WO2000059935A1

WO2000059935A1 - Anti-apoptotic fusion polypeptide

Info

Publication number: WO2000059935A1
Application number: PCT/US2000/009002
Authority: WO
Inventors: Carlos Paya; Alicia Algeciras-Schminich
Original assignee: Mayo Foundation For Medical Education And Research
Priority date: 1999-04-05
Filing date: 2000-04-05
Publication date: 2000-10-12
Also published as: WO2000059935A9; AU4198200A

Abstract

A chimeric moiety useful to inhibit apoptosis is provided.

Description

ANTI-APOPTOTIC FUSION POLYPEPTIDE

Background of the Invention

Apoptosis is a mechanism of cell deletion that is fundamental in the control of cellular homeostasis in most multi-cellular organisms. In the immune system, a form of lymphocyte apoptosis called activation induced cell death (AICD) plays a critical role in the termination of the immune response and in the induction of peripheral T cell tolerance to self antigens (Ju et al., 1995a; Van Parijs et al., 1996). A major mechanism controlling AICD relies on the interaction of the Fas receptor with its ligand, FasL (Ju et al., 1995a; Van Parijs et al, 1996; Singer et al., 1994; Mogil et al., 1995). Fas is constitutively expressed in resting T cells and can be further up-regulated following cell activation (Nagata et al., 1995). The membrane bound FasL is not constitutively present in resting T cells but can be induced following T cell receptor (TCR) stimulation (Dhein et al., 1995; Alderson et al., 1995; Ju et al., 1995b). The relevance of this molecular mechanism in controlling peripheral T cell homeostasis is highlighted by the fact that mutations present in Fas or FasL result in deficient AICD responses, and hence in autoimmune and lymphoproliferative-like diseases (Rieux-Laucat et al., 1995; Reap et al., 1995; Watanabe-Fukunaga et al., 1992; Ramsdell et al., 1994; Fisher et al., 1998).

The molecular mechanism whereby Fas/FasL interactions control AICD of peripheral T cells is poorly understood. Induction of FasL following T cell activation is not sufficient to induce T cell apoptosis as Fas expressing, resting T cells are resistant to Fas stimulation (Boise et al., 1996). Therefore, it has been postulated that T cell activation, in addition to inducing de novo synthesis of FasL, results in the induction of a susceptibility state to Fas mediated apoptosis. One possibility is that IL-2 production, secondary to T cell activation, induces susceptibility to AICD mediated by Fas/FasL interactions. In fact, Fas mediated apoptosis is potentiated by IL-2 (Lenardo et al., 1991), and T cells from IL-2 and IL-2Rα chain knockout mice are resistant to AICD (Van Parijs et al., 1997; Kneitz et al., 1995; Willerford et al., 1995).

Fas receptor activation first requires its trimerization by FasL. The trimerized receptor binds the adaptor protein FADD through interaction of the death domain present in these two proteins (Chinnaiyan et al., 1995; Chinnaiyan death domain present in these two proteins (Chinnaiyan et al., 1995; Chinnaiyan et al., 1996). FADD in turn, recruits the caspase domain containing protein Caspase-8 (FLICE/MACH-1) (Boldin et al., 1996; Muzio et al., 1996). Caspase- 8 is then activated leading to the activation of a cascade of cysteine proteases or caspases that result in cell death by apoptosis (Chinnaiyan et al., 1997). This chain of events can be inhibited by FLIP, a FLICE-like inhibitor protein. FLIP was first described as a viral product that inhibited Fas and TNF mediated apoptosis (Hu et al, 1997a; Thome et al., 1997) and later was described to be present in mammalian cells (Irmler et al., 1997; Srinivasula et al., 1997; Hu et al., 1997b; Golstev et al., 1997). It is now believed that FLIP competitively inhibits binding of Caspase-8 to the Fas receptor complex, thus shutting off the downstream Fas signaling pathway. High levels of FLIP have been suggested to correlate with resistance to Fas mediated apoptosis in naive peripheral T cells and in melanoma tumors (Irmler et al., 1997). A recent study using T cell clones from a IL-2 knockout mice showed that IL-2 is necessary to decrease FLIP levels by suppressing gene transcription (Refaelli et al., 1999). However, the exact molecular mechanism by which T cell activation and, more specifically, IL-2 signaling, regulates FLIP levels has not been fully characterized.

Biological cells are generally impermeable to macromolecules, including proteins and nucleic acids. Some small molecules enter living cells at very low rates. The lack of means for delivering macromolecules into cells in vivo has been an obstacle to the therapeutic, prophylactic and diagnostic use of a potentially large number of proteins and nucleic acids having intracellular sites of action. Thus, what is needed is a chimeric moiety comprising an anti-apoptotic polypeptide that inhibits lymphocyte apoptosis, e.g., Fas-mediated apoptosis. Moreover, what is needed is an improved means for delivering such a chimeric moiety.

Summary of the Invention

The invention provides a chimeric moiety comprising at least a portion of an anti-apoptotic polypeptide or protein, e.g., FLIP or a portion thereof, in combination with, e.g., linked to, a transport moiety, i.e., a moiety which comprises a transport domain, effective to transport the chimeric moiety across a cell membrane. Preferably, the anti-apoptotic polypeptide inhibits the apoptosis of T cells, e.g., peripheral T cells. In some embodiments of the invention, the anti-apoptotic molecule is not p 16 or human papilloma virus protein E7. In one embodiment of the invention, the anti-apoptotic polypeptide comprises FLIP, either a viral, e.g., herpesvirus or poxvirus, or cellular FLIP. Preferred FLIP include, but are not limited to, those disclosed at Genbank Accession Nos. 2253683 (SEQ ID NO:2), 2253681 (SEQ ID NO:3) and 2253679 (SEQ ID NO:4). It is also preferred that the anti-apoptotic polypeptide and the transport moiety are covalently linked, e.g., as a fusion polypeptide, although non- covalent linkage is also envisioned. In one embodiment of the invention, the transport moiety comprises a peptide or polypeptide, e.g., a viral peptide or polypeptide such as the tat protein of lentiviruses, e.g., HIV or SIV isolates. In another embodiment of the invention, the chimeric moiety comprises nucleic acid encoding the anti-apoptotic polypeptide linked to a transport moiety, e.g., a transport polypeptide.

As described hereinbelow, TCR activation decreased the steady state protein levels of FLIP, an inhibitor of the Fas signaling pathway. Reconstitution of intracellular FLIP levels by the addition of a soluble TAT-FLIP chimera completely restored resistance to Fas mediated apoptosis in TCR stimulated primary T cells. Inhibition of IL-2 production by cyclosporin A, or inhibition of IL-2 signaling by rapamycin or anti-Σ -2 neutralizing antibodies, prevented the decrease of FLIP levels and conferred resistance to Fas mediated apoptosis following T cell activation. Using cell cycle blocking agents, activated T cells arrested in Gl phase were found to contain high levels of FLIP protein whereas activated T cells arrested in S phase had decreased FLIP protein levels. In addition, the soluble TAT-FLIP chimera inhibited HIV mediated T cell death.

Thus, a chimeric moiety of the invention such as a fusion polypeptide of the invention is useful to expand T cells in vitro, e.g., T cells specific for a particular antigen such as a tumor-specific antigen, useful in an immunogenic composition or vaccine as anti-apoptotic polypeptides such as FLIP may enhance the immune response, i.e., FLIP is an adjuvant, and/or to inhibit apoptosis of chronically activated T cells, e.g., activated CD4⁺T cells in HIV-infected patients may be treated ex vivo with the chimeric moiety or fusion polypeptide of the invention.

Therefore, the invention is generally applicable for therapeutic, prophylactic or diagnostic intracellular delivery of small molecules and macromolecules, such as anti-apoptotic polypeptides and nucleic acids encoding such polypeptides, that are not inherently capable of entering target cells at a useful rate. The processes and compositions of this invention may be applied to any organism, including animals, e.g., mammals such as rats, mice, rabbits, bovines, ovines, equines, and primates, for example, monkeys and humans. The processes and compositions of this invention may also be applied to ammals and humans in utero.

Thus, the invention provides a method to inhibit ligand-induced apoptosis of lymphocytes. The method comprises contacting lymphocytes, for example, T cells such as peripheral T cells, with an effective amount of a chimeric moiety comprising at least a portion of an anti-apoptotic polypeptide or protein linked to a transport moiety. Preferably, the chimeric moiety is a fusion polypeptide comprising an amino terminal transport peptide or polypeptide and FLIP or a portion thereof. Hence, the invention also provides a host cell contacted with the chimeric moiety of the invention. The compositions of the invention include a composition comprising an anti-apoptotic polypeptide or protein in combination with, e.g., linked to, a transport moiety and a carrier, e.g., a pharmaceutically acceptable carrier. One embodiment of the invention includes an immunogenic composition or vaccine comprising a portion of an anti-apoptotic polypeptide, e.g., FLIP or a portion thereof, linked to an immunogenic moiety. Another embodiment includes an immunogenic composition or vaccine comprising a transport moiety linked to a portion of an anti-apoptotic polypeptide, e.g., FLIP or a portion thereof, linked to an immunogenic moiety.

The invention also provides an isolated and purified nucleic acid molecule, e.g., RNA or DNA, comprising a nucleic acid segment encoding a fusion polypeptide of the invention, or the complement thereof. The nucleic acid molecules of the invention may be single stranded or double stranded. Thus, the invention further provides an expression cassette comprising a DNA segment encoding a fusion polypeptide operably linked to transcriptional regulatory sequences, e.g., a promoter, enhancer, and/or polyadenylation sequences. The expression cassette of the invention may be introduced to a host cell to yield a host cell that produces the fusion polypeptide. Further provided is a method to prepare a fusion polypeptide comprising an anti-apoptotic polypeptide and a transport peptide or polypeptide. The method comprises contacting a host cell with an expression cassette comprising a DNA segment encoding a fusion polypeptide operably linked to transcriptional regulatory sequences so as to yield a transformed host cell. Preferably, the fusion polypeptide is isolated from the transformed host cell.

Brief Description of the Drawings

Figure 1. T cell activation results in decreased levels of FLIP and susceptibility to Fas mediated apoptosis. CD3⁺ T cells were activated with anti- CD3 (CD3XL) (lanes 2 and 5) alone, or in combination with anti-CD28

(CD28XL) (lanes 3 and 6), or with isotype control (IgGXL) antibodies for 24, 48 and 72 hours. A) Whole cell extracts were electrophoresed and probed with anti- FLIP rat serum followed by anti-rat IgG HRP (upper panel), anti-Caspase-8 antibodies (middle panel), or with anti-actin antibodies (lower panel). B) FLIP and Caspase-8 protein levels from A) were analyzed by densitometry and the FLIP and Caspase-8 to actin ratio was calculated and represented in arbitrary units (ratio IgGXL, lanes 1 and 4 = 1.0). C) Anti-Fas antibody (CH-11) was added for 20 hours after 24 hours (hatched bars) or 72 hours (plain bars) of T cell activation by IgGXL, CD3XL, or CD28XL, followed by analysis of apoptosis by propidium iodide (PI) staining. Results shown are from one representative experiment of three.

Figure 2. Exogenous added FLIP reverts the susceptibility to Fas mediated apoptosis following anti-CD3 stimulation. CD3⁺ T cells were activated with IgGXL or CD3XL for 72 hours. Activated CD3⁺ T cells were transduced with different concentrations of HA-TAT-FLIP (A) or TAT-E7 (B) fusion protein for 1 hour prior to the addition of 500 ng/ml anti-Fas (CH-11), and cell viability was analyzed 20 hours later by trypan blue dye exclusion. The data represents the mean and standard deviation of duplicate points within each experiment. Results shown are from one representative experiment of three. Figure 3. IL-2 is required to induce decreased levels of FLIP and to induce susceptibility to Fas mediated apoptosis. A) Isotype antibody control (IgGXL) or anti-CD3 antibody (CD3XL) treated CD3⁺ T cells were incubated for 72 hours in the presence or absence (0; vehicle control) of 250 nM cyclosporin A (CsA), and immunoblotted with anti-FLIP or anti-actin antibodies. B) Same as panel A, except that CD3⁺ T cells were treated or not (0) with 30 μg/ml of anti-IL-2 (αIL-2), or anti-IL-6 (αIL-6) antibodies. C) CD3⁺T cells were activated with anti-CD3 (CD3XL) or IgG isotype antibody (IgGXL) for 72 hours in the presence of medium alone (0), CsA (250 nM), or anti-IL-2 neutralizing antibodies (αIL-2) (30 μg/ml). Anti-Fas antibody was added (+) or not (-) after 72 hours and incubated for an additional 20 hours. Cell viability was analyzed by trypan blue dye exclusion. The data represents the mean and standard deviation of duplicate points within each experiment.

Figure 4. A rapamycin sensitive signaling pathway is required for FLIP down regulation. A) Isotype antibody control (IgGXL) or anti-CD3 antibody (CD3XL) treated CD3⁺ T cells were incubated for 72 hours in the presence of DMSO (vehicle control) or 100 nM rapamycin (RAP), and immunoblotted with anti-FLIP or anti-actin antibodies. B) CD3⁺T cells were activated with anti-CD3 (CD3XL) or IgG isotype antibody (IgGXL) for 72 hours in the presence of vehicle control (DMSO), or RAP (100 nM). Anti-Fas antibody was added (+) or not (-) after 72 hours and incubated for an additional 20 hours. Cell viability was analyzed by trypan blue dye exclusion. The data represents the mean and standard deviation of duplicate points within each experiment.

Figure 5. Decrease in FLIP levels correlates with LL-2 induced proliferation. CD3⁺T cells were activated with anti-CD3 (CD3XL) or IgG isotype antibody (IgGXL) in the absence or presence of CsA. After 20 hours, cells were incubated with 200 U/ml of LL-2 for 24, 48 and 72 hours. IgGXL and CD3XL samples were harvested after 72 hours of activation. A) Immunoblot analysis for FLIP levels and actin (protein loading control). B) Cells were incubated for the indicated time points. Radiolabeled [³H] thymidine was added and samples cultured for an additional 8 hours. Data points represent the mean of triplicate values. Similar results were observed in three independent experiments.

Figure 6. FLIP levels are regulated during the cell cycle. A) CD3⁺T cells were activated with anti-CD3 (CD3XL) or IgG isotype antibody (IgGXL) in the absence or presence of CsA. After 20 hours, cells were incubated with 200 U/ml or IL-2 in the absence or presence of 5 μg/ml of aphidicolin (APH) and 300 μM of mimosine (MIMO). Cells were harvested 72 later hours and FLIP and actin levels analyzed by immunoblot. B) Anti-CD3 activated T cells were gated and sorted based on Hoeschst 33342 fluorescence. Diagrams show the regions used for cell sorting. Rl represents cells in G0/G1, R2 are cells in S phase, and R3 represents cells in G2/M phase. C) CD3 activated cells were sorted as in B, and FLIP and actin levels analyzed by immunoblot. Results shown are from one representative experiment of two. Figure 7. Codons for various amino acids. Figure 8. Exemplary amino acid substitutions.

Figure 9. Schematic of the pTAT-HA vector. The HA tag, flanked by glycine residues, was inserted into the Ncol site of pTAT. The 5' Ncol site was inactivated.

Figure 10. cDNA of human FLIP linked to DNA encoding a detectable amino acid sequence.

Figure 11. Effect of TAT-FLIP in CD4+ T cell apoptosis. A) CD4+ T cells were treated with 250 nM TAT-FLIP for 1 hour and then co-cultured with 293T cells expressing HIV gpl20 for 24 hours. Cell death was determined by trypan blue. B) HIV infected CD4+ T cells were incubated with 250 nM TAT- FLIP for 24 hours and cell death was determined by trypan blue stoning. Data represents day 5 of HTV infection.

Detailed Description of the Invention

Definitions As used herein, the term "recombinant nucleic acid" or "preselected nucleic acid," e.g., "recombinant DNA sequence or segment" or "preselected DNA sequence or segment" refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from any appropriate tissue source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in a genome which has not been transformed with exogenous DNA. An example of preselected DNA "derived" from a source, would be a DNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

Thus, recovery or isolation of a given fragment of DNA from a restriction digest can employ separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. See Lawn et al., Nucleic Acids Res., 9., 6103 (1981), and Goeddel et al., Nucleic Acids Res., 8., 4057 (1980). Therefore, "preselected DNA" includes completely synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from RNA, as well as mixtures thereof.

As used herein, the term "derived" with respect to a RNA molecule means that the RNA molecule has complementary sequence identity to a particular DNA molecule. "Chemical cross linking" or "conjugation" means covalent bonding of two or more pre-formed molecules ("moieties").

A "fusion polypeptide or protein" means co-linear, covalent linkage of two or more proteins via their polypeptide backbones, through genetic expression of a DNA molecule encoding those proteins, e.g., in a host cell or via in vitro transcription and translation.

"Spacer amino acid" means an amino acid (preferably having a small side chain) included between a transport moiety, such as a transport peptide comprising a transport domain, and an amino acid residue used for chemical cross-linking (e.g., to provide molecular flexibility and avoid steric hindrance).

"Target cell" or "host cell" means a cell into which a chimeric moiety of the invention or a DNA molecule encoding a fusion polypeptide of the invention is delivered. A "target cell" may be any cell, including prokaryotic and eukaryotic cells, e.g., mammalian cells such as human cells. For prophylactic or therapeutic purposes, it is preferred that the chimeric moiety or DNA molecule of the invention is delivered to lymphocytes, e.g., T cells. The delivery of the chimeric moiety or DNA molecule of the invention may be in vivo, ex vivo or in vitro.

A "transport moiety" is any molecule which is capable of delivering another molecule into a target cell, i.e., the transport moiety has a "transport domain". For example, tat polypeptide, or a portion thereof, may be employed as a transport moiety. Preferably, a stabilizing agent, e.g., one which serves to increase tat stability and uptake, can be employed when cells are contacted with a chimeric moiety of the invention. For example, metal ions which bind to tat protein and increase its stability and uptake, can be used for this purpose.

As used herein, the terms "isolated and/or purified" refer to in vitro preparation, isolation and or purification of a therapeutic agent of the invention, e.g., a DNA molecule or fusion polypeptide of the invention, so that it is not associated with in vivo substances. Thus, with respect to an "isolated nucleic acid molecule" encoding a fusion polypeptide, which includes a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, the "isolated nucleic acid molecule" (1) is not associated with all or a portion of a polynucleotide in which the "isolated nucleic acid molecule" is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature (i.e., it is chimeric), or (3) does not occur in nature as part of a larger sequence. Thus, an isolated DNA is isolated from its natural cellular environment and components of the cells, such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed. An isolated nucleic acid molecule means a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA. For example, "isolated FLIP nucleic acid" is RNA or DNA containing greater than 9, preferably 36, and more preferably 45 or more, sequential nucleotide bases that encode at least a portion of FLIP, or a variant thereof, or a RNA or DNA complementary thereto, that is complementary or hybridizes, respectively, to RNA or DNA encoding FLIP and remains stably bound under stringent conditions, as defined by methods well known in the art, e.g., in Sambrook et al., supra. Thus, the RNA or DNA is "isolated" in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and is preferably substantially free of any other RNA or DNA. The phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is reintro duced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell. The term "oligonucleotide" referred to herein includes naturally occurring, and modified nucleotides linked together by naturally occurring, and non-naturally occurring oligonucleotide linkages. Oligonucleotides are a polynucleotide subset with 200 bases or fewer in length. Preferably, oligonucleotides are 10 to 60 bases in length and most preferably 12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 bases in length. Oligonucleotides are usually single stranded, e.g., for probes, although oligonucleotides may be double stranded, e.g., for use in the construction of a variant. Oligonucleotides can be either sense or antisense oligonucleotides. The term "naturally occurring nucleotides" referred to herein includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotides" referred to herein includes nucleotides with modified or substituted sugar groups and the like. The term "oligonucleotide linkages" referred to herein includes oligonucleotides linkages such as phosphorothioate, phosphorodithioate, phophoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoroamidate, and the like. An oligonucleotide can include a label for detection, if desired.

The term "isolated polypeptide" or "isolated fusion polypeptide" means a polypeptide encoded by cDNA or recombinant RNA, or is synthetic in origin, or some combination thereof, which isolated polypeptide (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of human proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.

The term "sequence homology" means the proportion of base matches between two nucleic acid sequences or the proportion amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%, the percentage denotes the proportion of matches over the length of sequence from, e.g., a sequence encoding a FLIP or a transport moiety, that is compared to some other sequence. Gaps (in either of the two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less are preferred with 2 bases or less more preferred. When using oligonucleotides as probes or treatments, the sequence homology between the target nucleic acid and the oligonucleotide sequence is generally not less than 17 target base matches out of 20 possible oligonucleotide base pair matches (85%); preferably not less than 9 matches out of 10 possible base pair matches (90%), and more preferably not less than 19 matches out of 20 possible base pah- matches (95%).

The term "selectively hybridize" means to detectably and specifically bind. Polynucleotides, oligonucleotides and fragments of the invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids. High stringency conditions can be used to achieve selective hybridization conditions as known in the art and discussed herein. Generally, the nucleic acid sequence homology between the polynucleotides, oligonucleotides, and fragments of the invention and a nucleic acid sequence of interest is at least 65%, and more typically with preferably increasing homologies of at least about 70%, about 90%, about 95%, about 98%, and 100%.

Moderate and stringent hybridization conditions are well known to the art, see, for example, sections 9.47-9.51 of Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989)). For example, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (SSC); 0.1% sodium lauryl sulfate (SDS) at 50°C, or (2) employ a denaturing agent such as formamide during hybridization e.g., 50% formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C. Another example is use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% sodium dodecylsulfate (SDS), and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1% SDS. It is preferred that the DNA molecule of the invention which encodes a fusion polypeptide comprising FLIP hybridizes under hybridizing conditions to a DNA molecule comprising a DNA segment encoding SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or an apoptosis inhibiting portion thereof.

Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less are preferred with 2 or less being more preferred. Alternatively and preferably, two protein sequences (or polypeptide sequences derived from them of at least 30 amino acids in length) are homologous, as this term is used herein, if they have an alignment score of at more than 5 (in standard deviation units) using the program ALIGN with the mutation data matrix and a gap penalty of 6 or greater. See Dayhoff, M. O., in Atlas of Protein Sequence and Structure, 1972, volume 5, National Biomedical Research Foundation, pp. 101-110, and Supplement 2 to this volume, pp. 1-10. The two sequences or parts thereof are more preferably homologous if their amino acids are greater than or equal to 50% identical when optimally aligned using the ALIGN program.

The term "corresponds to" is used herein to mean that a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence. In contradistinction, the term "complementary to" is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence.

The following terms are used to describe the sequence relationships between two or more polynucleotides: "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity", and

"substantial identity". A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length. Since two polynucleotides may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.

A "comparison window", as used herein, refers to a conceptual segment of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 4jk 443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) &£: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.

The term "sequence identity" means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms "substantial identity" as used herein denote a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 20-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.

As applied to polypeptides, the term "substantial identity" means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least about 80 percent sequence identity, preferably at least about 90 percent sequence identity, more preferably at least about 95 percent sequence identity, and most preferably at least about 99 percent sequence identity. As used herein, the terms "label" or "labeled" refer to incorporation of a detectable marker, e.g., by incorporation of a radiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or colorimetric methods). Various methods of labeling polypeptides are known in the art and may be used. Examples of labels for polypeptides include, but are not limited to, the following: radioisotopes (e.g., ³H, ¹⁴C, ³⁵S, ¹²⁵0, ¹³¹I), fluorescent labels (e.g., FITC, rhodamine, lanthanide, phosphors), enzymatic labels (e.g., horseradish peroxidase, β- galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags). In some embodiments, labels are attached by spacer arms of various lengths to reduce potential steric hindrance.

As used herein, "substantially pure" means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, about 90%, about 95%, and about 99%. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.

T. Nucleic Acid Molecules of the Invention A. Sources of the Nucleic Acid Molecules of the Invention

Sources of nucleotide sequences from which the present nucleic acid molecules encoding at least a portion of an anti-apoptotic polypeptide, e.g., FLIP, a transport polypeptide or peptide, e.g., tat or a portion thereof, a variant thereof or the nucleic acid complement thereof, include total or polyA⁺ RNA from any viral or eukaryotic, preferably mammalian, cellular source from which cDNAs can be derived by methods known in the art. Other sources of the DNA molecules of the invention include genomic libraries derived from any eukaryotic cellular source, including virally infected cells. Nucleic acid sources for tat include lentivirus-infected cells. Nucleic acid sources for FLIP include mammalian and viral sources.

B. Isolation of the Nucleic Acid Molecules of the Invention

A nucleic acid molecule encoding an anti-apoptotic polypeptide or a transport polypeptide or peptide can be identified and isolated using standard methods, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (1989). For example, reverse-transcriptase PCR (RT-PCR) can be employed to isolate and clone FLIP or tat DNA. Oligo- dT can be employed as a primer in a reverse transcriptase reaction to prepare first-strand cDNAs from isolated RNA which contains RNA sequences of interest. RNA can be isolated by methods known to the art, e.g., using TRIZOL^™ reagent (GIBCO-BRL/Life Technologies, Gaithersburg, Maryland). Resultant first-strand cDNAs are then amplified in PCR reactions.

"Polymerase chain reaction" or "PCR" refers to a procedure or technique in which amounts of a preselected fragment of nucleic acid, RNA and/or DNA, are amplified as described in U.S. Patent No. 4,683,195. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers comprising at least 7-8 nucleotides. These primers will be identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, and the like. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol.. 5_1, 263 (1987); Erlich, ed., PCR Technology, (Stockton Press, New York, 1989). Thus, PCR- based cloning approaches rely upon conserved sequences deduced from alignments of related gene or polypeptide sequences.

Primers are made to correspond to highly conserved regions of polypeptides or nucleotide sequences which were identified and compared to generate the primers, e.g., by a sequence comparison of isolated FLIP genes. One primer is prepared which is predicted to anneal to the antisense strand, and another primer prepared which is predicted to anneal to the sense strand, of a DNA molecule which encodes an anti-apoptotic polypeptide such as FLIP. The products of each PCR reaction are separated via an agarose gel and all consistently amplified products are gel-purified and cloned directly into a suitable vector, such as a known plasmid vector. The resultant plasmids are subjected to restriction endonuclease and dideoxy sequencing of double-stranded plasmid DNAs.

Another approach to identify, isolate and clone cDNAs which encode, e.g., FLIP, is to screen a cDNA library. Screening for DNA fragments that encode all or a portion of a cDNA encoding FLIP can be accomplished by probing the library with a probe which has sequences that are highly conserved between genes believed to be related to FLIP, e.g., the homolog of a particular FLIP from a different species, or by screening of plaques for binding to antibodies that specifically recognize FLIP. DNA fragments that bind to a probe having sequences which are related to FLIP, or which are immunoreactive with antibodies to FLIP, can be subcloned into a suitable vector and sequenced and/or used as probes to identify other cDNAs encoding all or a portion of FLIP. C Variants of the Nucleic Acid Molecules of the Invention

Nucleic acid molecules encoding amino acid sequence variants of an anti-apoptotic polypeptide or a transport polypeptide or peptide are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of, for example, FLIP or tat.

Oligonucleotide-mediated mutagenesis is a preferred method for preparing amino acid substitution variants of a peptide or polypeptide. This technique is well known in the art as described by Adelman et al., DNA, 2, 183 (1983). Briefly, DNA is altered by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native DNA sequence of FLIP or a transport peptide or polypeptide. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in FLIP or a transport peptide or polypeptide. Generally, oligonucleotides of at least 25 nucleotides in length are used. An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotide(s) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule. The oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea et al, Proc. Natl. Acad. Sci. U.S.A.. 25, 5765 (1978).

The DNA template can be generated by those vectors that are either derived from bacteriophage Ml 3 vectors (the commercially available M13mpl8 and M13mpl9 vectors are suitable), or those vectors that contain a single- stranded phage origin of replication as described by Viera et al., Meth. En7ymol.. 152, 3 (1987). Thus, the DNA that is to be mutated may be inserted into one of these vectors to generate single-stranded template. Production of the single- stranded template is described in Sections 4.21-4.41 of Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, N.Y. 1989).

Alternatively, single-stranded DNA template may be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques. For alteration of the native DNA sequence (to generate amino acid sequence variants, for example), the oligonucleotide is hybridized to the single- stranded template under suitable hybridization conditions. A DNA polymerizing enzyme, usually the Klenow fragment of DNA polymerase I, is then added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis. A heteroduplex molecule is thus formed such that one strand of DNA encodes the mutated form of FLIP or the transport peptide or polypeptide, and the other strand (the original template) encodes the native, unaltered sequence of FLIP or the transport peptide or polypeptide. This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JM101. After the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with 32-phosphate to identify the bacterial colonies that contain the mutated DNA. The mutated region is then removed and placed in an appropriate vector for peptide or polypeptide production, generally an expression vector of the type typically employed for transformation of an appropriate host.

The method described immediately above may be modified such that a homoduplex molecule is created wherein both strands of the plasmid contain the mutations(s). The modifications are as follows: The single-stranded oligonucleotide is annealed to the single-stranded template as described above. A mixture of three deoxyribonucleotides, deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP), is combined with a modified thiodeoxyribocytosine called dCTP-(αS) (which can be obtained from the Amersham Corporation). This mixture is added to the template- oligonucleotide complex. Upon addition of DNA polymerase to this mixture, a strand of DNA identical to the template except for the mutated bases is generated. In addition, this new strand of DNA will contain dCTP-(αS) instead of dCTP, which serves to protect it from restriction endonuclease digestion. After the template strand of the double-stranded heteroduplex is nicked with an appropriate restriction enzyme, the template strand can be digested with ExoHI nuclease or another appropriate nuclease past the region that contains the site(s) to be mutagenized. The reaction is then stopped to leave a molecule that is only partially single-stranded. A complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase. This homoduplex molecule can then be transformed into a suitable host cell such as E. coli JM101. For example, a prefened embodiment of the invention is an isolated and purified DNA molecule having nucleotide substitutions which are "silent" (see Figure 7). That is, when silent nucleotide substitutions are present in a codon, the same amino acid is encoded by the codon with the nucleotide substitution as is encoded by the codon without the substitution. Nucleotide substitutions can be introduced into DNA segments by methods well known to the art. See, for example, Sambrook et al., supra. Thus, nucleic acid molecules encoding at least a portion of, for example, FLLP or tat, may be modified so as to yield nucleic acid molecules of the invention having silent nucleotide substitutions, or to yield nucleic acid molecules having nucleotide substitutions that result in amino acid substitutions (see peptide variants hereinbelow). IT. Preparation of Agents Falling Within the Scope of the Invention

A. Nucleic Acid Molecules

1 . Chimeric Expression Cassettes

To prepare expression cassettes for transformation herein, the recombinant or preselected DNA sequence or segment may be circular or linear, double-stranded or single-stranded. A preselected DNA sequence which encodes an RNA sequence that is substantially complementary to a mRNA sequence encoding an anti-apoptotic polypeptide such as FLIP or a transport peptide or polypeptide is typically a "sense" DNA sequence cloned into a cassette in the opposite orientation (i.e., 3' to 5' rather than 5' to 3')- Generally, the preselected DNA sequence or segment is in the form of chimeric DNA, such as plasmid DNA, that can also contain coding regions flanked by control sequences which promote the expression of the preselected DNA present in the resultant cell line. As used herein, "chimeric" means that a vector comprises DNA from at least two different species, or comprises DNA from the same species, which is linked or associated in a manner which does not occur in the "native" or wild type of the species.

Aside from preselected DNA sequences that serve as transcription units for FLIP or a transport peptide or polypeptide, a portion of the preselected DNA may be untranscribed, serving a regulatory or a structural function. For example, the preselected DNA may itself comprise a promoter that is active in mammalian cells, or may utilize a promoter already present in the genome that is the transformation target. Such promoters include the CMV promoter, as well as the SV40 late promoter and retroviral LTRs (long terminal repeat elements), although many other promoter elements well known to the art may be employed in the practice of the invention.

Other elements functional in the host cells, such as introns, enhancers, polyadenylation sequences and the like, may also be a part of the preselected DNA. Such elements may or may not be necessary for the function of the DNA, but may provide improved expression of the DNA by affecting transcription, stability of the mRNA, or the like. Such elements may be included in the DNA as desired to obtain the optimal performance of the transforming DNA in the cell. "Control sequences" is defined to mean DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotic cells, for example, include a promoter, and optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

"Operably linked" is defined to mean that the nucleic acids are placed in a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a peptide or polypeptide if it is expressed as a preprotein that participates in the secretion of the peptide or polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice. The preselected DNA to be introduced into the cells further will generally contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of transformed cells from the population of cells sought to be transformed. Alternatively, the selectable marker may be carried on a separate piece of DNA and used in a co-transformation procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are .well known in the art and include, for example, antibiotic and herbicide-resistance genes, such as neo, hpt, dhfr, bar, aroA, dapA and the like. See also, the genes listed on Table 1 of Lundquist et al. (U.S. Patent No. 5,848,956).

Reporter genes are used for identifying potentially transformed cells and for evaluating the functionality of regulatory sequences. Reporter genes which encode for easily assayable proteins are well known in the art. In general, a reporter gene is a gene which is not present in or expressed by the recipient organism or tissue and which encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Preferred genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli, the beta-glucuronidase gene (gus) of the uidA locus of E. coli, and the luciferase gene from firefly Photinus pyralis. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.

The general methods for constructing recombinant DNA which can transform target cells are well known to those skilled in the art, and the same compositions and methods of construction may be utilized to produce the DNA useful herein. For example, J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (2d ed., 1989), provides suitable methods of construction. 7. Transformation into Host Cells The recombinant DNA can be readily introduced into the host cells, e.g., mammalian, bacterial, yeast or insect cells by transfection with an expression vector comprising DNA encoding an anti-apoptotic polypeptide or transport peptide or polypeptide, or its complement, by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a transformed cell having the recombinant DNA stably integrated into its genome, so that the DNA molecules, sequences, or segments, of the present invention are expressed by the host cell.

Physical methods to introduce a preselected DNA into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods to introduce the DNA of interest into a host cell include the use of DNA and RNA viral vectors. The main advantage of physical methods is that they are not associated with pathological or oncogenic processes of viruses. However, they are less precise, often resulting in multiple copy insertions, random integration, disruption of foreign and endogenous gene sequences, and unpredictable expression. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like.

As used herein, the term "cell line" or "host cell" is intended to include well-characterized homogenous, biologically pure populations of cells. These cells may be eukaryotic cells that are neoplastic or which have been

"immortalized" in vitro by methods known in the art, as well as primary cells, or prokaryotic cells. The cell line or host cell is preferably of mammalian origin, but cell lines or host cells of non-mammalian origin may be employed, including plant, insect, yeast, fungal or bacterial sources. "Transfected" or "transformed" is used herein to include any host cell or cell line, the genome of which has been altered or augmented by the presence of at least one preselected DNA sequence, which DNA is also referred to in the art of genetic engineering as "heterologous DNA," "recombinant DNA," "exogenous DNA," "genetically engineered," "non-native," or "foreign DNA," wherein said DNA was isolated and introduced into the genome of the host cell or cell line by the process of genetic engineering. The host cells of the present invention are typically produced by transfection with a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence. Preferably, the transfected DNA is a chromosomally integrated recombinant DNA sequence, which comprises a gene encoding a fusion polypeptide of the invention or its complement, which host cell may or may not express significant levels of autologous or "native" anti-apoptotic polypeptide, e.g., FLIP.

To confirm the presence of the preselected DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of a particular fusion polypeptide, e.g., by immunological means (ELISAs and Western blots) or by assays described hereinabove to identify agents falling within the scope of the invention.

To detect and quantitate RNA produced from introduced preselected DNA segments, RT-PCR may be employed. In this application of PCR, it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of an RNA species. While Southern blotting and PCR may be used to detect the preselected

DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the peptide products of the introduced preselected DNA sequences or evaluating the phenotypic changes brought about by the expression of the introduced preselected DNA segment in the host cell. Polypeptides, Polypeptide Variants, Chimeric Moieties, and Derivatives

The present isolated, purified polypeptides, fusion polypeptides or variants thereof, can be synthesized in vitro, e.g., by the solid phase peptide synthetic method or by recombinant DNA approaches (see above, and including in vitro transcription/translation systems). The solid phase peptide synthetic method is an established and widely used method, which is described in the following references: Stewart et al., Solid Phase Peptide Synthesis, W. H. Freeman Co., San Francisco (1969); Merrifield, J. Am. Chem. Snc, £52149 (1963); Meienhofer in "Hormonal Proteins and Peptides," ed.; CH. Li, Vol. 2 (Academic Press, 1973), pp. 48-267; Bavaay and Merrifield, "The Peptides," eds. E. Gross and F. Meienhofer, Vol. 2 (Academic Press, 1980) pp. 3-285; and Clark-Lewis et al., Meth. Enzymol., 2S2, 233 (1997). These polypeptides can be further purified by fractionation on immunoaffinity or ion-exchange columns; ethanol precipitation; reverse phase HPLC; chromatography on silica or on an anion-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G- 75; or ligand affinity chromatography. Once isolated and characterized, derivatives, e.g., chemically derived derivatives, of a given polypeptide or fusion polypeptide ofthe invention can be readily prepared. For example, amides ofthe fusion polypeptide ofthe invention, or variants thereof may also be prepared by techniques well known in the art for converting a carboxylic acid group or precursor, to an amide. A preferred method for amide formation at the C-terminal carboxyl group is to cleave the polypeptide from a solid support with an appropriate amine, or to cleave in the presence of an alcohol, yielding an ester, followed by aminolysis with the desired amine. Salts of carboxyl groups of a polypeptide, e.g., a fusion polypeptide, or polypeptide variant ofthe invention may be prepared in the usual manner by contacting the polypeptide with one or more equivalents of a desired base such as, for example, a metallic hydroxide base, e.g., sodium hydroxide; a metal carbonate or bicarbonate base such as, for example, sodium carbonate or sodium bicarbonate; or an amine base such as, for example, triethylamine, triethanolamine, and the like.

N-acyl derivatives of an amino group ofthe fusion polypeptide, or variants thereof, may be prepared by utilizing an N-acyl protected amino acid for the final condensation, or by acylating a protected or unprotected peptide. O- acyl derivatives may be prepared, for example, by acylation of a free hydroxy peptide or peptide resin. Either acylation may be carried out using standard acylating reagents such as acyl halides, anhydrides, acyl imidazoles, and the like. Both N- and O-acylation may be carried out together, if desired.

Formyl-methionine, pyroglutamine and trimethyl-alanine may be substituted at the N-terminal residue ofthe peptide or peptide variant. Other an-dno-terminal modifications include aminooxypentane modifications (see Simmons et al, Science, 226, 276 (1997)).

In addition, the amino acid sequence of a polypeptide or fusion polypeptide ofthe invention can be modified so as to result in a variant polypeptide. The modification includes the substitution of at least one amino acid residue in the polypeptide for another amino acid residue, including substitutions which utilize the D rather than L form, as well as other well known amino acid analogs, e.g., unnatural amino acids such as α, α-disubstituted amino acids, N-alkyl amino acids, lactic acid, and the like. These analogs include phosphoserine, phosphothreonine, phosphotyrosine, hydroxyproline, gamma- carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, l,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine, ornithine, citruline, α-methyl-alanine, para-benzoyl-phenylalanine, phenylglycine, propargylglycine, sarcosine, e-N,N,N-trimethyllysine, e-N-acetyllysine, N- acetylserine, N-formylmethionine, 3-methylhistidine, 5 -hydroxy lysine, ω-N-methylarginine, and other similar amino acids and imino acids and tert- butylglycine. One or more ofthe residues ofthe polypeptide can be altered, so long as the peptide variant is biologically active. Conservative amino acid substitutions are prefened—that is, for example, aspartic-glutamic as acidic amino acids; lysine/arginine/histidine as basic amino acids; leucine/isoleucine, methionine/valine, alanine/valine as hydrophobic amino acids; serine/glycine/alanine/threonine as hydrophilic amino acids. Conservative amino acid substitution also includes groupings based on side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. For example, it is reasonable to expect that replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the properties ofthe resulting variant polypeptide. Whether an amino acid change results in a functional polypeptide can readily be determined by assaying the specific activity ofthe peptide variant. Assays are described in detail herein.

Conservative substitutions are shown in Figure 8 under the heading of exemplary substitutions. More preferred substitutions are under the heading of prefened substitutions. After the substitutions are introduced, the variants are screened for biological activity.

Amino acid substitutions falling within the scope ofthe invention, are, in general, accomplished by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure ofthe peptide backbone in the area ofthe substitution, (b) the charge or hydrophobicity ofthe molecule at the target site, or (c) the bulk ofthe side chain. Naturally occurring residues are divided into groups based on common side-chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gin, his, lys, arg;

(5) residues that influence chain orientation: gly, pro; and

(6) aromatic; trp, tyr, phe. The invention also envisions polypeptide variants with non-conservative substitutions. Non-conservative substitutions entail exchanging a member of one ofthe classes described above for another.

Acid addition salts ofthe polypeptide or variant polypeptide or of amino residues ofthe polypeptide or variant polypeptide may be prepared by contacting the polypeptide or amine with one or more equivalents of the desired inorganic or organic acid, such as, for example, hydrochloric acid. Esters of carboxyl groups ofthe peptides may also be prepared by any ofthe usual methods known in the art.

It is also envisioned that the chimeric moieties, e.g., a fusion polypeptide or a variant thereof, ofthe invention may comprise moieties other than the portion which inhibits apoptosis or the portion useful to transport the chimeric moiety into a cell (i.e., "derivatives" of chimeric moieties), e.g., other peptide or polypeptide molecules, such as antibodies or fragments thereof, nucleic acid molecules, sugars, lipids, e.g., cholesterol or other lipid derivatives which may increase membrane solubility, fats, a detectable signal molecule such as a radioisotope, e.g., gamma emitters, small chemicals, metals, salts, synthetic polymers, e.g., polylactide and polyglycolide, and surfactants which preferably are covalently attached or linked to the chimeric moiety, e.g., a fusion polypeptide ofthe invention, so long as the other moieties do not alter the biological activity ofthe chimeric moiety or polypeptide. Also envisioned is a derivative in which at least two ofthe moieties are non-covalently associated with each other. The rate at which single-stranded and double-stranded nucleic acids enter cells, in vitro and in vivo, may be advantageously enhanced, using the transport polypeptides of this invention. Methods for chemical cross- linking of polypeptides to nucleic acids are well known in the art. Thus, a transport moiety may be linked to nucleic acid molecule encoding FLIP or a portion thereof. A preferred transport moiety is tat. It will be appreciated that the entire

86 amino acids which make up the tat protein may not be required for the uptake activity of tat. For example, a protein fragment or a peptide which has fewer than the 86 amino acids, but which exhibits uptake into cells and uptake into the cell nucleus, can be used (a functionally effective fragment or portion of tat). Tat protein containing residues 1-72 is sufficient for uptake activity and tat residues 1-67 are shown to mediate the entry of a heterologous protein into cells. In addition, a synthetic peptide containing tat residues 1-58 has been shown to have uptake activity. A tat peptide comprising the region that mediates entry and uptake into cells can be further defined using known techniques (see, e.g., Frankel, A. D. et al., Proc. Natl. Acad. Sci. USA, £6:7397-7401 (1989)).

The tat peptide can be a single (i.e., continuous) amino acid sequence present in the tat polypeptide or it can be two or more amino acid sequences which are present in the tat polypeptide, but in the naturally-occurring protein are separated by other amino acid sequences. As used herein, tat protein includes a naturally-occurring amino acid sequence which is the same as that of naturally- occurring tat protein, its functional equivalent or functionally equivalent fragments thereof (peptides). Such functional equivalents or functionally equivalent fragments possess uptake activity into the cell and into the cell nucleus that is substantially similar to that of naturally occurring tat protein. Tat protein can be obtained from naturally occurring sources or can be produced using genetic engineering techniques or chemical synthesis.

The amino acid sequence of naturally occurring HIV tat protein can be modified, by addition, deletion and/or substitution of at least one amino acid present in the naturally occurring tat protein, to produce modified tat protem (also referred to herein as tat protein). Modified tat protein or tat peptide analogs with increased stability can thus be produced using known techniques. Therefore, tat proteins or peptides may have amino acid sequences which are substantially similar, although not identical, to that of naturally occurring tat protein or portions thereof.

Variants of tat protein can be designed to modulate the intracellular location of tat and the molecule of interest following uptake into the cell or when expressed in the cell. When added exogenously, such variants are designed such that the ability of tat to enter cells is retained (i.e., the uptake of the variant tat protein or peptide into the cell is substantially similar to that of naturally occurring HIV tat). For example, alteration ofthe basic region thought to be important for nuclear localization (see e.g., Dang, C. V. and Lee, W. M. F., L Bin!. Chem.. 264:18019-18023 (1989); Hauber, J. et al., J. Viro 62:1181-1187 (1989); Ruben, S. A. et al., J. Virol., 62:1-8 (1989)) can result in a cytoplasmic location or partially cytoplasmic location of tat, and therefore, ofthe molecule of interest. Alternatively, a sequence for binding a cytoplasmic component can be introduced into tat in order to retain tat and the molecule of interest in the cytoplasm or to confer regulation upon nuclear uptake of tat and a linked molecule.

Naturally occurring HIV-1 tat protein has a region (amino acids 22-37) wherein 7 out of 16 amino acids are cysteine. Those cysteine residues are capable of forming disulfide bonds with each other, with cysteine residues in the cysteine-rich region of other tat protein molecules and with cysteine residues in a cargo protein or the cargo moiety of a conjugate. Such disulfide bond formation can cause loss ofthe biological activity ofthe linked moiety. Furthermore, even if there is no potential for disulfide bonding to the linked moiety, disulfide bond formation between transport domains leads to aggregation and insolubility ofthe chimeric moieties. The tat cysteine-rich region is potentially a source of serious problems in the use of naturally occurring tat protein for cellular delivery of linked molecules.

The cysteine-rich region is required for dimerization of tat in vitro, and is required for trans-activation of HIV DNA sequences. Therefore, removal ofthe tat cysteine-rich region has the additional advantage of eliminating the natural activity of tat, i.e., induction of HIV transcription and replication.

In a preferred embodiment ofthe invention, the sequence of amino acids preceding the cysteine-rich region is fused directly to the sequence of amino 5 acids following the cysteine-rich region. Such transport polypeptides are called tatΔcys, and have the general formula (tatl-21)-(tat38-n), where n is the number ofthe carboxy-terminal residue, i.e., 49-86. Preferably, n is 58-72. The amino acid sequence preceding the cysteine-rich region ofthe tat protein is not required for cellular uptake. A preferred transport moiety consists of amino acids 37-72 0 of tat protein, and is called tat37-72. Retention of tat residue 37, a cysteine, at the amino terminus ofthe transport polypeptide is preferred, because it is useful for chemical cross-linking. Other preferred tat transport peptides include amino acids 49-57, 47-58, 47-72, 37-72, 38-72, 38-58, 37-58, 1-21 and 38-72, 47-62, and 38-62 (see U.S. Patent No. 5,804,604, which is specifically incorporated by 5 reference herein), as well as the minimal 11 amino acids of tat present in pTAT (i.e., YGRKKRRQRRR (SEQ ID NO:7) (see Ezhevsky et al., 1997; and Lissy et al., 1998).

The advantages ofthe tatΔcys polypeptides, tat37-72 and other embodiments of this invention include the following: a) the natural activity of tat protein, i.e., induction of HTV transcription, is eliminated; b) dimers, and higher multimers ofthe transport polypeptide are avoided; c) the level of expression of tatΔcys genetic fusions in E. coli may be improved; d) some polypeptide conjugates or fusion polypeptides may display increased solubility and superior ease of handling; and some may display increased activity, as compared with conjugates or fusions containing the cysteine-rich region.

The attachment of anti-apoptotic moiety to a transport domain to produce a chimeric moiety ofthe invention may be effected by any means which produces a link between the two moieties which is sufficiently stable to withstand the conditions used and which does not alter the function of either moiety. Preferably, the link between them is covalent. For example, recombinant techniques can be used to covalently attach tat protein to FLIP, such as by joining the gene coding for FLIP with the gene coding for tat and introducing the resulting gene construct into a cell capable of expressing the fusion polypeptide. Alternatively, the two separate nucleotide sequences can be expressed in a cell or can be synthesized chemically and subsequently joined, using known techniques. Alternatively, a FLIP -tat polypeptide can be synthesized chemically as a single amino acid sequence (i.e., one in which both constituents are present) and, thus, joining is not needed.

Numerous chemical cross-linking methods are known and potentially applicable for linking the transport moiety to the anti-apoptotic moiety. Many known chemical cross-linking methods are non-specific, i.e., they do not direct the point of coupling to any particular site on the transport moiety or the anti- apoptotic moiety. As a result, use of non-specific cross-linking agents may attack functional sites or sterically block active sites, rendering the conjugated proteins biologically inactive.

A preferred approach to increasing coupling specificity is direct chemical coupling to a functional group found only once or a few times in or both ofthe polypeptides to be cross-linked. For example, in many proteins, cysteine, which is the only protein amino acid containing a thiol group, occurs only a few times. Also, for example, if a polypeptide contains no lysine residues, a cross-linking reagent specific for primary amines will be selective for the amino terminus of that polypeptide. Successful utilization of this approach to increase coupling specificity requires that the polypeptide have the suitably rare and reactive residues in areas ofthe molecule that may be altered without loss ofthe molecule's biological activity.

Cysteine residues may be replaced when they occur in parts of a polypeptide sequence where their participation in a cross-linking reaction would likely interfere with biological activity. When a cysteine residue is replaced, it is typically desirable to minimize resulting changes in polypeptide folding. Changes in polypeptide folding are minimized when the replacement is chemically and sterically similar to cysteine. For these reasons, serine is preferred as a replacement for cysteine. Thus, a cysteine residue may be introduced into a polypeptide's amino acid sequence for cross-linking purposes. When a cysteine residue is introduced, introduction at or near the amino' or carboxy' terminus is preferred. Conventional methods are available for such amino acid sequence modifications, whether the polypeptide of interest is produced by chemical synthesis or expression of recombinant DNA.

Coupling ofthe two moieties can be accomplished via a coupling or conjugating agent. There are several intermolecular cross-linking reagents which can be utilized (see, for example, Means, G. E. and Feeney, R. E., Chemical Modification of Proteins, Holden-Day, pp.39-43 (1974)). Among these reagents are, for example, J-succinimidyl 3-(2-pryidyldithio) propionate (SPDP or N, N'-(l,3-phenylene) bismaleimide (both of which are highly specific for sulfhydryl groups and form irreversible linkages); N, N'-ethylene-bis- (iodoacetamide) or other such reagent having 6 to 11 carbon methylene bridges (which relatively specific for sulfhydryl groups); and l,5-difluoro-2,4- dinitrobenzene (which forms irreversible linkages with amino and tyrosine groups). Other cross-linking reagents useful for this purpose include: p,p'- difluoro-m,m'-dinitrodiphenylsulfone (which forms frreversible cross-linkages with amino and phenolic groups); dimethyl adipimidate (which is specific for amino groups); phenol- 1,4-disulfonylchloride (which reacts principally with amino groups); hexamethylenediisocyanate or diisothiocyanate, or azophenyl-p- diisocyanate (which reacts principally with amino groups); glutaraldehyde (which reacts with several different side chains) and disdiazobenzidine (which reacts primarily with tyrosine and histidine).

Cross-linking reagents may be homobifunctional, i.e., having two functional groups that undergo the same reaction. A preferred homobifunctional cross-linking reagent is bismaleimidohexame ("BMH"). BMH contains two maleimide functional groups, which react specifically with sulfhydryl-containing compounds under mild conditions (pH 6.5-7.7). The two maleimide groups are connected by a hydrocarbon chain. Therefore, BMH is useful for irreversible cross-linking of polypeptides that contain cysteine residues.

Cross-linking reagents may also be heterobifunctional. Heterobifunctional cross-linking agents have two different functional groups, for example, an amine-reactive group and a thiol-reactive group, that will cross-link two proteins having free amines and thiols, respectively. Examples of heterobifunctional cross-linking agents are succinimidyl 4-(N- maleimidomethyl)cyc lohexane- 1 -carboxylate ("SMCC"), m-maleimidobenzoyl- N-hydroxysuccinimide ester ("MBS"), and succinimide 4-(p-maleimidophenyl) butyrate ("SMPB"), an extended chain analog of MBS. The succinimidyl group of these cross-linkers reacts with a primary amine, and the thiol-reactive maleimide forms a covalent bond with the thiol of a cysteine residue. Cross-linking reagents often have low solubility in water. A hydrophilic moiety, such as a sulfonate group, may be added to the cross-linking reagent to improve its water solubility. Sulfo-MBS and sulfo-SMCC are examples of cross-linking reagents modified for water solubility.

Many cross-linking reagents yield a conjugate that is essentially non- cleavable under cellular conditions. However, some cross-linking reagents contain a covalent bond, such as a disulfide, that is cleavable under cellular conditions. For example, dit obis(succinimidylpropionate) ("DSP"), Traut's reagent and N-succinimidyl 3-(2-pyridyldithio)propionate ("SPDP") are well- known cleavable cross-linkers. The use of a cleavable cross-linking reagent permits the anti-apoptotic moiety to separate from the transport polypeptide after delivery into the target cell. Direct disulfide linkage may also be useful.

Some new cross-linking reagents such as n-γ-maleimidobutyryloxy- succinimide ester ("GMBS") and sulfo-GMBS, have reduced immunogenicity. In some embodiments ofthe present invention, such reduced immunogenicity may be advantageous.

Numerous cross-linking reagents, including the ones discussed above, are commercially available. Detailed instructions for their use are readily available from the commercial suppliers. A general reference on protein cross-linking and conjugate preparation is: S. S. Wong, Chemistry of Protein Conjugation and Cross-Linking, CRC Press (1991).

Chemical cross-linking may include the use of spacer arms. Spacer arms provide intramolecular flexibility or adjust intramolecular distances between conjugated moieties and thereby may help preserve biological activity. A spacer arm may be in the form of a polypeptide moiety comprising spacer amino acids. Alternatively, a spacer arm may be part ofthe cross-linking reagent, such as in "long-chain SPDP" (Pierce Chem. Co., Rockford, III, cat. No. 21651 H). TTT. Dosages, Formulations and Routes of Administration of the Agents ofthe Invention

The therapeutic agents ofthe invention, including their salts, are preferably administered at dosages of at least about 0.01 to about 100 mg/kg, more preferably about 0.1 to about 50 mg/kg, and even more preferably about 0.1 to about 30 mg/kg, of body weight, although other dosages may provide beneficial results. The amount administered will vary depending on various factors including, but not limited to, the agent chosen, the disease, whether prevention or treatment is to be achieved, and if the agent is modified for bioavailability and in vivo stability.

Administration of a sense or antisense nucleic acid molecule may be accomplished through the introduction of cells transformed with an expression cassette comprising the nucleic acid molecule (see, for example, WO 93/02556) or the adininistration ofthe nucleic acid molecule (see, for example, Feigner et al., U.S. Patent No. 5,580,859, Pardoll et al., Immunity, 2, 165 (1995);

Stevenson et al., Immunol. Rev., 145, 211 (1995); Moiling, J. Mol. Med.. 25, 242 (1997); Donnelly et al., Ann. N.Y. Acad. Sci., 222, 40 (1995); Yang et al., Mnl Med. Today. 2, 476 (1996); Abdallah et al., Biol. Cell, £5, 1 (1995)). Pharmaceutical formulations, dosages and routes of administration for nucleic acids are generally disclosed, for example, in Feigner et al., supra.

The amount of therapeutic agent acbninistered is selected to treat a particular indication. The therapeutic agents ofthe invention are also amenable to chronic use for prophylactic purposes, preferably by systemic administration.

Administration ofthe therapeutic agents in accordance with the present invention may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose ofthe administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The administration ofthe agents ofthe invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.

One or more suitable unit dosage forms comprising the therapeutic agents ofthe invention, which, as discussed below, may optionally be formulated for sustained release, can be administered by a variety of routes including oral, or parenteral, including by rectal, buccal, vaginal and sublingual, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, intrathoracic, intrapulmonary and intranasal routes. The formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to pharmacy. Such methods may include the step of bringing into association the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system. When the therapeutic agents ofthe invention are prepared for oral administration, they are preferably combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation, or unit dosage form. The total active ingredients in such formulations comprise from 0.1 to 99.9% by weight ofthe formulation. By "pharmaceutically acceptable" it is meant the carrier, diluent, excipient, and/or salt must be compatible with the other ingredients ofthe formulation, and not deleterious to the recipient thereof. The active ingredient for oral administration may be present as a powder or as granules; as a solution, a suspension or an emulsion; or in achievable base such as a synthetic resin for ingestion ofthe active ingredients from a chewing gum. The active ingredient may also be presented as a bolus, electuary or paste.

Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, douches, lubricants, foams or sprays containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate. Formulations suitable for rectal administration may be presented as suppositories.

Pharmaceutical formulations containing the therapeutic agents ofthe invention can be prepared by procedures known in the art using well known and readily available ingredients. For example, the agent can be formulated with common excipients, diluents, or carriers, and formed into tablets, capsules, suspensions, powders, and the like. Examples of excipients, diluents, and carriers that are suitable for such formulations include the following fillers and extenders such as starch, sugars, mannitol, and silicic derivatives; binding agents such as carboxymethyl cellulose, HPMC and other cellulose derivatives, alginates, gelatin, and polyvinyl-pyrrolidone; moisturizing agents such as glycerol; disintegrating agents such as calcium carbonate and sodium bicarbonate; agents for retarding dissolution such as paraffin; resorption accelerators such as quaternary ammonium compounds; surface active agents such as cetyl alcohol, glycerol monostearate; adsorptive carriers such as kaolin and bentonite; and lubricants such as talc, calcium and magnesium stearate, and solid polyethyl glycols.

For example, tablets or caplets containing the agents ofthe invention can include buffering agents such as calcium carbonate, magnesium oxide and magnesium carbonate. Caplets and tablets can also include inactive ingredients such as cellulose, pregelatinized starch, silicon dioxide, hydroxy propyl methyl cellulose, magnesium stearate, microcrystalline cellulose, starch, talc, titanium dioxide, benzoic acid, citric acid, com starch, mineral oil, polypropylene glycol, sodium phosphate, and zinc stearate, and the like. Hard or soft gelatin capsules containing an agent ofthe invention can contain inactive ingredients such as gelatin, microcrystalline cellulose, sodium lauryl sulfate, starch, talc, and titanium dioxide, and the like, as well as liquid vehicles such as polyethylene glycols (PEGs) and vegetable oil. Moreover, enteric coated caplets or tablets of an agent ofthe invention are designed to resist disintegration in the stomach and dissolve in the more neutral to alkaline environment ofthe duodenum.

The therapeutic agents ofthe invention can also be formulated as elixirs or solutions for convenient oral administration or as solutions appropriate for parenteral a<-ministration, for instance by intramuscular, subcutaneous or intravenous routes. The pharmaceutical formulations ofthe therapeutic agents ofthe invention can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.

Thus, the therapeutic agent may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampules, pre-filled syringes, small volume infusion containers or in multi-dose containers with an added preservative. The active ingredients may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use. These formulations can contain pharmaceutically acceptable vehicles and adjuvants which are well known in the prior art. It is possible, for example, to prepare solutions using one or more organic solvent(s) that is/are acceptable from the physiological standpoint, chosen, in addition to water, from solvents such as acetone, ethanol, isopropyl alcohol, glycol ethers such as the products sold under the name "Dowanol", polyglycols and polyethylene glycols, C,-C₄ alkyl esters of short-chain acids, preferably ethyl or isopropyl lactate, fatty acid triglycerides such as the products marketed under the name "Miglyol", isopropyl myristate, animal, mineral and vegetable oils and polysiloxanes.

The compositions according to the invention can also contain thickening agents such as cellulose and/or cellulose derivatives. They can also contain gums such as xanthan, guar or carbo gum or gum arable, or alternatively polyethylene glycols, bentones and montmorillonites, and the like.

It is possible to add, if necessary, an adjuvant chosen from antioxidants, surfactants, other preservatives, film-forming, keratolytic or comedolytic agents, perfumes and colorings. Also, other active ingredients may be added, whether for the conditions described or some other condition.

For example, among antioxidants, t-butylhydroquinone, butylated hydro xyanisole, butylated hydroxytoluene and α-tocopherol and its derivatives may be mentioned. The galenical forms chiefly conditioned for topical application take the form of creams, milks, gels, dispersion or microemulsions, lotions thickened to a greater or lesser extent, impregnated pads, ointments or sticks, or alternatively the form of aerosol formulations in spray or foam form or alternatively in the form of a cake of soap.

Additionally, the agents are well suited to formulation as sustained release dosage forms and the like. The formulations can be so constituted that they release the active ingredient only or preferably in a particular part ofthe intestinal or respiratory tract, possibly over a period of time. The coatings, envelopes, and protective matrices may be made, for example, from polymeric substances, such as polylactide-glycolates, liposomes, microemulsions, microparticles, nanoparticles, or waxes. These coatings, envelopes, and protective matrices are useful to coat indwelling devices, e.g., stents, catheters, peritoneal dialysis tubing, and the like.

The therapeutic agents ofthe invention can be delivered via patches for transdermal administration. See U.S. Patent No. 5,560,922 for examples of patches suitable for transdermal delivery of a therapeutic agent. Patches for transdermal delivery can comprise a backing layer and a polymer matrix which has dispersed or dissolved therein a therapeutic agent, along with one or more skin permeation enhancers. The backing layer can be made of any suitable material which is impermeable to the therapeutic agent. The backing layer serves as a protective cover for the matrix layer and provides also a support function. The backing can be formed so that it is essentially the same size layer as the polymer matrix or it can be of larger dimension so that it can extend beyond the side of the polymer matrix or overlay the side or sides ofthe polymer matrix and then can extend outwardly in a manner that the surface ofthe extension ofthe backing layer can be the base for an adhesive means. Alternatively, the polymer matrix can contain, or be formulated of, an adhesive polymer, such as polyacrylate or acrylate/vinyl acetate copolymer. For long-term applications it might be desirable to use microporous and/or breathable backing laminates, so hydration or maceration ofthe skin can be n-Linimized.

Examples of materials suitable for making the backing layer are films of high and low density polyethylene, polypropylene, polyurethane, polyvinylchloride, polyesters such as poly(ethylene phthalate), metal foils, metal foil laminates of such suitable polymer films, and the like. Preferably, the materials used for the backing layer are laminates of such polymer films with a metal foil such as aluminum foil. In such laminates, a polymer film ofthe laminate will usually be in contact with the adhesive polymer matrix. The backing layer can be any appropriate thickness which will provide the desired protective and support functions, a suitable thickness will be from about 10 to about 200 microns. Generally, those polymers used to form the biologically acceptable adhesive polymer layer are those capable of forming shaped bodies, thin walls or coatings through which therapeutic agents can pass at a controlled rate. Suitable polymers are biologically and pharmaceutically compatible, nonallergenic and insoluble in and compatible with body fluids or tissues with which the device is contacted. The use of soluble polymers is to be avoided since dissolution or erosion ofthe matrix by skin moisture would affect the release rate ofthe therapeutic agents as well as the capability ofthe dosage unit to remain in place for convenience of removal. Exemplary materials for fabricating the adhesive polymer layer include polyethylene, polypropylene, polyurethane, ethylene/propylene copolymers, ethylene/ethylacrylate copolymers, ethylene/vinyl acetate copolymers, silicone elastomers, especially the medical-grade polydimethylsiloxanes, neoprene rubber, polyisobutylene, polyacrylates, chlorinated polyethylene, polyvinyl chloride, vinyl chloride- vinyl acetate copolymer, crosslinked polymethacrylate polymers (hydrogel), polyvinylidene chloride, poly(ethylene terephthalate), butyl rubber, epichlorohydrin rubbers, ethylenvinyl alcohol copolymers, ethylene- vinyloxyethanol copolymers; silicone copolymers, for example, polysiloxane- polycarbonate copolymers, polysiloxanepolyethylene oxide copolymers, polysiloxane-polymethacrylate copolymers, polysiloxane-alkylene copolymers (e.g., polysiloxane-ethylene copolymers), polysiloxane-alkylenesilane copolymers (e.g., polysiloxane-ethylenesilane copolymers), and the like; cellulose polymers, for example methyl or ethyl cellulose, hydroxy propyl methyl cellulose, and cellulose esters; polycarbonates; polytetrafluoroethylene; and the like.

Preferably, a biologically acceptable adhesive polymer matrix should be selected from polymers with glass transition temperatures below room temperature. The polymer may, but need not necessarily, have a degree of crystallinity at room temperature. Cross-linking monomeric units or sites can be incorporated into such polymers. For example, cross-linking monomers can be incoφorated into polyacrylate polymers, which provide sites for cross-linking the matrix after dispersing the therapeutic agent into the polymer. Known cross-linking mon- omers for polyacrylate polymers include polymethacrylic esters of polyols such as butylene diacrylate and dimethacrylate, trimethylol propane trimethacrylate and the like. Other monomers which provide such sites include allyl acrylate, allyl methacrylate, diallyl maleate and the like. Preferably, a plasticizer and/or humectant is dispersed within the adhesive polymer matrix. Water-soluble polyols are generally suitable for this purpose. Incorporation of a humectant in the formulation allows the dosage unit to absorb moisture on the surface of skin which in turn helps to reduce skin irritation and to prevent the adhesive polymer layer ofthe delivery system from failing.

Therapeutic agents released from a transdermal delivery system must be capable of penetrating each layer of skin. In order to increase the rate of permeation of a therapeutic agent, a transdermal drug delivery system must be able in particular to increase the permeability ofthe outermost layer of skin, the stratum corneum, which provides the most resistance to the penetration of molecules. The fabrication of patches for transdermal delivery of therapeutic agents is well known to the art.

For administration to the upper (nasal) or lower respiratory tract by inhalation, the therapeutic agents ofthe invention are conveniently delivered from an insufflator, nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray. Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount.

Alternatively, for administration by inhalation or insufflation, the composition may take the form of a dry powder, for example, a powder mix of the therapeutic agent and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form in, for example, capsules or cartridges, or, e.g., gelatine or blister packs from which the powder may be administered with the aid of an inhalator, insufflator or a metered-dose inhaler. For intra-nasal administration, the therapeutic agent may be administered via nose drops, a liquid spray, such as via a plastic bottle atomizer or metered- dose inhaler. Typical of atomizers are the Mistometer (Wintrop) and the Medihaler (Riker). The local delivery ofthe therapeutic agents ofthe invention can also be by a variety of techniques which administer the agent at or near the site of disease. Examples of site-specific or targeted local delivery techniques are not intended to be limiting but to be illustrative ofthe techniques available. Examples include local delivery catheters, such as an infusion or indwelling catheter, e.g., a needle infusion catheter, shunts and stents or other implantable devices, site specific carriers, direct injection, or direct applications.

For topical administration, the therapeutic agents may be formulated as is known in the art for direct application to a target area. Conventional forms for this purpose include wound dressings, coated bandages or other polymer coverings, ointments, creams, lotions, pastes, jellies, sprays, and aerosols, as well as in toothpaste and mouthwash, or by other suitable forms, e.g., via a coated condom. Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents. Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents. The active ingredients can also be delivered via iontophoresis, e.g., as disclosed in U.S. Patent Nos. 4,140,122; 4,383,529; or 4,051,842. The percent by weight of a therapeutic agent ofthe invention present in a topical formulation will depend on various factors, but generally will be from 0.01% to 95% ofthe total weight ofthe formulation, and typically 0.1-25% by weight.

When desired, the above-described formulations can be adapted to give sustained release ofthe active ingredient employed, e.g., by combination with certain hydrophilic polymer matrices, e.g., comprising natural gels, synthetic polymer gels or mixtures thereof.

Drops, such as eye drops or nose drops, may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs. Drops can be delivered via a simple eye dropper-capped bottle, or via a plastic bottle adapted to deliver liquid contents dropwise, via a specially shaped closure. The therapeutic agent may further be formulated for topical administration in the mouth or throat. For example, the active ingredients may be formulated as a lozenge further comprising a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia; mouthwashes comprising the composition ofthe present invention in a suitable liquid carrier; and pastes and gels, e.g., toothpastes or gels, comprising the composition ofthe invention.

The formulations and compositions described herein may also contain other ingredients such as antimicrobial agents, or preservatives. Furthermore, the active ingredients may also be used in combination with other therapeutic agents, for example, oral contraceptives, bronchodilators, anti- viral agents, steroids and the like.

To employ a fusion polypeptide comprising an anti-apoptotic polypeptide such as FLIP to enhance the immunological response of a particular immunogen, e.g., the Haemophilis influenza type b (Hib) capsular polysaccharide (polyribosylribitol phosphate, PRP), FLIP or a portion thereof, may be conjugated to the immunogen. Thus, for example, a fusion polypeptide comprising FLIP, tat, and an immunogenic moiety, can be used in making a vaccine. For example, the immunogenic moiety can be an antigen from the bacteria or virus or other infectious agent that the vaccine is employed to immunize against (e.g., gpl20 of HIN). Providing the antigen into the cell cytoplasm allows the cell to process the fusion polypeptide, including the immunogenic moiety, and express it on the cell surface. Expression ofthe immunogenic moiety on the cell surface will raise a killer T-lymphocyte response, thereby inducing immunity. The use of nucleic acid molecules to prepare vaccines is described in, for example, Feigner et al., supra and Stevenson et al., supra. A vaccine ofthe invention may also comprise cells or viruses having nucleic acid encoding the immunogen and an anti-apoptotic polypeptide, e.g., FLIP or a portion thereof, optionally as a fusion polypeptide.

For a general description of vaccine principles and practice, see Ada, In: Fundamental Immunology, 2^nd ed., Raven Press Ltd., N.Y., pp. 985-1030 (1989).

The invention will be further described by the following example.

Example 1

Materials and Methods Cells and Culture Condition To isolate CD3⁺ T cells, peripheral blood rnononuclear cells (PBMC) from healthy donors were isolated from buffy coats by density gradient centrifugation (Ficoll-Hypaque; Pharmacia LKB Biotechnology, Inc., Piscataway, NJ). PBMCs were then depleted of monocytes by two cycles of plastic adherence, and CD3⁺ T cells were purified by neuraminidase treated sheep red blood cell (SRBC) rosetting. The remaining cell population was repeatedly found to be 98% CD3⁺ T cells as determined by flow cytometry analysis. CD3⁺ T cells used in the various experiments were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA), 2 mM L-glutamine, and antibiotics (penicillin 100/ml, streptomycin 100 μg/ml) (Whitaker Bioproducts, Walkersville, MD) at 2 x 10⁶ cells/ml in 24 well plates.

Antibodies, Reagents, and Plasmids. The apoptosis-inducing anti-Fas cross linking monoclonal antibodies (clone CH-11, IgM) was purchased from Upstate Biotechnology (Lake Placid, NY) and used at 500 ng/ml. The anti-IL2 neutralizing antibody was obtained from R&D Systems (Minneapolis, MN) and anti-IL6 antibody (M10) was a gift from Immunex Corp. (Seattle, WA). The pharmacological inhibitors: cyclosporin A (CsA), rapamycin (RAP), aphidicolin (APH), and mimosine (MIMO) were purchased from Calbiochem (La Jolla, CA). The anti human FLIP antiserum was generated by injecting rats with a peptide spanning amino acids 2-26 of human FLIP

(SAEVIHQVEEALDTDEKEMLFLCRD; SEQ ED NO:l) (Irmler et al., 1997; Griffith et al., 1998). The anti-FLICE antibody was obtained from Santa Cruz (Santa Cruz, CA). CDN T Cell Cross Linking. Purified CD3⁺ T cells were incubated for 45 minutes at 4°C with the monoclonal antibody anti-CD3 (OKT3, ATCC), and anti-CD28 (Becton Dickinson, CA), or an isotype matched control mouse IgG2a (Sigma, St. Louis, MO), at a concentration of 5 μg of antibody/2 x 10° cells/ml. Antibody bound cells were then washed and cross linked by incubation in 24 well Nunclon® plates (Sigma) that had been previously coated with goat anti- mouse (GAM) antibodies (Biosource, CA) and incubated for the indicated times at 37°C. GAM antibody pre-coating was performed using 20 μg ofthe antibody preparation in 200 μl of 0.05 M carbonate buffer/well for 2 hours at 37°C and washed twice with 10% RPMI 1640.

For T cell activation in the presence of inhibitors, CsA was added to the cells (200 nM) one hour prior to CD3 cross linking. RAP (100 nM), anti-IL2 (30 μg/ml), and anti-IL6 (30 μg/ml) neutralizing antibodies were added at the time of cross linking. The inhibitors were present during the length of T cell activation. For FLIP rescue experiments, HA-TAT-FLDP fusion protein was added to cell cultures 1 hour prior to anti-Fas stimulation.

For cell cycle synchronization, CD3⁺T cells were CD3 cross linked in the presence of CsA for 20 hours, after which cells were extensively washed and incubated with recombinant human IL-2 (200 U/ml) (Chiron, CA) in the absence of presence ofthe indicated cell cycle blocker for the indicated time period. Cell cycle blockers were used at 5 μg/ml of ADH and 300 μM of MIMO. Cell Death Induction and Analysis. To determine Fas-mediated apoptosis, CD3 cross linked T cells were treated with anti-Fas cross linking IgM antibody (CH- 11) for 24 hours during the indicated incubation times. Flow cytometry analysis for apoptosis was performed by propidium iodide staining. Briefly, cells were harvested, and washed in 1 ml of PBS. Cells were resuspended in Saponin buffer (20 mM HEPES pH=7.4, 120 mM NaCl, 60 μg/ml saponin) containing 50 μg/ml RNase a and 20 μg/ml propidium iodide (PI), incubated 1 hour at 37°C in the dark and analyzed immediately on a FACScan® flow cytometer. The results were calculated using CellQuest® software and cell death was determined by gating in the subdiploid population.

The percent cell death using trypan blue dye exclusion was calculated as follows: (total number of blue cells)(100 x total number of cells). Results from cultures from triplicate cells were used to calculate the mean and standard deviation.

T cell Proliferation Assays. Thymidine incorporation was measured after 24, 48 and 72 hours of stimulation. Cells (1 x 10⁵) were pulsed by the addition of 1.25 μCi of methyl [³H] thymidine (5.0 Ci/mmol, Amersham, IL) for 8 hours. Cells were harvested and thymidine incorporation measured on a Matrix 96 direct betaplate counter (Packard, CT). Data are expressed as the mean cpm of triplicate wells. Cell Extraction and Western Immunohlotting. Total cellular protein extracts were obtained by washing the cells twice in phosphate buffer saline and resuspending the cells in lysis buffer (IX Phosphate Buffer Saline (PBS) pH=7.4 containing 0.5% NP-40, 0.5 mM PMSF, 10 μg/ml leupeptin, 2 μg/ml aproptinin, and 2 μg/ml pepstatin). Cells were kept on ice for 10 minutes, and centrifuged at 12,000 x g for 15 minutes. The amount of cellular protein present in the clarified supernatant was calculated using the Bio-Rad protein assay.

For Western blotting, equal amounts of cellular protein (15 or 25 μg) for each sample were loaded and separated on a 10% SDS-PAGE and transferred to Immobilon-P membranes (Millipore, Bedford, MA) by standard procedures. Blots were hybridized with anti-FLIP rat serum, followed by rabbit anti-rat IgG HRP conjugated (Amersham), and anti-FLICE antibodies followed by HRP- linked protein A. Anti-actin polyclonal antibody (Sigma) was used as control for equal protein loading.

TAT Fusion Protein Purification. The human FLIP cDNA (obtained from Dr. Jurg Tschopp, Switzerland) was cloned into the Xhol-Ncol site of pHA-TAT vector, which contains the N-terminal protein transduction domain from the human immunodeficiency virus tat protein (Ezhevsky et al., 1997; Lissy et al., 1998), using PCR and the following primers: sense primer 5' CATGCCATGGTCATGTCTGCTGAA 3' (SEQ ID NO:5) and antisense primer 5' CGGAATTCTAGACTAGTCATCTACTCGAG 3' (SEQ ID NO:6). HA-TAT-FLIP fusion protein was transformed into BL-21 cells and expressed in exponentially growing BL-21 cells cultured in selection media by a two hours treatment with IPTG. The fusion protein was purified by sonication in 10 ml of 8 M urea, 100 mM NaCl, 20 mM HEPES (pH=8.0). Lysates were clarified by centrifugation and the supernatant loaded into a 3 ml Ni-NTA column (Qiagen) in the above buffer containing 10 mM imidazole. HA-TAT-FLIP fusion protein was eluted by increasing concentration of imidazole followed by dialysis. Protein purity was analyzed by Commasie Blue staining. Intracellular levels of HA-TAT-FLIP were detected by Western blot analysis using anti-HA antibodies. HA-TAT-FLEP fusion protein internalized in a concentration dependent first- order equilibrium reaction, reaching maximum intracellular concentrations in 30 minutes (Lissy et al., 1998). The TAT-E7 plasmid (kindly provided by Dr. Steven Dowdy) was purified as described above. Cell Sorting. For cell cycle analysis of FLIP levels, CD3XL T cells were washed with PBS and resuspended in PBS containing 10 μg/ml of Hoeschst 33342 (Calbiochem, CA) during 1 hour at 37°C. Cells were immediately analyzed using a FACStar® (Becton Dickinson, CA), gated and sorted into G0/G1 and S phase based in the Hoeschst 33342 fluorescence and DNA content. Densitometry Analysis. Immunoreactive bands on Western blots were analyzed using AMBIS. Background levels were subtracted from each sample. FLIP and FLICE protein levels were normalized to actin levels for each sample. The protein levels ofthe control (IgGXL) were arbitrarily set at 1.0 and the change in protein levels was calculated as the protein levels in the experimental samples (CD3XL and CD3XL/CD28XL) divided by the protein levels in the control sample (IgGXL). Re-su-ls

T Cell Activation and FLIP Protein Levels. Previous reports demonstrated that T cell activation is a necessary step to render resting lymphocytes susceptible to Fas mediated apoptosis (reviewed in Green et al., 1994, and Krammer et al., 1994). In order to study the T cell activation mediated events that results in susceptibility to Fas induced apoptosis, human primary CD3⁺ T cells were employed. To determine whether T cell receptor (TCR) activation results in down regulation of inhibitors ofthe Fas signaling pathway such as FLIP, resting primary peripheral CD3⁺ T cells were stimulated with IgG isotype, anti-CD3, or the combination of anti-CD3 and anti-CD28 antibodies for different time periods, after which cells were lysed, and FLIP protein levels were analyzed by immunoblotting. In parallel, the effect of CD3, or CD3 and CD28, cross linking was verified by analyzing lymphocyte proliferation as measured by [³H] thymidine incorporation during the different incubation periods. As shown in Figure 1 A and IB, T cell activation triggered by anti-CD3 or anti-CD3 and anti- CD28, but not IgG isotype, antibodies results in a significant decrease on FLIP protein levels after 72 hours of T cell activation. In contrast, the levels of caspase-8, another component ofthe Fas signaling pathway, were not significantly modified following T cell activation. Decreased FLIP levels were not associated with the appearance of cleavage forms. No significant differences in FLIP protein levels were observed between anti-CD3 or the combination of anti-CD3 and anti-CD28 stimulated T cells, suggesting that CD3 mediated T cell activation is sufficient to cause a reduction of FLIP protein levels, in the absence of CD28 co-activation.

To determine whether the decreased FLIP protein levels observed following T cell activation correlated with susceptibility to Fas mediated apoptosis, CD3⁺ T cells were activated for 24 or 72 hours with anti-CD3 antibodies (alone or in combination with anti-CD28 antibodies) or IgG isotype antibodies, followed by the addition of an anti-Fas IgM agonist antibody for 20 hours. The highest degree of susceptibility to Fas mediated apoptosis was observed after 72 hours of CD3 activation (Figure 1C), a time period which correlated with the marked decrease in FLIP protein levels (Figure 1 A and B). Similar results were observed when anti-CD3 and anti-CD28 antibodies were combined, confiπning that CD3 mediated T cell activation alone is sufficient to cause both a decrease in FLIP levels and to render the cell susceptible to Fas mediated apoptosis. In order to show that FLIP degradation is the event necessary for induction of Fas mediated AICD, exogenous FLIP was added to activated T cells. FLIP was added as a full length fusion protein containing the HIV-Tat. HTV-Tat has previously been shown to be internalized into more than 99% of target cells (Lissy et al., 1998). CD3⁺ T cells were activated for 72 hours with anti-CD3 antibodies and treated HA-tagged TAT-FLIP fusion protein or an irrelevant fusion protein (TAT-E7) for 1 hour followed by the addition of anti- Fas antibody for 20 hours. As shown in Figure 2, addition of HA-TAT-FLIP but not the TAT-E7 fusion protein to CD3⁺ activated T cells reverses the susceptibility to Fas mediated apoptosis in a concentration dependent manner without affecting viability in control mock treated cells. These results indicate that, following T cell activation, decreased levels of FLIP is sufficient to induce a state of susceptibility to Fas mediated apoptosis in peripheral human T lymphocytes.

IT .-?. Production and Signaling is Required for Decreased FLIP Protein Levels. IL-2 is one ofthe prevalent cytokines produced following T cell activation. In addition, IL-2 have been shown to predispose mature T lymphocytes to apoptosis (Leonardo et al., 1991). IL-2 seems to play a critical role in the control of AIDC since mice lacking EL-2 receptor α chain (IL-2Rα) signaling subunit are defective in Fas mediated apoptosis and have abnormal lymphocyte accumulation (Van Parijs et al., 1997; Kneitz et al., 1995; Willerford et al., 1995; Suzuki et al., 1995. Based on this information, the potential role of IL-2 in regulating FLIP protein levels following TCR activation in primary resting T cells was investigated. CD3⁺ T cells were activated with anti-CD3 antibodies for 72 hours in the presence or absence of CsA, an inhibitor ofthe initial phase of TCR mediated T cell activation and EL-2 production (Schrieber et al., 1992). Immunoblot analysis of cytosolic extracts demonstrated that the decreased levels of FLIP that are observed 72 hours following T cell activation by anti-CD3 antibodies, but not isotype control antibodies, is inhibited by CsA (Figure 3 A). This implies that events that ensue following T cell activation, such as IL-2 production, can alter intracellular levels of FLIP.

CsA blocks many signal transduction pathways triggered by TCR activation, including those leading to IL-2 production (Schrieber et al., 1992). The role to IL-2 was further elucidated by determining whether its neutralization following T cell activation would affect intracellular levels of FLIP. CD3⁺ T cells were stimulated or not with anti-CD3 antibodies in the presence of neutralizing IL-2 or IL-6 specific antibodies for 72 hours, after which the levels of FLIP were analyzed by immunoblotting. The presence of anti-IL2 neutralizing antibodies during the process of T cell activation partially abrogated the decrease in FLIP protein levels, whereas anti-IL6 antibodies did not have an effect on FLIP protein levels (Figure 3B). These results support the requirement of IL-2 in the regulation of FLIP protein levels following T cell activation. To further confirm that the modification of FLIP levels following T cell activation conelates with susceptibility to Fas mediated apoptosis, CD3 activated T cells were incubated in the presence or absence of CsA, or anti-IL-2 neutralizing antibodies and tested for their susceptibility to Fas mediated apoptosis. As shown in Figure 3C, CsA and anti-IL2 neutralizing antibodies inhibited the induction of susceptibility to Fas mediated apoptosis. These results indicate that IL-2 is necessary and sufficient to control FLIP levels, and support the role of FLIP as inhibitor ofthe Fas signaling pathway. A Rapamycin Sensitive IL-2 Signaling Pathway Regulates FLIP Protein Level. Rapamycin is known to inhibit cell cycle progression and T cell proliferation in response to IL-2 (Dumont et al, 1990; Morice et al., 1993; Abraham et al., 1996), thus providing a tool to study whether signal transduction pathways that are triggered by the engagement of IL-2R influence FLIP protein levels. CD3⁺T cells were incubated with anti-CD3 or IgG isotype antibodies for 72 hours in the presence or absence of rapamycin, followed by the analysis of FLIP levels by immunoblotting. As shown in Figure 4A, rapamycin prevents the down regulation of FLIP protein levels induced by anti-CD3 stimulation, but has no effect on the levels of FLIP under resting conditions (IgGXL). Figure 4B shows that treatment with rapamycin during the 72 hours of T cell activation prevents susceptibility to Fas mediated apoptosis. These results are in agreement with results described above where CsA and anti-IL-2 neutralizing antibodies also blocked susceptibility to Fas mediated apoptosis.

Regulation of FLTP Levels During the Cell Cycle. In order to delineate the IL-2 signaling events that regulate FLIP levels, CD3⁺ T cells were activated with anti- CD3 antibodies in the presence of CsA to inhibit IL-2 production and to prime the cells to respond to EL-2. After 20 hours of TCR stimulation and CsA treatment, cells were incubated with IL-2 for different time periods and FLIP levels analyzed. As shown in Figure 5 A, FLIP levels decreased after 48 hours of IL-2 stimulation, and further decreased by 72 hours. The progressive decrease in FLIP protein levels parallels the increase in cell proliferation as determined by [³H] thymidine incorporation (Figure 5B). These results provide a link between IL-2 induced cell proliferation and the down regulation of FLIP protein levels. To determine whether FLIP protein levels fluctuate during the cell cycle, CD3⁺ T cells were synchronized at different stages ofthe cell cycle using mimosine, which causes and arrest of cells Gl phase, and aphidicolin, which arrests cells in the early S phase (Johnson et al., 1993; Lalande, 1990). After 20 hours of anti-CD3 antibody treatment and CsA treatment, cells were incubated with IL-2 for 72 hours in the presence or absence ofthe cell cycle blockers followed by the analysis of FLIP levels by immunoblotting. In parallel, the effectiveness ofthe cells stimulation and cell cycle inhibitors was confirmed by [³H] thymidine incorporation and flow cytometric analysis. As shown in Figure 6A, T cells arrested in early S phase with aphidicolin have decreased FLIP levels (lane 6), whereas cells arrested in the Gl phase by mimosine had FLIP levels comparable to nonstimulated cells (lane 5). These results suggest that decrease in FLIP levels occur during the Gl to S phase transition.

In order to demonstrate that FLIP levels are regulated during the cell cycle, and that the decrease in FLIP in the presence of aphidicolin is not secondary to non-specific effects ofthe cell cycle inhibition, cells were sorted based on their DNA content. Anti-CD3 activated cells were sorted using Hoeschst 33342 staining for cell cycle analysis (Figure 6B), and FLIP levels were analyzed by immunoblot. As shown in Figure 6C, the levels of FLIP in S phase cells were decreased when compared to G0/G1 gated cells. Based on these results, it was concluded that the levels of FLIP decrease when cells progress to the S phase. Discussion

While T cell activation is known to be required for susceptibility to Fas mediated apoptosis, the molecular basis for this process remains unknown. Using TCR activation of primary CD3⁺ T cells, it was shown that FLIP protein levels are markedly decreased by 72 hours of T cell activation, a time point when the cells are highly susceptible to Fas mediated apoptosis. IL-2 is the principal mediator of FLIP protein down regulation that FLIP protein levels are down regulated during S phase.

The fact that IL-2 is the critical factor controlling FLIP protein levels explains previous observations in IL-2 and IL-R knockout mice. Knockout mice develop a pronounced lymphadenopathy as well as associated inflammatory and autoimmune disorders (Willerford et al., 1995; Suzuki et al., ). These phenotypes are similar to those observed in mice lacking Fas or FasL (Reap et al, 1995; Watanabe-Fukunaga et al., 1992). In addition, it has been recently shown that activated CD25 7^" (IL-2Rα) T cells are resistant to Fas mediated AICD (Van Parijs et al., 1997), supporting the role of IL-2 as a regulator of T cell homeostasis. Furthermore, a recent study using IL-2 knockout mice demonstrated that FLIP mRNA levels are decreased following T cell activation (Rafaelli et al., 1968). The results described herein and the findings from others provide a novel molecular immune mechanism which, if defective, explains the ALPS syndrome characterized by lymphocyte accumulation in the absence of defects in Fas or FasL (Dianzani et al., 1997; Sneller et al., 1997). Inhibition of IL-2 production by CsA, or EL-2 signaling by anti IL-2 neutralizing antibodies or rapamycin is shown herein to significantly block susceptibility to Fas mediated apoptosis by preventing FLIP degradation. Either CsA, FK506, or rapamycin are being currently used or studied as potent immunosuppressive agents to prevent allograft rejection in transplantation and to decrease autoimmunity in rheumatologic diseases. A better understanding as to how these compounds can affect T cell homeostasis by targeting specific second messenger controlling Fas susceptibility of T lymphocytes may help explain some ofthe side effects of these drugs. Also, the fact that IL-2 directly influences T cell homeostasis should provide more insights as to the utilization of this cytokine in boosting the immune system in disease states already characterized by T cell depletion and enhanced T cell activation such as AIDS.

Viral and cellular FLIP have been implicated in the protection of apoptosis against death domain containing receptors (Thome et al., 1997). High levels of FLIP are detected in melanoma tumors and in resting T cells and this correlates with resistance against Fas mediated apoptosis (Irmler et al., 1997; Griffith et al., 1998). Previous reports had shown that resting T cells are unable to recruit of caspase-8 to the Fas receptor and an inhibitor of this pathway was suggested to be present in resting T cells (Peter et al., 1997). Based on the results described herein, after T cell activation, the low protein levels of FLIP may not be sufficient to prevent the binding of caspase-8, which protein levels remained unchanged, to the Fas receptor making the cell competent to receive the Fas mediated death signal.

Rapamycin inhibits the cell cycle progression triggered by IL-2 stimulation of T cells (Abraham et al., 1996) and thus the inhibition of FLIP down regulation by rapamycin further supports the requirement of cell proliferation to decrease FLIP levels. The fact that FLIP levels are down regulated during S phase provides a molecular mechanism to previous observation where TCR induced apoptosis occurs preferentially in S phase (Boehme et al., 1993). These findings may also explain why T cell lines, such as Jurkats, which are continuously proliferating by virtue of their transformed phenotype, have undetectable levels of FLIP and therefore are highly susceptible to Fas mediated apoptosis.

Thus, cell cycle regulation is implicated as essential in deciding cell fate after response to antigen stimulation. It can be hypothesized that components of the cell cycle machinery negatively regulate the Fas apoptotic pathway. Quiescent cells (GO) and cells entering the cell cycle (Gl) have a competent apoptotic machinery that is kept inactive by high levels of FLIP. Following cell cycle progression, if the conditions are favorable for proliferation, the apoptotic program will be turned off by increasing levels of FLIP; whereas if cell deletion is necessary, as in the case of self antigen recognition, FLIP levels will be down regulated allowing for functional apoptotic machinery. A previous report suggested that the late Gl check point is required to determine the cell fate (Lissy et al., 1998). Whether FLIP down regulation occurs in late Gl needs to be further investigated since the cell cycle blockers used in the study described herein do not distinguish the Gl restriction point.

A recent study suggests that FLIP down regulation may be secondary to repressed transcription (Refaelli et al., 1998). However, preliminary data indicate increased FLIP mRNA levels despite lower protein levels (data not shown). Therefore, reduction of translation or accelerated protein degradation could account for FLIP down regulation. Many elements ofthe cell cycle machinery are modulated at different stages ofthe cell cycle. The cyclin dependent kinase inhibitor, p27, is present at high amounts during GO and Gl phase and decreases as the cell enters the cell cycle. Down regulation of p27 levels is characterized by constant amounts of p27 mRNA levels and protein synthesis, accompanied by increased ubiquitin-proteasome mediated protein degradation (Pagand et al., 1998). This scenario could be analogous to FLIP protein levels regulation. Thus, FLIP levels are linked to cell cycle progression. Elucidation ofthe mechanism by which FLIP levels are regulated throughout the cell cycle will contribute in the understanding of diseases such as autoimmunity and tumor malignancies where resistance to apoptosis by death inducing receptors may play an important role in pathogenesis.

References

Abraham, R. T., and G. J. Wiederrecht. Immunopharmacology of rapamycin.

Annu. Rev. Immunol., 14:483-510 (Abstr.) (1996). Alderson, M. R., T. W. Tough, T. Davis-Smith, S. Braddy, B. Falk, K. A. Schooley, R. G. Goodwin, C. a. Smith, F. Ramsdell, and D. H. Lynch.

Fas ligand mediates activation-induced cell death in human T lymphocytes. J. Exp. Med., 181(l):71-77 (1995). Boehme, S. A., and M. J. Leonardo. Propriocidal apoptosis of mature T lymphocytes occurs at S phase ofthe cell cycle. Eur. J. Immunol. 22:1552-1560 (1993).

Boise, L. H. and C. B. Thompson. Hierarchical control of lymphocyte survival.

Science, 224:67-68 (1996). Boldin, M. P., T. M. Goncharov, Y. V. Goltsev, and D. Wallach. Involvement of

MACH, a novel MORT/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell, £5:803-815 (1996).

Chinnaiyan, A. M., K. O'Rourke, M. Tewari, and V. M. Dixit. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell, £1:505-512 (1995). Chinnaiyan, A. M., C. G. Tepper, M. F. Seldin, K. O'Rourke, F. C. Kischkel, S. Hellbardt, P. H. Krammer, M. E. Peter, and V. M. Dixit. FADD/MORT1 is a common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis. J. Biol. Chem., 271 (9) :49 1-4965 (1996). Chinnaiyan, A. M., and V. M. Dixit. Portrait of an executioner: the molecular mechanism of Fas/APO-1 -induced apoptosis. Semin. Immunol., 2:69-76. (1997)

Dhein, J., H. Walczak, C. Baumler, K.M. Debatin, and P.H. Krammer.

Autocrine T-cell suicide mediated by APO-l/(Fas/CD95). Nature,

222(6512):438-441 (¹⁹⁹⁵)- Dianzani, U., M. Bragardo, D. DiFranco, C. Alhandi, P. Scagni, D. Buonfiglio, V. Redoglia, S. Bonissoni, A. Correra, I. Dianzani, U. Ramenghi.

