohepatitis
US9895416B2 (en) 2012-12-27 2018-02-20 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having cholestasis
US9273107B2 (en) 2012-12-27 2016-03-01 Ngm Biopharmaceuticals, Inc. Uses and methods for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
US9925242B2 (en) 2012-12-27 2018-03-27 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for treatment of nonalcoholic steatohepatitis
US9878009B2 (en) 2012-12-27 2018-01-30 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants and fusions of FGF19 polypeptides for modulating bile acid homeostasis in a subject having error of bile acid synthesis
US11103554B2 (en) 2012-12-27 2021-08-31 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants of FGF19 polypeptides for reducing bile acid synthesis in a subject having cirrhosis
US11564972B2 (en) 2012-12-27 2023-01-31 Ngm Biopharmaceuticals, Inc. Methods of using compositions comprising variants of FGF19 polypeptides for treating primary biliary cirrhosis in a subject
US10369199B2 (en) 2013-10-28 2019-08-06 Ngm Biopharmaceuticals, Inc. Methods of using variants of FGF19 polypeptides for the treatment of cancer
US11596676B2 (en) 2014-01-24 2023-03-07 Ngm Biopharmaceuticals, Inc. Methods of treating nonalcoholic steatohepatitis comprising administering an anti-human beta klotho antibody or binding fragment thereof
US10744191B2 (en) 2014-01-24 2020-08-18 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins and methods of use thereof
US10093735B2 (en) 2014-01-24 2018-10-09 Ngm Biopharmaceuticals, Inc. Beta-klotho binding proteins
US10398758B2 (en) 2014-05-28 2019-09-03 Ngm Biopharmaceuticals, Inc. Compositions comprising variants of FGF19 polypeptides and uses thereof for the treatment of hyperglycemic conditions
US11241481B2 (en) 2014-06-16 2022-02-08 Ngm Biopharmaceuticals, Inc. Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
US10456449B2 (en) 2014-06-16 2019-10-29 Ngm Biopharmaceuticals, Inc. Methods and uses for modulating bile acid homeostasis and treatment of bile acid disorders and diseases
US10517929B2 (en) 2014-10-23 2019-12-31 Ngm Biopharmaceuticals, Inc. Pharmaceutical compositions comprising FGF19 variants
US11141460B2 (en) 2014-11-07 2021-10-12 Ngm Biopharmaceuticals, Inc. Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders
US10434144B2 (en) 2014-11-07 2019-10-08 Ngm Biopharmaceuticals, Inc. Methods for treatment of bile acid-related disorders and prediction of clinical sensitivity to treatment of bile acid-related disorders
US10800843B2 (en) 2015-07-29 2020-10-13 Ngm Biopharmaceuticals, Inc. Beta klotho-binding proteins
US11667708B2 (en) 2015-07-29 2023-06-06 Ngm Biopharmaceuticals, Inc. Anti-human beta klotho antibody or binding fragment thereof and methods of their use
US10744185B2 (en) 2015-11-09 2020-08-18 Ngm Biopharmaceuticals, Inc. Methods of using variants of FGF19 polypeptides for the treatment of pruritus
US11370841B2 (en) 2016-08-26 2022-06-28 Ngm Biopharmaceuticals, Inc. Methods of treating fibroblast growth factor 19-mediated cancers and tumors

Also Published As

Publication number Publication date
AU3924300A (en) 2000-10-23

Similar Documents

Publication Publication Date Title
WO2000060085A1 (fr) Facteur de croissance 20 des fibroblastes
US6780987B1 (en) β-cap73 control of normal and abnormal cell migration
EP1187932A2 (fr) Molecules toll et leurs utilisations
US20020127671A1 (en) 52927, a novel human calcium channel and uses thereof
US6225085B1 (en) LRSG protein and nucleic acid molecules and uses therefor
US6500657B1 (en) 33167, a novel human hydrolase and uses therefor
US20020068322A1 (en) 47765, a novel human lysyl oxidase and uses thereof
US6500654B1 (en) CARK protein and nucleic acid molecules and uses therefor
WO2000053769A1 (fr) Nouvelles molecules du site actif de la famille de la thioredoxine et leurs utilisations
US20020197680A1 (en) 54420, a novel human calcium channel
WO2001083752A2 (fr) 23949 et 32391, nouveaux canaux ioniques humains, et utilisation associee
WO2001000878A2 (fr) Nouveau membre de la famille des facteurs de croissance des cellules endotheliales vasculaires et son utilisation
US20020081651A1 (en) 26649, a novel human GTPase activating molecule and uses therefor
US20020123094A1 (en) 57250, a novel human sugar transporter family member and uses thereof
WO2002024743A2 (fr) 55063, nouveau membre de la famille nmda humaine et ses applications
US20030049727A1 (en) 25658, a novel human calcium channel subunit and uses thereof
US20030166880A1 (en) 57304, a novel human organic cation transporter and uses thereof
US20020077462A1 (en) 33556, a novel human transporter and uses thereof
EP1123311A1 (fr) Molecules d'acide nucleique et proteines isolees presentant une homologie avec les proteines nip2 et leurs utilisations
US20020081696A1 (en) 32529, a novel human guanine nucleotide exchange factor family member and uses thereof
US20020177148A1 (en) FBH58295FL, a novel human amino acid transporter and uses thereof
WO2001074854A2 (fr) Le 32449, nouveau transporteur humain et ses utilisations
WO2001066743A2 (fr) Nouvelle molecule de canal sodique et son utilisation
EP1285060A2 (fr) 26335, serine/threonine dehydratase humaine et ses utilisations
WO2001081416A2 (fr) Le 47615, nouveau canal ionique humain et ses utilisations

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP