WO2000059917A2 - Information-carrying and information-processing polymers - Google Patents

Information-carrying and information-processing polymers Download PDF

Info

Publication number
WO2000059917A2
WO2000059917A2 PCT/EP2000/002893 EP0002893W WO0059917A2 WO 2000059917 A2 WO2000059917 A2 WO 2000059917A2 EP 0002893 W EP0002893 W EP 0002893W WO 0059917 A2 WO0059917 A2 WO 0059917A2
Authority
WO
WIPO (PCT)
Prior art keywords
information
polymers
sequences
carrying
logomers
Prior art date
Application number
PCT/EP2000/002893
Other languages
German (de)
French (fr)
Other versions
WO2000059917A3 (en
Inventor
Hilmar Rauhe
Udo Feldkamp
Wolfgang Banzhaf
Jonathan C. Howard
Original Assignee
Hilmar Rauhe
Udo Feldkamp
Wolfgang Banzhaf
Howard Jonathan C
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hilmar Rauhe, Udo Feldkamp, Wolfgang Banzhaf, Howard Jonathan C filed Critical Hilmar Rauhe
Priority to EP00925150A priority Critical patent/EP1169330A2/en
Priority to JP2000609427A priority patent/JP2002541539A/en
Publication of WO2000059917A2 publication Critical patent/WO2000059917A2/en
Publication of WO2000059917A3 publication Critical patent/WO2000059917A3/en

Links

Classifications

    • G—PHYSICS
    • G11—INFORMATION STORAGE
    • G11C—STATIC STORES
    • G11C13/00—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00
    • G11C13/0002—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00 using resistive RAM [RRAM] elements
    • G11C13/0009—RRAM elements whose operation depends upon chemical change
    • G11C13/0014—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material
    • G11C13/0019—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material comprising bio-molecules
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y10/00—Nanotechnology for information processing, storage or transmission, e.g. quantum computing or single electron logic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • G—PHYSICS
    • G06—COMPUTING; CALCULATING OR COUNTING
    • G06N—COMPUTING ARRANGEMENTS BASED ON SPECIFIC COMPUTATIONAL MODELS
    • G06N3/00—Computing arrangements based on biological models
    • G06N3/12—Computing arrangements based on biological models using genetic models
    • G06N3/123—DNA computing
    • G—PHYSICS
    • G11—INFORMATION STORAGE
    • G11C—STATIC STORES
    • G11C13/00—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00
    • G11C13/0002—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00 using resistive RAM [RRAM] elements
    • G11C13/0009—RRAM elements whose operation depends upon chemical change
    • G11C13/0014—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material

Definitions

  • the invention relates to processes for the production of information-carrying polymers, information-carrying polymers obtainable by these processes; Methods for isolating, reproducing and reading out such information-carrying polymers; polymeric data storage and DNA computers, which include information-carrying polymers, and the use of information-carrying polymers for the production of molecular weight standards, as markers or signatures, for the encryption of information, as molecular glue or for the production or processing of the smallest molecular structures.
  • nucleic acids it is known to use nucleic acids to label materials. US 05451505 describes the idea of using nucleic acids with a length of 20-1000 bp for the identification of materials which can be used for the purpose of authentication. However, fundamental problems such as the construction of suitable sequences or suitable codes for representing information are not discussed, let alone solved satisfactorily.
  • DNA deoxiribonucleic acid
  • RNA ribonucleic acid
  • WO 97/07440 and [L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)] describe a method of calculating a graph algorithm ("Hamiltonian path problem") as a decision problem using DNA molecules .
  • the algorithm is implemented by representing the edges and nodes of the graph as DNA sequences.
  • the algorithm is calculated in that a number of paths of the graph are generated by the hybridization of complementary DNA sequences.
  • the method described presupposes that enough molecules are available so that every possible solution to the respective problem instance occurs statistically at least once in the initial set of paths. However, due to the statistical nature of the hybridization processes, this cannot be guaranteed. In addition, in
  • CONFIRMATION COPY The first step is to create cyclic graphs, which increases the number of wrong solutions from the start.
  • WO 97/07440 is too limited to be usable for molecular information processing beyond the algorithm described: the Hamiltonian path problem is hard-coded, other algorithms cannot be calculated with it, every problem instance has to be new be encoded. Programming is not provided, all steps of the algorithm are carried out by hand. An input / output system is not planned. Overall, the method for programming algorithms or for implementing a computer is not suitable.
  • WO 97/29117 and [Frank Guarnieri, Makiko Fliss, Carter Bancroft, Making DNA Add, Science, 273, 220-223, (1996)] describe a method of carrying out additions with the aid of DNA molecules. The addition takes place as a shift operation with overflow transfer in vitro with DNA molecules and primer elongation.
  • the present invention is therefore based on the object of providing a method which allows information processing on a molecular basis to be carried out using regular grammars, without being restricted to one or a few grammars.
  • the method is said to be compatible with conventional computers and to allow information processing that takes place partly on a molecular basis and partly on the basis of conventional computers.
  • the process should be programmable and largely automatable.
  • the polymers produced within the process should be readable and usable for further applications and processes.
  • step III using the NFR method to implement a grammar defined in step I by producing monomer sequences that uniquely represent the rule set R of a grammar G;
  • step IV From the monomer sequences prepared in step III for each rule of the rule set R of G to assemble an oligomer [Algome ⁇ representing the rule (algomer assembly); V. the oligomers (algomers) assembled in step IV to be information-bearing
  • Double-stranded oligomer that is a rule of a given
  • Carrier of a number of nucleic acids which are used for the detection of complementary sequences.
  • Byte unit of information consisting of 8 bits, or molecule that represents 8 bits.
  • Elongator Algomer with two overhang sequences; can with terminator or
  • a grammar G describes a language L (G), the alphabet of this
  • a grammar G is a quadruple ( ⁇ , V, R, S) with terminal alphabet ⁇ ,
  • logomer polymer that carries symbolic information and was created by the chaining of algomers. Accordingly, a logomer consists of repeating units of algomers. A logomer represents a word of a language L (G) by the corresponding one
  • Oligomer Short chain molecule made up of repeating units (monomers).
  • Short double-stranded molecules are also called oligomers.
  • PCR Polymerase Chain Reaction polymerase chain reaction; Exponential DNA amplification method.
  • the PCR requires one DNA template to be duplicated and two
  • a symbol string can be generated.
  • Terminals are the "letters" of a person's words
  • Terminator Algomer with an overhang sequence Can only ligate with elongator.
  • Monomers is 10-unique to a set M of other sequences if each partial sequence of length 10 of S is not in any other sequence
  • variable can be a
  • Figure 1 Algomers, as described in the explanation of step IV of the method according to the invention.
  • the algomers each have a double-stranded core sequence that represents a terminal of a given grammar and at least one single-stranded overhang sequence that represents a variable of the given grammar, so that each algomer represents exactly one rule of the given grammar.
  • X and Y are not variables, but overhang sequences that e.g. can be used for cloning. Letters with overlines indicate complementarity.
  • AOA and A1A are elongators
  • XsA and AeY are terminators.
  • the algomers shown here represent the grammar described below for generating binary random numbers.
  • FIG. 2 Symbol polymerization, as described in the explanation of step V according to the invention. Algomers are linked to logomers by chaining (in the case of DNA: hybridization and ligation).
  • the logomer Xs01010101 eY contains a terminated bit sequence, which can be reproduced in a defined orientation by the overhangs X and Y.
  • Figure 3 Pattern showing symbol polymerization for binary random numbers after gel electrophoresis and staining (lanes 1 -3). Due to the random length of the binary random numbers, there is a regular conductor pattern. Lane 4 shows a 50bp molecular weight standard (Gibco BRL, Life Technologies, Catalog No. 10416-014).
  • Figure 4 Cloning of a logomer obtained by symbol polymerization in a vector, as described below for the amplification and isolation of logomers.
  • Figure 5 Schematic representation of a band pattern which is obtained by reading out a binary logomer by PCR and subsequent gel electrophoresis (described below).
  • the algomers have a length of 30 bp (overhang sequences calculated only 1/2). If the length of the logomer is known, it is sufficient to read out only oen or only 1 s. Reading out both bits is for control purposes.
  • the process can also be used for multivalent logomers (more than 2 elongators).
  • FIG 6 Band pattern of a gel electrophoresis after PCR for reading out three different logomers.
  • M (lane 5) is a 50 bp molecular weight standard (Gibco BRL, Life Technologies, Catalog No. 10416-014).
  • Figure 7 Schematic representation of the reading out of logomers by
  • the elongators carry restriction sites which are arranged asymmetrically in such a way that the restriction digestion of logomers results in a clear cutting pattern of fragments.
  • the pattern corresponds to bands of different lengths and can be made visible by gel electrophoresis.
  • R1 and R2 are different restriction enzymes, x and y denote the length of the fragments obtained after restriction digestion. For example, a ratio x: y of 1: 2.
  • Figure 8 Band patterns obtained by gel electrophoresis after reading out logomers by restriction digestion. Lane 7 and 8 contain molecular weight standards (Lane 7: 50pb wire, Gibco BRL, Life Technologies, Catalog No. 10416-014; Lane 8: 10bp wire)
  • Figure 9 Schematic representation of a polymeric data storage medium based on algomers and symbol polymerization as described below.
  • Algomers can polymerize on anchor molecules (AM) bound to a solid support (C).
  • the writing (W) is carried out by the repeated sequence (ReW) of hybridization-ligation restriction cycles (Hyb, Lig, Res).
  • the logomers obtained can be separated and read out by denaturing or restriction (Den / Dig).
  • Figure 10 Simplified representation of the components of a DNA desktop computer as described below. The details are:
  • Figure 11 Encryption of logomeres as described below. If the terminators and the primers priming in them are unknown, the respective logomer is encrypted and cannot be read out (A). If, on the other hand, a primer priming in a terminator is available or the sequence of a terminator is known, the respective logomer can be read (B).
  • Figure 12 Y-shaped molecule that can be used as a terminator in the asymmetric encryption of logomers. Elongators can be attached to the end marked with 2, further, for example Y-shaped, molecules to the ends labeled 1 and 3. If several Y-shaped molecules are linked together, tree-like structures are obtained.
  • Figure 13 Logomer with terminators s and e, which are implemented as tree-like structures.
  • Figure 14 Logomer L linked to a vector V with tree-like terminators.
  • the terminators are designed so that only one branch of the terminator can be linked to the vector.
  • Figure 15 Labeling of nucleic acids with logomers as described below: In order to label genetically engineered or modified products, a logomer is inserted into a non-transcribed area using recombinant techniques, e.g. before the promoter (P) of a gene to be labeled (G) used.
  • P promoter
  • G gene to be labeled
  • Figure 16 Marking documents with logomeres as described below.
  • Lane 1 shows the molecular weight standard used (50bp, Gibco BRL, Life Technologies, catalog No. 10416-014), lane 2 (0-bits) and lane 3 (1-bits) the band pattern of reading out logomer No. 330 by PCR aqueous solution, lanes 4 and 5 the same as lanes 2 and 3, but here the logomer No. 330 is not dried from aqueous solution but in approx. 10 9 molecules / ⁇ l on paper (3M Post-It, dried for 1 hour ) was used as a piece of paper (approx. 1 mm 2 ) in the readout PCR.
  • FIG. 17 Preparation of molecular weight standards by readout PCR, which contains a unary logomer as a template, as described below.
  • 1 shows the arrangement of nested primers in the readout PCR
  • FIG. 2 shows the band pattern obtained after gel electrophoresis of the PCR fragments.
  • Figure 18 Gluing surfaces with nucleic acids as described below.
  • C denotes the surface to be glued
  • Log the logomeres that are bound to the surfaces for gluing.
  • 1 shows the behavior of surfaces with non-complementary
  • 2 the behavior of surfaces with complementary logomers.
  • FIG 19 Gluing surfaces with logomers, antibodies and ligands as described below: C 0 and Ci designate the surfaces to be glued, which can consist of the same or different material.
  • the surfaces to be glued are offset with logomeres (log).
  • Proteins for example antibodies of the type Ab A and Ab B, can bind to the logomers, wherein Ab A and Ab B can be the same or different. From A and Ab B are in turn connected to one another by a ligand (Li).
  • Figure 20 Bonding surfaces with proteins, eg antibodies, without using logomers.
  • C 0 and Ci denote the surfaces to be glued, which can consist of the same or different material. Bind the Ab A and Ab B proteins directly to the surfaces to be glued and are in turn connected to each other by a ligand (Li).
  • Figure 21 Linking sequences to longer sequence chains can lead to violations of the specified uniqueness, which can result in incorrect hybridizations and thus disfunctionality. This is due to the emergence of new base sequences (marked in the figure) due to the link.
  • Figure 22 Example of linking terminals with a variable.
  • the four rules of grammar with variable A shown result in four different paths that overlap over the length of the variable sequence for A.
  • some sequences for overlapping terminals (b, c) also overlap, so that three paths converge on the left and right.
  • Figure 23 If more than four different variable sequences (A, B, C, D, E) have transitions to the same terminal sequence (0), at least one base sequence must be used several times.
  • the dotted frame shows the iteration step in which a violation of the uniqueness must be tolerated in order to be able to translate all the rules from R.
  • Figure 24 Parallel filling in of two sequence extensions for variables A and B.
  • the dotted frame shows the iteration step in which the start base sequences for the path search lie. From the next iteration step, violations of the uniqueness may be tolerated. It should be noted that there are branches across group boundaries (e.g. terminal b to variables A and B).
  • Figure 25 Sketch of a 1-byte molecule.
  • the section marked with an x contains a unique sequence that represents a defined byte value (the 256 nucleic acid sequences required for the representation of all byte values are listed in the sequence listing).
  • the section marked with s contains a unique sequence that encodes the byte position of the relevant byte within multibytes and serves as a template for PCR reactions (see sequence listing).
  • the sections marked with o and e are used to produce multibytes from individual bytes and as templates for PCR reactions (see sequence listing).
  • Figure 26 Schematic representation of four 1-byte molecules with different byte positions (s 0 - s 3 ). The single bytes can be combined to multibytes.
  • Figure 27 For the purpose of duplication, individual byte molecules can be cloned in genetic vectors (plasmids).
  • Figure 28 Example of the construction of a byte-representing DNA molecule.
  • Molecules consist of several functional subunits: For X there are 256 unique base sequences that represent all values of a single byte. S is a unique sequence that represents the position of a byte (the immediately following X in the string) within multibytes. O and E serve as unique recognition sequences for the concatenation of individual bytes to multibytes.
  • DNA bytes can be used unlinked or chained for identification.
  • DNA sections are obtained which are used for the "spotting" of biochips.
  • the biochips produced in this way are used for reading individual bytes or multibytes.
  • Figure 29 Concatenation of bytes to multibytes.
  • 4 bytes are linked to a 32-bit data structure.
  • the terminal sequences L and R can act as adapters to insert the 32-bit DNA data structure into other DNA. You can either carry specific recombination sites or restriction sites.
  • An example is the labeling of a plasmid in Figure 31.
  • Figure 30 Schematic structure of a 32-bit molecule that is produced by linking 4 1-byte molecules.
  • the molecule can be added or attached to the substances to be labeled for the purpose of labeling.
  • the sequences labeled L and R can carry restriction or recombination sites through which they are linked to the molecule to be labeled.
  • Figure 31 Identification of a plasmid by a 32-bit molecule.
  • the zeroth byte has the value 109, the first the value 67, the second the value 35, the third the value 192.
  • the byte pattern of the marked plasmid corresponds to the number 3223536493.
  • Figure 32 Sketch of a 1-byte biochip that was spotted with all 256 x fragments (see Figure 25 to Figure 28) from x 0 to x 255 (X chip). Only some of the 256 different sequences are shown. To read out multibytes, the individual bytes are pre-amplified with PCR (s to e) and hybridized individually on separate chips. For a 4-byte molecule (see Figure 30), 4 PCR reactions and 4 chips are required.
  • Figure 33 Sketch of a 1-byte biochip that was spotted with all 256 s 0 x fragments (see Figure 25 to Figure 28) from s 0 x 0 to s 0 x 255 (SX chip). Only some of the 256 different sequences are shown. In contrast to the chip type from Figure 32, the hybridization conditions can be selected so that bytes are detected depending on their position in a multibyte. In the example, only s 0 Xi but no s n X ⁇ with n ⁇ 0 are detected. Analog 1-byte chips can be produced that only detect s-ix, etc. This makes it possible to produce chips that can read multibytes directly (without PCR) and completely. An example is the 4-byte chip shown in Figure 37.
  • Figure 34 Layout of the 1-byte chip. If the chip is implemented as an X chip (see Figure 32), it contains 256 spots with all 256 x fragments (see sequence listing); if it is implemented as an SX chip (see Figure 33), it contains 256 spots with all SjX fragments.
  • Sequences for s and x are chosen such that they have melting temperatures that are as similar as possible to one another, but different sequences as possible in order to rule out incorrect hybridizations.
  • Figure 35 Production of multibyte chips from 1-byte SX chips.
  • the example shows the production of a 4-byte chip from an SX 0 , SXr, an SX 2 and an SX 3 chip.
  • Multibyte chips can be arranged, for example, in linear (a) or 2-dimensional (b) byte arrays.
  • Figure 36 Reading a 32-bit molecule (see Figure 30 and Figure 31) with a 4-byte SX chip (see Figure 35). For reading out, 32-bit molecules can be hybridized directly with the entire chip. This enables the 32-bit value to be read out directly (marked in the example). The bytes can also be independently amplified with PCR and hybridized separately.
  • a multibyte chip can also be constructed from identical 8-bit units that are only spotted with X fragments. In order to maintain the position information of the bytes, the individual bytes must then be spotted separately from one another in the corresponding sectors.
  • Multibyte array of identical 1-byte chips (X-chips). Multibyte arrays made of X chips can also be used to read out marking molecules, as has already been described. In addition, multi-byte arrays can be used for storage and for the visual display of computer data.
  • G For a language L (G), which is described by G, all words from L can be formed as words above the terminal alphabet ⁇ by deriving the start symbol S according to the rules from R.
  • ⁇ : ⁇ 0, 1, So, s ,, s 2 , ..., s n . ⁇ , s n , e 0 , e ,, e 2 e m . ⁇ , e m ⁇ with n, m ⁇ IN and n, m> 0.
  • V: ⁇ A ⁇ , start symbol S and rule set
  • Representation of data types e.g. can be read as letters, numbers, alphanumeric characters or character strings. If you read them as the binary representation of numbers, the above words are in decimal notation: a) 0 (empty) b) 1 c) 2 d) 32.
  • the NFR process is a process for the production of monomer sequences (oligo- and polymers, e.g. nucleic acids), which ensures that the monomer sequences produced using the process: a) a clear and unique sequence of monomers to have; b) are as similar as possible to one another and therefore do not enter into false hybridizations with one another if possible; c) have certain structural properties, e.g. a certain ratio of the different monomers to one another, the presence or absence of certain partial sequences and a maximum agreement (homology) with one another; d) have certain chemical properties, e.g. the occurrence of certain chemically active partial sequences which have an influence on chemical reactions, in the case of nucleic acids in particular the interaction with proteins
  • Protein binding sites, restriction sites, stop codons have certain physical properties, e.g. a certain melting temperature.
  • the NFR process allows the production of clear, possibly dissimilar monomer sequences with predefinable structural, chemical and physical properties. It is suitable for the production of monomer sequences for controlled chemical reactions, e.g. are required for molecular information processing. It is used in step III of the method according to the invention for the implementation of regular grammars.
  • the NFR method is a further development according to the invention of the Niehaus method for generating clear, possibly dissimilar sequences, which is described in [Jens Niehaus, DNA Computing: Evaluation and Simulation, diploma thesis at the Department of Computer Science at the University of Dortmund, Chair XI, 116-123, (1998 )] and what is hereby incorporated by reference in its entirety.
  • the NFR process is a further development of the Niehaus process in accordance with the invention, since only the NFR process allows the production of monomer sequences, such as those for a
  • Base sequences of length 6 Since the length of base sequences describes the maximum possible overlaps between different monomer sequences, it therefore has a direct influence on the hybridization behavior of sequences and the
  • steps IV and V according to the invention work, the method must, however, be generalized for base sequences of any length, which was done in the NFR method.
  • the Niehaus method only allows the generation of sequences of the same length, whereas the NFR method can generate sequences of different lengths and different numbers. The latter is essential for correct hybridization behavior of sequences and the functioning of steps IV and V according to the invention.
  • the Niehaus method guarantees uniqueness and maximum dissimilarity of sequences only for sequences that were generated by a single application of the method. It is imperative, however, to be compatible with existing sequences, i.e. to be able to generate clear and maximally dissimilar sequences. In contrast to the Niehaus method, the NFR method can generate new sequences that are compatible (i.e.
  • the method can be applied to the same set of sequences as often as required.
  • the Niehaus method limits the maximum length of common partial sequences, but not their number. Therefore, any two sequences constructed according to the Niehaus method can contain several common partial sequences, which can unintentionally lead to a high degree of homology (sequence agreement). Homology in turn has a direct influence on the hybridization behavior of sequences and the functioning of steps IV and V according to the invention.
  • the NFR method also leads to the construction of sequences
  • the Niehaus method does not allow the integration of certain, predeterminable sequences and partial sequences. However, such sequences are necessary for the execution and control of certain chemical reactions, e.g. controlled enzymatic interactions, imperative. Examples of such sequences are in the case of nucleic acids
  • NFR method allows the integration of any sequences and partial sequences in the production of monomer sequences, while ensuring uniqueness and maximum dissimilarity.
  • the Niehaus method does not provide for the possibility of generating sequences with certain structural, chemical or physical properties.
  • the NFR process contains the possibility of producing sequences with certain structural, chemical and physical properties.
  • NFR method enables the generation of symbol-representative sequences that are representative of the rules required for the implementation of a grammar
  • Sequences can be linked. h) Sequences can only be constructed using the NFR method so that the
  • monomer sequences can be prepared in such a way that both the entire sequence and e.g. the first third of the sequence has a 50% GC content.
  • Mbas set of all base sequences of length l bas .
  • Decomposition is obtained from M seq .
  • Thickness of M n0bas number of base sequences in M no as .
  • n Number of sequences to be constructed per process cycle.
  • n o t Total number of sequences produced in all process cycles.
  • l lmax maximum number of sequences that can be constructed per process cycle.
  • Homology A measure of the correspondence between two sequences.
  • the melting temperature is determined using the closest neighbor method (see Breslauer, K.J., Frank, R., Blocker,
  • ⁇ H and ⁇ S are the enthalpy and entropy of the DNA helix, R the molar
  • the number of sequences actually obtained per process cycle can be lower if they are to have certain physical, chemical or structural properties, or if additional sequences are produced in addition to existing sequences.
  • n dead sequences are constructed in z process cycles and collected in a quantity M seq . You start with the empty sequence set M seq .
  • Amount of the monomer sequences produced should be included. It is advisable not to add too many and not too long sequences, since the procedure does not guarantee the same properties for these sequences as for the sequences constructed below. 3 Beginning of the process cycle: The structural, chemical and physical properties that the sequences to be produced must fulfill are specified. Structural properties are at least the presence or absence of certain partial sequences (possibly also the positions at which the partial sequences are or should not be contained in the sequences to be generated) and the ratio of the number of different monomers to one another (in the case of DNA: GC / AT ratio).
  • Chemical properties are at least the occurrence of certain partial sequences which have an influence on the chemical interaction with own or other substances (in the case of DNA, for example, certain protein binding sites, restriction sites such as 5'gatatc3 'for EcoRV, the stop codons 5'tca3', 5'tta3 ', 5'cta3' etc.).
  • DNA for example, certain protein binding sites, restriction sites such as 5'gatatc3 'for EcoRV, the stop codons 5'tca3', 5'tta3 ', 5'cta3' etc.
  • the set M bas of all sequences of the alphabet A of length l bas is generated.
  • the sequences generated in this way are referred to as base sequences.
  • These basic sequences serve to construct the sequences to be produced.
  • Each base sequence is assigned a status "used” or "unused”.
  • Self-complementary base sequences from M bas are now marked as used.
  • a set M nobas of all partial sequences of the length l bas given in step 4 is made from the already existing sequences from M seq within a decomposition process
  • a directed graph is constructed from the base sequences, the nodes of which represent certain base sequences:
  • the graph contains exactly a lbas nodes, of which (a IBas / 2 4-
  • Each node is associated with a base sequence S b (i) that is not complementary to itself (furthermore, there will be no distinction between nodes and associated base sequence).
  • the node S b (k) is called the successor node of S ( i>.
  • the node associated with the complement of the base sequence encoded by node S (i) is called the complement node to node S b (i) .
  • Sequences of length l seq are found by searching for a path with (l seq - l ov ) nodes. Each node can only be used once. In addition, for each node that lies in one of the paths, the complement node must not appear in any path. Like the sequence, the start node of the path has a status “used” or “unused”. Sequences are constructed from the graph using the following procedure:
  • step 3 or 4 If the number of sequences constructed is not sufficient, the process cycle from step 3 or 4 can be repeated any number of times. In particular, it is possible to reset the structural, chemical and physical criteria and the values for n, l Seq> l bas per process cycle. In this way it is possible to construct sequences with different structural, chemical and physical properties, as well as different lengths, which are nonetheless compatible, i.e. unambiguous and maximally dissimilar.
  • the constructed sequences are synthesized in vitro, in the case of nucleic acids preferably using an oligonucleotide synthesizer (e.g. ABI 392, ABI 398, ABI 3948 from Perkin-Elmer Applied Biosystems).
  • an oligonucleotide synthesizer e.g. ABI 392, ABI 398, ABI 3948 from Perkin-Elmer Applied Biosystems.
  • the sequence data are transmitted to the control unit of the oligonucleotide synthesizer and the sequences are produced as single-stranded nucleic acids.
  • the sequences can also be ordered commercially.
  • PAGE-purified oligonucleotides e.g. available from ARK Scientific GmbH Biosystems, 64293 Darmstadt
  • a group of sequences (here: the terminals, e.g. sequences for representing bits or sequences with certain chemical or biological properties) are specified.
  • a transition is the path of length l ba5-1 that connects terminals and variables that belong together. In Figure 21, this consists, for example, of the marked base sequences. Transitions can converge (e.g. terminals a, b, c to variable A in Figure 22) or branch (e.g. variable A to terminals b, c, d in Figure 22).
  • variable-terminal transitions in the same way as described under 4. However, the successors are not freely selectable, but are given by the 1 bas - 1 first nucleotides of the right terminal sequence.
  • the path search follows this specification to determine whether the paths can be completed.
  • the production of monomer sequences for representing the regular set of grammars in step III of the method according to the invention is carried out using the NFR method (Niehaus-Feldkamp-Rauhe method) after step II of the method according to the invention.
  • NFR method Nehaus-Feldkamp-Rauhe method
  • To implement grammars exactly 2r monomer sequences are produced for the rules of a grammar G using the NFR method, so that the monomer sequences for the symbols (terminals and variables) shown and the rules R of the grammar G are clear and as unlike as possible, and have the required structural, chemical and physical properties.
  • the monomer sequences are prepared by the NFR method in such a way that they can be combined to form algomers as described below.
  • 2 monomer sequences are put together to form an algomer that represents exactly one rule R of a grammar G.
  • Both monomer sequences each contain sequences which contain the corresponding symbols (terminals or variables) required by R rule.
  • oligomers after step III of the process according to the invention depends on the chemical nature of the monomers used.
  • the procedure is as follows: Algomers are double-stranded and have a 5'-strand (upper strand) and a 3'-strand (lower strand). Upper strand and lower strand can be the link between a terminal sequence and a variable sequence.
  • X -> yZ constructed an algomer that contains a unique double-stranded core sequence y to which a unique single-stranded overhang sequence X is attached at the 5 'end and a unique single-stranded overhang sequence Z at the 3' end.
  • X can be identical to Z.
  • X -> z constructed an algomer that contains a unique double-stranded core sequence z, to which a unique single-stranded overhang sequence X is attached at the 5 'end.
  • Algomers of the form S: yX and X -> z are called terminators ("Start”, “End”), since they are used for
  • the monomer sequences produced in steps II and III of the method according to the invention preferably comprise nucleotides, in particular ribonucleotides, particularly preferably deoxyribonucleotides.
  • the monomer sequences constructed in step II of the method according to the invention can advantageously certain sequences, e.g.
  • Stop codons recognition sequences for enzymes that cleave nucleic acids
  • step IV The sequences synthesized in step III are assembled in step IV of the method according to the invention.
  • all of the techniques known to those skilled in the art of assembling oligomer sequences can be used to carry out step IV.
  • the single-stranded sequences belonging to elongators are phosphorylated.
  • Various protocols known to the person skilled in the art are possible for this, for example the following: in a 20 // I batch, 16 ⁇ l of a synthesized 100 / M sequence, 2 ⁇ l ligation buffer (e.g. 50 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , 10 mM dithiothreitol, 1 mM ATP, 25 // g / ml BSA Bovine Serum Albumin, New England Biolabs) and 2 ⁇ ⁇ PNK (polynucleotide kinase, e.g.
  • the single strands (upper and lower strand) belonging to an algomer are hybridized to a finished algomer.
  • the upper and lower strand phosphorylation approaches can simply be used.
  • Several protocols are possible for hybridization; a denaturation step at approximately 95 ° C. at the beginning (this simultaneously deactivates the PNK in the approaches of the elongators) and slow hybridization are preferred.
  • the following protocol can be used for oligomers of length 30, which can be varied according to the knowledge of the person skilled in the art:
  • step V of the method according to the invention the algomers are linked to form longer-chain, information-carrying polymers (logomers). Since algomers represent the rule set R of a grammar G, all logomer words generated thereby correspond to
  • Symbol polymerization means in the event that the terminal symbols represent bits, that is, in the case that:
  • step V all techniques known to those skilled in the art to link oligomers to polymers can be used to carry out step V.
  • the following protocol can be used, which can be varied according to the knowledge of the person skilled in the art: in a 27 ⁇ l batch, 1 ⁇ l 50 / M "Staif'-Algomer, 1 / I 50 ⁇ M" end "-Algomer and 2x 10 // I 40 ⁇ M each Elongator algomers (obtained from step IV of the process according to the invention), 1.5 // I 10mM rATP and 3.5 ⁇ l T4 DNA ligase with 400 NEB units / ⁇ l (eg catalog numbers # 202S and # 202L NEB) between 4 ° C. and 25 ° C. incubated for 2 to 24 hours, other reaction volumes function analogously, incubation time and temperature can be varied in a manner known to the person skilled in the art.
  • NEB units / ⁇ l eg catalog numbers # 202S and # 202L NEB
  • Figure 3 shows the result of such a symbol polymerization.
  • any number of algomers that are not terminators can be linked.
  • the polymerization process comes to a standstill for each individual logomer when the corresponding molecule carries an algomer at its ends, which acts as a terminator molecule (“start”, “end”).
  • Another object of the present invention is a process for the isolation and duplication of information-carrying polymers, which have been obtained according to one of the preceding claims, which is characterized in that information-carrying polymers obtained in step V are ligated into cloning vectors, competent cells are transformed with these vectors and the successfully transformed bacteria selected using selection markers.
  • the logomers obtained from step V of the process according to the invention described above symbol polymerization
  • the cloning vector used is cut open with restriction enzymes and a logomer is ligated into it.
  • the method ensures that only fully polymerized (terminated) logomers can be ligated to the target vector.
  • Logomers correctly ligated into the target vector form a ring-shaped molecule again.
  • logomeres are separated by transforming bacteria with the mixture of molecules that is the result of the ligation.
  • the vectors carry selection markers (preferably antibiotic resistance, e.g. ampicillin resistance) with which successfully transformed bacteria can be selected. Since each bacterium expresses only one plasmid, each successfully transformed bacterium carries exactly one logomer. Logomers cloned in this way can then simply be reproduced in large quantities (on solid or in liquid medium, fermenters) for further use.
  • the logomers obtained from step V of the method according to the invention are cloned for the purpose of separation and duplication in any cloning vector (plasmid) which carries restriction sites which are compatible with the sequence overhangs of the terminators of the logomers (for example Hindlll, BamHI recognition sequences in the cloning vector pBluescript II KS +/-, Stratagene, catalog # 212207).
  • the cloning is carried out according to usual laboratory protocols, e.g. in [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)].
  • cloning vectors can be used for cloning, as are customary for molecular biological methods.
  • plasmid pBluescript II KS +/-, Stratagene, catalog no. # 212207 is suitable.
  • the plasmid is subjected to a restriction digest with two restriction enzymes that produce overhangs that are compatible with the terminators of the logomers.
  • restriction enzymes e.g. BamHI and Hindlll (e.g. from NEB, New England Biolabs, catalog no .: # 136S and # 104S) can be used.
  • a conventional restriction protocol can be used for this, which can be varied according to the knowledge of the person skilled in the art, e.g. the following:
  • the logomers obtained in step V of the method according to the invention and the prepared cloning vectors are ligated.
  • the manner in which the preparation is carried out ensures that, if possible, only the desired ligations take place: the terminators of the logomers carry two different overhang sequences which are compatible with the overhang sequences of the cloning vector which were created by restriction. As a result, the logomers can only ligate into the cloning vector in a defined direction.
  • the terminators of the logomers are not phosphorylated, which is why logomers can only ligate with the overhang sequences of the cloning vector.
  • the ligation is carried out using a conventional ligation protocol, e.g. in [J. Sambrook, E.F.
  • the molar ratio of logomers / cloning vector can e.g. 500, in 10 ⁇ l total volume:
  • the protocol can be varied according to the knowledge of the person skilled in the art. For example, it is possible to use a protocol for TCL (Temperature Cycle Ligation, [Lund, AH, Duch, M., Pedersen, FS, Increased cloning efficency by temperature-cycle ligation, Nucleic Acids Research, 24: (4), 800-801, (1996)]).
  • TCL Temporal Cycle Ligation
  • the ligation mixture obtained is now used for the transformation of competent cells, as shown below by way of example: c) transformation of competent cells
  • the information-carrying polymers (logomers) obtained in step V of the method according to the invention can be isolated and reproduced using the following methods:
  • the molecular mixture obtained from a symbol polymerization is passed over a carrier material to which oligomers ("anchor sequences") are bound, which in turn can bind to the terminators of the logomers.
  • the bound logomers are then taken up individually and can be reproduced as required.
  • oligomers which have ends compatible with the overhanging ends of the terminators are bound, for example, to a hydroxylapatite column.
  • the logomers obtained from step V of the process according to the invention are passed over the column, as a result of which the logomers can bind to the anchor sequences by hybridization. The logomers bound in this way are then taken up individually.
  • Anchor sequences are covalently bound to a membrane (e.g. Gene Screen Plus, DuPont, Biotechnology Systems; Hybond-N, Amersham Life Sciences).
  • the membrane is rasterized, ie divided into individual fields. Exactly one anchor sequence per field is covalently bound to the membrane.
  • the logomers obtained from step V of the process according to the invention are then passed over the membrane and hybridized with the anchor sequences.
  • the membrane is then cut into the individual fields of the grid.
  • the individual fields which now contain a maximum of one logomer linked to the respective anchor sequence, can now be transferred to separate vessels (eg Eppendorf tubes).
  • the logomers can then be separated from the membrane by denaturing.
  • denaturing please note that the Denaturation temperature is chosen so that it is high enough to logomer and
  • the logomers which are obtained as a mixture from a symbol polymerization, are diluted to such an extent that exactly one molecule is statistically contained in a respective target volume. This can then be detected and reproduced using the PCR.
  • the dilution of the initial volume in target volumes can take place simultaneously, so that an initial volume is diluted to n target volumes.
  • mixture of Logomeren in an initial volume V a is determined a dilution factor of n in V a given Logomere so diluted to n target volumes V z, that in each target volume V z statistically exactly one Logomer contain is.
  • a dilution factor of the initial volume (eg 1 ⁇ l) is titrated in a dilution series.
  • An aliquot (eg 1 ⁇ l) of each dilution in the series is then used as a template for a PCR reaction in order to determine in which dilutions logomers can still be detected.
  • an approximate dilution factor can be specified which just about still contains a logomer. If necessary, this dilution factor can be determined more precisely by titrating out the last dilution, which still contains logomers. Correspondingly smaller dilution steps are used (e.g. if you always dilute 1:10 in the first dilution series, you can dilute 1: 2 in the second dilution series; the method of more precise determination of the dilution factor can in principle be used with any accuracy).
  • the PCR can be carried out in at least two ways: a) Two opposite primers, e.g. the 5'-
  • PCR is carried out like that for reading out the logomers, but an approach with a pair of primers as with reading out logomers by means of PCR in the
  • the DNA fragments obtained by PCR are made visible by gel electrophoresis.
  • a 2-4% agarose gel e.g. UltraPure TM from Gibco BRL,
  • the logomers obtained from a symbol polymerization can - depending on their intended use - be duplicated. This is necessary, for example, for the visualization of the stored information or the further use of the logomers as markers for the identification of substances and objects.
  • logomers are duplicated by PCR.
  • the logomer to be reproduced serves as a template, the primers required prime in opposite directions in the terminators (either 5'-start and 3'-end, or 5'-end and 3'-start), so that the logomer is completely reproduced.
  • the primers can also prime further outside the logomer.
  • dNTPs for example Pharmacia Biotech, catalog no .: 27-2035-01 / 2/3
  • Taq polymerase for example Gibco- BRL, catalog no .: 18038-034, 18038-042, 18038-067)
  • PCR buffer for example Gibco- BRL, catalog no .: 18038-034, 18038-042, 18038-067)
  • MgCI 2 e.g. GIBCO- BRL, catalog no .: 18067-017
  • the invention furthermore relates to information-carrying polymers which can be obtained by the processes according to the invention described above.
  • Finished logomers can either be read by means of PCR (polymerase chain reaction), which is preferred according to the invention, or by means of restriction digestion.
  • PCR polymerase chain reaction
  • the PCR method has the advantage of being able to reproduce even the smallest amounts of DNA in such a way that the logomers can be read directly after the PCR and a gel separation.
  • the band pattern obtained by the PCR method on a gel can be read directly as a binary code.
  • the invention therefore furthermore relates to a method for reading out information from information-carrying polymers which have been obtained and / or isolated and reproduced as described above, characterized in that a) n solutions containing the information-carrying polymer are each mixed with a pair of counter-rotating primers, where n stands for the number of oligomers contained in the polymer as elongators; b) carries out at least n-1 PCR runs, where n stands for the number of oligomers contained as elongators in the polymer and one primer of each pair primes in the terminator opposite the elongator and the other primer primes in the elongator itself; c) the polymer fragments obtained from the PCR are separated according to their length by electrophoresis and d) optically reads the pattern obtained from the electrophoresis.
  • the method can also be carried out using fluorescent-labeled primers or nucleotides of different colors. This makes it possible to mark several approaches in different colors and to read several approaches in one track by gel electrophoresis. In addition, the reading process can be automated with modern sequencing machines (e.g. available from ABI).
  • the logomers can be read out using PCR.
  • the method of reading binary patterns with PCR has already been described as DNA typing by [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209, (1991)].
  • the method described there is used here in a modified form as a readout PCR for reading out the logomers. Differences from the method described in [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209, (1991)] are that synthetically generated templates are used that do not necessarily contain binary patterns.
  • PCR and gel electrophoresis conditions are selected so that the result can be read directly from the gel without the signals obtained as a band pattern having to be additionally amplified by blotting.
  • n PCR approaches are used for n elongators of the underlying grammar.
  • Each PCR approach contains the logomer to be read as a template and also a pair of opposing primers, one of which primes in the elongator, the other in the terminator opposite the elongator (e.g. 5 '- "Start" and 3'-0, see figure 5).
  • Any commercially available thermal cycler eg PTC-100, MJ Research
  • 20-30 bp have proven to be expedient for the length of the primers, but other lengths can also be used.
  • the annealing temperature must be selected accordingly (can be determined using the Oligo 5.0 program, for example). Appropriate
  • Annealing temperatures are about 55 ° C for 20-mers and about 65 ° C to 74 ° C for 30-mers.
  • dNTPs Pulcoa Biotech, catalog no .: 27-2035-01 / 2/3
  • Taq polymerase Gabco-BRL
  • the following protocol (primer: 30-mers) can be used as the PCR program: hrit t Action Temperature Duration Go to Number of step repetitions
  • the legibility of the band patterns of the subsequent gel electrophoresis may be expedient for the legibility of the band patterns of the subsequent gel electrophoresis to keep as much amplified DNA as possible in the smallest possible volume, which can then be loaded onto a gel.
  • the volumes can be reduced in a suitable manner (eg with a SpeedVac, eg SpeedVac Concentrator, Savant).
  • a SpeedVac eg SpeedVac Concentrator, Savant.
  • the different length fragments result in a specific pattern, on the basis of which the logomer to be read can be identified (see Figure 5 and Figure 6).
  • a 4% agarose gel e.g. UltraPure TM from Gibco BRL, Life Technologies, catalog no .: 15510-027
  • a molecular weight standard e.g. a 50bp ladder
  • the DNA is separated in a suitable manner in a gel chamber, e.g. 1: 45 hours at 60V.
  • the parameters can be selected relatively freely, in particular the gel runtime can be shortened further.
  • the gel obtained is stained in 0.001% ethidium bromide for 5 minutes and visualized under UV. An example of a gel obtained in this way can be found in Figure 6.
  • the elongators can be read out by restriction digestion.
  • the elongators must be constructed in such a way that they carry asymmetrically offset restriction interfaces.
  • Each elongator has a specific restriction interface.
  • the restriction enzyme EcoRV eg NEB, catalog no. # 195S
  • Smal eg NEB, catalog no. # 141 S
  • the logomer to be read is cut in various restriction approaches.
  • a restriction approach with the respective restriction enzyme is formed for each elongator.
  • the DNA fragments obtained from the restriction are of different lengths.
  • the different length fragments result in a specific pattern, on the basis of which the logomer to be read can be identified.
  • a e.g. Bacterial colony obtained by separating and replicating logomers by cloning is used to inoculate 2-5 ml of a 37 ° C. overnight culture (for example LB medium with 10 ⁇ g / l ampicillin as described in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)]).
  • a cloning vector e.g. pGEM-T Easy (Promega, Catalog No. A1360) and binary logomers can also be used without terminators.
  • the plasmid DNA containing the logomer is isolated from the overnight culture (for example using the Qiagen Plasmid Miniprep Kit, Qiagen, Catalog No. 12123, or by alkaline lysis as described in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)]).
  • the plasmid DNA obtained from a) is cut in n restriction batches for n elongators.
  • Each restriction approach contains a restriction enzyme that cuts in a specific elongator and a restriction enzyme that cuts out the logomer from the cloning site. The following approaches were used in the example used:
  • the DNA fragments obtained from b) are separated electrophoretically (e.g. 4%
  • ⁇ : ⁇ 0, 1, s 0 , S ⁇ , s 2 , ..., s n - ⁇ , s n , e m ⁇ with n, me IN and n, m> 0.
  • logomeres can be used to encode the characters of a chosen alphabet.
  • the character length can be selected differently, but it makes sense to use the character lengths (nibble, 1 byte, 2 byte, 4 byte, 8 byte, etc.) that are also used for conventional data processing systems.
  • the convention for the interpretation of the characters shown is also optional.
  • the characters can be numbers, letters, alphanumeric characters or any other data structure.
  • the binary patterns generated here can be read as data and symbols, they can be interpreted as alphanumeric characters, for example. If they are interpreted as numbers, the specified grammar generates 8-bit random numbers.
  • All 8-bit patterns can be isolated from a sufficiently large amount of random 8-bit binary patterns and created as a library (e.g. for displaying all alphanumeric characters).
  • any alphanumeric characters can be displayed in any coding (e.g. ASCII, ANSI, ISO 8859-x, Unicode).
  • a character can also span several logomers (e.g.
  • nibble representation in which there is a 1-byte characters spanning two logomers, or Unicode, where a 16-bit character spans two 8-bit or four 4-bit logomers).
  • Unicode where a 16-bit character spans two 8-bit or four 4-bit logomers.
  • the 1-byte alphabet generated with this grammar is sufficient, for example, for all alphanumeric characters of the ASCII, ANSI or ISO 8859-x standards.
  • n n different terminators are required, so that the character strings generated with this grammar are structured as follows: Srjxe, s ⁇ e, ..., s n - ⁇ xe, s n xe where x is any binary representation with, in this case, is 8 bits. It then means:
  • the character string "Elisabeth” can be represented in ASCII code: s 0 01000101 e, s ⁇ H OH OOe, s 2 01101001e, s 3 O ⁇ 110O11 e, s 4 01100001 e, s 5 01100010e, s 6 01100101 e, s 7 011101 OOe, s 8 01101 OOOe
  • ⁇ : ⁇ 0, 1, s, e 0 , e ⁇ e 2 , ..., e n - ⁇ , e n ⁇ can be selected, whereby the
  • Character string "Elisabeth" in ASCII code as: s01000101e 0 , sO ⁇ 101100 ⁇ , s01101001 e 2 , s01110011 e 3 , s01100001 e 4 , s01100010e 5 , s01100101 ⁇ ⁇ , s01110100e 7 , s01101000e 8 .
  • ⁇ : ⁇ 0, 1, s 0 , s ⁇ s 2 , ..., s n - ⁇ , s n , e 0 , ei, e 2 , ..., e fr1 , e n ⁇ , with which the character string "Elisabeth" in ASCII code as: s 0 01000101e 0 , S I OI I OH OO ⁇ L s 2 01101001 e 2 , s 3 01110011e 3 , s 4 01100001 e 4 , s 5 01100010e 5 , s 6 01100101 ⁇ , s 7 01110100e 7 , s 8 01101000e 8 is shown.
  • the character string "Elisabeth" in ASCII code would be represented as: s 0 01 OOe, SiOl 01 e, s 2 0110e, s 3 110Oe, s 4 0110e, s 5 1001 e, s 6 0111 e, s 7 0011 e, s 8 0110e, s 9 0001 e, s 10 0110e, Sn0010e, s 12 0110e, s 13 0101e, S ⁇ 4 0111e, s 15 0100e, s 16 01 10e, S ⁇ 7 1000e
  • the individual characters can be processed completely independently of one another and e.g. can be read separately.
  • the representation of any data types is possible. For example, can e.g. two bytes (0. + 1., 2. + 3, n. + n + 1.) are combined to form a 2-byte code (e.g. Unicode).
  • Alphanumeric strings can be used to represent any identifier (name, number, date, etc.).
  • Random numbers are required for certain problems in computer science (e.g. simulations) and mathematics. These are generally generated with the aid of algorithms. However, since these algorithms are deterministic, they are generated
  • Random numbers only by pseudo-random numbers.
  • the number series generated are randomized to different extents.
  • a real random number generator can be implemented that generates random numbers much faster than is possible with conventional methods.
  • the random number generator is implemented with the following grammar (grammar for binary random numbers of any length):
  • sA agctttatatctccatttgccctagtgaag aatatagaggtaaacgggatcacttcaacc
  • algomers are prepared from the sequences. As described in step IV according to the invention, these algomers are polymerized to logomers and can be read out according to the method according to the invention for reading information from information-carrying polymers (as described above). Random numbers generated in this way can be seen in Figure 6.
  • the information contained in logomers can be encrypted.
  • at least one of the primers required for the readout PCR acts as a secret key (see Figure 11). This is preferably one of the primers priming in the terminators. Is the If the sequence of this primer (key sequence) and the primer itself are only known to authorized accesses, the information contained in the logomers encrypted in this way is only accessible to authorized accesses.
  • s k ⁇ y is the secret key.
  • the maximum theoretical encryption Key max a '
  • the maximum usable encryption Key eff a' "d , where d indicates the number of bases in which a dummy key must differ from the correct key, so in the readout PCR no key code can read the correct sequence and vice versa the correct key cannot read a key logomer (only the target logomer).
  • d can become> 1.
  • S 0 Si, s 2 S f . ⁇ , s t , e ⁇ , where n, f ⁇ IN, n> 1.
  • n indicates the number of real keys used, f the number of dummy keys used; the set of variables V used and the set of rules R used are optional and depend on the information to be encoded.
  • sham sequences (“sham logomers”) are generated in addition to the information-bearing logomers, which are intended to prevent unauthorized readout access to the information contained in the logomers.
  • the method can be used for all logomer applications and has, among other things. the advantage of being very effective due to the specificity of the primer used as a secret key.
  • symmetrical and asymmetrical encryption methods can be implemented.
  • a symmetrical encryption method it is sufficient for subscribers A and B of a communication to agree on a secret key sequence. Subscriber B encrypts a message to A stored as a logomer by B producing logomers only with the secret terminators and adding additional logomers that carry other terminators to his message. Only A is then able to provide the primer pair required for reading, since only A knows the terminator sequence required.
  • An asymmetrical encryption procedure requires additional effort, e.g. the use of molecules with irregular shapes (see e.g. Figure 12 and Figure 13): If a communication subscriber B wants to send an encrypted message to A, he receives a public key from A, which he uses for encryption who can use the message represented as a logomer.
  • A's public key consists of a pair of terminators and a pool of additional dummy terminators with similar properties, but different sequences and other 3 'overhang sequences. Of the real terminators, only the 3 'overhang sequence is known, with which it can be linked to the - publicly known - elongators.
  • terminators Molecules based on irregular shapes e.g. B. used on the basis of the Y-shaped molecules shown in Figure 12.
  • the Y-shaped molecules shown can be assembled into further branched tree-like molecules. The root of such a terminator molecule implemented as a tree then contains the overhang sequence compatible with the elongators, while only one of the branches of the tree contains the real terminator sequence.
  • the encrypted message is also supplemented with dummy logomers as described above, only A who knows the real terminator sequence can then filter out the correct message from the set of molecules by linking it to the compatible vector, whereas a potential attacker without knowledge of the real terminator sequence can can not.
  • the presence of the key sequence itself can provide information as to whether a labeled product is genuine or not.
  • the information about the authenticity of the labeled product can be verified or falsified using a process in which the key primer serves as a hybridization probe for a fluorescence detection reaction.
  • Another object of the present invention is therefore the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for encrypting information.
  • steps I-V Purpose is the quality control of the same, which is problematic due to the manufacturing process and the fluctuating quality of the chemicals used.
  • the method described in steps I-V according to the invention can be used to test the quality of oligonucleotides.
  • a binary grammar such as that for the random number generator (see above) or a unary grammar such as that for the production of molecular weight standards (see below) is used to generate logomers of any length.
  • the length of the logomers obtained from a symbol polymerization is directly proportional to the quality of the oligonucleotides used: the longer the logomers made electrophoretically visible, the better the quality of the oligonucleotides used.
  • Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for quality control of synthetically produced oligonucleotides.
  • the logomers described here can be used as markers to identify products, products, substances and devices.
  • Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, as markers or signatures.
  • the logomers can be used as a "binary label" that is added to a product and contains information about the product so labeled.
  • logomers can contain information about a) manufacturer b) product (e.g. serial number) c) intended use d) substance class e) hazard class f) quality g) purity h) production and expiry date. Almost any product and product can be provided with almost any information. Since the logomers are non-toxic and biodegradable, they can also be used for highly sensitive products such as food, medicines and pharmaceutical products.
  • Labeled products can e.g. be: a) chemical products, e.g. Varnishes, paints, oils, lubricants and fuels, solvents, inks etc. b) liquid materials: solutions, suspensions, emulsions c) genetic engineering products d) foodstuffs, e.g. to identify genetically modified components or to monitor foodstuffs during the production process e) drugs and pharmaceutical products f) paper products, documents, money g) devices
  • the need to label products exists in a wide variety of areas and due to different requirements.
  • Reasons for labeling can e.g. be: quality assurance in the production process, monitoring of product purity and avoidance of contamination, protection against counterfeiting and product piracy, proof of certain product components, product labeling with any product information.
  • This need also arises in particularly sensitive areas, such as the labeling of foods, medical and pharmaceutical products and genetically engineered or modified products. It is desirable here that information about the respective product is available directly on the product, in particular if mix-ups or counterfeits are to be avoided and the identification of different components of a product is also desired.
  • logomeres can be used as serial numbers, which are mixed in car paints, whereby the vehicle owner can be identified in the event of an insurance claim (e.g. accident or theft).
  • Product labeling could monitor the quality and purity of chemical products and prevent contamination.
  • a constant problem is the falsification of documents, signatures and money, which makes sophisticated labeling processes necessary.
  • the substances and compounds mentioned are not suitable at all for use in labeling sensitive and highly sensitive products such as food or medication.
  • the requirements for a labeling process for any product include at least:
  • the label should be available directly in or on the product; the labeling should be easy to demonstrate; the labeling must be harmless to health.
  • the logomers described here have the following advantages over the previously used compounds:
  • Labeling of particularly sensitive products such as food and pharmaceutical products can be used.
  • nucleic acids are elementary building blocks of all previously known biological life forms. Therefore, due to their chemical nature, they cannot be harmful to any known biological organism ("biochemical compatibility"). However, based on the genetic information contained (the program included), nucleic acids can very well be potentially harmful if they are read in an organism: if they code for toxic proteins or (as in the case of viral genetic material) can "reprogram” a respective target organism. However, the logomers used here cannot contain any information harmful to an organism for the reasons mentioned below.
  • logomers contain no genetic, i.e. Biologically relevant information (“semantic incompatibility"): With regard to the information contained, logomeres correspond to letters, numbers or sequences of letters and numbers in binary coding that are legible for us or a computer, but not for the genetic apparatus of an organism. For a biological organism it simply "nonsense code”.
  • nucleic acids are omnipresent in our environment. They will be dismantled in no time.
  • logomers can be generated by the methods described in steps I-V according to the invention and reproduced using the methods described above according to the invention. Depending on the area of application, different methods and different work-up processes can be carried out to reproduce the logomers.
  • To label petrochemical products for example, logomers can be duplicated by cloning in bacteria. The bacteria obtained can be lysed to avoid unnecessary contamination. A special purification of the logomer DNA is generally not necessary.
  • the production of logomeres for sensitive and highly sensitive products requires a more complex duplication and purification process. The goal is to preserve the purest possible logomers.
  • the duplication - as described according to the invention - can be carried out with PCR.
  • the DNA obtained from bacteria must be purified. If the logomers are cloned in bacterial vectors, a targeted breakdown of these resistance genes (e.g. by restriction enzymes) is part of a further workup.
  • logomers can be directly connected to a product to identify it. You can e.g. mixed into liquid substances or applied to solid substances. In the case of genetically engineered products, the logomers can be covalently linked to the product to be labeled using recombination and cloning techniques. The labeling of substances and products with logomers enables, among other things. monitoring of production processes, quality control, the identification of individual components and the quantitative and qualitative detection of contamination.
  • a coding of bytes and multibytes in the form of nucleic acids is defined.
  • Suitable sequences for representing bytes and multibytes are constructed.
  • a library of byte representing nucleic acids is made in vitro.
  • Biochips are used to identify bytes and multibytes.
  • Different (organic and inorganic) materials and objects as well as individual genes are identified with bytes or multibytes (and if necessary encrypted).
  • nucleic acids used must have logical, physical, chemical and biological properties. In particular, they must / should be easy to reproduce, be easy to read and interact with biological sequences in a defined manner.
  • data-representative nucleic acids are defined in such a way that a) they represent bytes b) they can also represent more complex data structures (multibytes) c) individual bytes can be linked to form multibytes d) they can be read with a biochip e) they can be used to produce 1 byte and multibyte biochips can be used f) individual bytes and multibytes can be reproduced with PCR g) can be cloned h) can be linked to other nucleic acids in such a way that they mark them i) carry as few restriction sites as possible
  • a specific byte value x is then read out by denaturing the corresponding data molecule into single strands and hybridizing with the chip.
  • the hybridized sequences are labeled analogously to the typical functioning of biochips, for example by fluorescent labeling.
  • the data molecule After the data molecule has been hybridized with a 1-byte chip, this contains exactly one marked position on the biochip, which thus precisely denotes the byte value (see Figure 36).
  • the data molecule that carries the sequence x 192 hybridizes exactly at position 192 in the chip and can be identified on the basis of the position within the chip.
  • the bytes Since the principle of reading out data molecules using the biochip is based on the hybridization of complementary sequences, the bytes are constructed in such a way that they can simultaneously serve to produce the corresponding biochips.
  • the byte molecules carry enzymatic restriction sites, so that either the sub-sequence containing x or the sub-sequence containing s and x can be cut out of a complete byte molecule.
  • These sub-sequences are then denatured and spotted on a chip carrier.
  • all 256 x sequences are applied to the chip in ascending order. This makes it possible to identify a sequence with previously unknown x based on its hybridization position. If you only use the x sub-sequence for the production of the 1-byte chip, you contain chips called X-chips (see Figure 32), if you use the sub-sequence containing s and x, you get the ones called SX chips
  • Chips (see Figure 33). Both X and SX chips can also be combined to form multibyte chips. Another requirement for the production of biochips is the availability of sufficient quantities of sequences.
  • the byte molecules can either be produced directly with oligosynthesizem, cloned or duplicated from a few template molecules using PCR.
  • the sub-sequences designated as o, s, and e can serve as priming sites (see Figure 25, Figure 26, Figure 27, Figure 28).
  • the byte molecules carry sticky ends that are compatible with restriction sites (eg Xhol and Xbal, see Figure 28).
  • h) To make it easier to link bytes and multibytes with any nucleic acids more can be done either by ligation or by overlap assembly and PCR
  • Terminators are attached to bytes and multibytes (see figure
  • these adapters carry restriction sites or recombination sites, so that they either by restriction and ligation or by
  • Recombination can be linked to other nucleic acids. This is particularly advantageous for labeling nucleic acids, especially genes. i) In connection with the linking of bytes and multibytes with others
  • nucleic acids that, in particular, multibytes carry only a few restriction sites, so that the user of nucleic acids which are provided with bytes and multibytes can work with them as usual as possible and, if possible, does not have to do without restriction sites which would otherwise destroy the bytes. Therefore, the bytes are constructed so that after the production of single-stranded multibytes from all restriction sites that are on
  • Sequence palindromes of length 6 are based only on the restriction sites Aflll, Nhel and Ncol in the multibytes and therefore not easily e.g. can be used for nucleic acids labeled with multibytes. If necessary. you can even remove the remaining restriction sites from the bytes and multibytes without the bytes and
  • sequences required for implementation are synthesized using the NFR method already described.
  • the sequences are constructed in such a way that all sequences are as dissimilar as possible.
  • the x-sub-sequences have a GC portion of 50%
  • the o-, s- and e-sequences have a GC portion of 66%
  • multibytes contain 3 sequence palindromes of length 6, each recognized once by Aflll, Nhel and Ncol become.
  • Explanation of 3 The byte molecules can be produced directly using an oligosynthesizer. In order to produce larger quantities of byte molecules, however, it is often advisable to create a clone library that contains all of the byte molecules.
  • Explanation of 4 Due to the byte position information it contains, bytes can also represent multibytes without being directly linked to each other (logical link to multi-line multibytes). However, for some applications, e.g. the labeling of nucleic acid strands, it is advisable to physically link the individual bytes to form a multibyte (single-stranded multibyte, see Figure 30 and Figure 31). For this purpose, the individual bytes are linked to one another either by ligation or by overlap assembly and PCR.
  • Biochips for reading bytes and multibytes are produced with subunits of the molecules that act as bytes. Basically there are at least 2 architectures: the X chip (see Figure 32), the one with x sub-sequences (see Figure 25 to Figure 28) and the SX chip (see Figure 33), the one with sx sub-sequences (see Figure 25 up to Figure 28). Both chips are 1-byte chips and can be combined to form multibyte chips. The principle of operation is similar: The information from data molecules is read out by hybridization with the chip. The byte value can be read from the hybridization position of the data molecule.
  • ROM and RAM data storage
  • hybridizing the chip with a specific data molecule corresponds to assigning a value to a memory cell.
  • the memory cell is erased again by denaturing (eg by increasing the temperature or changing the pH value).
  • specific sequences that are hybridized with the chip can also be provided with optically active molecules of different colors, so that color patterns can also be generated in a targeted manner, so that multibyte chips can also be used as a display. If you combine sequences of different melting temperatures with optically active molecules of different colors, you can also display a color in the sense of a thermometer.
  • the difference between the X-Chip and SX-Chip is that the SX-Chip can read (and save) the byte position in addition to the byte value.
  • the advantage of the X chip is that very large multibyte arrays can be made from identical X chips.
  • the advantage of the SX chip is that it can be used to read single-stranded multibyte molecules without having to hybridize the individual bytes separately.
  • the adapters L and R can be used to connect sequences with bytes and multibytes, which serve to connect these with nucleic acids.
  • the adapters contain, for example, suitable restriction sites or recombination sites.
  • a multibyte can be cloned into a plasmid using suitable restriction sites, as a result of which this plasmid is labeled.
  • This can consist, for example, of a 32-bit serial number (see Figure 31).
  • Another example of application is the attachment of recombinant sites to a data molecule, which means that this can be introduced, for example, into non-coding regions (for example introns) of genes, thereby marking them.
  • multibyte arrays are used for the purpose of storing computer data.
  • a single byte is written by hybridizing a 1-byte chip with a (possibly optically marked) nucleic acid that contains exactly once a defined x sequence that corresponds to the value to be written (eg x 192 ).
  • the data are read out analogously to the reading of biological DNA arrays, for example by scanning. Data is deleted by denaturing and, if necessary, washing it afterwards.
  • the logomers described here can be used to label genetically engineered or modified products.
  • Products used in food "classic" molecular biological methods such as PCR, restriction digestion, Southern blot hybridization and sequencing.
  • nucleic acid-based logomers for labeling genetic engineering products fulfills these criteria and has the following advantages: - logomers can store almost any information; individual components can be detected quickly and with high sensitivity; a method that is standardized down to the last detail can be used to read out the information (reading method according to the method according to the invention, standardized primers can be used here); - The sequence of the genes sought can be completely unknown; the sequence of the genes detected can be secret without the identification or authentication being restricted; additional security mechanisms can also be implemented using encryption.
  • any suitable grammar e.g. such as the one already described for the random number generator, the 1-byte alphabet or for character strings.
  • the characters required for the representation of markers are taken from the characters generated with the grammar and added to the product to be labeled.
  • the characters produced as logomers can be introduced into the product to be labeled as follows: a) by admixture; here logomers are produced, isolated and reproduced as described in the method according to the invention. b) by cloning, as described in the process according to the invention; Figure 6 shows e.g. the identification of bacterial clones by logomers, which were produced using the grammar already described for the random number generator. c) by restriction and ligation; Here, logomers are produced, isolated and reproduced according to the invention. The logomers obtained in this way are now through
  • the method is particularly suitable for labeling individual molecules, in particular individual nucleic acids, particularly preferably individual genes.
  • the method is suitable e.g. for all organisms (microorganisms, plants, animals). For example, clones of microorganisms or plants can be labeled. The method is also suitable for labeling food and for labeling cattle to combat BSE disease.
  • the identification can be read again using an immunoassay (ELISA).
  • ELISA immunoassay
  • the amount of information available for the process is very limited Proteins carrying information are not heat-resistant and the method requires comparatively large amounts of substance for immunization and detection reaction.
  • Molecules, nucleic acids and genetically engineered or modified products described can be used for labeling.
  • logomers can provide information about the manufacturer, expiry date, serial number, etc. contain. The procedure for
  • Labeling of food is the same as already under The methods described above enable, for example, the labeling of individual molecules,
  • Cloning techniques can be used to identify individual organisms so that a single organism and all of its descendants can be identified.
  • the labeling process using logomers thus enables: monitoring of the target product across the entire manufacturing and
  • logomers based on nucleic acids are suitable for labeling beverages.
  • logomers based on nucleic acids are suitable for labeling sensitive and highly sensitive products. In addition to food, these are also medical and pharmaceutical products. In order to avoid confusion, contamination and counterfeiting, logomers can e.g. medical and pharmaceutical products.
  • the advantage of labeling with logomers is that the label is directly linked to the labeled product and that products can be individually labeled, for example. In this way, the manufacturing process can be monitored, products can be clearly identified even after repeated decanting, and contamination and pooling of samples can be detected. With the help of logomers, for example in the case of preserved blood, the date of manufacture and expiry, blood group and manufacturer can be identified.
  • the methods described above enable authentication and counterfeit protection, for example
  • logomeres can be used to authenticate products, objects and devices. For this purpose, logomers are preferably generated and reproduced according to the invention.
  • logomers obtained in this way are applied / applied or mixed to products, objects and devices, the logomers contained in logomers can be read out again at any time according to the invention. If encryption techniques are used to generate the logomeres, as already described, the readout requires authorized access.
  • logomers obtained according to the invention can be applied in aqueous solution (preferably at 10 3 to 10 18 molecules / ⁇ l) directly to documents for identification. As such, they can serve as a certificate of authenticity for the document marked in this way.
  • a small snippet of paper (1 mm 2 is sufficient) is used as a template for a PCR readout reaction according to the invention.
  • An example can be found in Figure 16.
  • a logomer was dried in aqueous solution in approx. 10 9 molecules / ⁇ l on 3M Postlt paper for approx. 1 hour and 1mm 2 of the post-its as a template for a readout to test the principle -PCR used.
  • Documents of any paper quality can be used, eg 80g / m 2 standard copy paper.
  • the same procedure is also suitable for the identification of money or banknotes, with the advantages here being that markings that have already been printed can also be marked, - serial numbers can be assigned, encryption can be used.
  • one of the primers used for reading in the PCR can also be used as a hybridization probe for a subsequent staining detection reaction (e.g. with an intercalating dye, e.g. ethidium bromide).
  • an intercalating dye e.g. ethidium bromide
  • Another example is the authentication of liquid solutions, suspensions and emulsions with logomers.
  • ink can be individually marked with logomers so that signatures can be checked for authenticity.
  • Another example is the labeling of automobiles by adding logomeres to the car paint.
  • logomers are added to the car paint (or other components of the vehicle) as an admixture.
  • the added logomers can contain information about the serial number, manufacturer, vehicle type or the like. Based on this information, a vehicle can be identified in the event of an accident, theft or illegal disposal.
  • An advantage of the method described here is that traces of paint are sufficient to identify the vehicle, which is particularly the case with Accidents may be of interest. Another advantage is that the identity of a vehicle is very difficult to falsify.
  • logomers isolated from the lacquer can then be read out, as in the description, for reading out the information contained in logomers, preferably by PCR.
  • a sample of the paint is taken, dissolved with a suitable solvent (turpentine or similar) and mixed with the same volume of water. Subsequent centrifugation separates hydrophilic and hydrophobic components.
  • the aqueous phase is then taken up (in which the hydrophilic nucleic acid-based logomers are located) and the logomers contained are precipitated by the customary methods (for example as in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989 )] described).
  • the logomers obtained can be processed by the processes according to the invention, e.g. by readout PCR.
  • the present invention furthermore relates to the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for the purpose of quality assurance, counterfeit protection, labeling of foods, labeling of genetic engineering, chemical, medical and pharmaceutical products, labeling of organisms, labeling of documents, the marking of money, the marking of objects and machines, the marking of solutions, suspensions and emulsions as well as the authentication of people and objects.