Deficiency ofthe Fas apoptosis pathway without Fas gene mutations in pediatric patients with autoimmunity/lymphoproliferation. Blood,

£9-/-£):2871-2879 (1997). Dumont, F. J., M.J. Staruch, S. L. Koprak, M. R. Melino, and N. H. Sigal.

Distinct mechanisms of suppression of murine T cell activation by the related macrolides FK-506 and rapamycin. T. Immunol .., 144:251-258

(1990). Ezhevsky, S. A., H. Nagahara, A. M. Vocero-Akbani, D. R. Gius, M. C. Wei, and S. F. Dowdy. Hypo-phosphorylation ofthe retinoblastoma protein

(pRb) by cyclin D:Cdk4/6 complexes results in active pRb. Proc Natl.

Δ--ad-_ScL, 24(2Q): 10699- 10704 (1997). Fisher, G. H., F. J. Rosenberg, S. E. Straus, J. K. Dale, L. A. Middelton, A. Y. Lin, W. Strober, M. J. Lenardo, and J. M. Puck. Dominant interfering

Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell, £1:935-346. (1995). Golstev, Y. V., A. V. Kovalenko, E. Arnold, E. E. Varfolomeev, V. M.

Brodianskii, and D. Wallach. CASH, a novel caspase homologue with death effector domains. J. Biol. Chem, 272(32):! 9641 -19644 (1997).

Green, D. R., and D. W. Scott. Activation-induced apoptosis in lymphocytes.

Curr. pin. Immunol , 6:476-487 (1994). Griffith, T. S., W. A. Chin, G. C. Jackson, D. H. Lynch, and M. Z. Kubin.

Intracellular regulation of TRAEL-induced apoptosis in human melanoma cells. J_^-mmunαL, 161(6):2833-2840 (1998).

Hu, S., C Vincenz, M. Buller, and V. M. Dixit. A novel family of viral death effector domain-containing molecules that inhibit both CD-95- and tumor necrosis factor receptor- 1 -induced apoptosis. J. Biol. Chem.,

22205):9621-9623 (1997a). Hu, S., C. Vincenz, J. Ni, R. Gentz, and V. M. Dixit. I-FLICE, a novel inhibitor of tumor necrosis factor receptor-1- and CD-95-induced apoptosis. JL

Biol. Chem.222(2£): 17255- 17257 (1997b). Irmler, M., M. Thome, M. Hahne, P. Schneider, K. Hofinann, V. Steiner, J.-L.

Bodmer, M. Schrδter, K. Bums, C. Mattmann, D. Rimoldi, L. E. French, and J. Tschopp. Inhibition of death receptor signals by cellular FLIP.

Nature, 2££:190-195 (1997). Johnson, R. T., C. S. Downes, and R. E. Meyn. The synchronization of mammalian cells. In The Cell cycle: a practical approach. P. Fantes and R. Brooks, eds. Oxford; New York: IRL Press at Oxford University Press

(1993). Ju, S.-T., D.J. Panka, H. Cui, R. Ettinger, M. El-Khatib, D. H. Shen, B. Z.

Stanger, and A. Marshak-Rothestein. Fas (CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature,

222:444-445 (1995a). Ju, S. T., D. J. Panka, H. Cui, R. Ettinger, M. El-Khatib, D. H. Sherr, and B. Z.

Stanger. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature, 373(651 444-448 (1995b). Kneitz, B., T. Herrmann, S. Yonehara, and A. Schimpl. Normal clonal expansion but impaired Fas-mediated cell death and anergy induction in interleukin-2-deficient mice. Fur. T. Tmmunol., 25{9-):2572-2577 (1995). Krammer, P. H., I. Behrmann, P. Daniel, J. Dhein, and K.-M. Debatin.

Regulation of apoptosis in the immune system. Curr. Biol, 6:279-289 (1994).

Lalande, M. A reversible arrest point in the late Gl phase ofthe mammalian cell cycle. Exp. Cell Research, l£6:332-339 (1990). Lenardo, M. J. Interleukin-2 programs mouse ab T lymphocytes for apoptosis.

Nature, 252:858-861 (1991). Lissy, N. A., L. F. Van Dyk, M. Becker-Hapak, A. Vocero-Akbani, J. H.

Mendler, and S. F. Dowdy. TCR antigen-induced cell death occurs from a late Gl phase cell cycle check point. Immunity, £:57-65 (1998). Mogil, R.J., L. Radvanyi, R. Gonzalez-Quintial, R. Miller, G. Mills, A. N.

Theofilopoulos, and D. R. Green. Fas (CD95) participates in peripheral T cell deletion and associated apoptosis in vivo. Tntl. Tmmunol..

2(2):1451-1458 (1995). Morice, W. G., G. J. Brunn, G. Wiederrecht, J. J. Siekierka, and R. T. Abraham.

Rapamycin-induced inhibition of p34^cdc2 kinase activation is associated with G,/S-phase growth arrest in T lymphocytes. J. Biol. Chem.. 26£(5):3734-3738 (1993).

Muzio, M., A. M. Chinnaiyan, F. C. Kischkel, K. O'Rourke, A. Shevchenko, J.

Ni, C. Scaffidi, J. D. Bretz, M. Zhang, R. Gentz, M. Mann, P. H.

Krammer, M. E. Peter, and V. M. Dixit. FLICE, a novel FADD- homologous ICE/CED-3-like protease, is recruited to the CD95

(Fas/APO-1) death-inducing signaling complex. Cell, £5:817-827

(1996). Nagata, S., and P. Golstein. The Fas death factor. Science, 262(5202): 1449- 1456 (1995).

Pagano, M., S. W. Tarn, A. M. Theodoras, P. Beer-Romero, G. Del Sal, V. Chau,

P. R. Yew, G. F. Draetta, and M. Rolfe. Role ofthe Ubiquitin-

Proteasome Pathway in Regulating Abundance ofthe Cyclin-Dependent

Kinase Inhibitor p27. Science, 262:682-685 (1995). Peter, M. E., F. C. Kischkel, C. G. Scheuerpflug, J. P. Medema, K.-M. Debatin, and P. H. Krammer. Resistance of cultured peripheral T cells towards activation-induced cell death involves a lack of recruitment for FLICE

(MACH caspase 8) to the CD95 death-inducing signaling complex. Fur.

1. Tmmunol.. 22:1207-1212 (1997). Ramsdell, R., M. S. Seaman, R. E. Miller, T. W. Tough, M. R. Alderson, and D.

H. Lynch, gld/gld mice are unable to express a functional ligand for Fas.

Fur T Tmmunn 24:928-933 (1994). Reap, E. A., D. Leslie, M. Abrahams, R. A. Eisenberg, and P. L. Cohen.

Apoptosis abnormalities of splenic lymphocytes in autoimmune lpr and gld mice. T. Tmmunol., 154:936-943 (1995).

Refaelli, J., L. Van Parijs, C. A. London, J. Tschoop, and A. K. Abbas.

Biochemical mechanisms of EL-2 regulated Fas-mediated T cell apoptosis. Immunity, 8(5V61 -623 (1998). Rieux-Laucat, F. Le Deist, C. Hivroz, I. A. G. Roberts, K. M. Debatin, A. Fischer, and J. P. de Villartay. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science, 26£:1347-

1349 (1995). Schrieber, S. L., and G. R. Crabtree. The mechanism of action of cyclosporin A and FK506. Tmmunol. Today, 1 (4V136-142 O 992Y Singer, G. G., and A. K. Abbas. The Fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice.

Jjinm-mty, 1:365-371 (1994). Sneller, M. C, J. Wang, J. K. Dale, W. Strober, L. A. Middleton, Y. Choi, T. A. Fleisher, M. S. Lim, E. S. Jaffe, J. M. Puck, M. J. Lenardo, and S. E. Straus. Clinical, immunologic, and genetide features of an autoimmune lymphoproliferation syndrome associated with abnormal lymphocyte apoptosis. Bbo-d, £2(4): 1341-1348 (1997).

Srinivasula, S. M., M. Ahmad, S. Ottilie, F. Bullrich, S. Banks, Y. Wang, T. Fernandes-Alnemri, C. M. Croce, G. Litwack, K. J. Tomaselli, R. C. Armstrong, and E. S. Alnemri. FLAME-1, a novel FADD-like anti- apoptotic molecule that regulates Fas/TNFRl -induced apoptosis. J--Jiio-L Chem-, 222(2β): 18542-18545 (1997).

Suzuki, H., T. M. Kundig, C. Furlonger, A. Wakeham, E. Timms, T.

Matsuyama, R. Schmits, J. J. Simard, P. S. Ohashi, H. Griesser. Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science , 268(5216):1472-1476 (1995). Thome, M., P. Schneider, K. Hofinann, H. Fickenscher, E. Meinl, F. Neipel, C. Mattmann, K. Bums, J.-L. Bodmer, M. Schroter, C. Scaffidi, P. H. Krammer, M. E. Peter, and J. Tschopp. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature, 2£6:517- 521 (1997). Van Parijs, L., A. Ibraghimov, and A. K. Abbas. The roles of costimulation and Fas in T cell apoptosis and peripheral tolerance. Tmmunity, 4:321-328. (1996). Van Parijs, L., A. Biuckians, A. Ibragimov, F. W. Alt, D. M. Willerford, and A. K. Abbas. Functional responses and apoptosis of CD25 (IL-2Rα)- Deficient T cells expressing a transgenic antigen receptor. J. Tmmunol .,

15£:3738-3745 (1997). Watanabe-Fukunaga, R., C.L Brannan, N.G. Copeland, N. A. Jenkins, and S. Nagata. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature, 256:314-317 (1992). Willerford, D. M., J. Chen, J. A. Ferry, L. Davidson, A. Ma, F. W. Alt.

Interleukin-2 receptor alpha chain regulates the size and content ofthe peripheral lymphoid compartment. Tmmunity, 3_{4):521-530 (1995). All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain ofthe detailed herein may be varied.

Claims

WHAT TS CLATMF.D TS

1. A chimeric moiety comprising at least a portion of an anti-apoptotic polypeptide in combination with a transport moiety, wherein the transport moiety is effective to transport the chimeric moiety across a cell membrane, and wherein the anti-apoptotic polypeptide inhibits apoptosis of lymphocytes.

2. The chimeric moiety of claim 1 wherein the anti-apoptotic polypeptide is linked to the transport moiety.

3. The chimeric moiety of claim 1 wherein the anti-apoptotic polypeptide is FLIP.

4. The chimeric moiety of claim 3 wherein FLIP is of cellular origin.

5. The chimeric moiety of claim 3 wherein FLEP is of viral origin.

6. The chimeric moiety of claim 3 wherein FLIP and the transport moiety are covalently linked.

7. The chimeric moiety of claim 1 wherein the transport moiety is a polypeptide or peptide.

8. The chimeric moiety of claim 6 wherein the polypeptide or peptide is a viral polypeptide or peptide.

9. A fusion polypeptide comprising at least a portion of FLIP linked to a transport peptide or polypeptide, wherein the transport moiety is effective to transport the fusion polypeptide across a cell membrane.

10. The fusion polypeptide of claim 9 wherein FLIP is of cellular origin.

11. The fusion polypeptide of claim 9 wherein FLIP is of viral origin.

12. The fusion polypeptide of claim 9 wherein the transport peptide or polypeptide is a viral polypeptide or peptide.

13. The fusion polypeptide of claim 9 wherein the transport peptide or polypeptide is a cellular polypeptide.

14. A method to inhibit ligand-induced apoptosis, comprising: contacting T cells with an effective amount ofthe chimeric moiety of claim 1.

15. A method to inhibit ligand-induced apoptosis, comprising: contacting T cells with an effective amount ofthe fusion polypeptide of claim 9.

16. A method to prepare an apoptosis-inhibiting chimeric moiety, comprising: linking at least a portion of an anti-apoptotic polypeptide and a transport moiety, wherein the transport moiety is effective to transport the chimeric moiety across a cell membrane, and wherein the anti- apoptotic polypeptide inhibits apoptosis of peripheral T cells.

17. A target cell contacted with the chimeric moiety of claim 1.

18. A target cell contacted with the fusion polypeptide of claim 9.

19. A host cell, the genome of which is augmented with a nucleic acid encoding a fusion polypeptide, wherein the fusion polypeptide comprises at least a portion of an anti-apoptotic polypeptide and a transport peptide or polypeptide, wherein the anti-apoptotic polypeptide inhibits apoptosis of peripheral T cells.

20. An expression cassette encoding a fusion polypeptide, wherein the fusion polypeptide comprises at least a portion of an anti-apoptotic polypeptide and a transport peptide or polypeptide, wherein the transport moiety is effective to transport the chimeric moiety across a cell membrane, and wherein the anti-apoptotic polypeptide inhibits apoptosis of peripheral T cells.

21. A composition comprising the chimeric moiety of claim 1 and a carrier.

22. A composition comprising the fusion polypeptide of claim 9 and a carrier.

23. A vaccine or immunogenic composition comprising a portion of an anti- apoptotic polypeptide in combination with an immunogenic moiety.

24. The vaccine or immunogenic composition of claim 23 wherein the anti- apoptotic polypeptide is linked to the immunogenic moiety.

25. An isolated and purified DNA molecule comprising a DNA segment encoding a fusion polypeptide comprising at least a portion of FLIP and a transport peptide or polypeptide.

26. The isolated DNA molecule of claim 25 wherein the transport polypeptide is at the amino terminus ofthe fusion polypeptide.

27. A vector comprising pHA-TAT-FLIP.