  • the typical methods of molecular biological analysis include the electrophoretic length separation of DNA and RNA fragments.
  • a molecular weight standard (“ladder”) is usually used, which contains fragments of known length and is used for comparison with the fragments of the samples to be analyzed.
  • the method is based on using logomers as a template for a readout PCR, the result of which is a mixture of DNA fragments of defined length and defined
  • Length distances is. It is based on the previously described methods for generating and reading out logomers. DNA fragments of different lengths at very short, regular intervals can be obtained if a unary polymer acts as a template for a readout PCR with nested primers.
  • the 5 'primer primes in the start sequence of the polymer.
  • the opposite 3 'primer is a group of primers that are nested in the elongator (shown in Figure 17 as 3 levels of primers offset against each other). Since the polymer consists of repetitions of only one elongator molecule, one obtains n * m bands for n repetitions and m nested 3 'primers. The process also works in mirror image with a primer priming in the end terminator and correspondingly opposite 5 'primers. The bands obtained can be used as molecular weight standards, for example in electrophoresis.
  • DNA fragments of defined length and defined length spacings are preferably generated using PCR analogously to the method according to the invention for reading out Logomeres.
  • at least one primer is used per elongator, usually even a number of several primers that are shifted from one another. The number of primers per elongator depends on the desired length spacing. If, for example, it is desired to use algomers with a length of 30 bp and if the lengths of the DNA fragments generated should each have a 10 bp difference, then three primers, each shifted exactly 10 bp against each other, are to be used.
  • the NFR method used ensures that the partial sequences serving as templates can have the same GC content, the use of nested primers and the balance of the AT / GC ratio of the DNA fragments produced.
  • the latter is particularly important in view of the fact that the running behavior of DNA fragments in electrophoresis depends not only on the length but also on the composition of the fragments. This applies in particular to high-resolution molecular weight standards in which there are only very small distances between lengths.
  • Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for the production of molecular weight standards.
  • the described logomers can be used as RAM (read and write) and ROM (read only) data storage of high capacity and low energy consumption. To ensure the highest possible density of information and to make the handling of the memory as easy as possible, the logomers are bound to a solid support. This ensures that the logomers are addressed individually, i.e. can be written, read and deleted individually (see Figure 9).
  • the required writing and reading operations are carried out on the basis of the enzymatic reactions described in step V according to the invention and the reading of the information contained in logomers, which in turn are controlled by temperature changes.
  • the temperature changes can be carried out either by laser or by heating and cooling the solid support, for example in a thermal cycler.
  • a modification of the symbol polymerization method described above is used for writing.
  • the polymerization takes place on a solid support, the algomers are linked to one another by repeated restriction ligation cycles.
  • anchor molecules are irreversibly bound to the carrier (by UV radiation or in the oven).
  • the support provided with anchor molecules in this way can now be reversibly described with logomers, which can be removed again in an erasing process.
  • starter algomers In a writing process, specific algomers (“starter algomers”) are first bound to the anchor molecules by hybridization. These starter algomers in turn are the starting point for a symbol polymerization in which further algomers are linked together.
  • the algomers are linked by repeated cycles of restriction and ligation. In each cycle, the last algomer of a polymerizing chain is cut with a restriction enzyme, so that a single-stranded overhang sequence (elongation point) is formed, to which in turn the next algomer can be bound by ligation.
  • the algomers must have a specific one
  • Each algomer to be written has a single-stranded overhang sequence with which it can bind to the elongation point of a logomer.
  • Elongation point can be called the end Algomer. c) Each algomer to be written that is not the end algomer has a double-stranded end, in which the recognition sequence for the selected one
  • Restriction enzyme is located. In the event of a restriction, the enzyme cleaves the algomer so that a single-stranded overhang sequence arises, which in turn can itself serve as an elongation point.
  • Each finished logomer has exactly one starter and one end algomer. Starter and end algomers are, according to the definition given above, terminators.
  • the overhang sequences of the algomers are compatible with a restriction enzyme chosen in each case, so that an algomer to be linked can bind to the elongation point of a logomer and the elongation point subsequently created by restriction is identical to its predecessor.
  • the sequence following the overhang sequence in the algomer is selected in such a way that a linked algomer cannot be split off again by a subsequent restriction process.
  • Membranes such as Gene Screen Plus (DuPont, Biotechnology Systems, catalog no .: NEF-986 or NEF-987), Hybond-N (Amersham Life Sciences, catalog) are suitable as solid supports No .: RPN 82N or RPN 137N), silicon, silicate surfaces or glass.
  • the anchor molecules are each covalently bound to it (UV radiation or heat).
  • Suitable restriction enzymes are commercially available enzymes, preferably those that are not deactivated at 65 ° C (e.g. Hindlll).
  • the writing operations are based on the fact that the enzymes used for writing have different temperature optima. So is the temperature optimum for
  • thermocycler and thermally manipulable material Since all reading and writing operations are carried out using enzymes, it is necessary to be able to temper the wearer. When using a thermocycler and thermally manipulable material, all memory cells can be subjected to the same operation simultaneously. Alternatively, memory cells can be accessed individually and independently of one another if a correspondingly small read / write head is used. This read / write head must serve on the one hand as a pipetting device for the required molecules (enzymes, algomers) and on the other hand must generate the temperature required for a certain manipulation (e.g. with the aid of a laser). During the deletion process, a logomer is detached from the respective anchor molecule by denaturation. The anchor molecule is then available again for a writing process.
  • a logomer is detached from an anchor molecule by denaturation. It can then be read out using the method according to the invention.
  • the operations described writing, erasing, reading are performed by enzymes at different temperatures.
  • all memory cells can be subjected to the same operation simultaneously.
  • memory cells can be accessed individually and independently of one another if a correspondingly small read / write head is used. This read / write head must serve on the one hand as a pipetting device and on the other hand must generate the temperature required for a certain manipulation.
  • Another object of the present invention is therefore a polymeric data storage device, comprising information-carrying polymers according to the invention, methods for linking molecules according to the invention, readout methods according to the invention or isolation and duplication methods according to the invention.
  • a DNA computer can be constructed using the information representation by algomers and logomers already described.
  • the DNA computer comprises (see Figure 10): a) oligonucleotide synthesizer b) thermocycler c) pipetting device d) device for isolating polymers e) device for separating nucleic acids, eg electrophoresis system f) scanner g) control computer (workstation, eg PC)
  • DNA Computer is designed as a hybrid system, in which simple, computationally intensive algorithms or the storage of data using DNA and the necessary devices (devices a) to e)) are carried out and a conventional computer (preferably workstation, e.g. PC) as the host and control computer.
  • the DNA computer contains at least one thermal cycler, which serves as an "information reactor” and can be controlled via the control computer (eg MJ Research PTC-100, Eppendorf Mastercycler). Molecular mixtures of nucleic acids, enzymes and other chemical substances are located in the tubes or microtiter plates of the thermal cycler Substances (eg buffers, nucleotides) which are required for the algomer assembly (step IV of the method according to the invention) and the symbol polymerization (step V of the method according to the invention)
  • the DNA computer is programmed by implementing algorithms as grammars (step I of the The monomer sequences required in each case for the grammars are produced by the NFR method and the use of an oligonucleotide synthesizer (eg ABI 392, ABI 398, ABI 3948 from Perkin-Elmer Applied Biosystems) (steps II and III of the method according to the invention).
  • the control computer in turn now carries out further calculations and controls on the basis of the results obtained in this way and, if necessary, initiates further molecular reactions. For example, Based on the results obtained, the control computer can initiate the reimplementation of grammars (production of oligomers using the NFR method). In this way, the information obtained by molecular methods as logomers can serve not only as passive data but also as instructions (and addresses). This enables a self-controlling process of various algorithms, which is necessary for universal data processing.
  • the DNA computer processes information as oligo- and polymers.
  • Cloning vectors which are in liquid solution or on a solid, addressable carrier, serve as storage cells for the data.
  • the DNA computer is programmable as described above using grammars and can be controlled by a conventional computer, which acts as a control computer and host system.
  • the DNA computer can perform certain operations in molar orders of magnitude (for example symbol polymerization, as described in step V of the method according to the invention, in 10 12-10 20 elementary operations per second), one possible application is the calculation of simple, computationally intensive algorithms.
  • the DNA computer can also be used for other applications, such as the generation of certain, regular DNA structures that are of interest, for example, within nanotechnology.
  • Another object of the present invention is therefore a DNA computer comprising information-carrying polymers according to the invention.
  • Another object of the present invention is a DNA computer in which a readout method according to the invention and / or isolation and duplication methods according to the invention are used. The methods described above enable, for example, the production of the smallest molecular structures with logomers
  • the smallest molecular structures can be produced.
  • the building blocks of such structures are algomers, which can be combined to form regular patterns of logomers.
  • Different algomers can be doped with different foreign molecules (ligands) in order to obtain regular, high molecular weight patterns of the respective ligands.
  • the logomers act as a "skeleton" of molecular assemblies of ligands.
  • a binary logomer could contain alternating patterns of conductive and non-conductive ligands.
  • the arrangement of many logomers on a solid support can result in conductor tracks in the nanometer range.
  • Biomolecules, antibodies, optically active molecules or the like can also be used as ligands. be used.
  • logomeres can be used as an "intelligent" adhesive (see Figure 18).
  • the hybridization of complementary nucleotides is used here. If logomers are applied to the surfaces to be bonded, which are covalently bonded to the surfaces to be bonded, otherwise completely identical surfaces can only be bonded if they have complementary sequences, since only surfaces of complementary nucleic acids form hydrogen bonds.
  • the "intelligence" of the adhesive therefore consists in a highly selective adhesive effect due to the sequences used in each case.
  • the adhesive strength for surfaces to be bonded can also be set precisely: on the one hand, the density of the logomers on the respective surfaces can be used to set their adhesive strength, and on the other hand, the melting point can be varied via the AT / GC ratio of the logomers, so that bonded surfaces lose their adhesion at different temperatures. Due to the fact that harmless, easily degradable biomolecules are used as an adhesive, such adhesives can also be used for medical use (e.g. surgery, micro-surgery). Another use is the use of the described method in high-precision and authentication applications.
  • ligands can be, for example, specific antibodies directed against DNA sequences. These can, for example, be connected to each other via another ligand (see Figure 19).
  • a simple, non-programmable adhesive effect can also be achieved without logomers if the proteins used (for example antibodies) can in turn bind to the surfaces to be bonded (such as antibodies if the surface to be bonded is their antigen). See also Figure 20. Simpler adhesives are possible if proteins that bind specifically to certain areas are genetically engineered. An alternative method is to ensure that the surfaces to be glued are not weak
  • the adhesive force is set via the density of algomers.
  • the surfaces to be glued are provided with algomers, each of which has complementary sticky ends. These can then hybridize and go through
  • Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for the manufacture or processing of the smallest molecular structures or as a molecular adhesive.
  • Another object of the present invention is therefore the use of the NFR method, the "parallel extension” method and the translation of grammars into molecules for the production of components of nanotechnological modular systems.
  • the methods described above enable, for example, the controlled, programmable production of biologically active nucleic acids.
  • Centromeres promoters, exons, genes or the like. These can then be controlled, programmable way to biologically active constructs, such as genes or artificial chromosomes.
  • Another object of the present invention is therefore the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for the controlled production of biologically active nucleic acids.

Abstract

The invention relates to methods for producing information-carrying polymers, information-carrying polymers obtained using these methods, and to methods for isolating, duplicating, and selecting such information-carrying polymers. The invention also relates to polymeric data memories and DNA computers which contain the information-carrying polymers, and to the use of information-carrying polymers for producing molecular weight standards, as markers or signatures, for encoding information, as molecular-scale adhesives, or for producing or processing the smallest molecular structures.

Description

Informationstragende und informationsverarbeitende PolymereInformation-bearing and information-processing polymers
Beschreibungdescription
Die Erfindung betrifft Verfahren zur Herstellung informationstragender Polymere, nach diesen Verfahren erhältliche informationstragende Polymere; Verfahren zur Isolierung, zur Vervielfältigung und zum Auslesen solcher informationstragender Polymere; polymere Datenspeicher und DNA-Computer, die informationstragende Polymere umfassen sowie die Verwendung informationstragender Polymere zur Herstellung von Molekulargewichtsstandards, als Marker oder Signaturen, zur Verschlüsselung von Information, als molekulare Kleber oder zur Herstellung oder Bearbeitung kleinster molekularer Strukturen.The invention relates to processes for the production of information-carrying polymers, information-carrying polymers obtainable by these processes; Methods for isolating, reproducing and reading out such information-carrying polymers; polymeric data storage and DNA computers, which include information-carrying polymers, and the use of information-carrying polymers for the production of molecular weight standards, as markers or signatures, for the encryption of information, as molecular glue or for the production or processing of the smallest molecular structures.
Es ist bekannt, Nukleinsäuren zur Markierung von Materialien zu verwenden. Die US- 05451505 beschreibt die Idee, Nukleinsäuren der Länge 20-1000bp zur Kennzeichnung von Materialien zu verwenden, die zum Zwecke der Authentifizierung dienen können. Ganz grundsätzliche Probleme wie das Konstruieren von geeigneten Sequenzen oder von geeigneten Kodierungen zur Repräsentation von Information werden jedoch nicht diskutiert, geschweige denn, befriedigend gelöst.It is known to use nucleic acids to label materials. US 05451505 describes the idea of using nucleic acids with a length of 20-1000 bp for the identification of materials which can be used for the purpose of authentication. However, fundamental problems such as the construction of suitable sequences or suitable codes for representing information are not discussed, let alone solved satisfactorily.
Es ist bekannt, Nukleinsäuren wie DNA (Deoxiribonucleic Acid = Desoxyribonukleinsäure) und RNA (Ribonucleic Acid = Ribonukleinsäure) auch außerhalb von Organismen zur Informationsverarbeitung zu verwenden. Es wurden bisher verschiedene Ansätze, DNA Moleküle zur Informationsverarbeitung zu verwenden, vorgestellt. Die WO 97/07440 und [L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)] beschreiben ein Verfahren, einen Graphen- Algorithmus ("Hamiltonian-Pfad-Problem") als Entscheidungsproblem mit Hilfe von DNA Molekülen zu berechnen. Der Algorithmus wird implementiert, indem die Kanten und Knoten des Graphen als DNA Sequenzen repräsentiert werden. Die Berechnung des Algorithmus wird dadurch vorgenommen, daß durch die Hybridisierung komplementärer DNA Sequenzen eine Menge von Pfaden des Graphen erzeugt werden.It is known to use nucleic acids such as DNA (deoxiribonucleic acid = deoxyribonucleic acid) and RNA (ribonucleic acid = ribonucleic acid) outside of organisms for information processing. Various approaches to using DNA molecules for information processing have been presented so far. WO 97/07440 and [L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)] describe a method of calculating a graph algorithm ("Hamiltonian path problem") as a decision problem using DNA molecules . The algorithm is implemented by representing the edges and nodes of the graph as DNA sequences. The algorithm is calculated in that a number of paths of the graph are generated by the hybridization of complementary DNA sequences.
Aus dieser Menge von Pfaden werden dann mit Hilfe molekularbiologischer Verfahren alle Pfade entfernt, die eine falsche oder keine Lösung des Algorithmus sind. Wurden alle Schritte erfolgreich ausgeführt, so muß am Ende entweder mindestens ein DNA Strang übrigbleiben, der die richtige Lösung des Problems enthält, oder es bleibt kein DNA Strang übrig, was bedeutet, daß der Algorithmus keine Lösung hat.From this set of paths, all paths that are incorrect or not a solution of the algorithm are then removed using molecular biological methods. If all steps have been carried out successfully, then at least one DNA strand that contains the correct solution to the problem must either remain at the end, or no DNA strand remains, which means that the algorithm has no solution.
Das beschriebene Verfahren setzt voraus, daß genügend viele Moleküle zur Verfügung stehen, damit jede mögliche Lösung der jeweiligen Probleminstanz statistisch mindestens einmal in der Ausgangsmenge von Pfaden vorkommt. Dies kann aufgrund der statistischen Natur der Hybridisierungsvorgänge jedoch nicht garantiert werden. Außerdem können imThe method described presupposes that enough molecules are available so that every possible solution to the respective problem instance occurs statistically at least once in the initial set of paths. However, due to the statistical nature of the hybridization processes, this cannot be guaranteed. In addition, in
BESTA TIGUNGSKOPIE ersten Schritt auch zyklische Graphen entstehen, was von vorneherein die Menge falscher Lösungen vergrößert.CONFIRMATION COPY The first step is to create cyclic graphs, which increases the number of wrong solutions from the start.
Der in WO 97/07440 beschriebene Ansatz zeigt, daß Symbolverarbeitung überhaupt in vitro mit DNA Molekülen vorgenommen werden kann. Jedoch ist der beschriebene Ansatz in der Praxis kaum verwendbar: Ein Problem ist, daß der Algorithmus nicht deterministisch, sondern nur stochastisch ist, das gefundene Ergebnis ist damit nur mit einer bestimmten Wahrscheinlichkeit korrekt. Ein weiteres Problem ist, daß die Implementierung des Algorithmus nicht effizient (Laufzeit-optimal) ist, dadurch wird die Berechnung langsam. Es wird dargelegt, daß das verwendete Verfahren zur Lösung NP-vollständiger Probleme (einer Klasse von Problemen, für die nur deterministische Lösungsalgorithmen mit exponentieller Laufzeit bekannt sind und von der vermutet wird, daß es keine effizienten deterministischen Lösungsalgorithmen gibt) besonders gut geeignet sei, weil der Algorithmus aufgrund der Parallelität der ausgeführten Operationen nur lineare Laufzeit benötige. Diese Argumentation ist jedoch insofern fehlerhaft, als die lineare Laufzeit durch eine exponentielle Anzahl von Molekülen kompensiert wird. Die exponentielle Problemgröße bleibt also unverändert bestehen.The approach described in WO 97/07440 shows that symbol processing can even be carried out in vitro with DNA molecules. However, the approach described can hardly be used in practice: One problem is that the algorithm is not deterministic, but only stochastic, so the result found is only correct with a certain probability. Another problem is that the implementation of the algorithm is not efficient (runtime optimal), which makes the calculation slow. It is stated that the method used to solve NP-complete problems (a class of problems for which only deterministic solution algorithms with exponential runtime are known and which are suspected to be no efficient deterministic solution algorithms) is particularly well suited because the algorithm requires only linear runtime due to the parallelism of the operations performed. However, this reasoning is incorrect in that the linear transit time is compensated for by an exponential number of molecules. The exponential problem size remains unchanged.
Insgesamt ist das in der WO 97/07440 beschriebene Verfahren zu sehr eingeschränkt, um für molekulare Informationsverarbeitung über den beschriebenen Algorithmus hinaus verwendbar zu sein: Das Hamiltonian-Pfad-Problem ist fest kodiert, andere Algorithmen können damit nicht berechnet werden, jede Probleminstanz muß neu kodiert werden. Programmierung ist nicht vorgesehen, alle Schritte des Algorithmus werden von Hand ausgeführt. Ein Input- /Output-System ist nicht vorgesehen. Insgesamt ist das Verfahren zur Programmierung von Algorithmen oder zur Implementierung eines Computers nicht geeignet. Die WO 97/29117 und [Frank Guarnieri, Makiko Fliss, Carter Bancroft, Making DNA Add, Science, 273, 220-223, (1996)] beschreiben ein Verfahren, Additionen mit Hilfe von DNA Molekülen auszuführen. Die Addition erfolgt als Schiebeoperation mit Überlauf-Übertrag in vitro mit DNA Molekülen und Primer-Elongation.Overall, the method described in WO 97/07440 is too limited to be usable for molecular information processing beyond the algorithm described: the Hamiltonian path problem is hard-coded, other algorithms cannot be calculated with it, every problem instance has to be new be encoded. Programming is not provided, all steps of the algorithm are carried out by hand. An input / output system is not planned. Overall, the method for programming algorithms or for implementing a computer is not suitable. WO 97/29117 and [Frank Guarnieri, Makiko Fliss, Carter Bancroft, Making DNA Add, Science, 273, 220-223, (1996)] describe a method of carrying out additions with the aid of DNA molecules. The addition takes place as a shift operation with overflow transfer in vitro with DNA molecules and primer elongation.
Das beschriebene Verfahren beschreibt ausschließlich Additionen. Jedoch ist selbst die Verwendung als Addierer aus mindestens zwei Gründen ungünstig: Zum einen ist Addition mit dem beschriebenen Verfahren nicht effizient (Laufzeit-optimal) implementiert. Zum anderen ist das verwendete System formal unvollständig, weil die durch Addition erzeugten Ergebnisse ihrerseits nicht mehr als Zahlen für Berechnungen verwendet werden können. Über die Addition hinausgehende Konzepte fehlen. Insgesamt ist das Verfahren zur Programmierung von Algorithmen oder zur Implementierung eines Computers nicht geeignet. In [Qi Ouyang, Peter D. Kaplan, Shumao Liu, Albert Libchaber, DNA Solution of the Maximal Clique Problem, Science, 278, 446-449, (1997)] wird ein Verfahren beschrieben, einen Algorithmus zur Lösung des "Max-Clique-Problem"s zu implementieren. Der Algorithmus stammt aus der Graphentheorie und fällt unter die NP-vollständigen Probleme. Wie in [L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021 -1024, (1994)] ist das Verfahren nur in der Lage, einen fest kodierten Lösungsalgorithmus zu berechnen. Auch hier wird das Ergebnis nur mit einer bestimmten Wahrscheinlichkeit erhalten. Das von den Autoren beschriebene Verfahren enthält keine weiterführenden Konzepte (etwa in Hinsicht der Implementierung auch anderer Algorithmen).The described method only describes additions. However, even use as an adder is unfavorable for at least two reasons: First, addition is not implemented efficiently (runtime-optimal) with the described method. On the other hand, the system used is formally incomplete because the results generated by addition cannot be used as numbers for calculations. There are no concepts beyond the addition. Overall, the method for programming algorithms or for implementing a computer is not suitable. [Qi Ouyang, Peter D. Kaplan, Shumao Liu, Albert Libchaber, DNA Solution of the Maximal Clique Problem, Science, 278, 446-449, (1997)] describes a method, an algorithm for solving the "Max-Clique Problem to implement. The algorithm comes from graph theory and falls under the NP-complete problems. As in [LM Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)], the method is only able to calculate a hard-coded solution algorithm. Again, the result is only with a certain one Get probability. The method described by the authors contains no further concepts (for example with regard to the implementation of other algorithms).
Insgesamt ist das Verfahren zur Programmierung von Algorithmen oder zur Implementierung eines Computers nicht geeignet. In [Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self- assembly of DNA: Some Theory and Experiments, Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996)] wird erörtert, reguläreOverall, the method for programming algorithms or for implementing a computer is not suitable. In [Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self- assembly of DNA: Some Theory and Experiments, Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996)] is discussed, regular
Grammatiken in DNA durch Verknüpfung von Oligonukleotiden mit "sticky ends" zu implementieren. Die Ausführungen sind jedoch rein theoretischer Natur und scheitern an wesentlichen, bisher ungelösten Problemen. Insbesondere wird nicht dargelegt, wie die zur Implementierung von Grammatiken benötigten Sequenzen konstruiert werden müssen. Gerade dies ist aber das entscheidende Problem, ohne dessen Lösung Grammatiken nicht implementiert werden können. Der Grund dafür liegt darin, daß die Sequenzen, die die Variablen und Terminale einer Grammatik repräsentieren, sowohl eindeutig, als auch untereinander hinreichend unähnlich sein müssen. Außerdem müssen sie bestimmte strukturelle, chemische und physikalische Eigenschaften erfüllen. Andernfalls sind Fehlhybridisierungen zwischen Sequenzen zwangsläufig, die bei der Polymerisierung zu ungewollten Kettenverlängerungen und Kettenabbrüchen führen und damit das Funktionieren des Verfahrens unmöglich machen. Dieses Problem verschärft sich mit der Anzahl der benötigten Sequenzen exponentiell.Implement grammars in DNA by linking oligonucleotides with "sticky ends". However, the explanations are purely theoretical in nature and fail due to essential, as yet unsolved problems. In particular, it does not explain how the sequences required to implement grammars have to be constructed. But this is precisely the crucial problem, without which grammars cannot be implemented. The reason for this is that the sequences that represent the variables and terminals of a grammar must be both unique and sufficiently dissimilar from one another. They also have to meet certain structural, chemical and physical properties. Otherwise, incorrect hybridizations between sequences are inevitable, which lead to unwanted chain extensions and chain breaks during the polymerization and thus make the operation of the method impossible. This problem worsens exponentially with the number of sequences required.
Das beschriebene Verfahren wird von den Autoren selbst wieder verworfen, bzw. insofern als unzureichend bezeichnet, als es keine sonderlich interessanten Berechnungen erlaube (Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self-assembly of DNA: Some Theory and Experiments, Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996), S. 8, 2. Absatz, 1. Zeile).The described method is rejected by the authors themselves or insofar as it does not allow any particularly interesting calculations (Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self-assembly of DNA: Some Theory and Experiments , Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996), p. 8, 2nd paragraph, 1st line).
Weiterführende Experimente der Autoren stützen sich entsprechend auch nicht weiter auf reguläre Grammatiken und lineare Polymere, sondern auf kontextsensitive Grammatiken zur Erzeugung von DNA Gitterstrukturen [Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two-dimensional DNA crystals, Nature, 394, 539-544, (1998)]. Der von den Autoren beschriebene Ansatz ist womöglich zur Erzeugung DNA- basierter Nanostrukturen (Herstellung von Katalysatoren usw.) geeignet. Zur Informationsverarbeitung eignet er sich hingegen nicht, hier sind die erzeugten Gitterstrukturen eher hinderlich. Zwar sprechen die Autoren von der Möglichkeit, das mathematische Konzept der "Wang tiles" durch die erzeugten Gitterstrukturen zu realisieren und damit potentiell auch für Berechnungen zu verwenden, sie bleiben aber bei der bloßen Erwähnung einer solchen Möglichkeit, ohne zu beschreiben, wie dies im Sinne einer Informationsverarbeitung genutzt werden kann. Es ist überhaupt zweifelhaft, ob der von den Autoren beschriebene Ansatz überhaupt zu einer Informationsverarbeitung geeignet ist: Die Gitterstrukturen verhindern die Vervielfältigung informationstragender Sequenzen (z.B. durch Klonierung oder PCR = Polymerase Chain Reaction = Polymerase Kettenreaktion) und machen es unmöglich, die erzeugten Strukturen als Daten zu verwenden, weil diese nicht mehr, etwa durch PCR, ausgelesen werden können. Entsprechend sieht der gewählte Ansatz in der jetzigen Form konzeptionell gar keine Möglichkeit vor, die erzeugten Strukturen im Sinne einer Informationsverarbeitung, etwa als Daten, zu nutzen.Further experiments by the authors are therefore no longer based on regular grammars and linear polymers, but on context-sensitive grammars for generating DNA lattice structures [Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two -dimensional DNA crystals, Nature, 394, 539-544, (1998)]. The approach described by the authors may be suitable for the generation of DNA-based nanostructures (production of catalysts, etc.). On the other hand, it is not suitable for information processing, here the generated grid structures are rather a hindrance. Although the authors speak of the possibility of realizing the mathematical concept of the "Wang tiles" by means of the generated lattice structures and thus potentially using them for calculations, they remain with the mere mention of such a possibility without describing how this is done in the sense an information processing can be used. It is at all doubtful whether the approach described by the authors is suitable for information processing at all: The lattice structures prevent the duplication of information-carrying sequences (eg by cloning or PCR = polymerase chain Reaction = polymerase chain reaction) and make it impossible to use the generated structures as data because they can no longer be read out, for example by PCR. Accordingly, the selected approach in its current form does not provide any conceptual possibility of using the generated structures in the sense of information processing, such as data.
Aus dem Stand der Technik ist bisher kein Verfahren bekannt, das es erlaubt, DNA Moleküle für die Implementierung effizienter Algorithmen zu verwenden. Es ist kein Verfahren bekannt, Berechnungen automatisch (etwa in Art eines molekularen Computers) durchzuführen. Es ist auch kein Verfahren bekannt, Programme in Form von regulären Grammatiken mit molekularen Verfahren so zu implementieren, daß damit a) unterschiedliche (im Idealfall beliebige) reguläre Grammatiken implementiert werden können b) die mit regulären Grammatiken erzeugten Wörter einer Sprache ausgelesen werden können c) die mit regulären Grammatiken erzeugten Wörter einer Sprache für technische Zwecke (z.B. Informationsverarbeitung, Polymerchemie) weiterverwendet werden können.To date, no method is known from the prior art which allows DNA molecules to be used for the implementation of efficient algorithms. No method is known for performing calculations automatically (for example in the manner of a molecular computer). There is also no known method for implementing programs in the form of regular grammars with molecular methods in such a way that a) different (ideally any) regular grammars can be implemented b) the words of a language generated with regular grammars can be read out c) the words of a language generated with regular grammars can be used for technical purposes (e.g. information processing, polymer chemistry).
Der vorliegenden Erfindung liegt daher die Aufgabe zugrunde, ein Verfahren bereitzustellen, das es erlaubt, Informationsverarbeitung auf molekularer Basis mithilfe regulärer Grammatiken vorzunehmen, ohne dabei auf eine oder wenige Grammatiken eingeschränkt zu sein. Das Verfahren soll kompatibel zu herkömmlichen Computern sein und eine Informationsverarbeitung erlauben, die teilweise auf molekularer Basis und teilweise auf der Basis herkömmlicher Computer stattfindet. Das Verfahren soll programmierbar und weitgehend automatisierbar sein. Die innerhalb des Verfahrens erzeugten Polymere sollen lesbar und für weiterführende Anwendungen und Verfahren verwendbar sein.The present invention is therefore based on the object of providing a method which allows information processing on a molecular basis to be carried out using regular grammars, without being restricted to one or a few grammars. The method is said to be compatible with conventional computers and to allow information processing that takes place partly on a molecular basis and partly on the basis of conventional computers. The process should be programmable and largely automatable. The polymers produced within the process should be readable and usable for further applications and processes.
Diese Aufgabe wird gelöst durch ein Verfahren zur Herstellung informationstragender Polymere, das umfaßt,This object is achieved by a method for producing information-carrying polymers, which comprises
I. eine reguläre Grammatik G = (Σ, V, R, S) mit einem endlichen Terminalalphabet Σ, einer endlichen Variablenmenge V, einer endlichen Regelmenge R und einem Startsymbol S zu definieren;I. to define a regular grammar G = (Σ, V, R, S) with a finite terminal alphabet Σ, a finite set of variables V, a finite set of rules R and a start symbol S;
II. das NFR-Verfahren (Niehaus-Feldkamp-Rauhe-Verfahren) zur Herstellung von Monomersequenzen (Oligo- oder Polymere);II. The NFR process (Niehaus-Feldkamp-Rauhe process) for the production of monomer sequences (oligo- or polymers);
III. mit dem NFR-Verfahren eine in Schritt I definierte Grammatik zu implementieren, indem damit Monomersequenzen hergestellt werden, die die Regelmenge R einer Grammatik G eindeutig darstellen;III. using the NFR method to implement a grammar defined in step I by producing monomer sequences that uniquely represent the rule set R of a grammar G;
IV. aus den in Schritt III hergestellten Monomersequenzen für jede Regel der Regelmenge R von G ein die Regel repräsentierendes Oligomer [Algomeή zusammenzusetzen (Algomer-Assemblierung); V. die in Schritt IV zusammengesetzten Oligomere (Algomere) zu informationstragendenIV. From the monomer sequences prepared in step III for each rule of the rule set R of G to assemble an oligomer [Algomeή representing the rule (algomer assembly); V. the oligomers (algomers) assembled in step IV to be information-bearing
Polymeren zu verknüpfen (Symbolpolymerisation).Linking polymers (symbol polymerization).
Im Rahmen der vorliegenden Erfindung werden folgende Definitionen und Abkürzungen verwendet:The following definitions and abbreviations are used in the context of the present invention:
Algomer Doppelsträngiges Oligomer, das eine Regel einer gegebenenAlgomer Double-stranded oligomer that is a rule of a given
Grammatik repräsentiert. Algomere können miteinander zu Logomeren verknüpft werden. Auslese-PCR PCR, die zum Auslesen der in Logomeren enthaltenen Information verwendet wird. Biochip Auch als Microarray, DNA-Array, Gene-Array, Gene-Chip bezeichneterRepresents grammar. Algomers can be linked together to form logomers. Readout PCR PCR, which is used to read out the information contained in logomers. Biochip Also known as a microarray, DNA array, gene array, gene chip
Träger einer Anzahl von Nukleinsäuren, die zur Detektion komplementärer Sequenzen benutzt werden. Bitpolymerisation Prozeß des Verkettens von Algomeren zu Logomeren, wenn es nur zwei verschiedene Elongatoren gibt.Carrier of a number of nucleic acids which are used for the detection of complementary sequences. Bit polymerisation Process of chaining algomers to logomers if there are only two different elongators.
Byte Informationseinheit aus 8 Bit, bzw. Molekül, das 8 Bit repräsentiert. Elongator Algomer mit zwei Überhangsequenzen; kann mit Terminator oderByte unit of information consisting of 8 bits, or molecule that represents 8 bits. Elongator Algomer with two overhang sequences; can with terminator or
Elongator ligieren und führt zu einer Kettenverlängerung. Grammatik Formalismus, der Sprachen beschreibt. Er basiert auf der formalenElongator ligate and leads to a chain extension. Grammar formalism that describes languages. It is based on the formal
Theorie von Sprachen [Chomsky, N., Three modeis for the description of language, JACM, 2:3, 113-124, (1956)], [Chomsky, N., On certain formal properties of grammars, Inf. and Control, 2:2, 137-167, (1959)],Theory of languages [Chomsky, N., Three modeis for the description of language, JACM, 2: 3, 113-124, (1956)], [Chomsky, N., On certain formal properties of grammars, Inf. And Control, 2: 2, 137-167, (1959)],
[Chomsky, N., Formal properties of grammars, Handbook of Math.[Chomsky, N., Formal properties of grammars, Handbook of Math.
Psych., 2, 323-418, (1963)].Psych., 2, 323-418, (1963)].
Eine Grammatik G beschreibt eine Sprache L(G), das Alphabet dieserA grammar G describes a language L (G), the alphabet of this
Sprache und deren Syntax. Nach einer Grammatik G können alleLanguage and its syntax. According to a grammar G everyone can
Wörter dieser Sprache erzeugt werden.Words of this language are generated.
Eine Grammatik G ist ein Quadrupel (Σ, V, R, S) mit Terminalalphabet Σ,A grammar G is a quadruple (Σ, V, R, S) with terminal alphabet Σ,
Variablenmenge V, Startsymbol S und Regelmenge R.Set of variables V, start symbol S and control set R.
Logomer Polymer, das symbolische Informationen trägt und durch die Verkettung von Algomeren erzeugt wurde. Entsprechend besteht ein Logomer aus sich wiederholenden Einheiten von Algomeren. Ein Logomer repräsentiert ein Wort einer Sprache L(G), die von der entsprechendenLogomer polymer that carries symbolic information and was created by the chaining of algomers. Accordingly, a logomer consists of repeating units of algomers. A logomer represents a word of a language L (G) by the corresponding one
Grammatik G erzeugt wird.Grammar G is generated.
Monomer Einzelmolekül. Mehrere Monomere können zu längeren Ketten verknüpft werden und so Oligomere und Polymere bilden.Single monomer molecule. Several monomers can be linked to form longer chains and thus form oligomers and polymers.
Monomere sind im Fall von Desoxyribonukleinsäure die NukleotideIn the case of deoxyribonucleic acid, monomers are the nucleotides
(Adenin, Cytosin, Guanin, Thymin wie auch sog. Basenanaloga wie(Adenine, cytosine, guanine, thymine as well as so-called base analogues such as
Hypoxanthin etc.).Hypoxanthine etc.).
Multibyte Eine beliebige Datenstruktur, die aus Vielfachen von Bytes besteht. Oligomer Kurzkettiges Molekül aus sich wiederholenden Einheiten (Monomeren).Multibyte Any data structure consisting of multiples of bytes. Oligomer Short chain molecule made up of repeating units (monomers).
Auch kurze doppelsträngige Moleküle werden als Oligomere bezeichnet.Short double-stranded molecules are also called oligomers.
PCR Polymerase Chain Reaction = Polymerase Kettenreaktion; Verfahren zur exponentiellen Vervielfältigung von DNA.PCR Polymerase Chain Reaction = polymerase chain reaction; Exponential DNA amplification method.
Die PCR benötigt ein DNA Template, das vervielfältigt wird, und zweiThe PCR requires one DNA template to be duplicated and two
Primer, die jeweils gegenläufig im Template ansetzen und alsPrimers, which start in opposite directions in the template and as
Startpunkte einer DNA Polymerisation fungieren. Durch iterativeStarting points of a DNA polymerization act. Through iterative
Wiederholung von Schmelzen-Hybridisierung-Polymerisations-Zyklen wird das DNA Template vervielfältigt. Polymer Langkettiges Molekül aus sich wiederholenden Einheiten (Monomeren). Regel auch: Produktionsregel, Ersetzungsregel oder Ableitungsregel.Repetition of melt-hybridization-polymerization cycles, the DNA template is duplicated. Polymer Long chain molecule made up of repeating units (monomers). Rule also: production rule, replacement rule or derivation rule.
Beschreibt die Ersetzung von Symbolen durch andere. Durch die wiederholte Anwendung von Regeln können Symbolketten erzeugt werden. Sequenz Informatik: Abfolge von Zeichen;Describes the replacement of symbols by others. By repeatedly applying rules, symbol chains can be created. Computer science sequence: sequence of characters;
Chemie: Abfolge kovalent verbundener Monomere;Chemistry: sequence of covalently linked monomers;
Molekularbiologie: Abfolge kovalent verbundener Nukleotide.Molecular biology: sequence of covalently linked nucleotides.
Komplementarität Zwei Sequenzen sind dann komplementär, wenn sie miteinander hybridisieren können. Im Falle von DNA sind z.B. die SequenzenComplementarity Two sequences are complementary if they can hybridize with each other. In the case of DNA e.g. the sequences
5'attt3' und 5'aaat3' komplementär, die Sequenz 5'acgt3' ist zu sich selbst komplementär.5'attt3 'and 5'aaat3' complementary, the sequence 5'acgt3 'is complementary to itself.
Startsymbol Variable innerhalb einer Grammatik, von der ausgehend, durchStart symbol variable within a grammar from which to start
Anwendung der Regeln der Grammatik, eine Symbolkette erzeugt werden kann. Symbolpolymerisation Prozeß des Verkettens von Algomeren zu Logomeren. Terminal Symbol einer Grammatik. Ein Terminal kann nicht weiter ersetztApplying the rules of grammar, a symbol string can be generated. Symbol polymerization Process of chaining algomers to logomers. Terminal symbol of a grammar. A terminal can no longer be replaced
(substituiert) werden. Terminale sind die "Buchstaben" der Worte einer(substituted). Terminals are the "letters" of a person's words
Sprache L(G).Language L (G).
Terminator Algomer mit einer Überhangsequenz. Kann nur mit Elongator ligieren.Terminator Algomer with an overhang sequence. Can only ligate with elongator.
Führt zum Kettenabbruch bei einer Symbolpolymerisation.Leads to chain termination during symbol polymerization.
Uniqueness Eindeutigkeit von Sequenzen untereinander. Eine Sequenz S ausUniqueness of uniqueness of sequences. A sequence S from
Monomeren ist 10-unique zu einer Menge M anderer Sequenzen, wenn jede Teilsequenz der Länge 10 von S in keiner anderen Sequenz derMonomers is 10-unique to a set M of other sequences if each partial sequence of length 10 of S is not in any other sequence
Menge M auftritt. Die Uniqueness kann auch in Prozent angegeben werden. Z.B. sind 2 Sequenzen der Länge 20, deren längste gemeinsame Teilsequenz 5 Monomere beträgt, zueinander 6-unique, ihre Uniqueness in Prozent beträgt: (1 - 5/20) * 100 = 80%.Set M occurs. The uniqueness can also be given in percent. For example, 2 sequences of length 20, the longest common partial sequence of which is 5 monomers, are 6-unique to one another, and their uniqueness is in percent: (1 - 5/20) * 100 = 80%.
Variable Symbol einer Grammatik. Eine Variable kann gemäß der Regel einerVariable symbol of a grammar. According to the rule, a variable can be a
Grammatik von Terminalen, Variablen oder Kombinationen vonGrammar of terminals, variables or combinations of
Terminalen und Variablen ersetzt werden. Kurzbeschreibung der AbbildungenTerminals and variables are replaced. Brief description of the pictures
Abbildung 1 : Algomere, wie in der Erläuterung zu Schritt IV des erfindungsgemäßen Verfahrens beschrieben. Die Algomere besitzen jeweils eine doppelsträngige Kernsequenz, die ein Terminal einer gegebenen Grammatik darstellt und mindestens eine einzelsträngige Überhangsequenz, die eine Variable der gegebenen Grammatik darstellt, so daß jeweils ein Algomer genau eine Regel der gegebenen Grammatik repräsentiert. X und Y sind keine Variablen, sondern Überhangsequenzen, die z.B. für eine Klonierung benutzt werden können. Mit Überstrichen dargestellte Buchstaben kennzeichnen Komplementarität. Gemäß der Definition sind AOA und A1A Elongatoren, XsA und AeY Terminatoren. Die hier dargestellten Algomere repräsentieren die im Folgenden beschriebenen Grammatik zur Erzeugung binärer Zufallszahlen.Figure 1: Algomers, as described in the explanation of step IV of the method according to the invention. The algomers each have a double-stranded core sequence that represents a terminal of a given grammar and at least one single-stranded overhang sequence that represents a variable of the given grammar, so that each algomer represents exactly one rule of the given grammar. X and Y are not variables, but overhang sequences that e.g. can be used for cloning. Letters with overlines indicate complementarity. By definition, AOA and A1A are elongators, XsA and AeY are terminators. The algomers shown here represent the grammar described below for generating binary random numbers.
Abbildung 2: Symbolpolymerisation, wie in der Erläuterung zum erfindungsgemäßen Schritt V beschrieben. Algomere werden durch Verkettung (im Falle von DNA: Hybridisierung und Ligation) zu Logomeren verknüpft. Das Logomer Xs01010101 eY beinhaltet eine terminierte Bitfolge, die durch die Überhänge X und Y in einer definierten Orientierung vervielfältigt werden kann.Figure 2: Symbol polymerization, as described in the explanation of step V according to the invention. Algomers are linked to logomers by chaining (in the case of DNA: hybridization and ligation). The logomer Xs01010101 eY contains a terminated bit sequence, which can be reproduced in a defined orientation by the overhangs X and Y.
Abbildung 3: Muster, das die Symbolpolymerisation für binäre Zufallszahlen nach Gelelektrophorese und Färbung zeigt (Spuren 1 -3). Aufgrund der zufälligen Länge der binären Zufallszahlen ergibt sich ein regelmäßiges Leitermuster. Spur 4 zeigt einen 50bp Molekulargewichtsstandard (Gibco BRL, Life Technologies, Katalog Nr. 10416-014).Figure 3: Pattern showing symbol polymerization for binary random numbers after gel electrophoresis and staining (lanes 1 -3). Due to the random length of the binary random numbers, there is a regular conductor pattern. Lane 4 shows a 50bp molecular weight standard (Gibco BRL, Life Technologies, Catalog No. 10416-014).
Abbildung 4: Klonierung eines durch Symbolpolymerisation erhaltenen Logomers in einem Vektor, wie zu Vervielfältigung und Isolierung von Logomeren im Folgenden beschrieben.Figure 4: Cloning of a logomer obtained by symbol polymerization in a vector, as described below for the amplification and isolation of logomers.
Abbildung 5: Schematische Darstellung eines Bandenmusters, das durch Auslesen eines binären Logomers durch PCR und nachfolgende Gelelektrophorese erhalten wird (im Folgenden beschrieben). Im gezeigten Beispiel haben die Algomere eine Länge von 30bp (Überhangsequenzen nur 1/2 gerechnet). Bei bekannter Länge des Logomers reicht es, jeweils nur Oen oder nur 1 en auszulesen. Beide Bits auszulesen dient der Kontrolle. Das Verfahren kann auch für mehrwertige Logomere (mehr als 2 Elongatoren) verwendet werden.Figure 5: Schematic representation of a band pattern which is obtained by reading out a binary logomer by PCR and subsequent gel electrophoresis (described below). In the example shown, the algomers have a length of 30 bp (overhang sequences calculated only 1/2). If the length of the logomer is known, it is sufficient to read out only oen or only 1 s. Reading out both bits is for control purposes. The process can also be used for multivalent logomers (more than 2 elongators).
Abbildung 6: Bandenmuster einer Gelelektrophorese nach PCR zum Auslesen von drei verschiedenen Logomeren. Die Logomere wurden nach der im Folgenden beschriebenen Grammatik für Zufallszahlen beliebiger Länge erhalten. Als Zufallszahlen von unten nach oben gelesen ist a = 262, b = 97, c = 329. M (Spur 5) ist ein 50bp Molekulargewichtsstandard (Gibco BRL, Life Technologies, Katalog Nr. 10416-014). Abbildung 7: Schematische Darstellung des Auslesens von Logomeren durchFigure 6: Band pattern of a gel electrophoresis after PCR for reading out three different logomers. The logomers were obtained according to the grammar described below for random numbers of any length. Read as random numbers from bottom to top is a = 262, b = 97, c = 329. M (lane 5) is a 50 bp molecular weight standard (Gibco BRL, Life Technologies, Catalog No. 10416-014). Figure 7: Schematic representation of the reading out of logomers by
Restriktionsverdau wie im Folgenden beschrieben. Die Elongatoren tragen Restriktionsschnittstellen, die derart asymmetrisch angeordnet sind, daß der Restriktionsverdau von Logomeren in einem eindeutigen Schnittmuster von Fragmenten resultiert. Das Schnittmuster entspricht Banden verschiedener Länge, und kann durch Gelelektrophorese sichtbar gemacht werden. R1 und R2 sind unterschiedliche Restriktionsenzyme, x und y bezeichnen die Länge der nach Restriktionsverdau erhaltenen Fragmente. Zweckmäßig ist z.B. ein Verhältnis x:y von 1 :2.Restriction digestion as described below. The elongators carry restriction sites which are arranged asymmetrically in such a way that the restriction digestion of logomers results in a clear cutting pattern of fragments. The pattern corresponds to bands of different lengths and can be made visible by gel electrophoresis. R1 and R2 are different restriction enzymes, x and y denote the length of the fragments obtained after restriction digestion. For example, a ratio x: y of 1: 2.
Abbildung 8: Bandenmuster, die durch Gelelektrophorese nach dem Auslesen von Logomeren durch Restriktionsverdau erhalten werden. Spur 7 und 8 enthalten Molekulargewichtsstandards (Spur 7: 50pb Leiter, Gibco BRL, Life Technologies, Katalog Nr. 10416-014; Spur 8: 10bp Leiter)Figure 8: Band patterns obtained by gel electrophoresis after reading out logomers by restriction digestion. Lane 7 and 8 contain molecular weight standards (Lane 7: 50pb wire, Gibco BRL, Life Technologies, Catalog No. 10416-014; Lane 8: 10bp wire)
Abbildung 9: Schematische Darstellung eines polymeren Datenspeichers auf der Basis von Algomeren und Symbolpolymerisation wie im Nachfolgenden beschrieben. Algomere können an Ankermoleküle (AM), die an einem festen Träger (C) gebunden ist, polymerisieren. Das Schreiben (W) erfolgt durch die wiederholte Abfolge (ReW) von Hybridisierungs-Ligations- Restriktionszyklen (Hyb, Lig, Res). Durch Denaturieren oder Restriktion (Den/Dig) können die erhaltenen Logomere abgetrennt und ausgelesen werden.Figure 9: Schematic representation of a polymeric data storage medium based on algomers and symbol polymerization as described below. Algomers can polymerize on anchor molecules (AM) bound to a solid support (C). The writing (W) is carried out by the repeated sequence (ReW) of hybridization-ligation restriction cycles (Hyb, Lig, Res). The logomers obtained can be separated and read out by denaturing or restriction (Den / Dig).
Abbildung 10: Vereinfachte Darstellung der Bestandteile eines DNA Desktop Computers wie im Nachfolgenden beschrieben. Im Einzelnen sind:Figure 10: Simplified representation of the components of a DNA desktop computer as described below. The details are:
A: Oligo-Synthesizer, B: Thermozykler, C: Reaktionskammern, D: Pipettiervorrichtung, E: Gel, F: Scanner, G: Steuerungscomputer Es kennzeichnen:A: Oligo Synthesizer, B: Thermocycler, C: Reaction Chambers, D: Pipetting Device, E: Gel, F: Scanner, G: Control Computer It features:
1 : Zugabe von Oligonukleotiden, 2: Zugabe synthetisierter Oligomere in Reaktionskammern des Thermozyklers, 3: Zugabe von Lösungen und Molekülen, die zur Algomer-Assemblierung, Symbolpolymerisation, zur Isolierung von Logomeren und zum Auslesen benötigt werden.1: addition of oligonucleotides, 2: addition of synthesized oligomers in reaction chambers of the thermal cycler, 3: addition of solutions and molecules which are required for algomer assembly, symbol polymerization, for the isolation of logomers and for reading.
Abbildung 11 : Verschlüsselung von Logomeren wie im Folgenden beschrieben. Sind die Terminatoren und die darin primenden Primer unbekannt, so ist das jeweilige Logomer verschlüsselt und kann nicht ausgelesen werden (A). Ist dagegen ein in einem Terminator primender Primer verfügbar oder die Sequenz eines Terminators bekannt, so kann das jeweilige Logomer gelesen werden (B).Figure 11: Encryption of logomeres as described below. If the terminators and the primers priming in them are unknown, the respective logomer is encrypted and cannot be read out (A). If, on the other hand, a primer priming in a terminator is available or the sequence of a terminator is known, the respective logomer can be read (B).
Abbildung 12: Y-förmiges Molekül, das als Terminator bei der asymmetrischen Verschlüsselung von Logomeren verwendet werden kann. Elongatoren können an das mit 2 markierte Ende angeknüpft werden, weitere, z.B. Y-förmige, Moleküle an die mit 1 und 3 bezeichneten Enden. Werden mehrere Y-förmige Moleküle miteinander verknüpft, so erhält man baumartige Strukturen. Abbildung 13: Logomer mit Terminatoren s und e, die als baumartige Strukturen realisiert sind.Figure 12: Y-shaped molecule that can be used as a terminator in the asymmetric encryption of logomers. Elongators can be attached to the end marked with 2, further, for example Y-shaped, molecules to the ends labeled 1 and 3. If several Y-shaped molecules are linked together, tree-like structures are obtained. Figure 13: Logomer with terminators s and e, which are implemented as tree-like structures.
Abbildung 14: Mit einem Vektor V verknüpftes Logomer L mit baumartigen Terminatoren. Die Terminatoren sind so konstruiert, daß jeweils nur ein Ast des Terminators mit dem Vektor verknüpft werden kann.Figure 14: Logomer L linked to a vector V with tree-like terminators. The terminators are designed so that only one branch of the terminator can be linked to the vector.
Abbildung 15: Markierung von Nukleinsäuren mit Logomeren wie im Nachfolgenden beschrieben: Um gentechnisch hergestellte oder veränderte Produkte zu markieren, wird ein Logomer mithilfe rekombinativer Techniken in einen nicht-transkribierten Bereich, z.B. vor den Promotor (P) eines zu markierenden Genes (G), eingesetzt.Figure 15: Labeling of nucleic acids with logomers as described below: In order to label genetically engineered or modified products, a logomer is inserted into a non-transcribed area using recombinant techniques, e.g. before the promoter (P) of a gene to be labeled (G) used.
Abbildung 16: Markierung von Dokumenten mit Logomeren wie im Nachfolgenden beschrieben. Spur 1 zeigt den verwendeten Molekulargewichtsstandard (50bp, Gibco BRL, Life Technologies, Katalog Nr. 10416-014), Spur 2 (0-Bits) und Spur 3 (1 -Bits) das Bandenmuster des Auslesens von Logomer Nr. 330 durch PCR aus wässriger Lösung, die Spuren 4 und 5 dasselbe wie die Spuren 2 und 3, wobei hierbei jedoch das Logomer Nr. 330 nicht aus wässriger Lösung, sondern in ca. 109 Molekülen/μl getrocknet auf Papier (3M Post- It, 1 Stunde getrocknet) als Papierschnipsel (ca. 1 mm2) in die Auslese-PCR einging.Figure 16: Marking documents with logomeres as described below. Lane 1 shows the molecular weight standard used (50bp, Gibco BRL, Life Technologies, catalog No. 10416-014), lane 2 (0-bits) and lane 3 (1-bits) the band pattern of reading out logomer No. 330 by PCR aqueous solution, lanes 4 and 5 the same as lanes 2 and 3, but here the logomer No. 330 is not dried from aqueous solution but in approx. 10 9 molecules / μl on paper (3M Post-It, dried for 1 hour ) was used as a piece of paper (approx. 1 mm 2 ) in the readout PCR.
Abbildung 17: Herstellung von Molekulargewichtsstandards durch Auslese-PCR, die ein unäres Logomer als Template enthält, wie im Nachfolgenden beschrieben. 1 zeigt die Anordnung verschachtelter Primer in der Auslese-PCR, 2 das nach Gelelektrophorese der PCR-Fragmente erhaltene Bandenmuster.Figure 17: Preparation of molecular weight standards by readout PCR, which contains a unary logomer as a template, as described below. 1 shows the arrangement of nested primers in the readout PCR, FIG. 2 shows the band pattern obtained after gel electrophoresis of the PCR fragments.
Abbildung 18: Verkleben von Flächen mit Nukleinsäuren wie im Nachfolgenden beschrieben. C bezeichnet die zu verklebende Fläche, Log die Logomere, die zum Verkleben an die Flächen gebunden werden. 1 zeigt das Verhalten von Flächen mit nicht-komplementären, 2 das Verhalten von Flächen mit komplementären Logomeren.Figure 18: Gluing surfaces with nucleic acids as described below. C denotes the surface to be glued, Log the logomeres that are bound to the surfaces for gluing. 1 shows the behavior of surfaces with non-complementary, 2 the behavior of surfaces with complementary logomers.
Abbildung 19: Verkleben von Flächen mit Logomeren, Antikörpern und Liganden wie im Nachfolgenden beschrieben: C0 und Ci bezeichnen die zu verklebenden Flächen, die aus gleichem oder unterschiedlichem Material bestehen können. Die zu verklebenden Flächen sind mit Logomeren (Log) versetzt. An die Logomere können Proteine, z.B. Antikörper vom Typ Ab A und Ab B binden, wobei Ab A und Ab B gleich oder verschieden sein können. Ab A und Ab B sind ihrerseits durch einen Liganden (Li) miteinander verbunden.Figure 19: Gluing surfaces with logomers, antibodies and ligands as described below: C 0 and Ci designate the surfaces to be glued, which can consist of the same or different material. The surfaces to be glued are offset with logomeres (log). Proteins, for example antibodies of the type Ab A and Ab B, can bind to the logomers, wherein Ab A and Ab B can be the same or different. From A and Ab B are in turn connected to one another by a ligand (Li).
Abbildung 20: Verkleben von Flächen mit Proteinen z.B. Antikörpern ohne Verwendung von Logomeren. C0 und Ci bezeichnen die zu verklebenden Flächen, die aus gleichem oder unterschiedlichem Material bestehen können. Die Proteine vom Typ Ab A und Ab B binden direkt an die zu verklebenden Flächen und sind ihrerseits durch einen Liganden (Li) miteinander verbunden.Figure 20: Bonding surfaces with proteins, eg antibodies, without using logomers. C 0 and Ci denote the surfaces to be glued, which can consist of the same or different material. Bind the Ab A and Ab B proteins directly to the surfaces to be glued and are in turn connected to each other by a ligand (Li).
Abbildung 21 : Bei der Verknüpfung von Sequenzen zu längeren Sequenzketten kann es zu Verletzungen der vorgegebenen Uniqueness kommen, die Fehlhybridisierungen und damit Disfunktionalität nach sich ziehen kann. Dies ist auf das Entstehen neuer Basissequenzen (in der Abbildung markiert) aufgrund der Verknüpfung zurückzuführen.Figure 21: Linking sequences to longer sequence chains can lead to violations of the specified uniqueness, which can result in incorrect hybridizations and thus disfunctionality. This is due to the emergence of new base sequences (marked in the figure) due to the link.
Abbildung 22: Beispiel des Verknüpfens von Terminalen mit einer Variablen. Durch die gezeigten vier Regeln einer Grammatik mit der Variable A ergeben sich vier verschiedene Pfade, die sich über die Länge der Variablensequenz für A überschneiden. Außerdem überschneiden sich auch einige Sequenzen für mehrfach vorkommende Terminale (b, c), so daß links und rechts je drei Pfade zusammenlaufen.Figure 22: Example of linking terminals with a variable. The four rules of grammar with variable A shown result in four different paths that overlap over the length of the variable sequence for A. In addition, some sequences for overlapping terminals (b, c) also overlap, so that three paths converge on the left and right.
Abbildung 23: Haben mehr als vier verschiedene Variablensequenzen (A, B, C, D, E) Übergänge zu der gleichen Terminalsequenz (0), so muß mindestens eine Basissequenz mehrfach verwendet werden. Der gepunktete Rahmen zeigt den Iterationsschritt an, in der eine Verletzung der Uniqueness toleriert werden muß, um alle Regeln aus R übersetzen zu können.Figure 23: If more than four different variable sequences (A, B, C, D, E) have transitions to the same terminal sequence (0), at least one base sequence must be used several times. The dotted frame shows the iteration step in which a violation of the uniqueness must be tolerated in order to be able to translate all the rules from R.
Abbildung 24: Paralleles Auffüllen zweier Sequenzenverlängerungen für die Variablen A und B. Der gepunktete Rahmen zeigt den Iterationsschritt, in dem die Startbasissequenzen für die Pfadsuche liegen. Ab dem nächsten Iterationsschritt können ggf. Verletzungen der Uniqueness toleriert werden. Zu beachten ist, daß sich hier Verzweigungen auch über gruppengrenzen hinweg ergeben (z.B. des Terminals b zu den Variablen A und B).Figure 24: Parallel filling in of two sequence extensions for variables A and B. The dotted frame shows the iteration step in which the start base sequences for the path search lie. From the next iteration step, violations of the uniqueness may be tolerated. It should be noted that there are branches across group boundaries (e.g. terminal b to variables A and B).
Abbildung 25: Skizze eines 1 -Byte repräsentierenden Moleküls. Der mit x markierte Abschnitt enthält eine eindeutige Sequenz, die einen definierten Bytewert darstellt (die für die Darstellung aller Bytewerte benötigten 256 Nukleinsäuresequenzen sind im Sequenzprotokoll aufgeführt). Der mit s markierte Abschnitt enthält eine eindeutige Sequenz, die die Byteposition des betreffenden Bytes innerhalb von Multibytes kodiert und dient als Template für PCR Reaktionen (siehe Sequenzprotokoll). Die mit o und e markierten Abschnitte dienen zur Herstellung von Multibytes aus einzelnen Bytes und als Template für PCR Reaktionen (siehe Sequenzprotokoll).Figure 25: Sketch of a 1-byte molecule. The section marked with an x contains a unique sequence that represents a defined byte value (the 256 nucleic acid sequences required for the representation of all byte values are listed in the sequence listing). The section marked with s contains a unique sequence that encodes the byte position of the relevant byte within multibytes and serves as a template for PCR reactions (see sequence listing). The sections marked with o and e are used to produce multibytes from individual bytes and as templates for PCR reactions (see sequence listing).
Abbildung 26: Schematische Darstellung von vier 1 -Byte Molekülen mit unterschiedlichen Bytepositionen (s0 - s3). Die Einzelbytes können zu Multibytes verbunden werden.Figure 26: Schematic representation of four 1-byte molecules with different byte positions (s 0 - s 3 ). The single bytes can be combined to multibytes.
Abbildung 27: Zum Zwecke der Vervielfältigung können einzelne Bytemoleküle in genetischen Vektoren (Plasmiden) kloniert werden. Abbildung 28: Beispiel der Konstruktion eines Byte-repräsentierenden DNA Moleküls. DasFigure 27: For the purpose of duplication, individual byte molecules can be cloned in genetic vectors (plasmids). Figure 28: Example of the construction of a byte-representing DNA molecule. The
Moleküle besteht aus mehreren funktionellen Untereinheiten: Für X gibt es 256 eindeutige Basenfolgen die alle Werte eines einzelnen Bytes darstellen. S ist eine eindeutige Sequenz, die die Position eines Bytes (das im Strang unmittelbar folgende X) innerhalb von Multibytes repräsentiert. O und E dienen als eindeutige Erkennungssequenzen für die Verkettung einzelner Bytes zu Multibytes.Molecules consist of several functional subunits: For X there are 256 unique base sequences that represent all values of a single byte. S is a unique sequence that represents the position of a byte (the immediately following X in the string) within multibytes. O and E serve as unique recognition sequences for the concatenation of individual bytes to multibytes.
DNA Bytes können unverkettet oder verkettet zur Kennzeichnung verwendet werden. Durch das Ausschneiden der X oder der SX Untereinheiten werden DNA Abschnitte gewonnen, die für das "Spotten" von Biochips verwendet werden. Die so hergestellten Biochips werden ihererseits zum Auslesen von einzelnen Bytes oder Multibytes verwendet.DNA bytes can be used unlinked or chained for identification. By cutting out the X or SX subunits, DNA sections are obtained which are used for the "spotting" of biochips. The biochips produced in this way are used for reading individual bytes or multibytes.
Abbildung 29: Verkettung von Bytes zu Multibytes. Im Beispiel werden 4 Bytes zu einer 32-bit Datenstruktur verknüpft. Außerdem können die endständigen Sequenzen L und R als Adapter fungieren, um die 32-bit DNA Datenstruktur in andere DNA einzubringen. Sie können entweder spezifische Rekombinationssites oder Restriktionssites tragen. Ein Beispiel ist die Kennzeichnung eines Plasmids in Abbildung 31.Figure 29: Concatenation of bytes to multibytes. In the example, 4 bytes are linked to a 32-bit data structure. In addition, the terminal sequences L and R can act as adapters to insert the 32-bit DNA data structure into other DNA. You can either carry specific recombination sites or restriction sites. An example is the labeling of a plasmid in Figure 31.
Abbildung 30: Schematischer Aufbau eines 32-Bit Moleküls, das durch Verknüpfung von 4 1- Byte Molekülen hergestellt wird. Das Molekül kann zum Zwecke der Kennzeichnung den zu markierenden Substanzen beigemischt oder angeheftet werden. Zur Kennzeichnung von Nukleinsäurekonstrukten und Genen können die mit L und R bezeichneten Sequenzen Restriktions- oder Rekombinationssites tragen, durch die sie mit dem zu markierenden Molekül verbunden werden.Figure 30: Schematic structure of a 32-bit molecule that is produced by linking 4 1-byte molecules. The molecule can be added or attached to the substances to be labeled for the purpose of labeling. To identify nucleic acid constructs and genes, the sequences labeled L and R can carry restriction or recombination sites through which they are linked to the molecule to be labeled.
Abbildung 31 : Kennzeichnung eines Plasmids duch ein 32-bit Molekül. Das nullte Byte hat den Wert 109, das erste den Wert 67, das zweite den Wert 35, das dritte den Wert 192. Als 32-Bit Zahl ohne Vorzeichen entspricht das Bytemuster des gekennzeichneten Plasmids der Zahl 3223536493.Figure 31: Identification of a plasmid by a 32-bit molecule. The zeroth byte has the value 109, the first the value 67, the second the value 35, the third the value 192. As a 32-bit unsigned number, the byte pattern of the marked plasmid corresponds to the number 3223536493.
Abbildung 32: Skizze eines 1 -Byte Biochips, der mit allen 256 x-Fragmenten (siehe Abbildung 25 bis Abbildung 28) von x0 bis x255 gespottet wurde (X-Chip). Dargestellt sind nur einige der 256 unterschiedlichen Sequenzen. Zum Auslesen von Multibytes werden die jeweiligen Einzelbytes mit PCR voramplifiziert (s bis e) und einzeln auf getrennten Chips hybridisiert. So sind für ein 4-Byte Molekül (siehe Abbildung 30) 4 PCR Reaktionen und 4 Chips erforderlich.Figure 32: Sketch of a 1-byte biochip that was spotted with all 256 x fragments (see Figure 25 to Figure 28) from x 0 to x 255 (X chip). Only some of the 256 different sequences are shown. To read out multibytes, the individual bytes are pre-amplified with PCR (s to e) and hybridized individually on separate chips. For a 4-byte molecule (see Figure 30), 4 PCR reactions and 4 chips are required.
Abbildung 33: Skizze eines 1-Byte Biochips, der mit allen 256 s0x-Fragmenten (siehe Abbildung 25 bis Abbildung 28) von s0x0 bis s0x255 gespottet wurde (SX-Chip). Dargestellt sind nur einige der 256 unterschiedlichen Sequenzen. Im Gegensatz zum Chiptyp aus Abbildung 32 können hier die Hybridisierungsbedingungen so gewählt werden, daß Bytes abhängig von ihrer Position in einem Multibyte detektiert werden. Im Beispiel werden nur s0Xi aber keine snXι mit n ≠ 0 detektiert. Analog lassen sich 1 -Byte Chips herstellen, die nur s-ix, detektieren usw.. Das ermöglicht es, Chips herzustellen, die Multibytes direkt (ohne PCR) und vollständig lesen können. Ein Beispiel ist der in Abbildung 37 gezeigte 4-Byte Chip.Figure 33: Sketch of a 1-byte biochip that was spotted with all 256 s 0 x fragments (see Figure 25 to Figure 28) from s 0 x 0 to s 0 x 255 (SX chip). Only some of the 256 different sequences are shown. In contrast to the chip type from Figure 32, the hybridization conditions can be selected so that bytes are detected depending on their position in a multibyte. In the example, only s 0 Xi but no s n Xι with n ≠ 0 are detected. Analog 1-byte chips can be produced that only detect s-ix, etc. This makes it possible to produce chips that can read multibytes directly (without PCR) and completely. An example is the 4-byte chip shown in Figure 37.
Abbildung 34: Layout des 1 -Byte Chips. Ist der Chip als X-Chip implementiert (siehe Abbildung 32) enthält er 256 Spots mit allen 256 x-Fragmente (siehe Sequenzprotokoll), ist er als SX-Chip (siehe Abbildung 33) implementiert enthält er 256 Spots mit allen SjX-Fragmenten.Figure 34: Layout of the 1-byte chip. If the chip is implemented as an X chip (see Figure 32), it contains 256 spots with all 256 x fragments (see sequence listing); if it is implemented as an SX chip (see Figure 33), it contains 256 spots with all SjX fragments.
Jedes x-Fragment repräsentiert genau einen Bytewert (x0 = 0, Xi = 1 X255 = 255). DieEach x fragment represents exactly one byte value (x 0 = 0, Xi = 1 X 255 = 255). The
Sequenzen für s und x sind so gewählt, daß sie untereinander möglichst ähnliche Schmelztemperaturen haben, dabei aber möglichst unterschiedliche Sequenzen, um Fehlhybridisierungen auszuschließen.Sequences for s and x are chosen such that they have melting temperatures that are as similar as possible to one another, but different sequences as possible in order to rule out incorrect hybridizations.
Abbildung 35: Herstellung von Multibyte-Chips aus 1 -Byte SX-Chips. Im Beispiel ist die Herstellung eines 4-Byte Chips aus je einem SX0-, SXr, einem SX2- und einem SX3-Chip gezeigt. Multibyte-Chips können z.B. zu linearen (a) oder 2-dimensiohalen (b) Byte-Arrays angeordnet werden.Figure 35: Production of multibyte chips from 1-byte SX chips. The example shows the production of a 4-byte chip from an SX 0 , SXr, an SX 2 and an SX 3 chip. Multibyte chips can be arranged, for example, in linear (a) or 2-dimensional (b) byte arrays.
Abbildung 36: Auslesen eines 32-Bit Moleküls (siehe Abbildung 30 und Abbildung 31) mit einem 4-Byte SX-Chip (siehe Abbildung 35). Zum Auslesen können 32-Bit Moleküle direkt mit dem gesamten Chip hybridisiert werden. Dadurch kann der 32-bit Wert direkt ausgelesen werden (im Beispiel markiert). Außerdem können die Bytes auch unabhängig voneinander mit PCR amplifiziert und getrennt voneinander hybridisiert werden.Figure 36: Reading a 32-bit molecule (see Figure 30 and Figure 31) with a 4-byte SX chip (see Figure 35). For reading out, 32-bit molecules can be hybridized directly with the entire chip. This enables the 32-bit value to be read out directly (marked in the example). The bytes can also be independently amplified with PCR and hybridized separately.
Alternativ dazu kann ein Multibyte-Chip auch aus identischen 8-Bit Einheiten aufgebaut sein, die nur mit X-Fragmenten gespottet sind. Um die Positionsinformation der Bytes beizubehalten müssen dann die einzelnen Bytes getrennt voneinander in den jeweils korrespondierenden Sektoren gespottet werden.Alternatively, a multibyte chip can also be constructed from identical 8-bit units that are only spotted with X fragments. In order to maintain the position information of the bytes, the individual bytes must then be spotted separately from one another in the corresponding sectors.
Abbildung 37: Multibyte Array aus identischen 1 -Byte Chips (X-Chips). Multibyte Arrays aus X- Chips können ebenfalls zum Auslesen von Markierungsmolekülen verwendet werden wie bereits beschrieben wurde. Außerdem können Multibyte Arrays zum Speichern und für die optische Anzeige von Computerdaten verwendet werden.Figure 37: Multibyte array of identical 1-byte chips (X-chips). Multibyte arrays made of X chips can also be used to read out marking molecules, as has already been described. In addition, multi-byte arrays can be used for storage and for the visual display of computer data.
Sequenzprotokoll: Moleküle, die für die Herstellung der unten beschriebenen 32-Bit Moleküle benötigt werden. Die Moleküle werden wie unten beschrieben zu Algomeren zusammengesetzt. Die o, s, e und x Einheiten werden wie unten beschrieben zu Bytes zusammengesetzt. Diese werden wiederum wie unten beschrieben zu Multibytes (im Beispiel zu 4-Byte = 32-Bit Molekülen) zusammengesetzt. Die 32-Bit Moleküle werden ihrerseits z.B. zur Kennzeichnung und Markierung verwendet und außerdem zur Herstellung von Biochips (wie unten beschrieben) verwendet. Erläuterung zu I: Wahl von GrammatikenSequence listing: Molecules required to produce the 32-bit molecules described below. The molecules are assembled into algomers as described below. The o, s, e and x units are put together into bytes as described below. These are in turn combined as described below to form multibytes (in the example 4-byte = 32-bit molecules). For their part, the 32-bit molecules are used, for example, for marking and labeling and also for the production of biochips (as described below). Explanation to I: Choice of grammars
Eine Grammatik ist ein Quadrupel G = (Σ, V, R, S) mit einem endlichen Terminalalphabet Σ, einer endlichen Variablenmenge V, einer endlichen Regelmenge R und einem Startsymbol S. Für eine Sprache L(G), die durch G beschrieben wird, können alle Wörter aus L als Wörter über dem Terminalalphabet Σ gebildet werden, indem man das Startsymbol S entsprechend den Regeln aus R ableitet.A grammar is a quadruple G = (Σ, V, R, S) with a finite terminal alphabet Σ, a finite variable set V, a finite rule set R and a start symbol S. For a language L (G), which is described by G, all words from L can be formed as words above the terminal alphabet Σ by deriving the start symbol S according to the rules from R.
Die Definition einer Grammatik G nach Schritt I des erfindungsgemäßen Verfahrens ist insofern frei, als beliebige, endliche Mengen von Terminalen und Variablen kodiert werden können. Erfindungsgemäß bevorzugt ist jedoch die Definition von Grammatiken, die dieThe definition of a grammar G after step I of the method according to the invention is free in that any finite sets of terminals and variables can be encoded. According to the invention, however, the definition of grammars is preferred, which the
Binärdarstellung von Daten gestattet, insbesondere von Grammatiken mitBinary representation of data allowed, especially of grammars with
Σ:= {0, 1 , So, s,, s2, ..., sn.ι, sn, e0, e,, e2 em.ι, em} mit n, m ε IN und n, m > 0.Σ: = {0, 1, So, s ,, s 2 , ..., s n .ι, s n , e 0 , e ,, e 2 e m .ι, e m } with n, m ε IN and n, m> 0.
Diese ermöglichen die Herstellung binärer Logomere.These enable the production of binary logomers.
Zur Veranschaulichung wird im Folgenden eine erfindungsgemäß definierte reguläre Grammatik zur Erzeugung von Zufallszahlen beliebiger endlicher Länge in Binärdarstellung gezeigt:For illustration purposes, a regular grammar defined in accordance with the invention for generating random numbers of any finite length is shown in binary form below:
Es sei eine Grammatik G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, 1 , s, e}, VariablenmengeLet there be a grammar G = (Σ, V, R, S) with terminal alphabet Σ: = {0, 1, s, e}, set of variables
V:={A}, Startsymbol S und RegelmengeV: = {A}, start symbol S and rule set
R:= {R: = {
S:=sAS: = sA
A->0AA-> 0A
A->1AA-> 1A
A->e }, wobei s:= Start e:= Ende sind.A-> e}, where s: = start e: = end.
Mit dieser Grammatik können Wörter über dem TerminalalphabetWith this grammar, words can be placed above the terminal alphabet
∑:= {0, 1 , s, θ} gebildet werden. Alle Wörter der Sprache L beginnen mit „s" und hören mit „e" auf, dazwischen befindet sich eine zufällige Anzahl (auch 0) zufälliger Bits („0" und „1"). Wörter aus der Sprache L, die nach R gebildet werden, sind beispielsweise: a) S->sA->se b) S->sA->s1A->s1e c) S->sA->s0A->s00A->s001 A->s0010A->s001 Oe d) S->sA->s1 A->s10A->s100A->s1000A->s10000A->s100000A->s1 OOOOOe Die als Wörter der Spache L erzeugten Binärmuster können als beliebige jedoch eindeutige∑: = {0, 1, s, θ}. All words of the language L begin with "s" and end with "e", in between there is a random number (also 0) of random bits ("0" and "1"). Words from the language L that are formed after R are, for example: a) S->sA-> se b) S->sA->s1A-> s1e c) S->sA->s0A->s00A-> s001 A->s0010A-> s001 Oe d) S->sA-> s1 A->s10A->s100A->s1000A->s10000A->s100000A-> s1 OOOOOe The binary patterns generated as words of language L can be any, however, unique
Darstellung von Datentypen, z.B. als Buchstaben, Zahlen, alphanumerische Zeichen oder Zeichenketten gelesen werden. Liest man sie als die Binärdarstellung von Zahlen, so sind die obigen Wörter in Dezimaldarstellung: a) 0 (leer) b) 1 c) 2 d) 32.Representation of data types, e.g. can be read as letters, numbers, alphanumeric characters or character strings. If you read them as the binary representation of numbers, the above words are in decimal notation: a) 0 (empty) b) 1 c) 2 d) 32.
Erläuterung zu II: das NFR-Verfahren zur Herstellung von MonomersequenzenExplanation on II: the NFR process for the production of monomer sequences
Das NFR-Verfahren (Niehaus-Feldkamp-Rauhe-Verfahren) ist ein Verfahren zur Herstellung von Monomersequenzen (Oligo- und Polymeren, z.B. Nukleinsäuren), das gewährleistet, daß die mithilfe des Verfahrens hergestellten Monomersequenzen: a) eine eindeutige und einzigartige Abfolge von Monomeren haben; b) zueinander möglichst unähnlich sind und daher möglichst keine Fehlhybridisierungen untereinander eingehen; c) bestimmte strukturelle Eigenschaften aufweisen, z.B. ein bestimmtes Verhältnis der verschiedenen Monomere zueinander, das Enthaltensein oder Nicht-Enthaltensein bestimmter Teilsequenzen und eine maximale Übereinstimmung (Homologie) untereinander; d) bestimmte chemische Eigenschaften aufweisen, z.B. das Vorkommen bestimmter chemisch aktiver Teilsequenzen, die Einfluß auf chemische Reaktionen, im Falle von Nukleinsäuren insbesondere die Wechselwirkung mit Proteinen habenThe NFR process (Niehaus-Feldkamp-Rauhe process) is a process for the production of monomer sequences (oligo- and polymers, e.g. nucleic acids), which ensures that the monomer sequences produced using the process: a) a clear and unique sequence of monomers to have; b) are as similar as possible to one another and therefore do not enter into false hybridizations with one another if possible; c) have certain structural properties, e.g. a certain ratio of the different monomers to one another, the presence or absence of certain partial sequences and a maximum agreement (homology) with one another; d) have certain chemical properties, e.g. the occurrence of certain chemically active partial sequences which have an influence on chemical reactions, in the case of nucleic acids in particular the interaction with proteins
(Proteinbindungsstellen, Restriktionsschnittstellen, Stopcodons); e) bestimmte physikalische Eigenschaften aufweisen, z.B. eine bestimmte Schmelztemperatur.(Protein binding sites, restriction sites, stop codons); e) have certain physical properties, e.g. a certain melting temperature.
Das NFR-Verfahren erlaubt die Herstellung eindeutiger, möglichst unähnlicher Monomersequenzen mit vordefinierbaren strukturellen, chemischen und physikalischen Eigenschaften. Es eignet sich zur Herstellung von Monomersequenzen für kontrollierte chemische Reaktionen, wie sie z.B. für eine molekularen Informationsverarbeitung benötigt werden. Es wird in Schritt III des erfindungsgemäßen Verfahrens für die Implementierung regulärer Grammatiken verwendet.The NFR process allows the production of clear, possibly dissimilar monomer sequences with predefinable structural, chemical and physical properties. It is suitable for the production of monomer sequences for controlled chemical reactions, e.g. are required for molecular information processing. It is used in step III of the method according to the invention for the implementation of regular grammars.
Das NFR-Verfahren ist eine erfindungsgemäße Fortbildung des Niehaus-Verfahrens zur Erzeugung eindeutiger, möglichst unähnlicher Sequenzen, das in [Jens Niehaus, DNA Computing: Bewertung und Simulation, Diplomarbeit am Fachbereich Informatik der Universität Dortmund, Lehrstuhl XI, 116-123, (1998)] beschrieben ist, und worauf hiermit in vollem Umfang Bezug genommen wird. Das NFR-Verfahren ist insofern eine erfindungsgemäße Fortbildung des Niehaus-Verfahrens, als erst das NFR-Verfahren die Herstellung von Monomersequenzen erlaubt, wie sie für eineThe NFR method is a further development according to the invention of the Niehaus method for generating clear, possibly dissimilar sequences, which is described in [Jens Niehaus, DNA Computing: Evaluation and Simulation, diploma thesis at the Department of Computer Science at the University of Dortmund, Chair XI, 116-123, (1998 )] and what is hereby incorporated by reference in its entirety. The NFR process is a further development of the Niehaus process in accordance with the invention, since only the NFR process allows the production of monomer sequences, such as those for a
Herstellung in vitro, z.B. zur Implementierung von Grammatiken, benötigt werden. Die Gründe sind im Einzelnen: a) Das Niehaus-Verfahren beschreibt nur die Konstruktion von Sequenzen ausIn vitro production, e.g. to implement grammars. The reasons are in detail: a) The Niehaus method only describes the construction of sequences
Basissequenzen der Länge 6. Da die Länge von Basissequenzen die maximal zwischen verschiedenen Monomersequenzen möglichen Überlappungen beschreibt, daher unmittelbaren Einfluß auf das Hybridisierungsverhalten von Sequenzen und dasBase sequences of length 6. Since the length of base sequences describes the maximum possible overlaps between different monomer sequences, it therefore has a direct influence on the hybridization behavior of sequences and the
Funktionieren der erfindungsgemäßen Schritte IV und V hat, muß das Verfahren jedoch für Basissequenzen beliebiger Länge verallgemeinert werden, was im NFR-Verfahren vorgenommen wurde. b) Das Niehaus-Verfahren erlaubt nur die Erzeugung von Sequenzen gleicher Länge, wohingegen das NFR-Verfahren Sequenzen unterschiedlicher Länge und unterschiedlicher Anzahl erzeugen kann. Letzteres ist für ein korrektes Hybridisierungsverhalten von Sequenzen und das Funktionieren der erfindungsgemäßen Schritte IV und V unerläßlich. c) Das Niehaus-Verfahren gewährleistet Eindeutigkeit und maximale Unähnlichkeit von Sequenzen nur für Sequenzen, die durch eine einmalige Anwendung des Verfahrens erzeugt wurden. Zwingend erforderlich ist jedoch, auch zu schon existierenden Sequenzen jeweils kompatible, d.h. eindeutige und maximal unähnliche Sequenzen erzeugen zu können. Das NFR-Verfahren kann im Gegsatz zum Niehaus-Verfahren zu beliebig vorgegebenen Sequenzen kompatible (d.h. eindeutige und maximal unähnliche) neue Sequenzen erzeugen. Dabei kann das Verfahren beliebig oft auf dieselbe Menge von Sequenzen angewendet werden. d) Das Niehaus-Verfahren beschränkt zwar die maximale Länge gemeinsamer Teilsequenzen, jedoch nicht deren Anzahl. Daher können 2 beliebige nach dem Niehaus- Verfahren konstruierte Sequenzen mehrere gemeinsame Teilsequenzen beinhalten, was ungewollt zu einer hohen Homologie (Sequenzübereinstimmung) führen kann. Die Homologie hat ihrerseits unmittelbaren Einfluß auf das Hybridisierungsverhalten von Sequenzen und das Funktionieren der erfindungsgemäßen Schritte IV und V. Das NFR- Verfahren dagegen führt bei der Konstruktion von Sequenzen auch einenIf steps IV and V according to the invention work, the method must, however, be generalized for base sequences of any length, which was done in the NFR method. b) The Niehaus method only allows the generation of sequences of the same length, whereas the NFR method can generate sequences of different lengths and different numbers. The latter is essential for correct hybridization behavior of sequences and the functioning of steps IV and V according to the invention. c) The Niehaus method guarantees uniqueness and maximum dissimilarity of sequences only for sequences that were generated by a single application of the method. It is imperative, however, to be compatible with existing sequences, i.e. to be able to generate clear and maximally dissimilar sequences. In contrast to the Niehaus method, the NFR method can generate new sequences that are compatible (i.e. unambiguous and maximally dissimilar). The method can be applied to the same set of sequences as often as required. d) The Niehaus method limits the maximum length of common partial sequences, but not their number. Therefore, any two sequences constructed according to the Niehaus method can contain several common partial sequences, which can unintentionally lead to a high degree of homology (sequence agreement). Homology in turn has a direct influence on the hybridization behavior of sequences and the functioning of steps IV and V according to the invention. The NFR method, on the other hand, also leads to the construction of sequences
Homologievergleich durch und vermeidet dadurch ungewollte Fehlhybridisierungen. e) Das Niehaus-Verfahren erlaubt nicht die Integration bestimmter, vorgebbarer Sequenzen und Teilsequenzen. Solche Sequenzen sind jedoch für die Ausführung und Kontrolle bestimmter chemischer Reaktionen, z.B. kontrollierter enzymatischer Wechselwirkungen, zwingend notwendig. Beispiele für solche Sequenzen sind im Falle von NukleinsäurenHomology comparison and thereby avoids unwanted incorrect hybridizations. e) The Niehaus method does not allow the integration of certain, predeterminable sequences and partial sequences. However, such sequences are necessary for the execution and control of certain chemical reactions, e.g. controlled enzymatic interactions, imperative. Examples of such sequences are in the case of nucleic acids
Proteinbindungsstellen, Restriktionsschnittstellen und Stopcodons. Dagegen erlaubt das NFR-Verfahren die Integration beliebiger Sequenzen und Teilsequenzen in die Herstellung von Monomersequenzen und gewährleistet gleichzeitig Eindeutigkeit und maximale Unähnlichkeit. f) Das Niehaus-Verfahren sieht keine Möglichkeit vor, Sequenzen mit bestimmten strukturellen, chemischen oder physikalischen Eigenschaften zu erzeugen. Dagegen enthält das NFR-Verfahren die Möglichkeit, Sequenzen mit bestimmten strukturellen, chemischen und physikalischen Eigenschaften herzustellen. Dazu zählen u.a. dasProtein binding sites, restriction sites and stop codons. In contrast, the NFR method allows the integration of any sequences and partial sequences in the production of monomer sequences, while ensuring uniqueness and maximum dissimilarity. f) The Niehaus method does not provide for the possibility of generating sequences with certain structural, chemical or physical properties. On the other hand the NFR process contains the possibility of producing sequences with certain structural, chemical and physical properties. These include the
Verhältnis verschiedener Monomere zueinander und die Schmelztemperatur. Auch dies ist für die Implementierung von Grammatiken in vitro eine unbedingte Voraussetzung. g) Das Niehaus-Verfahren erlaubt keine direkte Erzeugung regelrepräsentierenderRatio of different monomers to each other and the melting temperature. This is also an essential requirement for the implementation of grammars in vitro. g) The Niehaus method does not allow direct generation of rule-representative ones
Sequenzen, wie sie zur Implementierung von Grammatiken benötigt werden. Dagegen ermöglicht das NFR-Verfahren die Erzeugung symbolrepräsentierender Sequenzen, die zu den für die Implementierung einer Grammatik benötigten regelrepräsentierendenSequences as needed to implement grammars. On the other hand, the NFR method enables the generation of symbol-representative sequences that are representative of the rules required for the implementation of a grammar
Sequenzen verknüpft werden können. h) Nur mithilfe des NFR-Verfahrens können Sequenzen auch so konstruiert werden, daß dieSequences can be linked. h) Sequences can only be constructed using the NFR method so that the
Eigenschaften der Eindeutigkeit, maximalen Unähnlichkeit sowie strukturelle, chemische und physikalische Eigenschaften auch für Teilsequenzen gelten. Z.B. lassen sich im Falle von Nukleinsäuren Monomersequenzen so herstellen, daß sowohl die Gesamtsequenz, als auch z.B. das erste Drittel der Sequenz einen 50%igen GC-Anteil haben. DieseProperties of uniqueness, maximum dissimilarity as well as structural, chemical and physical properties also apply to partial sequences. For example, In the case of nucleic acids, monomer sequences can be prepared in such a way that both the entire sequence and e.g. the first third of the sequence has a 50% GC content. This
Eigenschaft ist z.B. für das Funktionieren der Verkettung von Sequenzen, die pro Molekül für mehrere Hybridisierungsereignisse vorgesehen sind (wie z.B. die im Folgenden beschriebenen Algomere), eine unbedingte Voraussetzung. Nur so lassen sich z.B.Property is e.g. an essential prerequisite for the functioning of the chaining of sequences which are intended for several hybridization events per molecule (such as the algomers described below). This is the only way
Sequenzen so konstruieren, daß unterschiedliche Hybridisierungsereignisse pro Molekül gleichwahrscheinlich sind. i) Nur das NFR-Verfahren erlaubt die unmittelbare, automatische Herstellung vonConstruct sequences so that different hybridization events per molecule are equally likely. i) Only the NFR process allows the immediate, automatic production of
Monomersequenzen, z.B. durch einen Oligonukleotidsynthesizer. j) Bei der Verknüpfung von Sequenzen zu längerkettigen Sequenzen kann es zuMonomer sequences, e.g. through an oligonucleotide synthesizer. j) When linking sequences to longer-chain sequences, it can be too
Verletzungen der Uniqueness kommen. Für die korrekte Herstellung von Polymeren durch das Verknüpfen von Oligomeren (wie z.B. das Verknüpfen von Algomeren zu Logomeren) ist es unbedingt erforderlich, daß diese Uniqueness-Verletzungen nur in einem vordefinierten Bereich auftreten, damit keine unkontrollierten Fehlhybridisierungen auftreten (siehe Abbildung 21). Dieses Problem tritt ganz grundsätzlich auf und muß insbesondere für die Verknüpfung von Algomeren und die Verknüpfung von Variablen undUniqueness violations are coming. For the correct production of polymers by linking oligomers (such as linking algomers to logomers), it is imperative that these uniqueness violations only occur in a predefined range, so that no uncontrolled incorrect hybridizations occur (see Figure 21). This problem occurs quite fundamentally and must be used in particular for the linking of algomers and the linking of variables and
Terminalen gelöst werde, weil sonst eine Übersetzung von Grammatiken in Moleküle unmöglich ist. Das Niehaus-Verfahren löst dieses Problem nicht und ist daher für dieTerminals are solved, because otherwise a translation of grammars into molecules is impossible. The Niehaus method does not solve this problem and is therefore for them
Übersetzung von Grammatiken in Moleküle ungeeignet. Das Problem wird unterInappropriate translation of grammars into molecules. The problem is under
Verwendung des NFR-Verfahrens durch eine "Parallel-Extension" Strategie gelöst. Diese wird im Folgenden erläutert.Use of the NFR method solved by a "parallel extension" strategy. This is explained below.
Zur Herstellung von Monomersequenzen werden diese durch das NFR-Verfahren konstruiert und synthetisiert. Zur Herstellung von n Monomersequenzen wird das NFR-Verfahren wie im Folgenden beschrieben durchgeführt, wobei zur Beschreibung des Verfahrens folgende Abkürzungen benutzt werden: Alphabet der Mächtigkeit a e IN;To produce monomer sequences, these are constructed and synthesized using the NFR method. To produce n monomer sequences, the NFR process is carried out as described below, the following abbreviations being used to describe the process: Alphabet of thickness ae IN;
Im Falle von DNA ist A:= {a, c, g, t} und a = 4.In the case of DNA, A: = {a, c, g, t} and a = 4.
Sequenz.Sequence.
Folge von Elementen des Alphabets A, das einer Sequenz aus Monomeren entspricht.Sequence of elements of the alphabet A, which corresponds to a sequence of monomers.
'seq Länge der pro Verfahrenszyklus zu konstruierenden Sequenzen.'seq length of the sequences to be constructed per process cycle.
^seq Sequenz der Länge lseq.^ seq sequence of length l seq .
*^seq,k (k-1 )-tes Monomer der Sequenz Sseq (k e Z/V; k <= lsθq).* ^ seq, k (k-1) th monomer of the sequence S seq (ke Z / V; k <= l sθq ).
'bas Länge der pro Verfahrenszyklus zur Konstruktion von Sequenzen verwendeten Basissequenzen.'bas Length of the base sequences used for the construction of sequences per process cycle.
Es gilt: 0 < l as <= lseq ■The following applies: 0 <l as <= lseq ■
5bas Sequenz der Länge l as = Basissequenz; Sequenzen der Länge lseq werden aus Basissequenzen konstruiert. maximale Länge der Kette aufeinanderfolgender Monomere, die jeweils zwei durch das Verfahren erzeugte Sequenzen gemeinsam haben („overlap").5bas sequence of length l as = base sequence; Sequences of length l seq are constructed from basic sequences. maximum length of the chain of successive monomers, each of which has two sequences generated by the process in common ("overlap").
'bas - 1 •'bas - 1 •
'ov/lsβq Verhältnis von maximal erlaubter Sequenzwiederholung zu'ov / lsβq ratio of the maximum allowed sequence repetition to
Sequenzgesamtlänge;Total sequence length;
1. Maß für die Fehlhybridisierungswahrscheinlichkeit. ba asst/l 'jseq Verhältnis von Basissequenzlänge zu Sequenzgesamtlänge;1. Measure of the probability of incorrect hybridization. ba asst / l 'jseq ratio of base sequence length to total sequence length;
2. Maß für die Fehlhybridisierungswahrscheinlichkeit.2. Measure of the probability of incorrect hybridization.
Ms Menge von Sequenzen.M s set of sequences.
Mbas Menge aller Basissequenzen der Länge lbas.Mbas set of all base sequences of length l bas .
M nobas Teilmenge der Menge von Basissequenzen der Länge lbas, die durchM nobas subset of the set of base sequences of length l bas , which are given by
Dekomposition aus Mseq erhalten wird. |Mnobas| Mächtigkeit von Mn0bas = Anzahl der Basissequenzen in Mno as. n Anzahl pro Verfahrenszyklus zu konstruierender Sequenzen. n ot Anzahl insgesamt in allen Verfahrenszyklen hergestellter Sequenzen. l"lmax maximale Anzahl pro Verfahrenszyklus konstruierbarer Sequenzen. h Homologie. Ein Maß für die Übereinstimmung zwischen zwei Sequenzen.Decomposition is obtained from M seq . | Mnobas | Thickness of M n0bas = number of base sequences in M no as . n Number of sequences to be constructed per process cycle. n o t Total number of sequences produced in all process cycles. l " lmax maximum number of sequences that can be constructed per process cycle. h Homology. A measure of the correspondence between two sequences.
Es gilt: 0 <= h <= 1.The following applies: 0 <= h <= 1.
Schmelztemperatur. Für eine DNA-Sequenz wird die Schmelztemperatur nach dem Nearest Neighbour Verfahren (siehe Breslauer, K.J., Frank, R., Blocker,Melting temperature. For a DNA sequence, the melting temperature is determined using the closest neighbor method (see Breslauer, K.J., Frank, R., Blocker,
H., Marky, L.A., Proc. Natl. Acad. Sei., 83, 3746-3750, 1989) bestimmt: tm = ΔH / (ΔS + R x ln(C/4)) - 273,15°CH., Marky, LA, Proc. Natl. Acad. Sci., 83, 3746-3750, 1989): t m = ΔH / (ΔS + R x ln (C / 4)) - 273.15 ° C
Dabei sind ΔH und ΔS Enthalpie und Entropie der DNA-Helix, R die molareΔH and ΔS are the enthalpy and entropy of the DNA helix, R the molar
Gaskonstante und C die Konzentration der DNA-Sequenz. Das Herstellungverfahren erfolgt als ein Abfolge beliebig, jedoch endlich vielerGas constant and C the concentration of the DNA sequence. The manufacturing process is as a sequence of any number, but finally many
Verfahrenszyklen, in denen ntot Sequenzen konstruiert werden, und einer nachfolgenden Synthese, in der alle ntot Sequenzen in vitro erzeugt werden.Process cycles in which n dead sequences are constructed and a subsequent synthesis in which all n dead sequences are generated in vitro.
Die maximale Anzahl nmax der pro Verfahrenszyklus konstruierbaren Sequenzen errechnet sich entsprechend den oben gegebenen Definitionen nach nmax =/(a, lbas, lseq) := L( V * ( (albas) - (albas 2) - |Mnobas|) ) / (lseq - l0V)J . D.h. es lassen sich maximal nmax Sequenzen der Länge lseq aus Elementen eines Alphabetes A der Größe a (im Falle von DNA ist a = 4) konstruieren, die in maximal lov zusammenhängenden Ketten von Monomeren übereinstimmen. Die Anzahl der tatsächlich pro Verfahrenszyklus erhaltenen Sequenzen kann geringer sein, wenn diese bestimmte physikalische, chemische oder strukturelle Eigenschaften aufweisen sollen, oder wenn zusätzlich zu bereits vorhandenen Sequenzen weitere Sequenzen hergestellt werden.The maximum number n max of the sequences that can be constructed per process cycle is calculated according to the definitions given above according to n max = / (a, l bas , l seq ): = L (V * ((a lbas ) - (a lbas 2 ) - | M nobas |)) / (l seq - l 0V ) J. This means that a maximum of n max sequences of length l seq can be constructed from elements of an alphabet A of size a (in the case of DNA, a = 4), which match in chains of monomers connected in a maximum of l ov . The number of sequences actually obtained per process cycle can be lower if they are to have certain physical, chemical or structural properties, or if additional sequences are produced in addition to existing sequences.
Im Einzelnen sind folgende Verfahrensschritte nötig:The following procedural steps are necessary:
1 Es werden ntot Sequenzen in z Verfahrenszyklen konstruiert und in einer Menge Mseq gesammelt. Man beginnt mit der leeren Sequenzmenge Mseq.1 n dead sequences are constructed in z process cycles and collected in a quantity M seq . You start with the empty sequence set M seq .
2 Zur Sequenzmenge Mseq können einmalig, vor Beginn des Verfahrenszyklus, beliebige, jedoch eindeutige, Sequenzen hinzugefügt werden. Dies kann nützlich sein, um bestimmte Sequenzen hinzuzufügen, die aus Gründen der weiteren Anwendung in der2 Any, but unambiguous, sequences can be added once to the sequence set M seq before the start of the process cycle. This can be useful to add certain sequences that are used in the
Menge der hergestellten Monomersequenzen enthalten sein sollen. Es empfiehlt sich dabei, nicht zu viele und nicht zu lange Sequenzen hinzuzufügen, da das Verfahren für diese Sequenzen nicht dieselben Eigenschaften garantiert wie für die im Folgenden konstruierten Sequenzen. 3 Beginn des Verfahrenszyklus: Es werden die strukturellen, chemischen und physikalischen Eigenschaften festgelegt, die die herzustellenden Sequenzen erfüllen müssen. Strukturelle Eigenschaften sind zumindest das Enthaltensein oder Nicht- Enthaltensein bestimmter Teilsequenzen (ggfs. auch die Positionen, an denen die Teilsequenzen in den zu erzeugenden Sequenzen enthalten oder nicht enthalten sein sollen) und das Verhältnis der Anzahl der verschiedenen Monomere zueinander (im Falle von DNA: Verhältnis GC/AT). Chemische Eigenschaften sind mindestens das Vorkommen bestimmter Teilsequenzen, die Einfluß auf die chemische Wechselwirkung mit eigenen oder anderen Substanzen haben (im Falle von DNA z.B. bestimmte Proteinbindungsstellen, Restriktionsschnittstellen wie z.B. 5'gatatc3' für EcoRV, die Stopcodons 5'tca3', 5'tta3', 5'cta3' usw.). Zu den festzulegenden physikalischenAmount of the monomer sequences produced should be included. It is advisable not to add too many and not too long sequences, since the procedure does not guarantee the same properties for these sequences as for the sequences constructed below. 3 Beginning of the process cycle: The structural, chemical and physical properties that the sequences to be produced must fulfill are specified. Structural properties are at least the presence or absence of certain partial sequences (possibly also the positions at which the partial sequences are or should not be contained in the sequences to be generated) and the ratio of the number of different monomers to one another (in the case of DNA: GC / AT ratio). Chemical properties are at least the occurrence of certain partial sequences which have an influence on the chemical interaction with own or other substances (in the case of DNA, for example, certain protein binding sites, restriction sites such as 5'gatatc3 'for EcoRV, the stop codons 5'tca3', 5'tta3 ', 5'cta3' etc.). To the physical to be determined
Eigenschaften zählt zumindest die Schmelztemperatur tm der herzustellenden Sequenzen. Es werden jetzt die Anzahl der pro Zyklus gewünschten Sequenzen n <= nmax, nach obiger Formel lseq der zu konstruierenden Sequenzen und lbas der zur Konstruktion benötigten Basissequenzen festgelegt. Iseq und lbas werden nach der oben angegebenen Formel so gewählt, daß die gewünschte Anzahl n zu konstruierender Sequenzen erreicht werden kann. Da lbas/lSeq proportional zur Fehlhybridisierungswahrscheinlichkeit ist, werden lbas und lseq so gewählt, daß das Verhältnis lbas/lse möglichst gering ist (Werte unter 0,3 sind empfehlenswert) und Werte für lseq gute Hybridisierungsbedingungen garantieren. Für DNA sind temperaturabhängig beliebige Werte für lseq > 0 möglich. Es wird die Menge Mbas aller Sequenzen des Alphabetes A der Länge lbas erzeugt. Die solcherart erzeugten Sequenzen werden als Basissequenzen bezeichnet. Es gibt dabei immer al as Basissequenzen. Diese Basissequenzen dienen der Konstruktion der herzustellenden Sequenzen. Jede Basissequenz bekommt einen Status „benutzt" oder „unbenutzt" zugewiesen. Es werden zunächst alle als unbenutzt markiert. Selbst-komplementäre Basissequenzen aus Mbas werden nun als benutzt markiert. Dabei gibt es genau albas 2 zu sich selbst komplementäre Basissequenzen. Sollten bereits Sequenzen in der Menge Mseq vorhanden sein, so können entweder dazu kompatible neue Sequenzen konstruiert werden oder die Sequenzen einer Teilmenge von Msβq kompatibel verlängert werden. Dazu wird innerhalb eines Dekompositionsverfahrens aus den bereits vorhandenen Sequenzen aus Mseq eine Menge Mnobas aller Teilsequenzen der in Schritt 4 vorgegebenen Länge lbas derProperties counts at least the melting temperature t m of the sequences to be produced. Now the number of sequences desired per cycle n <= n max , according to the above formula l seq of the sequences to be constructed and l bas of the basic sequences required for the construction are determined. I seq and l bas are chosen according to the formula given above so that the desired number n of sequences to be constructed can be achieved. Since l bas / l Se q is proportional to the probability of incorrect hybridization, l bas and l seq are chosen so that the ratio l bas / l se is as low as possible (values below 0.3 are recommended) and values for l seq guarantee good hybridization conditions. Depending on the temperature, any values for l seq > 0 are possible for DNA. The set M bas of all sequences of the alphabet A of length l bas is generated. The sequences generated in this way are referred to as base sequences. There is always a l as base sequences. These basic sequences serve to construct the sequences to be produced. Each base sequence is assigned a status "used" or "unused". First, all are marked as unused. Self-complementary base sequences from M bas are now marked as used. There are exactly a lbas 2 basic sequences complementary to themselves. If sequences already exist in the set M seq , new compatible sequences can either be constructed or the sequences of a subset of M sβq can be extended in a compatible manner. For this purpose, a set M nobas of all partial sequences of the length l bas given in step 4 is made from the already existing sequences from M seq within a decomposition process
Sequenzen aus Mseq gebildet: Setze Mnobas = {}.Sequences formed from M seq : set M nobas = {}.
Jede Sequenz SSθq aus Mseqwird nun in (lseq - lov) Dekompositionsschritten zerlegt: Beginne mit i = 0 mit dem Dekompositionsschritt: Solange i < (lsβq - ):Each sequence S Sθ q from M seq is now broken down into (l seq - l ov ) decomposition steps: Start with i = 0 with the decomposition step : As long as i <(l sβq -):
Bilde als neue Sequenz Sne_ als Sequenz der Länge l as bestehend aus denForm as a new sequence S ne _ as a sequence of length l as consisting of the
MOnO eren seq,ι OlS seq,ι+lbas-
Figure imgf000021_0001
MOnO eren seq , ι OlS seq, ι + lbas-
Figure imgf000021_0001
Füge Sneu der Menge Mπ0bas hinzu. Setze i := i + 1. Die auf diese Weise erhaltene Menge Mnobas ist definitionsgemäß eine Teilmenge vonAdd S new to the set M π0 b as . Set i: = i + 1. The set M nobas obtained in this way is by definition a subset of
Mbas. Alle Basissequenzen der Menge Mbas, die auch in Mno as vorkommen, werden als benutzt markiert, so daß für die Konstruktion von Sequenzen genau (albas - al as 2 - |Mnobas|) unbenutzte Basissequenzen übrig bleiben, aus denen nun maximalM bas . All base sequences of the set M bas , which also occur in M no as , are marked as used, so that exactly unused base sequences are left over from the construction of sequences (a lbas - a l as 2 - | M nobas |), from which now maximum
Figure imgf000021_0002
verschiedene neue Sequenzen konstruiert werden können, die untereinander und zu den bereits vorhandenen Sequenzen keine Basissequenzen bzw. deren Komplemente gemeinsam haben. Aus den Basissequenzen wird ein gerichteter Graph konstruiert, dessen Knoten bestimmte Basissequenzen repräsentieren: Der Graph enthält genau albas Knoten, von denen bereits (aIBas/2 4- |Mnobas|) Knoten als benutzt markiert sind. Jeder Knoten ist mit einer Basissequenz Sb(i) assoziiert, die nicht zu sich selbst komplementär ist (im weiteren wird es keine Unterscheidung von Knoten und assoziierter Basissequenz geben). Es existiert eine Kante von Sb(i) nach Sb(k), wenn die lov letzten Buchstaben von Sb(i) den lov ersten Buchstaben von Sb<k) entsprechen, wenn also gilt:
Figure imgf000021_0002
Various new sequences can be constructed that do not have any base sequences or their complements in common with each other and with the existing sequences. A directed graph is constructed from the base sequences, the nodes of which represent certain base sequences: The graph contains exactly a lbas nodes, of which (a IBas / 2 4- | M nobas |) nodes are already marked as used. Each node is associated with a base sequence S b (i) that is not complementary to itself (furthermore, there will be no distinction between nodes and associated base sequence). There is an edge from S b (i) to S b ( k) if the l ov last letters of S b (i ) correspond to the l ov first letters of S b < k ), so if:
Sb(i),2 , ..., S (i),|bas = Sb(k),l Sb(k),lbas-1 -S b (i), 2, ..., S (i), | bas = S b (k), l Sb (k), lbas-1 -
Der Knoten Sb(k) wird Nachfolgeknoten von S (i> genannt.The node S b (k) is called the successor node of S ( i>.
Der Knoten, der mit dem Komplement der Basissequenz assoziiert ist, die durch den Knoten S (i) kodiert wird, wird Komplementknoten zu Knoten Sb(i) genannt. Sequenzen der Länge lseq werden gefunden, indem ein Pfad mit (lseq - lov) Knoten gesucht wird. Jeder Knoten darf maximal einmal benutzt werden. Außerdem darf für jeden Knoten, der in einem der Pfade liegt, der Komplementknoten in keinem Pfad vorkommen. Der Anfangsknoten des Pfades trägt wie die Sequenz einen Status „benutzt" bzw. „unbenutzt". Aus dem Graphen konstruiert man Sequenzen nach folgendem Verfahren:The node associated with the complement of the base sequence encoded by node S (i) is called the complement node to node S b (i) . Sequences of length l seq are found by searching for a path with (l seq - l ov ) nodes. Each node can only be used once. In addition, for each node that lies in one of the paths, the complement node must not appear in any path. Like the sequence, the start node of the path has a status “used” or “unused”. Sequences are constructed from the graph using the following procedure:
Kennzeichne alle unbenutzten Knoten des Graphen als unbenutzte Anfangsknoten. Für jedes s zwischen 1 und n:Mark all unused nodes in the graph as unused starting nodes. For every s between 1 and n:
Solange Knoten Sb(k) existiert, der noch nicht als benutzter Anfangsknoten markiert ist: Wähle einen unbenutzten Knoten Sb(k) aus.As long as node S b (k) exists that has not yet been marked as a used starting node: Select an unused node S b (k) .
Markiere Knoten Sb(k) als benutzten Anfangsknoten; außerdem: Markiere Sequenz Sb(k) und sein Komplement als benutzt. Nun wird eine neue Sequenz Snθu konstruiert, die neues Element für MS8q ist oder eine bestehenden Sequenz SSUb aus Mseq verlängert: Setze Sneu,o := Sb(k),ι.Mark node S b (k) as the used starting node; also: mark sequence S b (k ) and its complement as used. Now a new sequence S nθu is constructed that is a new element for M S8 q or extends an existing sequence S SUb from M seq : Set Sneu, o: = S b ( k ), ι.
Falls sie als neue Sequenz konstruiert wird, setze i := 0. Falls sie als Verlängerung einer bereits bestehenden Sequenz SSUb konstruiert wird, setze i := lsub.If it is constructed as a new sequence, set i: = 0. If it is constructed as an extension of an existing sequence S SUb , set i: = l sub .
Solange i < lseq - (L-1 ) und i >= 0 gilt: Existiert kein unbenutzter Nachfolgeknoten Sb(m) von Knoten Sb(k). so markiere Knoten Sb(k> und dessen Komplementknoten als unbenutzt und setze i := i-1.As long as i <l seq - (L-1) and i> = 0 applies: there is no unused successor node S b ( m) of node S b (k) . so mark node S b (k > and its complement node as unused and set i: = i-1.
Sonst wähle per Zufall einen unbenutzten Nachfolgeknoten S (m) von Knoten Sb(k) aus und markiere bm und dessen Komplementknoten als benutzt. Setze zusätzlich: i := i+1 , k := m, Sneu,i := S (m), 1. Wenn i = lseq - (l0.-1 ) ist, ist die Sequenz Sneu fertig: sie besteht aus denOtherwise, randomly select an unused successor node S (m) from node S b (k) and mark b m and its complement node as used. Also set: i: = i + 1, k: = m, S new , i: = S (m) , 1 . If i = l seq - (.-1 L 0), the sequence S is newly completed: it consists of the
Buchstaben Snβu,o bis Sneu,(iseq - iov>- 1 Zu jeder der in Schritt 10 erhaltenen Sequenzen werden die jeweiligen strukturellen, chemischen und physikalischen Eigenschaften im Vergleich zu den in Schritt 3 festgelegten Bedingungen ermittelt. Genügt die jeweiligeLetters S nβ u, o to S n eu, (ise q - iov> - 1 For each of the sequences obtained in step 10, the respective structural, chemical and physical properties are determined in comparison with the conditions specified in step 3. The respective one is sufficient
Sequenz nicht den vorgegebenen Bedingungen, so wird sie gelöscht und die von ihr benutzten Knoten und Komplementknoten wieder als unbenutzt markiert.If the sequence does not meet the specified conditions, it is deleted and the nodes and complement nodes used by it are again marked as unused.
12 Wenn die Anzahl der konstruierten Sequenzen nicht ausreicht, kann der Verfahrenszyklus von Schritt 3 oder 4 an beliebig oft wiederholt werden. Insbesondere ist es möglich, die strukturellen, chemischen und physikalischen Kriterien und die Werte für n, lSeq> lbas pro Verfahrenszyklus jeweils neu zu setzen. So ist es möglich, Sequenzen mit unterschiedlichen strukturellen, chemischen und physikalischen Eigenschaften, sowie unterschiedlicher Länge zu konstruieren, die trotzdem kompatibel, also eindeutig und maximal unähnlich sind.12 If the number of sequences constructed is not sufficient, the process cycle from step 3 or 4 can be repeated any number of times. In particular, it is possible to reset the structural, chemical and physical criteria and the values for n, l Seq> l bas per process cycle. In this way it is possible to construct sequences with different structural, chemical and physical properties, as well as different lengths, which are nonetheless compatible, i.e. unambiguous and maximally dissimilar.
Ansonsten geht man zum nächsten Schritt, der in vitro Synthese.Otherwise you go to the next step, the in vitro synthesis.
13 Die konstruierten Sequenzen werden in vitro, im Falle von Nukleinsäuren vorzugsweise mittels eines Oligonukleotidsynthezisers (z.B. ABI 392, ABI 398, ABI 3948 von Perkin- Elmer Applied Biosystems), synthetisiert. Dazu werden die Sequenzdaten der Steuerungseinheit des Oligonukleotidsynthesizers übermittelt und die Sequenzen als einzelsträngige Nukleinsäuren hergestellt. Die Sequenzen können auch kommerziell bestellt werden. Zweckmäßig sind PAGE-gereinigte Oligonukleotide (z.B. von ARK Scientific GmbH Biosystems, 64293 Darmstadt, erhältlich).13 The constructed sequences are synthesized in vitro, in the case of nucleic acids preferably using an oligonucleotide synthesizer (e.g. ABI 392, ABI 398, ABI 3948 from Perkin-Elmer Applied Biosystems). For this purpose, the sequence data are transmitted to the control unit of the oligonucleotide synthesizer and the sequences are produced as single-stranded nucleic acids. The sequences can also be ordered commercially. PAGE-purified oligonucleotides (e.g. available from ARK Scientific GmbH Biosystems, 64293 Darmstadt) are expedient.
Um Grammatiken in Moleküle übersetzen zu können muß das oben erwähnte Problem der Uniqueness-Verletzung bei der Verknüpfung von Sequenzen gelöst werden (siehe Abbildung 21 ). Dieses Problem ist mit dem Niehaus- Verfahren nicht zu behandeln, da dort keine Verknüpfung von Sequenzen vorgesehen ist. Im Einzelnen ist das Niehaus-Verfahren für die Lösung folgender Teilprobleme nicht mächtig genug: - Die Verknüpfung von Sequenzen kann zu einer Uniqueness-Verletzung führen (siehe Abbildung 21 ).In order to translate grammars into molecules, the above-mentioned problem of uniqueness violation when linking sequences must be solved (see Figure 21). This problem cannot be dealt with by the Niehaus method since there is no provision for linking sequences. In detail, the Niehaus method is not powerful enough to solve the following sub-problems: - Linking sequences can lead to a uniqueness violation (see Figure 21).
Bei der Verknüpfung von Variablen und Terminalen kann die Sequenz einer Variable je nach Grammatik in mehr als eine Terminalsequenz pro Ende übergehen und umgekehrt (siehe Abbildung 22 und Abbildung 24). - Bei der Verknüpfung z.B. mehrerer Terminalen mit der selben Variable kann es zu Uniqueness-Verletzungen kommen, die sich durch einfache Pfadsuche nicht auflösen lassen (siehe Abbildung 23).When linking variables and terminals, the sequence of a variable can change into more than one terminal sequence per end, depending on the grammar, and vice versa (see Figure 22 and Figure 24). - When linking e.g. Several terminals with the same variable can cause uniqueness violations that cannot be resolved by simply searching for a path (see Figure 23).
Das Problem wird mit einer als "Parallel-Extension" bezeichneten Strategie unter Verwendung des NFR-Verfahrens gelöst. Dabei wird im Einzelnen folgendermaßen vorgegangen (beispielhaft gezeigt für die Konstruktion von Variablen zu vorgegebenen Terminalen, siehe auch Abbildung 22 bis Abbildung 24):The problem is solved with a strategy called "parallel extension" using the NFR method. The detailed procedure is as follows (shown as an example for the construction of variables for given terminals, see also Figure 22 to Figure 24):
1. Eine Gruppe von Sequenzen (hier: die Terminale, z.B. Sequenzen zur Repräsentation von Bits oder Sequenzen mit bestimmten chemischen oder biologischen Eigenschaften) seien vorgegeben.1. A group of sequences (here: the terminals, e.g. sequences for representing bits or sequences with certain chemical or biological properties) are specified.
2. Sammle für jede Variable alle Paare von Terminalen, deren Sequenzen die jeweilige Variablensequenz im Logomer einrahmen werden und fasse sie zu Gruppen zusammen, eine Gruppe für jede Variable (siehe Abbildung 22 und Abbildung 24). Ordne die Pfade der Terminalpaare so an, daß zwischen jedem Paar eine Lücke bleibt, deren Länge der Variablenpfadlänge (lseq - lbas + 1) plus jeweils lbas - 1 Knoten für jeden der beiden2. For each variable, collect all pairs of terminals, the sequences of which will frame the respective variable sequence in the logomer and combine them into groups, one group for each variable (see Figure 22 and Figure 24). Arrange the paths of the terminal pairs so that there is a gap between each pair, the length of which is the variable path length (l seq - l bas + 1) plus each l bas - 1 node for each of the two
Übergänge entspricht. Dabei ist ein Übergang derjenige Pfad der Länge lba5 - 1 , der jeweils zusammengehörende Terminale und Variablen miteinander verbindet. In Abbildung 21 besteht dieser z.B. aus den markierten Basissequenzen. Übergänge können zusammenlaufen (z.B. die Terminale a, b, c zur Variable A in Abbildung 22) oder sich verzweigen (z.B. die Variable A zu den Terminalen b, c, d in Abbildung 22).Transitions. A transition is the path of length l ba5-1 that connects terminals and variables that belong together. In Figure 21, this consists, for example, of the marked base sequences. Transitions can converge (e.g. terminals a, b, c to variable A in Figure 22) or branch (e.g. variable A to terminals b, c, d in Figure 22).
3. Wähle die jeweils letzte Basissequenz jeder Terminalsequenz auf der linken Seite als Startknoten für den jeweiligen Pfad (siehe Abbildung 24).3. Select the last base sequence of each terminal sequence on the left as the start node for the respective path (see Figure 24).
4. Erzeuge die Terminal-Variable-Übergänge simultan, d.h. suche in jedem Iterationsschritt für alle Pfade je einen Nachfolgeknoten, dessen letztes Monomer für alle Pfade einer Gruppe das selbe ist. Kann in diesem Schritt kein unbenutzter und erlaubter Knoten gefunden werden, so wird Backtracking ausgelöst. Ist dieses nicht möglich, so scheitert die Übersetzung einer Grammatik in Algomere an diesem Punkt und die Übersetzung muß mit veränderten (vorzugsweise weniger restriktiven) Parametern wiederholt werden. Zulässig ist dagegen die mehrfache Verwendung eines Knotens in einem Iterationsschritt für die jeweils zusammengehörenden Übergänge (siehe Abbildung 23 und Abbildung 24).4. Generate the terminal variable transitions simultaneously, i.e. In each iteration step, look for a successor node for all paths, the last monomer of which is the same for all paths in a group. If no unused and allowed nodes can be found in this step, backtracking is triggered. If this is not possible, the translation of a grammar into algomers fails at this point and the translation must be repeated with changed (preferably less restrictive) parameters. In contrast, multiple use of a node in one iteration step is permitted for the transitions that belong together (see Figure 23 and Figure 24).
5. Erzeuge die Variablen-Sequenzen ebenfalls simultan als Verlängerung der Übergänge.5. Generate the variable sequences simultaneously as an extension of the transitions.
6. Erzeuge die Variable-Terminal-Übergänge analog wie unter 4 beschrieben. Hierbei sind die Nachfolger jedoch nicht frei wählbar, sondern durch die lbas - 1 ersten Nukleotide der rechten Terminalsequenz vorgegeben. Die Pfadsuche folgt hier dieser Vorgabe um festzustellen, ob die Pfade sich vervollständigen lassen.6. Generate the variable-terminal transitions in the same way as described under 4. However, the successors are not freely selectable, but are given by the 1 bas - 1 first nucleotides of the right terminal sequence. The path search follows this specification to determine whether the paths can be completed.
Durch das als "Parallel-Extension" bezeichnete Verfahren wird es möglich, eine Schnittstelle zwischen Computer und den in-vitro ausgeführten Schritten, beginnend mit der Synthetisierung von Oligonukleotiden, zu schaffen und die Schritte von Definition von Grammatiken bis zur Herstellung von Molekülen in-vitro vollständig zu automatisieren. Erläuterung zu IM: Implementierung regulärer Grammatiken mit dem NFR-VerfahrenThe method called "parallel extension" makes it possible to create an interface between the computer and the steps carried out in vitro, starting with the synthesis of oligonucleotides, and the steps from definition of grammars to the production of molecules in vitro fully automated. Explanation of IM: Implementation of regular grammars with the NFR method
Die Herstellung von Monomersequenzen zur Darstellung der Regelmenge von Grammatiken in Schritt III des erfindungsgemäßen Verfahrens erfolgt mit Hilfe des NFR-Verfahrens (Niehaus-Feldkamp-Rauhe-Verfahren) nach Schritt II des erfindungsgemäßen Verfahrens. Zur Implementierung von Grammatiken werden nach dem NFR-Verfahren für r Regeln einer Grammatik G genau 2r Monomersequenzen hergestellt, so daß die Monomersequenzen für die s dargestellten Symbole (Terminale und Variablen) und die Regeln R der Grammatik G eindeutig und zueinander möglichst unähnlich sind, sowie die geforderten strukturellen, chemischen und physikalischen Eigenschaften aufweisen.The production of monomer sequences for representing the regular set of grammars in step III of the method according to the invention is carried out using the NFR method (Niehaus-Feldkamp-Rauhe method) after step II of the method according to the invention. To implement grammars, exactly 2r monomer sequences are produced for the rules of a grammar G using the NFR method, so that the monomer sequences for the symbols (terminals and variables) shown and the rules R of the grammar G are clear and as unlike as possible, and have the required structural, chemical and physical properties.
Die Monomersequenzen werden dazu nach dem NFR-Verfahren so hergestellt, daß sie wie im Folgenden beschrieben zu Algomeren zusammengesetzt werden können. Es werden dabei jeweils 2 Monomersequenzen zu einem Algomer zusammengesetzt, das genau eine Regel R einer Grammatik G repräsentiert. Dabei enthalten beide Monomersequenzen jeweils Sequenzen, die die nach der Regel R erforderlichen zusammengehörenden Symbole (Terminale oder Variablen) enthalten.For this purpose, the monomer sequences are prepared by the NFR method in such a way that they can be combined to form algomers as described below. In each case, 2 monomer sequences are put together to form an algomer that represents exactly one rule R of a grammar G. Both monomer sequences each contain sequences which contain the corresponding symbols (terminals or variables) required by R rule.
Der Entwurf der Oligomere nach Schritt III des erfindungsgemäßen Verfahrens ist abhängig von der chemischen Natur der eingesetzten Monomere. Im bevorzugten Fall der aus Nukleotiden aufgebauten Oligomere wird folgendermaßen vorgegangen: Algomere sind doppelsträngig und haben einen 5'-Strang (Oberstrang) und einen 3'-Strang (Unterstrang). Oberstrang und Unterstrang können die Verknüpfung jeweils einer Terminal- und einer Variablensequenz sein.The design of the oligomers after step III of the process according to the invention depends on the chemical nature of the monomers used. In the preferred case of the oligomers built up from nucleotides, the procedure is as follows: Algomers are double-stranded and have a 5'-strand (upper strand) and a 3'-strand (lower strand). Upper strand and lower strand can be the link between a terminal sequence and a variable sequence.
Es seien X, Z beliebige Variablen, S eine Variable, die als Startsymbol fungiert, y, z beliebige Terminalsymbole. Dann wird für jede Regel der Form: a) S := yX ein Algomer konstruiert, das eine eindeutige doppelsträngige Kernsequenz y enthält, an die am 3'-Ende eine eindeutige einzelsträngige Überhangsequenz X angehängt ist; ":=" bedeutet in diesem Fall, daß S und yX identisch sind, d.h. yX als Startermolekül fungiert. b) X -> yZ ein Algomer konstruiert, das eine eindeutige doppelsträngige Kernsequenz y enthält, an die am 5'-Ende eine eindeutige einzelsträngige Überhangsequenz X und am 3'-Ende eine eindeutige einzelsträngige Überhangsequenz Z angehängt ist. X kann dabei identisch mit Z sein. c) X -> z ein Algomer konstruiert, das eine eindeutige doppelsträngige Kernsequenz z enthält, an die am 5'-Ende eine eindeutige einzelsträngige Überhangsequenz X angehängt ist.Let X, Z be any variables, S be a variable that acts as a start symbol, y, z be any terminal symbols. Then, for each rule of the form: a) S: = yX, an algomer is constructed which contains a unique double-stranded core sequence y to which a unique single-stranded overhang sequence X is appended at the 3 'end; ": =" in this case means that S and yX are identical, i.e. yX acts as a starter molecule. b) X -> yZ constructed an algomer that contains a unique double-stranded core sequence y to which a unique single-stranded overhang sequence X is attached at the 5 'end and a unique single-stranded overhang sequence Z at the 3' end. X can be identical to Z. c) X -> z constructed an algomer that contains a unique double-stranded core sequence z, to which a unique single-stranded overhang sequence X is attached at the 5 'end.
Algomere der Form S := yX und X -> z heißen Terminatoren ("Start", "Ende"), da sie zumAlgomers of the form S: = yX and X -> z are called terminators ("Start", "End"), since they are used for
Kettenabbruch während der Polymerisation im erfindungsgemäßen Verknüpfungsschritt V führen, der im Folgenden beschrieben wird; Algomere der Form X -> yZ heißen Elongatoren, weil sie zu einer Kettenverlängerung während der Polymerisation im erfindungsgemäßenChain termination during the polymerization in linkage step V according to the invention, which is described below; Algomers of the form X -> yZ are called elongators, because they lead to a chain extension during the polymerization in the invention
Verknüpfungsschritt V führen.Link step V lead.
Vorzugsweise umfassen die in den Schritten II und III des erfindungsgemäßen Verfahrens hergestellten Monomersequenzen Nukleotide, insbesondere Ribonukleotide, besonders bevorzugt Desoxyribonukleotide. Die in Schritt II des erfindungsgemäßen Verfahrens konstruierten Monomersequenzen können vorteilhafterweise bestimmte Sequenzen, z.B.The monomer sequences produced in steps II and III of the method according to the invention preferably comprise nucleotides, in particular ribonucleotides, particularly preferably deoxyribonucleotides. The monomer sequences constructed in step II of the method according to the invention can advantageously certain sequences, e.g.
Stopcodons, Erkennungssequenzen für Nukleinsäuren spaltende EnzymeStop codons, recognition sequences for enzymes that cleave nucleic acids
(Restriktionsnukleasen), Erkennungssequenzen für Nukleinsäure-bindende Proteine u.a. enthalten, wie sie beispielsweise in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)], [Rolf Knippers, Molekulare Genetik, Georg Thieme(Restriction nucleases), recognition sequences for nucleic acid binding proteins, etc. contained, as for example in [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)], [Rolf Knippers, Molecular Genetics, Georg Thieme
Verlag, (1997)] und [Benjamin Lewin, Genes V, Oxford University Press, (1994)] beschrieben werden.Verlag, (1997)] and [Benjamin Lewin, Genes V, Oxford University Press, (1994)].
Erläuterung zu IV: Algomer-AssemblierungExplanation of IV: Algomer assembly
Das Assemblieren der in Schritt III synthetisierten Sequenzen erfolgt in Schritt IV des erfindungsgemäßen Verfahrens. Im Rahmen der vorliegenden Erfindung sind zur Durchführung des Schrittes IV alle dem Fachmann bekannten Techniken, Oligomersequenzen zusammenzusetzen, einsetzbar. Im erfindungsgemäß bevorzugten Fall des Einsatzes von Nukleotidsequenzen ist es zweckmäßig folgendermaßen vorzugehen:The sequences synthesized in step III are assembled in step IV of the method according to the invention. In the context of the present invention, all of the techniques known to those skilled in the art of assembling oligomer sequences can be used to carry out step IV. In the preferred case according to the invention of using nucleotide sequences, it is advisable to proceed as follows:
a) Die zu Elongatoren gehörenden einzelsträngigen Sequenzen werden phosphoryliert. Dazu sind verschiedene dem Fachmann bekannte Protokolle möglich, z.B. das Folgende: In einem 20//I Ansatz werden 16μl einer synthetisierten 100 /M Sequenz, 2μl Ligationspuffer (z. B. 50 mM Tris-HCI pH 7.5, 10 mM MgCI2, 10 mM Dithiothreitol, 1 mM ATP, 25 //g/ml BSA Bovine Serum Albumin, New England Biolabs) und 2μ\ PNK (Polynukleotidkinase, z.B. von New England Biolabs, Katalognr. #201 S oder #201 L) 1 Stunde bei 37°C inkubiert. Volumina, Inkubationszeit und -temperatur können in dem Fachmann bekannter Weise variiert werden. b) Jeweils in einem Ansatz werden die zu einem Algomer gehörenden Einzelstränge (Ober- und Unterstrang) zu einem fertigen Algomer hybridisiert. Für Elongatoren können einfach die Phosphorylierungsansätze von Ober- und Unterstrang verwendet werden. Für die Hybridisierung sind mehrere Protokolle möglich; bevorzugt ist ein Denaturierungsschritt bei etwa 95°C zu Anfang (dieser deaktiviert gleichzeitig die PNK in den Ansätzen der Elongatoren) und eine langsame Hybridisierung. Z.B. kann für Oligomere der Länge 30 folgendes Protokoll verwendet werden, das gemäß den Kenntnissen des Fachmanns variiert werden kann:a) The single-stranded sequences belonging to elongators are phosphorylated. Various protocols known to the person skilled in the art are possible for this, for example the following: in a 20 // I batch, 16 μl of a synthesized 100 / M sequence, 2 μl ligation buffer (e.g. 50 mM Tris-HCl pH 7.5, 10 mM MgCl 2 , 10 mM dithiothreitol, 1 mM ATP, 25 // g / ml BSA Bovine Serum Albumin, New England Biolabs) and 2μ \ PNK (polynucleotide kinase, e.g. from New England Biolabs, catalog number # 201 S or # 201 L) for 1 hour at 37 ° C incubated. Volumes, incubation time and temperature can be varied in a manner known to the person skilled in the art. b) In one batch, the single strands (upper and lower strand) belonging to an algomer are hybridized to a finished algomer. For elongators, the upper and lower strand phosphorylation approaches can simply be used. Several protocols are possible for hybridization; a denaturation step at approximately 95 ° C. at the beginning (this simultaneously deactivates the PNK in the approaches of the elongators) and slow hybridization are preferred. For example, the following protocol can be used for oligomers of length 30, which can be varied according to the knowledge of the person skilled in the art:
In einem 40μl Ansatz werden jeweils 20μl des Oberstranges (100μM) und 20μl des Unterstranges (100/vM) in einem Thermozykler 5 Minuten auf 95°C erhitzt, 5 Minuten auf 72°C inkubiert und dann 25 Minuten jeweils 1 CC pro Minute abgekühlt. Erläuterung zu V: Herstellung von Logomeren durch Verkettung von Algomeren:In a 40 .mu.l approach, each 20 .mu.l of Colonel Ranges (100 microns) and 20 .mu.l of the lower rod (100 / vM) for 5 minutes at 95 ° C in a thermal cycler for 5 minutes at 72 ° C and then 25 minutes each 1 C C cooled per minute . Explanation of V: Production of logomers by chaining algomers:
SymbolpolymerisationSymbol polymerization
In Schritt V des erfindungsgemäßen Verfahrens werden die Algomere zu längerkettigen, informationstragenden Polymeren (Logomeren) verknüpft. Da Algomere die Regelmenge R einer Grammatik G darstellen, entsprechen alle dabei erzeugten Logomere Wörtern derIn step V of the method according to the invention, the algomers are linked to form longer-chain, information-carrying polymers (logomers). Since algomers represent the rule set R of a grammar G, all logomer words generated thereby correspond to
Sprache L(G), die durch die Grammatik G beschrieben wird.Language L (G), which is described by the grammar G.
Der geregelte Prozeß der Verkettung von Algomeren zu Logomeren wird alsThe regulated process of chaining algomers to logomers is called
„Symbolpolymerisation" bezeichnet, im Falle, daß die Terminalsymbole Bits repräsentieren, das heißt, im Falle, daß gilt:“Symbol polymerization” means in the event that the terminal symbols represent bits, that is, in the case that:
Σ:= {0, 1 , s0, Sι, s2 sn-ι, sn, e0, e1 t e2 em.ι, em} mit n, m e IN und n, m > 0, wird der Prozeß als „Bitpolymerisation" bezeichnet.Σ: = {0, 1, s 0 , Sι, s 2 s n -ι, s n , e 0 , e 1 t e 2 e m .ι, e m } with n, me IN and n, m> 0 , the process is referred to as "bit polymerization".
Im Rahmen der vorliegenden Erfindung sind zur Durchführung des Schrittes V alle dem Fachmann bekannten Techniken, Oligomere zu Polymeren zu verknüpfen, einsetzbar. Im erfindungsgemäß bevorzugten Fall des Einsatzes von Oligonukleotiden ist es zweckmäßig, die zu verknüpfenden Algomere in Gegenwart von Ligase zu inkubieren. Beispielsweise kann nach folgendem Protokoll vorgegangen werden, das gemäß den Kenntnissen des Fachmanns variiert werden kann: In einem 27μl Ansatz werden 1μl 50/ M "Staif'-Algomer, 1 /I 50μM "Ende"-Algomer und 2x jeweils 10//I 40μM Elongator-Algomere (aus Schritt IV des erfindungsgemäßen Verfahrens erhalten), 1.5//I 10mM rATP und 3,5μl T4 DNA Ligase mit 400 NEB Units/μl (z.B. Katalognr. #202S und #202L NEB) zwischen 4°C und 25°C für 2 bis 24Stunden inkubiert. Andere Reaktionsvolumina funktionieren analog. Inkubationszeit und -temperatur können in dem Fachmann bekannter Weise variiert werden.In the context of the present invention, all techniques known to those skilled in the art to link oligomers to polymers can be used to carry out step V. In the preferred case according to the invention when using oligonucleotides, it is expedient to incubate the algomers to be linked in the presence of ligase. For example, the following protocol can be used, which can be varied according to the knowledge of the person skilled in the art: in a 27μl batch, 1μl 50 / M "Staif'-Algomer, 1 / I 50μM" end "-Algomer and 2x 10 // I 40μM each Elongator algomers (obtained from step IV of the process according to the invention), 1.5 // I 10mM rATP and 3.5μl T4 DNA ligase with 400 NEB units / μl (eg catalog numbers # 202S and # 202L NEB) between 4 ° C. and 25 ° C. incubated for 2 to 24 hours, other reaction volumes function analogously, incubation time and temperature can be varied in a manner known to the person skilled in the art.
Abbildung 3 zeigt das Resultat einer solchen Symbolpolymerisation.Figure 3 shows the result of such a symbol polymerization.
Es können dabei grundsätzlich beliebig viele Algomere, die keine Terminatoren sind, verknüpft werden. Der Polymerisationsvorgang kommt für jedes einzelne Logomer dann zu einem Stillstand, wenn das entsprechende Molekül an seinen Enden jeweils ein Algomer trägt, das als Terminatormolekül ("Start", "Ende") fungiert.In principle, any number of algomers that are not terminators can be linked. The polymerization process comes to a standstill for each individual logomer when the corresponding molecule carries an algomer at its ends, which acts as a terminator molecule (“start”, “end”).
Vereinzelung und Vervielfältigung von Logomeren durch KlonierungSeparation and duplication of logomers by cloning
Ein weiterer Gegenstand der vorliegenden Erfindung ist ein Verfahren zur Isolierung und Vervielfältigung von informationstragenden Polymeren, die nach einem der vorhergehenden Ansprüche erhalten wurden, das dadurch gekennzeichnet ist, daß man in Schritt V erhaltene informationstragende Polymere in Klonierungsvektoren ligiert, kompetente Zellen mit diesen Vektoren transformiert und die erfolgreich transformierten Bakterien anhand von Selektionsmarkern selektioniert. Die aus Schritt V des oben beschriebenen erfindungsgemäßen Verfahrens (Symbolpolymerisation) erhaltenen Logomere können zum Zwecke der Vereinzelung und Vervielfältigung kloniert werden.Another object of the present invention is a process for the isolation and duplication of information-carrying polymers, which have been obtained according to one of the preceding claims, which is characterized in that information-carrying polymers obtained in step V are ligated into cloning vectors, competent cells are transformed with these vectors and the successfully transformed bacteria selected using selection markers. The logomers obtained from step V of the process according to the invention described above (symbol polymerization) can be cloned for the purposes of separation and duplication.
Dazu wird der verwendete Klonierungsvektor mit Restriktionsenzymen aufgeschnitten und ein Logomer hineinligiert. Das Verfahren stellt sicher, daß nur fertig polymerisierte (mit Terminatoren versehene) Logomere mit dem Zielvektor ligiert werden können. Korrekt in den Zielvektor ligierte Logomere bilden ein wieder ringförmiges Molekül. Die Vereinzelung von Logomeren erfolgt durch die Transformation von Bakterien mit dem Molekülgemisch, das das Resultat der Ligation ist. Die Vektoren tragen Selektionsmarker (vorzugsweise Antibiotika- Resistenz z.B. Ampicillin-Resistenz), mit denen erfolgreich transformierte Bakterien ausgewählt werden können. Da jedes Bakterium nur ein Plasmid exprimiert, ist jedes erfolgreich transformierte Bakterium Träger genau eines Logomers. Solcherart klonierte Logomere können dann zur weiteren Verwendung einfach und in großen Mengen (auf Festoder in Flüssigmedium, Fermentern) vervielfältigt werden.For this purpose, the cloning vector used is cut open with restriction enzymes and a logomer is ligated into it. The method ensures that only fully polymerized (terminated) logomers can be ligated to the target vector. Logomers correctly ligated into the target vector form a ring-shaped molecule again. Logomeres are separated by transforming bacteria with the mixture of molecules that is the result of the ligation. The vectors carry selection markers (preferably antibiotic resistance, e.g. ampicillin resistance) with which successfully transformed bacteria can be selected. Since each bacterium expresses only one plasmid, each successfully transformed bacterium carries exactly one logomer. Logomers cloned in this way can then simply be reproduced in large quantities (on solid or in liquid medium, fermenters) for further use.
Die aus Schritt V des erfindungsgemäßen Verfahrens erhaltenen Logomere werden zum Zwecke der Vereinzelung und Vervielfältigung in einem beliebigen Klonierungsvektor (Plasmid) kloniert, der Restriktionsschnittstellen trägt, die zu den Sequenzüberhängen der Terminatoren der Logomere kompatibel sind (z.B. Hindlll, BamHI Erkennungssequenzen im Klonierungsvektor pBluescript II KS +/-, Stratagene, Katalog Nr. #212207). Die Klonierung erfolgt nach üblichen Laborprotokollen, wie z.B. in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben. Z.B. kann folgendes Protokoll verwendet werden, das gemäß den Kenntnissen des Fachmanns variiert werden kann: a) Restriktion und Präparation des Klonierungsvektors Zur Klonierung können beliebige Klonierungsvektoren verwendet werden, wie sie für molekularbiologische Verfahren üblich sind. (Geeignet ist z.B. das Plasmid pBluescript II KS +/-, Stratagene, Katalog Nr. #212207). Das Plasmid wird einem Restriktionsverdau mit zwei Restriktionsenzymen unterworfen, die Überhänge erzeugen, die zu den Terminatoren der Logomere kompatibel sind. Als Restriktionsenzyme können z.B. BamHI und Hindlll (z.B. von NEB, New England Biolabs, Katalog Nr.: #136S und #104S) verwendet werden. Dazu kann ein übliches Restriktionsprotokoll verwendet werden, das gemäß den Kenntnissen des Fachmanns variiert werden kann, z.B. das Folgende:The logomers obtained from step V of the method according to the invention are cloned for the purpose of separation and duplication in any cloning vector (plasmid) which carries restriction sites which are compatible with the sequence overhangs of the terminators of the logomers (for example Hindlll, BamHI recognition sequences in the cloning vector pBluescript II KS +/-, Stratagene, catalog # 212207). The cloning is carried out according to usual laboratory protocols, e.g. in [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)]. For example, The following protocol can be used, which can be varied according to the knowledge of the person skilled in the art: a) Restriction and preparation of the cloning vector Any number of cloning vectors can be used for cloning, as are customary for molecular biological methods. (For example, the plasmid pBluescript II KS +/-, Stratagene, catalog no. # 212207 is suitable). The plasmid is subjected to a restriction digest with two restriction enzymes that produce overhangs that are compatible with the terminators of the logomers. As restriction enzymes e.g. BamHI and Hindlll (e.g. from NEB, New England Biolabs, catalog no .: # 136S and # 104S) can be used. A conventional restriction protocol can be used for this, which can be varied according to the knowledge of the person skilled in the art, e.g. the following:
In einem 50μl Ansatz werden 30μl Plasmid (0,7μg/μl), 5μl 10x Puffer (z.B. NEB2, New England Biolabs), 5μl BamHI (100 units), 5μl Hindlll (100 units) und 5μl BSA 10x für 1 -2 Stunden bei 37°C inkubiert. Zur Kontrolle wird 1μl des Ansatzes, sowie eine entsprechende Menge ungeschnittenes Plasmid auf einem 1% Agarose Gel (z.B. UltraPure™ von Gibco BRL, Life Technologies, Katalog Nr.: 15510-027) elektrophoretisch aufgetrennt. Zur Präparation der DNA wird der Restriktionsansatz phenolisiert, die DNA gefällt und wiederaufgenommen: - Ansatz auf 200μl mit Aqua dest. auffüllenIn a 50μl batch, 30μl plasmid (0.7μg / μl), 5μl 10x buffer (e.g. NEB2, New England Biolabs), 5μl BamHI (100 units), 5μl Hindlll (100 units) and 5μl BSA 10x are added for 1-2 hours Incubated at 37 ° C. As a control, 1 μl of the mixture and a corresponding amount of uncut plasmid are electrophoresed on a 1% agarose gel (e.g. UltraPure ™ from Gibco BRL, Life Technologies, catalog no .: 15510-027). To prepare the DNA, the restriction batch is phenolized, the DNA is precipitated and resumed: - batch to 200 μl with distilled water. fill up
200μl Phenol zugeben, vortexen, bei 10000g 3 Minuten zentrifugieren Überstand aufnehmen und 200μl Chloroform zugeben, vortexen, bei 10000g 3 Minuten zentrifugierenAdd 200μl phenol, vortex, centrifuge at 10000g for 3 minutes Absorb the supernatant and add 200μl chloroform, vortex, centrifuge at 10000g for 3 minutes
Überstand aufnehmen, mit 1/10 Vol. 3M NaAc ansäuern und mit 2,5x Volumen 100% EtOH versetzen, vortexen, für mindestens 15 Minuten auf -70°C - mindestens 15 Minuten auf 10000g zentrifugieren, Überstand abnehmen und verwerfen mit ca. 500μl 70% EtOH waschen, für 5-10 Minuten auf 10000g zentrifugieren, Überstand abnehmen und verwerfenAbsorb the supernatant, acidify with 1/10 vol. 3M NaAc and add 2.5x volume 100% EtOH, vortex, centrifuge for at least 15 minutes at -70 ° C - at least 15 minutes at 10000g, remove the supernatant and discard with approx. 500μl Wash 70% EtOH, centrifuge for 5-10 minutes at 10000g, remove and discard the supernatant
Pellet trocknen und in Aqua dest. wiederaufnehmen, so daß das geschnittene Plasmid mit 100ng/μl bis 1μg/μl vorliegt (höhere Konzentrationen sind auch möglich). Plasmid kann für weitere Ligationen nötigenfalls verdünnt werden.Dry the pellet and soak in aqua dest. resume so that the cut plasmid is present at 100ng / μl to 1μg / μl (higher concentrations are also possible). If necessary, plasmid can be diluted for further ligations.
b) Ligation des Logomers in den Klonierungsvektorb) Ligation of the logomer into the cloning vector
Die in Schritt V des erfindungsgemäßen Verfahrens erhaltenen Logomere und die präparierten Klonierungsvektoren werden ligiert. Durch die Art und Weise der Präparation ist gewährleistet, daß möglichst nur die gewünschten Ligationen stattfinden: Die Terminatoren der Logomere tragen zwei verschiedene Überhangsequenzen, die zu den durch Restriktion entstandenen Überhangsequenzen des Klonierungsvektors kompatibel sind. Dadurch können die Logomere nur in einer definierten Richtung in den Klonierungsvektor ligieren. Außerdem sind die Terminatoren der Logomere nicht phosphoryliert, weshalb Logomere ausschließlich mit den Überhangsequenzen des Klonierungsvektors ligieren können. Die Ligation erfolgt nach einem üblichen Ligationsprotokoil wie z.B. in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben, das gemäß den Kenntnissen des Fachmanns variiert werden kann, beispielsweise wie folgt: Das molare Verhältnis Logomere/Klonierungsvektor kann z.B. 500 betragen, in 10μl Gesamtvolumen werden:The logomers obtained in step V of the method according to the invention and the prepared cloning vectors are ligated. The manner in which the preparation is carried out ensures that, if possible, only the desired ligations take place: the terminators of the logomers carry two different overhang sequences which are compatible with the overhang sequences of the cloning vector which were created by restriction. As a result, the logomers can only ligate into the cloning vector in a defined direction. In addition, the terminators of the logomers are not phosphorylated, which is why logomers can only ligate with the overhang sequences of the cloning vector. The ligation is carried out using a conventional ligation protocol, e.g. in [J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)], which can be varied according to the knowledge of the person skilled in the art, for example as follows: The molar ratio of logomers / cloning vector can e.g. 500, in 10μl total volume:
1 μl Plasmid (10ng/μl = 5nM)1 μl plasmid (10ng / μl = 5nM)
0,5 μl 4μM Logomere aus Schritt V des erfindungsgemäßen Verfahrens0.5 μl 4μM logomers from step V of the method according to the invention
1 μl 10x Ligationspuffer1 ul 10x ligation buffer
0,5 μl T4 DNA Ligase (400u/μl) 7μl H20 für 12 Stunden auf 16°C ligiert.0.5 μl T4 DNA ligase (400 u / μl) 7 μl H 2 0 ligated to 16 ° C. for 12 hours.
Das Protokoll kann gemäß den Kenntnissen des Fachmanns variiert werden. Z.B. ist es möglich, ein Protokoll zur TCL (Temperature Cycle Ligation, [Lund, A.H., Duch, M., Pedersen, F.S, Increased cloning efficency by temperature-cycle ligation, Nucleic Acids Research, 24: (4), 800-801 , (1996)]) zu verwenden.The protocol can be varied according to the knowledge of the person skilled in the art. For example, it is possible to use a protocol for TCL (Temperature Cycle Ligation, [Lund, AH, Duch, M., Pedersen, FS, Increased cloning efficency by temperature-cycle ligation, Nucleic Acids Research, 24: (4), 800-801, (1996)]).
Der erhaltene Ligationsansatz wird nun für die Transformation kompetenter Zellen verwendet, wie nachfolgend beispielhaft gezeigt: c) Transformation kompetenter ZellenThe ligation mixture obtained is now used for the transformation of competent cells, as shown below by way of example: c) transformation of competent cells
Die Transformation von Bakterien (kompetente Zellen, Hoststamm z.B. dH5α, GIBCO BRL, Katalog Nr.: 18258-012) mit dem Ligationsansatz aus b) erfolgt nach einem der üblichenThe transformation of bacteria (competent cells, host strain e.g. dH5α, GIBCO BRL, catalog no .: 18258-012) using the ligation approach from b) is carried out according to one of the usual methods
Protokolle, wie z.B. in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben wird und das gemäß den Kenntnissen des Fachmanns variiert werden kann, z.B. wie folgt:Protocols, such as in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] and which can be varied according to the knowledge of the person skilled in the art, for example as follows:
200μl kompetenter Zellen (~ 5x107 CFU = Colony Forming Units, bei -70°C gelagert) werden aufgetaut und auf Eis gestellt - Etwa 1 ng des Ligationsansatzes aus b) wird dazu pipettiert und 20-30 Minuten auf Eis stehen gelassen, alle 5 Minuten vorsichtig mixen200μl competent cells (~ 5x10 7 CFU = Colony Forming Units, stored at -70 ° C) are thawed and placed on ice - about 1 ng of the ligation mixture from b) is pipetted into it and left on ice for 20-30 minutes, every 5 Mix gently for minutes
Hitzeschock: Ansatz 2 Minuten auf 42°C, zurück auf Eis - 0,8ml LB-Medium (+ 0,02M MgS0 + 0,01 M KCI) zugebenHeat shock: Mix for 2 minutes at 42 ° C, back on ice - add 0.8 ml LB medium (+ 0.02M MgS0 + 0.01 M KCI)
Ansatz 20-60 Minuten im Reagenzglas auf 37°C rollen - 0,1 - 1 ml auf Agarplatte (mit Antibiotikum, z.B. Ampicillin) ausplattieren und Über Nacht auf 37°C Die Transformation fungiert dabei als Selektionsverfahren auf erfolgreich klonierte Logomere und als Isolationsverfahren einzelner Logomere, weil jede Bakterienzelle genau ein Plasmid exprimiert.Mix 20-60 minutes in a test tube at 37 ° C - 0.1 - 1 ml plate on agar plate (with antibiotic, e.g. ampicillin) and overnight at 37 ° C. The transformation acts as a selection process for successfully cloned logomers and as an isolation process for individual ones Logomeres because each bacterial cell expresses exactly one plasmid.
Außer dem genannten Verfahren der Klonierung, das erfindungsgemäß bevorzugt ist, können die in Schritt V des erfindungsgemäßen Verfahrens erhaltenen informationstragenden Polymere (Logomere) mit folgenden Verfahren isoliert und vervielfältigt werden:In addition to the cloning method mentioned, which is preferred according to the invention, the information-carrying polymers (logomers) obtained in step V of the method according to the invention can be isolated and reproduced using the following methods:
Isolation durch Hybridisierung und chromatographische MethodenIsolation through hybridization and chromatographic methods
Hierbei wird das aus einer Symbolpolymerisation erhaltene Molekülgemisch über ein Trägermaterial gegeben, an das Oligomere ("Ankersequenzen") gebunden sind, die ihrerseits an die Terminatoren der Logomere binden können. Die gebundenen Logomere werden dann einzeln aufgenommen und können nach Bedarf vervielfältigt werden. Es sind hierzu verschiedene Verfahren einsetzbar: a) Affinitätschromatographie; dabei werden Ankersequenzen, die zu den überhängenden Enden der Terminatoren kompatible Enden besitzen, z.B. an eine Hydroxylapatit-Säule gebunden. Die aus Schritt V des erfindungsgemäßen Verfahrens erhaltenen Logomere werden über die Säule gegeben, wodurch die Logomere durch Hybridisierung an die Ankersequenzen binden können. Die solcherart gebundenen Logomere werden dann einzeln aufgenommen. b) Ankersequenzen werden an eine Membran (z.B. Gene Screen Plus, DuPont, Biotechnology Systems; Hybond-N, Amersham Life Sciences) kovalent gebunden. Die Membran ist gerastert, d.h. in einzelne Felder unterteilt. Pro Feld wird genau eine Ankersequenz kovalent an die Membran gebunden. Danach werden die aus Schritt V des erfindungsgemäßen Verfahrens erhaltenen Logomere über die Membran gegeben und mit den Ankersequenzen hybridisiert. Die Membran wird daraufhin in die einzelnen Felder des Rasters zerschnitten. Die einzelnen Felder, die nun maximal ein an die jeweilige Ankersequenz gebundenes Logomer enthalten, können jetzt in separate Gefäße (z.B. Eppendorf Tubes) überführt werden. Sodann können die Logomere durch Denaturieren von der Membran getrennt werden. Beim Denaturieren ist zu beachten, daß die Denaturierungstemperatur so gewählt ist, daß sie hoch genug ist, um Logomer undHere, the molecular mixture obtained from a symbol polymerization is passed over a carrier material to which oligomers ("anchor sequences") are bound, which in turn can bind to the terminators of the logomers. The bound logomers are then taken up individually and can be reproduced as required. Various methods can be used for this: a) affinity chromatography; anchor sequences which have ends compatible with the overhanging ends of the terminators are bound, for example, to a hydroxylapatite column. The logomers obtained from step V of the process according to the invention are passed over the column, as a result of which the logomers can bind to the anchor sequences by hybridization. The logomers bound in this way are then taken up individually. b) Anchor sequences are covalently bound to a membrane (e.g. Gene Screen Plus, DuPont, Biotechnology Systems; Hybond-N, Amersham Life Sciences). The membrane is rasterized, ie divided into individual fields. Exactly one anchor sequence per field is covalently bound to the membrane. The logomers obtained from step V of the process according to the invention are then passed over the membrane and hybridized with the anchor sequences. The membrane is then cut into the individual fields of the grid. The individual fields, which now contain a maximum of one logomer linked to the respective anchor sequence, can now be transferred to separate vessels (eg Eppendorf tubes). The logomers can then be separated from the membrane by denaturing. When denaturing, please note that the Denaturation temperature is chosen so that it is high enough to logomer and
Ankersequenz zu trennen, jedoch nicht so hoch, daß das Logomer selbst vollständig aufschmilzt.Separate anchor sequence, but not so high that the logomer itself melts completely.
Isolation durch VerdünnungIsolation by dilution
Bei der Isolation durch Verdünnung werden die Logomere, die als Gemisch aus einer Symbolpolymerisation erhalten werden, soweit verdünnt, daß in einem jeweiligen Zielvolumen statistisch genau ein Molekül enthalten ist. Dieses kann dann mit Hilfe der PCR aufgespürt und vervielfältigt werden. Die Verdünnung des Ausgangsvolumens in Zielvolumina kann dabei gleichzeitig geschehen, so daß ein Ausgangsvolumen auf n Zielvolumina verdünnt wird. Dazu wird erfindungsgemäß wie folgt vorgegangen:In the case of isolation by dilution, the logomers, which are obtained as a mixture from a symbol polymerization, are diluted to such an extent that exactly one molecule is statistically contained in a respective target volume. This can then be detected and reproduced using the PCR. The dilution of the initial volume in target volumes can take place simultaneously, so that an initial volume is diluted to n target volumes. To this end, the procedure according to the invention is as follows:
Zu einem, aus Schritt V des erfindungsgemäßen Verfahrens erhaltenen, Gemisch von Logomeren in einem Ausgangsvolumen Va wird ein Verdünnungsfaktor ermittelt, der n in Va enthaltene Logomere so auf n Zielvolumina Vz verdünnt, daß in jedem Zielvolumen Vz statistisch genau ein Logomer enthalten ist. Um den Verdünnungsfaktor zu ermitteln wird ein Aliquot des Ausgangsvolumens (z.B. 1μl) in einer Verdünnungsreihe austitriert. Von jeder Verdünnung der Reihe wird dann ein Aliquot (z.B. 1μl) als Template einer PCR-Reaktion verwendet, um zu ermitteln, in welchen Verdünnungen noch Logomere detektierbar sind. Erhält man solcherart die letzte Verdünnung, die noch Logomere enthält, und die Verdünnung, die schon keine mehr enthält, läßt sich ein ungefährer Verdünnungsfaktor angeben, der gerade noch ungefähr ein Logomer enthält. Gegebenenfalls kann dieser Verdünnungsfaktor durch Austitrieren der letzten Verdünnung, die noch Logomere enthält, genauer bestimmt werden. Dabei verwendet man entsprechend kleinere Verdünnungsschritte (verdünnt man z.B. in der ersten Verdünnungsreihe immer 1 :10, so kann man in der 2. Verdünnungsreihe z.B 1 :2 verdünnen; das Verfahren der genaueren Bestimmung des Verdünnungsfaktors kann dabei prinzipiell mit beliebiger Genauigkeit angewendet werden).Obtained at a, from step V of the method according to the invention, mixture of Logomeren in an initial volume V a is determined a dilution factor of n in V a given Logomere so diluted to n target volumes V z, that in each target volume V z statistically exactly one Logomer contain is. To determine the dilution factor, an aliquot of the initial volume (eg 1μl) is titrated in a dilution series. An aliquot (eg 1μl) of each dilution in the series is then used as a template for a PCR reaction in order to determine in which dilutions logomers can still be detected. If the last dilution which still contains logomers is obtained in this way, and the dilution which already contains no more, an approximate dilution factor can be specified which just about still contains a logomer. If necessary, this dilution factor can be determined more precisely by titrating out the last dilution, which still contains logomers. Correspondingly smaller dilution steps are used (e.g. if you always dilute 1:10 in the first dilution series, you can dilute 1: 2 in the second dilution series; the method of more precise determination of the dilution factor can in principle be used with any accuracy).
Da die PCR der Verdünnungen dazu dient, festzustellen, ob sich überhaupt noch Logomere in der Verdünnung befinden, kann die PCR auf mindestens zweierlei Weise durchgeführt werden: a) Als Primer dienen zwei gegenläufige, in den Terminatoren primende Primer, z.B. der 5'-Since the PCR of the dilutions serves to determine whether there are still any logomers in the dilution, the PCR can be carried out in at least two ways: a) Two opposite primers, e.g. the 5'-
Strang des Start-Terminators und der 3'-Strang des Ende-Terminators. Ansonsten sind die PCR-Bedingungen wie weiter unten unter Vervielfältigung von Logomeren durch PCR beschrieben. b) Die PCR wird wie die zum Auslesen der Logomere durchgeführt, es reicht jedoch ein Ansatz mit einem Paar von Primern wie unter Auslesen von Logomeren mittels PCR imStrand of the start terminator and the 3 'strand of the end terminator. Otherwise, the PCR conditions are as described below with the amplification of logomers by PCR. b) The PCR is carried out like that for reading out the logomers, but an approach with a pair of primers as with reading out logomers by means of PCR in the
Folgenden beschrieben.Described below.
Zur Kontrolle werden die durch PCR erhaltenen DNA Fragmente durch Gelelektrophorese sichtbar gemacht. Dazu wird z.B. ein 2-4%iges Agarose-Gel (z.B. UltraPure™ von Gibco BRL,As a control, the DNA fragments obtained by PCR are made visible by gel electrophoresis. For this, e.g. a 2-4% agarose gel (e.g. UltraPure ™ from Gibco BRL,
Life Technologies, Katalog Nr.: 15510-027) und als Molekulargewichtsstandard z.B. eine 50bp-Leiter (Gibco BRL, Life Technologies, Katalog Nr. 10416-014) verwendet. Das erhaltene Gel wird 5 Minuten in 0,001 % Ethidiumbromid gefärbt und unter UV sichtbar gemacht. Vervielfältigung von LogomerenLife Technologies, catalog no .: 15510-027) and as a molecular weight standard, for example a 50 bp conductor (Gibco BRL, Life Technologies, catalog no. 10416-014) is used. The gel obtained is stained in 0.001% ethidium bromide for 5 minutes and visualized under UV. Duplication of logomeres
Die aus einer Symbolpolymerisation erhaltenen Logomere können - je nach ihrer beabsichtigten Verwendung - vervielfältigt werden. Dies ist beispielsweise für die Visualisierung der gespeicherten Information oder die Weiterverwendung der Logomere als Marker zur Kennzeichnung von Stoffen und Gegenständen nötig.The logomers obtained from a symbol polymerization can - depending on their intended use - be duplicated. This is necessary, for example, for the visualization of the stored information or the further use of the logomers as markers for the identification of substances and objects.
Vervielfältigung von Logomeren durch PCRDuplication of logomeres by PCR
Bei diesem Verfahren werden Logomere durch PCR vervielfältigt. Das zu vervielfältigende Logomer dient als Template, die benötigten Primer primen jeweils gegenläufig in den Terminatoren (entweder 5'-Start und 3'-Ende, oder 5'-Ende und 3'-Start), so daß das Logomer vollständig vervielfältigt wird. Alternativ können die Primer, sofern das zu vervielfältigende Logomer von weiterer DNA umgeben ist, auch weiter außerhalb des Logomers primen.In this method, logomers are duplicated by PCR. The logomer to be reproduced serves as a template, the primers required prime in opposite directions in the terminators (either 5'-start and 3'-end, or 5'-end and 3'-start), so that the logomer is completely reproduced. Alternatively, if the logomer to be duplicated is surrounded by further DNA, the primers can also prime further outside the logomer.
Für die PCR-Ansätze, die in dem Fachmann bekannter Weise variiert werden können, werden z.B. folgende Reagentien und Bedingungen verwendet: dNTPs (z.B. Pharmacia Biotech, Katalog Nr.: 27-2035-01/2/3), Taq-Polymerase (z.B. Gibco- BRL , Katalog Nr.n: 18038-034, 18038-042, 18038-067), PCR-Puffer, MgCI2 (z.B. GIBCO- BRL, Katalog Nr.: 18067-017) The following reagents and conditions are used for the PCR batches, which can be varied in a manner known to those skilled in the art: dNTPs (for example Pharmacia Biotech, catalog no .: 27-2035-01 / 2/3), Taq polymerase (for example Gibco- BRL, catalog no .: 18038-034, 18038-042, 18038-067), PCR buffer, MgCI 2 (e.g. GIBCO- BRL, catalog no .: 18067-017)
Menge (μl) dNTP, 10mM 1Amount (μl) dNTP, 10mM 1
PCR-Puffer 10x 5PCR buffer 10x 5
MgCI2, 25mM 5MgCI 2 , 25mM 5
TAQ, 5u/μl 0,5TAQ, 5u / µl 0.5
Primer 1 , 10μM 1Primer 1, 10μM 1
Primer 2, 10μM 1Primer 2, 10μM 1
Template 1Template 1
(Logomer)(Logomer)
H20 35,5H 2 0 35.5
Gesamtvolumen 50Total volume 50
Als PCR-Programm kann beispielsweise folgendes Protokoll (Primer: 30-mere) verwendet werden:For example, the following protocol (primer: 30-mer) can be used as the PCR program:
Schritt Aktion Temperatur Dauer Gehe zu Anzahl Schritt WiederholungenStep Action Temperature Duration Go to Number of Step Repetitions
1 Denaturiere 95 °C 00:05:001 Denaturate 95 ° C 00:05:00
2 Denaturiere 95 °C 00:00:302 denatures 95 ° C 00:00:30
3 Annealing 68 °C 00:00:303 Annealing 68 ° C 00:00:30
4 Polymerisation 72 °C 00:00:304 Polymerization 72 ° C 00:00:30
5 Gehe zu 2 295 Go to 2 29
6 Kühlen 4 °C (beliebig)6 cooling 4 ° C (any)
7 Ende7 end
Ein weiterer Gegenstand der Erfindung sind informationstragende Polymere, die gemäß den oben beschriebenen erfindungsgemäßen Verfahren erhältlich sind.The invention furthermore relates to information-carrying polymers which can be obtained by the processes according to the invention described above.
Auslesen der in Logomeren enthaltenen InformationReading out the information contained in logomeres
Fertige Logomere können entweder mittels PCR (Polymerase Chain Reaction = Polymerasekettenreaktion), was erfindungsgemäß bevorzugt ist, oder mittels Restriktionsverdau gelesen werden. Dabei hat die PCR-Methode den Vorzug, bereits geringste Mengen DNA solcherart vervielfältigen zu können, daß die Logomere direkt nach der PCR und einer Gel-Auftrennung gelesen werden können. Im Falle von binären Logomeren kann das durch die PCR-Methode auf einem Gel erhaltene Bandenmuster unmittelbar als Binärcode gelesen werden.Finished logomers can either be read by means of PCR (polymerase chain reaction), which is preferred according to the invention, or by means of restriction digestion. The PCR method has the advantage of being able to reproduce even the smallest amounts of DNA in such a way that the logomers can be read directly after the PCR and a gel separation. In the case of binary logomers, the band pattern obtained by the PCR method on a gel can be read directly as a binary code.
Ein weiterer Gegenstand der Erfindung ist daher ein Verfahren zum Auslesen von Information aus informationstragenden Polymeren, die wie oben beschrieben erhalten und/oder isoliert und vervielfältigt wurden, dadurch gekennzeichnet, daß man a) n das informationstragende Polymer enthaltende Lösungen mit jeweils einem Paar gegenläufiger Primer versetzt, wobei n für die Zahl der als Elongatoren in dem Polymer enthaltenen Oligomere steht; b) mindestens n-1 PCR-Ansätze durchführt, wobei n für die Zahl der als Elongatoren in dem Polymer enthaltenen Oligomere steht und jeweils ein Primer eines jeden Paares in dem dem Elongator gegenüberliegenden Terminator primt und der andere Primer in dem Elongator selbst primt; c) die aus der PCR erhaltenen Polymer-Fragmente nach ihrer Länge durch Elektrophorese auftrennt und d) das aus der Elektrophorese erhaltene Muster optisch ausliest.The invention therefore furthermore relates to a method for reading out information from information-carrying polymers which have been obtained and / or isolated and reproduced as described above, characterized in that a) n solutions containing the information-carrying polymer are each mixed with a pair of counter-rotating primers, where n stands for the number of oligomers contained in the polymer as elongators; b) carries out at least n-1 PCR runs, where n stands for the number of oligomers contained as elongators in the polymer and one primer of each pair primes in the terminator opposite the elongator and the other primer primes in the elongator itself; c) the polymer fragments obtained from the PCR are separated according to their length by electrophoresis and d) optically reads the pattern obtained from the electrophoresis.
Das Verfahren kann auch unter Verwendung verschiedenfarbiger fluoreszenzmarkierter Primer oder Nukleotide durchgeführt werden. Dadurch wird es möglich, mehrere Ansätze verschiedenfarbig zu markieren und mehrere Ansätze in einer Spur gelelektrophoretisch zu lesen. Überdies kann der Ausleseprozeß dadurch mit modernen Sequenziermaschinen (z.B. von ABI erhältlich) automatisiert werden.The method can also be carried out using fluorescent-labeled primers or nucleotides of different colors. This makes it possible to mark several approaches in different colors and to read several approaches in one track by gel electrophoresis. In addition, the reading process can be automated with modern sequencing machines (e.g. available from ABI).
Auslesen von Logomeren mittels PCRReading out logomers using PCR
Um die in Logomeren enthaltenen Informationen sichtbar zu machen, können die Logomere mithilfe der PCR ausgelesen werden.In order to make the information contained in logomers visible, the logomers can be read out using PCR.
Die Methode des Auslesens binärer Muster mit PCR wurde als DNA Typing bereits von [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204- 209, (1991)] beschrieben. Die dort beschriebene Methode wird hier in einer abgewandelten Form als Auslese-PCR zum Auslesen der Logomere benutzt. Unterschiede zu der in [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209, (1991)] beschriebenen Methode bestehen darin, daß hier synthetisch erzeugte Templates verwendet werden, die nicht notwendig binäre Muster enthalten. Außerdem werden PCR- und Gel- Elektrophorese-Bedingungen so gewählt, daß das Ergebnis direkt vom Gel gelesen werden kann, ohne daß die als Bandenmuster erhaltenen Signale zusätzlich durch Blotting verstärkt werden müssen.The method of reading binary patterns with PCR has already been described as DNA typing by [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209, (1991)]. The method described there is used here in a modified form as a readout PCR for reading out the logomers. Differences from the method described in [Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209, (1991)] are that synthetically generated templates are used that do not necessarily contain binary patterns. In addition, PCR and gel electrophoresis conditions are selected so that the result can be read directly from the gel without the signals obtained as a band pattern having to be additionally amplified by blotting.
a) PCRa) PCR
Für das Auslesen eines Logomers werden für n Elongatoren der zugrundeliegenden Grammatik mindestens n - 1 , meistens aber n PCR-Ansätze gebraucht. Jeder PCR-Ansatz enthält das zu lesende Logomer als Template und außerdem ein Paar gegenläufiger Primer, von denen einer im Elongator, der andere im, dem Elongator gegenüberliegenden, Terminator primt (z.B. 5'-"Start" und 3'-0, siehe Abbildung 5). Für die PCR kann jeder handelsübliche Thermozykler (z.B. PTC-100, MJ Research) verwendet werden. Als zweckmäßig für die Länge der Primer haben sich 20-30bp erwiesen, jedoch sind auch andere Längen verwendbar. Je nach Primerlänge muß die Annealing-Temperatur entsprechend gewählt werden (kann z.B. mithilfe des Programmes Oligo 5.0 bestimmt werden). ZweckmäßigeTo read out a logomer, at least n - 1, but mostly n PCR approaches are used for n elongators of the underlying grammar. Each PCR approach contains the logomer to be read as a template and also a pair of opposing primers, one of which primes in the elongator, the other in the terminator opposite the elongator (e.g. 5 '- "Start" and 3'-0, see figure 5). Any commercially available thermal cycler (eg PTC-100, MJ Research) can be used for the PCR. 20-30 bp have proven to be expedient for the length of the primers, but other lengths can also be used. Depending on the primer length, the annealing temperature must be selected accordingly (can be determined using the Oligo 5.0 program, for example). Appropriate
Annealingtemperaturen sind für 20-mere ca. 55°C, für 30-mere etwa 65°C bis 74 °C.Annealing temperatures are about 55 ° C for 20-mers and about 65 ° C to 74 ° C for 30-mers.
Für die PCR-Ansätze werden z.B. folgende Reagentien und Protokolle verwendet, die in demFor the PCR approaches e.g. following reagents and protocols used in the
Fachmann bekannter Weise variiert werden können: dNTPs (Pharmacia Biotech, Katalog Nr.: 27-2035-01/2/3), Taq-Polymerase (Gibco-BRL,Those skilled in the art can be varied: dNTPs (Pharmacia Biotech, catalog no .: 27-2035-01 / 2/3), Taq polymerase (Gibco-BRL,
Katalog Nr.n: 18038-034, 18038-042, 18038-067), PCR-Puffer, MgCI2 (GIBCO-BRL, KatalogCatalog n: 18038-034, 18038-042, 18038-067), PCR buffer, MgCI 2 (GIBCO-BRL, catalog
Nr.: 18067-017)No .: 18067-017)
Menge (μl) dNTP, 10mM 1Amount (μl) dNTP, 10mM 1
PCR-Puffer 10x 5PCR buffer 10x 5
MgCI2, 25mM 5MgCI 2 , 25mM 5
TAQ, 5u/μl 0,5TAQ, 5u / µl 0.5
Primer 1 , 10μM 1Primer 1, 10μM 1
Primer 2, 10μM 1Primer 2, 10μM 1
Template 1Template 1
(Logomer)(Logomer)
H20 35,5H 2 0 35.5
Gesamtvolumen 50Total volume 50
Um genügend DNA zu erhalten, so daß das erhaltene Bandenmuster nach der Gelelektrophorese direkt vom Gel gelesen werden kann, kann jeder PCR-Ansatz m mal angesetzt werden. Z.B. kann m = 4 sein.In order to obtain enough DNA so that the band pattern obtained can be read directly from the gel after gel electrophoresis, each PCR approach can be prepared m times. For example, can be m = 4.
Als PCR-Programm kann folgendes Protokoll (Primer: 30-mere) verwendet werden: hrit t Aktion Temperatur Dauer Gehe zu Anzahl Schritt WiederholungenThe following protocol (primer: 30-mers) can be used as the PCR program: hrit t Action Temperature Duration Go to Number of step repetitions
1 Denaturiere 95 °C 00:05:001 Denaturate 95 ° C 00:05:00
2 Denaturiere 95 °C 00:00:302 denatures 95 ° C 00:00:30
3 Annealing 69,5 °C 00:00:303 Annealing 69.5 ° C 00:00:30
4 Polymerisation 72 °C 00:00:304 Polymerization 72 ° C 00:00:30
5 Gehe zu 2 295 Go to 2 29
6 Kühlen 4 °C (beliebig)6 cooling 4 ° C (any)
7 Ende7 end
Nach durchgeführter PCR ist es für die Lesbarkeit der Bandenmuster der nachfolgenden Gelelektrophorese evtl. zweckmäßig, möglichst viel amplifizierte DNA in möglichst geringem Volumen zu halten, das dann auf ein Gel geladen werden kann. Dazu können die Volumina auf geeignete Weise (z.B. mit einer SpeedVac, z.B. SpeedVac Concentrator, Savant) eingeengt werden. b) Gelelektrophorese Die für jeden Elongator aus der PCR erhaltenen DNA Fragmente haben verschiedene Länge.After the PCR has been carried out, it may be expedient for the legibility of the band patterns of the subsequent gel electrophoresis to keep as much amplified DNA as possible in the smallest possible volume, which can then be loaded onto a gel. For this purpose, the volumes can be reduced in a suitable manner (eg with a SpeedVac, eg SpeedVac Concentrator, Savant). b) Gel electrophoresis The DNA fragments obtained from the PCR for each elongator have different lengths.
Werden sie durch Elektrophorese aufgetrennt, so ergeben die unterschiedlichen Längenfragmente ein spezifisches Muster, anhand dessen sich das zu lesende Logomer identifizieren läßt (siehe Abbildung 5 und Abbildung 6). Für die Gelelektrophorese kann ein 4% Agarose-Gel (z.B. UltraPure™ von Gibco BRL, Life Technologies, Katalog Nr.: 15510- 027), als Molekulargewichtsstandard z.B. eine 50bp-Leiter (Gibco BRL, Life Technologies, Katalog Nr.: 10416-014) verwendet werden. Die Auftrennung der DNA erfolgt in einer Gelkammer in geeigneter Weise, z.B. 1 :45 Stunden bei 60V. Hier sind die Parameter jedoch relativ frei wählbar, insbesondere kann die Gel-Laufzeit weiter verkürzt werden. Das erhaltene Gel wird 5 Minuten in 0,001% Ethidiumbromid gefärbt und unter UV sichtbar gemacht. Ein Beispiel für ein solcherart erhaltenes Gel findet sich exemplarisch unter Abbildung 6.If they are separated by electrophoresis, the different length fragments result in a specific pattern, on the basis of which the logomer to be read can be identified (see Figure 5 and Figure 6). For gel electrophoresis, a 4% agarose gel (e.g. UltraPure ™ from Gibco BRL, Life Technologies, catalog no .: 15510-027), as a molecular weight standard e.g. a 50bp ladder (Gibco BRL, Life Technologies, catalog no .: 10416-014) can be used. The DNA is separated in a suitable manner in a gel chamber, e.g. 1: 45 hours at 60V. Here, however, the parameters can be selected relatively freely, in particular the gel runtime can be shortened further. The gel obtained is stained in 0.001% ethidium bromide for 5 minutes and visualized under UV. An example of a gel obtained in this way can be found in Figure 6.
Auslesen von Logomeren durch RestriktionsverdauReading out logomers by restriction digestion
Logomere können durch Restriktionsverdau ausgelesen werden. Dazu müssen die Elongatoren so konstruiert sein, daß sie asymmetrisch versetzte Restriktionsschnittstellen tragen. Jeder Elongator trägt dabei eine spezifische Restriktionsschnittstelle. Beispielsweise kann das Restriktionsenzym EcoRV (z.B. NEB, Katalog Nr. #195S) für O-Elongatoren und Smal (z.B. NEB, Katalog Nr. #141 S) für 1 -Elongatoren verwendet werden. Zum Lesen wird das zu lesende Logomer in verschiedenen Restriktionsansätzen geschnitten. Dazu wird pro Elongator ein Restriktionsansatz mit dem jeweiligen Restriktionsenzym gebildet. Die aus der Restriktion erhaltenen DNA Fragmente sind von verschiedener Länge. Werden sie durch Elektrophorese aufgetrennt, so ergeben die unterschiedlichen Längenfragmente ein spezifisches Muster, anhand dessen sich das zu lesende Logomer identifizieren läßt. Das folgende Beispiel zeigt die DNA-Fragmentlängen aller binären Logomere mit 4 Bit ohne Terminatoren mit Elongatorlänge = 30bp; Restriktionsschnittstelle pro Elongator nach 10bp. Logomers can be read out by restriction digestion. To do this, the elongators must be constructed in such a way that they carry asymmetrically offset restriction interfaces. Each elongator has a specific restriction interface. For example, the restriction enzyme EcoRV (eg NEB, catalog no. # 195S) can be used for O-elongators and Smal (eg NEB, catalog no. # 141 S) for 1 elongators. For reading, the logomer to be read is cut in various restriction approaches. For this purpose, a restriction approach with the respective restriction enzyme is formed for each elongator. The DNA fragments obtained from the restriction are of different lengths. If they are separated by electrophoresis, the different length fragments result in a specific pattern, on the basis of which the logomer to be read can be identified. The following example shows the DNA fragment lengths of all binary logomers with 4 bits without terminators with elongator length = 30 bp; Restriction interface per elongator after 10bp.
Binärzahl Q -SBinary number Q -S
0000 10, 40, 40, 40, 30 160 0000 10, 40, 40, 40, 30 160
0001 10, 40, 40, 70 130, 30 0010 10, 40, 80, 30 90, 70 °011 10,40,110 90,40,30 0001 10, 40, 40, 70 130, 30 0010 10, 40, 80, 30 90, 70 ° 011 10.40.110 90.40.30
0100 10,80,40,30 50,110 0100 10.80.40.30 50.110
0101 10, 80, 70 50, 80, 30 0101 10, 80, 70 50, 80, 30
0110 10,120,30 50,40,70 0110 10.120.30 50.40.70
0111 10,150 50,40,40,30 1000 50,40,40,30 10,150 0111 10.150 50.40.40.30 1000 50.40.40.30 10.150
1001 50,40,70 10,120,30 1001 50.40.70 10.120.30
1010 50, 80, 30 10, 80, 70 1010 50, 80, 30 10, 80, 70
101 1 50, 110 10, 80, 40, 30 1 100 90, 40, 30 10, 40, 110 1 101 90, 70 10, 40, 80, 30 101 1 50, 110 10, 80, 40, 30 1 100 90, 40, 30 10, 40, 110 1 101 90, 70 10, 40, 80, 30
. 1 1 1° 130, 30 10, 40, 40, 70, 1 1 1 ° 130, 30 10, 40, 40, 70
1 1 1 1 160 10, 40, 40, 40, 30 1 1 1 1 160 10, 40, 40, 40, 30
Im obigen Beispiel (4 Bits) erkennt man, daß die Längenmuster der Zahlen 0010 und 0100 bei Restriktion des O-Bits nicht eindeutig ist. 0010 und 0100 lassen sich jedoch anhand der Längenmuster bei Restriktion des 1 -Bits unterscheiden.In the example above (4 bits) you can see that the length pattern of the numbers 0010 and 0100 is not unique when the O bit is restricted. However, 0010 and 0100 can be differentiated based on the length pattern when the 1 bit is restricted.
Im Einzelnen wurde zur Durchführung des obigen Beispiels folgendermaßen vorgegangen, wobei sich die Protokolle gemäß den Kenntnissen des Fachmanns variieren lassen: a) DNA ExtraktionIn detail, the procedure for carrying out the above example was as follows, the protocols being able to be varied according to the knowledge of the person skilled in the art: a) DNA extraction
Eine z.B. durch Vereinzelung und Vervielfältigung von Logomeren durch Klonierung erhaltene Bakterienkolonie wird zum Animpfen von 2-5ml einer 37°C Übernachtkultur verwendet (z.B. LB-Medium mit 10μg/l Ampicillin wie in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben). Als Klonierungsvektor können hier z.B. pGEM-T Easy (Promega, Katalog Nr. A1360) und binäre Logomere auch ohne Terminatoren verwendet werden. Aus der Übernachtkultur wird die das Logomer enthaltende Plasmid-DNA isoliert (z.B. mithilfe des Qiagen Plasmid Miniprep Kit, Qiagen, Katalog Nr. 12123, oder durch alkalische Lyse wie in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben). b) RestriktionA e.g. Bacterial colony obtained by separating and replicating logomers by cloning is used to inoculate 2-5 ml of a 37 ° C. overnight culture (for example LB medium with 10 μg / l ampicillin as described in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)]). As a cloning vector, e.g. pGEM-T Easy (Promega, Catalog No. A1360) and binary logomers can also be used without terminators. The plasmid DNA containing the logomer is isolated from the overnight culture (for example using the Qiagen Plasmid Miniprep Kit, Qiagen, Catalog No. 12123, or by alkaline lysis as described in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)]). b) restriction
Die aus a) erhaltene Plasmid DNA wird für n Elongatoren in n Restriktionsansätzen geschnitten. Jeder Restriktionsansatz enthält ein Restriktionsenzym, das in einem spezifischen Elongator schneidet und ein Restriktionsenzym, das das Logomer aus der Klonierungssite ausschneidet. Im verwendeten Beispiel wurden folgende Ansätze verwendet:The plasmid DNA obtained from a) is cut in n restriction batches for n elongators. Each restriction approach contains a restriction enzyme that cuts in a specific elongator and a restriction enzyme that cuts out the logomer from the cloning site. The following approaches were used in the example used:
Name Menge Volumen (μl)Name Amount volume (μl)
Plasmid Logomer in pGEM-T 500ng/μl 6Plasmid logomer in pGEM-T 500ng / ul 6
DNA Easy (s.o.)DNA Easy (see above)
Puffer NEB2 10x 1 BSA 10x 1Buffer NEB2 10x 1 BSA 10x 1
Enzym 1 Eco RV 10u/μl 1Enzyme 1 Eco RV 10u / μl 1
Enzym 2 Eco Rl 10u/μl 1Enzyme 2 Eco Rl 10u / μl 1
Total 10Total 10
Name Menge Volumen (μl)Name Amount volume (μl)
Plasmid Logomer in pGEM-T 500ng/μl 6Plasmid logomer in pGEM-T 500ng / ul 6
DNA Easy (s.o.)DNA Easy (see above)
Puffer NEB4 10x 1Buffer NEB4 10x 1
BSA 10x 0BSA 10x 0
Enzym 1 Sma l 10u/μl 1Enzyme 1 Sma l 10u / ul 1
Enzym 2 Eco RI 10u/μl 1Enzyme 2 Eco RI 10u / μl 1
H20 1 Total 10H 2 0 1 Total 10
Die angegebenen Ansätze werden 1 Stunde auf 37CC inkubiert. c) GelelektrophoreseThe indicated batches are incubated at 37 C for 1 hour. c) Gel electrophoresis
Die aus b) erhaltenen DNA Fragmente werden elektrophoretisch aufgetrennt (z.B. 4%The DNA fragments obtained from b) are separated electrophoretically (e.g. 4%
Agarose UltraPure™ von Gibco BRL, Life Technologies, Katalog Nr.: 15510-027), mitAgarose UltraPure ™ from Gibco BRL, Life Technologies, Catalog No .: 15510-027), with
Ethidiumbromid (0,001 %) gefärbt und unter UV sichtbar gemacht (siehe Abbildung 8).Ethidium bromide (0.001%) stained and visualized under UV (see Figure 8).
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Implementierung binärer Logomere:The methods described above enable the implementation of binary logomers, for example:
Binäre Logomere werden mit Grammatiken erzeugt, in denen gilt:Binary logomers are generated with grammars in which:
Σ:= {0, 1 , s0, Sι, s2, ..., sn-ι, sn,
Figure imgf000038_0001
em} mit n, m e IN und n, m > 0.Σ: = {0, 1, s 0 , Sι, s 2 , ..., s n -ι, s n ,
Figure imgf000038_0001
e m } with n, me IN and n, m> 0.
Sie ermöglichen die einfachste und universellste Darstellung von Daten, wie sie auch von herkömmlichen Datenverarbeitungsmaschinen eingesetzt wird. Binäre Logomere sind Resultat einer Bitpolymerisation. Da abhängig von der jeweils gewählten Grammatik nahezu beliebige Symbole und Regeln kodiert werden können, können damit ebenso beliebige Daten und Datentypen erzeugt werden. Die oben beschriebenen Verfahren ermöglichen beispielsweise die Implementierung von Zeichenalphabeten:They enable the simplest and most universal representation of data, as is also used by conventional data processing machines. Binary logomers are the result of bit polymerization. Since almost any symbols and rules can be encoded depending on the grammar selected, any data and data types can also be generated. The methods described above enable the implementation of character alphabets, for example:
Logomere können eingesetzt werden, um die Zeichen eines gewählten Alphabetes zu kodieren. Die Zeichenlänge kann dabei unterschiedlich gewählt werden, sinnvoll ist es jedoch, die auch für herkömmliche Datenverarbeitungsanlagen benutzten Zeichenlängen (Halbbyte, 1 -Byte, 2-Byte, 4-Byte, 8-Byte usw.) zu verwenden. Ebenso ist die Konvention für die Interpretation der dargestellten Zeichen wahlfrei. Die Zeichen können Zahlen, Buchstaben, alphanumerische Zeichen oder beliebige andere Datenstrukturen sein.Logomeres can be used to encode the characters of a chosen alphabet. The character length can be selected differently, but it makes sense to use the character lengths (nibble, 1 byte, 2 byte, 4 byte, 8 byte, etc.) that are also used for conventional data processing systems. The convention for the interpretation of the characters shown is also optional. The characters can be numbers, letters, alphanumeric characters or any other data structure.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Implementierung eines 1 -Byte Alphabetes:For example, the methods described above enable the implementation of a 1-byte alphabet:
Es sei eine Grammatik G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, 1 , s, e}, Variablenmenge V:={ So, Si, S2, S3, S4, S5, S6, S7, S8}, Startsymbol S und RegelmengeLet there be a grammar G = (Σ, V, R, S) with terminal alphabet Σ: = {0, 1, s, e}, set of variables V: = {So, Si, S 2 , S 3 , S 4 , S 5 , S 6 , S 7 , S 8 }, start symbol S and rule set
R:=R: =
{{
S:=sS0 S: = sS 0
S0->0S1 SO-^ ST S 0 -> 0S 1 S O - ^ S T
S^OS∑S ^ OS∑
S1->1 S2 S 1 -> 1 S 2
S2->0S3 S 2 -> 0S 3
S2->1 S3 S3->0S4 S 2 -> 1 S 3 S 3 -> 0S 4
S3->1 S4 S 3 -> 1 S 4
S4->0S5 S 4 -> 0S 5
S4->1 s5 S 4 -> 1 s 5
S5->0S6 S5->1 S6 S 5 -> 0S 6 S 5 -> 1 S 6
S6->0S7 S 6 -> 0S 7
S6->1 s7 S 6 -> 1 s 7
S7->0S8 S 7 -> 0S 8
S7->1S8 S8->eS 7 -> 1S 8 S 8 -> e
} wobei: s := Start e := Ende. Beispiel: nach den Regeln der angegebenen Grammatik können alle 8-Bit Zeichen erzeugt werden: z.B.: Erzeugung der 8-Bit 0, 00000000:} where: s: = start e: = end. Example: All 8-bit characters can be generated according to the rules of the specified grammar: e.g. generation of 8-bit 0, 00000000:
S-> sS0 -> sOS! -> s00S2 -> s000S3 -> s0000S4 -> s00000S5 -> s0O0000S6 -> s0000000S7 -> sOOOOOOOOSo -> sOOOOOOOOe z.B.: Erzeugung der 8-Bit 255, 11111111 :S-> sS 0 -> sOS! -> s00S 2 -> s000S 3 -> s0000S 4 -> s00000S 5 -> s0O0000S 6 -> s0000000S 7 -> sOOOOOOOOSo -> sOOOOOOOOe e.g. generation of 8-bit 255, 11111111:
S-> sSi -> s1 S1 -> s11 S2 -> s111 S3 -> s1111 S4 -> s11111 S5 -> s111111 S6 -> s1111111 S7 -> s11111111 S8 -> s11111111e z.B.: Erzeugung der 8-Bit 85, 01010101 : S-> sS0 -> sOSi -> s01 S2 -> s010S3 -> s0101 S4 -> s01010S5 -> s010101 S6 -> s0101010S7 -> s01010101S8 -> s01010101eS-> sSi -> s1 S 1 -> s11 S 2 -> s111 S 3 -> s1111 S 4 -> s11111 S 5 -> s111111 S 6 -> s1111111 S 7 -> s11111111 S 8 -> s11111111e e.g. generation the 8-bit 85, 01010101: S-> sS 0 -> sOSi -> s01 S 2 -> s010S 3 -> s0101 S 4 -> s01010S 5 -> s010101 S 6 -> s0101010S 7 -> s01010101S 8 -> s01010101e
Die für die Implementierung in vitro benötigten Sequenzen werden nach dem NFR-Verfahren, wie in den erfindungsgemäßen Schritten II und III beschrieben, hergestellt. Algomere und Logomere werden, wie in den erfindungsgemäßen Schritten IV - V beschrieben, hergestellt und die erhaltenen Logomere vorzugsweise mittels des unter Vereinzelung und Vervielfältigung von Logomeren durch Klonierung beschriebenen Verfahrens isoliert und vervielfältigt. Die solcherart erzeugten alphanumerischen Zeichen können jetzt für verschiedene technische Zwecke (z.B. die Markierung und Identifizierung von Stoffen) eingesetzt werden und, evtl. nach zusätzlichen technischen Schritten, gemäß dem erfindungsgemäßen Verfahren zum Auslesen von Information aus informationstragenden Polymeren (wie oben beschrieben) ausgelesen werden.The sequences required for implementation in vitro are produced by the NFR method, as described in steps II and III according to the invention. Algomers and logomers are prepared as described in steps IV-V according to the invention, and the logomers obtained are preferably isolated and reproduced by means of the process described by separating and multiplying logomers by cloning. The alphanumeric characters generated in this way can now be used for various technical purposes (e.g. the marking and identification of substances) and, possibly after additional technical steps, according to the method according to the invention for reading information from information-carrying polymers (as described above).
Da die hier erzeugten Binärmuster wahlfrei als Daten und Symbole gelesen werden können, können sie z.B als alphanumerische Zeichen interpretiert werden. Werden sie als Zahlen interpretiert, so erzeugt die angegebene Grammatik 8-Bit Zufallszahlen.Since the binary patterns generated here can be read as data and symbols, they can be interpreted as alphanumeric characters, for example. If they are interpreted as numbers, the specified grammar generates 8-bit random numbers.
Aus einer genügend großen Menge zufälliger 8-Bit Binärmuster können alle 8-Bit Muster isoliert und als Bibliothek (z.B. zur Darstellung aller alphanumerischen Zeichen) angelegt werden.All 8-bit patterns can be isolated from a sufficiently large amount of random 8-bit binary patterns and created as a library (e.g. for displaying all alphanumeric characters).
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Darstellung von Zeichenketten:The methods described above enable the display of strings, for example:
Da Algomere so hergestellt werden können, daß sich unterschiedlich lange Logomere erzeugen lassen, ist es möglich, auch Zeichenketten darzustellen. Aus praktischen Gründen ist es jedoch zweckmäßig, nur wenige Zeichen pro Logomer vorzusehen. Z.B. kann ein einzelnes Logomer 4 Bit (Halbbyte) oder 8 Bit (1 Byte) enthalten. (Falls mehr Bit erforderlich sind, sollten zweckmäßigerweise immer Vielfache von 8 Bit = 1 Byte verwendet werden.) In Binärdarstellung können dann beliebige alphanumerische Zeichen in beliebiger Kodierung (z.B. ASCII, ANSI, ISO 8859-x, Unicode) dargestellt werden. Dabei kann sich ein Zeichen auch über mehrere Logomere erstrecken (Bsp.: Halbbyte-Darstellung, bei der sich jeweils ein 1 -Byte Zeichen über zwei Logomere erstreckt, oder Unicode, bei der sich ein 16-Bit Zeichen über zwei 8-Bit oder vier 4-Bit Logomere erstreckt). Für die Darstellung von Zeichenketten ist es dann nötig, die einzelnen Zeichen mit Positionsinformation zu versehen. Dazu reicht es, in den jeweiligen Grammatiken verschiedene Terminatoren (z.B. verschiedene "Start"- Terminatoren) zu verwenden, deren Sequenzen jeweils die Positionsinformation repräsentieren.Since algomers can be produced in such a way that logomers of different lengths can be generated, it is also possible to display character strings. For practical reasons, however, it is advisable to provide only a few characters per logomer. For example, a single logomer can contain 4 bits (nibbles) or 8 bits (1 byte). (If more bits are required, multiples of 8 bits = 1 byte should always be used.) In binary representation, any alphanumeric characters can be displayed in any coding (e.g. ASCII, ANSI, ISO 8859-x, Unicode). A character can also span several logomers (e.g. nibble representation, in which there is a 1-byte characters spanning two logomers, or Unicode, where a 16-bit character spans two 8-bit or four 4-bit logomers). To display character strings, it is then necessary to provide the individual characters with position information. To do this, it is sufficient to use different terminators (eg different "start" terminators) in the respective grammars, the sequences of which each represent the position information.
Beispiel: Es sei eine Grammatik G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, 1 , e, s0, s-i, s2, ..., Sn-1, sn}, Variablenmenge V:={ S0, Si, S2, S3, S4, S5, S6, S7, S8}, Startsymbol S und Regelmenge R:=Example: Let there be a grammar G = (Σ, V, R, S) with terminal alphabet Σ: = {0, 1, e, s 0 , si, s 2 , ..., S n -1, s n }, Variable set V: = {S 0 , Si, S 2 , S 3 , S 4 , S 5 , S 6 , S 7 , S 8 }, start symbol S and rule set R: =
{{
S:=SjSrjS: = SjSrj
S0->0SιS 0 -> 0Sι
S0->1 Sι Sι->0S2 S 0 -> 1 Sι Sι-> 0S 2
S >1 S2 S> 1 S 2
S2->0S3 S 2 -> 0S 3
S2->1 S3 S 2 -> 1 S 3
S3->0S4 S3->1 S4 S 3 -> 0S 4 S 3 -> 1 S 4
S4->0S5 S 4 -> 0S 5
S4->1 S5 s5->os6 S 4 -> 1 S 5 s 5 -> os 6
S5->1 S6 S6->0S7 S 5 -> 1 S 6 S 6 -> 0S 7
S6->1 S7 S 6 -> 1 S 7
S7->0S8 S 7 -> 0S 8
S7->1 S8 S 7 -> 1 S 8
S8->e } wobei: s, := Start, mit i = {0 n} e := Ende.S 8 -> e} where: s,: = start, with i = {0 n} e: = end.
Das mit dieser Grammatik erzeugte 1 -Byte Alphabet reicht z.B. für alle alphanumerischen Zeichen des ASCII, ANSI oder ISO 8859-x Standards. Für eine Zeichenkette der Länge n werden n verschiedene Terminatoren benötigt, so daß die mit dieser Grammatik erzeugten Zeichenketten wie folgt aufgebaut sind: Srjxe, s^e, ..., sn-ιxe, snxe wobei x eine beliebige Binärdarstellung mit, in diesem Fall, 8 Bit ist. Es bedeutet dann:The 1-byte alphabet generated with this grammar is sufficient, for example, for all alphanumeric characters of the ASCII, ANSI or ISO 8859-x standards. For a character string of length n, n different terminators are required, so that the character strings generated with this grammar are structured as follows: Srjxe, s ^ e, ..., s n -ιxe, s n xe where x is any binary representation with, in this case, is 8 bits. It then means:
Sr-xe := Zeichen x an Position 0 (O.tes Zeichen)Sr-xe: = character x at position 0 (Oth character)
Sixe := Zeichen x an Position 1 (l .tes Zeichen) s2xe := Zeichen x an Position 2 (2.tes Zeichen) usw.Sixe: = character x at position 1 (1st character) s 2 xe: = character x at position 2 (2nd character) etc.
Mit der Grammatik läßt sich beispielsweise die Zeichenkette "Elisabeth" im ASCII-Code darstellen: s001000101 e, s^H OH OOe, s201101001e, s3OΪ 110O11 e, s401100001 e, s501100010e, s601100101 e, s7011101 OOe, s801101 OOOe Alternativ kann auch Σ:= {0, 1 , s, e0, e^ e2, ..., en-ι, en} gewählt werden, wodurch dieWith the grammar, for example, the character string "Elisabeth" can be represented in ASCII code: s 0 01000101 e, s ^ H OH OOe, s 2 01101001e, s 3 OΪ 110O11 e, s 4 01100001 e, s 5 01100010e, s 6 01100101 e, s 7 011101 OOe, s 8 01101 OOOe Alternatively, Σ: = {0, 1, s, e 0 , e ^ e 2 , ..., e n -ι, e n } can be selected, whereby the
Zeichenkette "Elisabeth" im ASCII-Code als: s01000101e0, sOΪ 101100θι, s01101001 e2, s01110011 e3, s01100001 e4, s01100010e5, s01100101 ββ, s01110100e7, s01101000e8 dargestellt wird. Eine weitere Möglichkeit ist Σ:= {0, 1 , s0, s^ s2, ..., sn-ι, sn , e0, ei, e2, ..., efr1, en}, womit die Zeichenkette "Elisabeth" im ASCII-Code als: s001000101e0, SIOI I OH OOΘL s201101001 e2, s301110011e3, s401100001 e4, s501100010e5, s601100101 ββ, s701110100e7, s801101000e8 dargestellt wird.Character string "Elisabeth" in ASCII code as: s01000101e 0 , sOΪ 101100θι, s01101001 e 2 , s01110011 e 3 , s01100001 e 4 , s01100010e 5 , s01100101 β β , s01110100e 7 , s01101000e 8 . Another possibility is Σ: = {0, 1, s 0 , s ^ s 2 , ..., s n -ι, s n , e 0 , ei, e 2 , ..., e fr1 , e n } , with which the character string "Elisabeth" in ASCII code as: s 0 01000101e 0 , S I OI I OH OOΘ L s 2 01101001 e 2 , s 3 01110011e 3 , s 4 01100001 e 4 , s 5 01100010e 5 , s 6 01100101 ββ, s 7 01110100e 7 , s 8 01101000e 8 is shown.
In Halbbyte-Darstellung mit Positionsinformation würde die Zeichenkette "Elisabeth" im ASCII- Code dargestellt als: s001 OOe, SiOl 01 e, s20110e, s3110Oe, s40110e, s51001 e, s60111 e, s70011 e, s80110e, s90001 e, s100110e, Sn0010e, s120110e, s130101e, Sι40111e, s150100e, s1601 10e, Sι71000eIn a half-byte representation with position information, the character string "Elisabeth" in ASCII code would be represented as: s 0 01 OOe, SiOl 01 e, s 2 0110e, s 3 110Oe, s 4 0110e, s 5 1001 e, s 6 0111 e, s 7 0011 e, s 8 0110e, s 9 0001 e, s 10 0110e, Sn0010e, s 12 0110e, s 13 0101e, Sι 4 0111e, s 15 0100e, s 16 01 10e, Sι 7 1000e
Aufgrund der Positionsinformation, die durch die Sequenz der Terminatoren repräsentiert wird, können die einzelnen Zeichen völlig unabhängig voneinander verarbeitet werden und z.B. getrennt voneinander gelesen werden. Mit einem solchen Alphabet ist die Darstellung beliebiger Datentypen möglich. Z.B. können z.B. jeweils zwei Byte (0. + 1., 2. + 3 , n. + n+1.) zu einem 2-Bytecode (z.B. Unicode) zusammengefaßt werden. Alphanumerische Zeichenketten können verwendet werden, um beliebige Bezeichner (Namen, Zahlen, Datum usw.) darzustellen.Due to the position information represented by the sequence of the terminators, the individual characters can be processed completely independently of one another and e.g. can be read separately. With such an alphabet, the representation of any data types is possible. For example, can e.g. two bytes (0. + 1., 2. + 3, n. + n + 1.) are combined to form a 2-byte code (e.g. Unicode). Alphanumeric strings can be used to represent any identifier (name, number, date, etc.).
Die für die Implementierung in vitro benötigten Sequenzen werden nach dem NFR-Verfahren, wie in den erfindungsgemäßen Schritten II und III beschrieben, hergestellt. Algomere und Logomere werden, wie in den erfindungsgemäßen Schritten IV - V beschrieben, hergestellt, die erhaltenen Logomere vorzugsweise mittels des unter Vereinzelung und Vervielfältigung von Logomeren durch Klonierung beschriebenen Verfahrens isoliert und vervielfältigt. Die solcherart erzeugten alphanumerischen Zeichen und Zeichenketten können jetzt für verschiedene technische Zwecke (z.B. die Markierung und Identifizierung von Stoffen) eingesetzt werden und, evtl. nach zusätzlichen technischen Schritten, gemäß dem erfindungsgemäßen Verfahren zum Auslesen von Information aus informationstragenden Polymeren (wie oben beschrieben) ausgelesen werden. Die oben beschriebenen Verfahren ermöglichen beispielsweise die Implementierung eines Zufallszahlengenerators:The sequences required for implementation in vitro are produced by the NFR method, as described in steps II and III according to the invention. Algomers and logomers are prepared as described in steps IV-V according to the invention, and the logomers obtained are preferably isolated and reproduced by means of the process described by separating and multiplying logomers by cloning. The alphanumeric characters and character strings generated in this way can now be used for various technical purposes (for example the marking and identification of substances) and, possibly after additional technical steps, according to the inventive method for reading information from information-carrying polymers (as described above) become. The methods described above enable, for example, the implementation of a random number generator:
Für bestimmte Probleme der Informatik (z.B. Simulationen) und der Mathematik werden Zufallszahlen benötigt. Diese werden im allgemeinen rechnergestützt durch Algorithmen erzeugt. Da diese Algorithmen jedoch deterministisch sind, handelt es sich bei den erzeugtenRandom numbers are required for certain problems in computer science (e.g. simulations) and mathematics. These are generally generated with the aid of algorithms. However, since these algorithms are deterministic, they are generated
Zufallszahlen nur um Pseudo-Zufallszahlen. Überdies sind die erzeugten Zahlenreihen aufgrund der unterschiedlichen Güte der Algorithmen unterschiedlich gut randomisiert.Random numbers only by pseudo-random numbers. In addition, due to the different quality of the algorithms, the number series generated are randomized to different extents.
Für manche Anwendungen werden daher echte Zufallszahlen benötigt. Ist dies der Fall, muß ein physikalischer Prozeß in die Erzeugung von Zufallszahlen einbezogen werden. Ein solcherReal random numbers are therefore required for some applications. If this is the case, a physical process must be included in the generation of random numbers. Such a
Prozeß ist etwa das Rauschen der Soundkarte in einem PC, das von entsprechenderProcess is about the noise of the sound card in a PC, that of appropriate
Software verarbeitet wird.Software is processed.
Mithilfe der hier beschriebenen Verfahren kann ein echter Zufallszahlengenerator implementiert werden, der Zufallszahlen sehr viel schneller erzeugt, als es mit herkömmlichen Verfahren möglich ist.Using the methods described here, a real random number generator can be implemented that generates random numbers much faster than is possible with conventional methods.
Der Zufallszahlengenerator wird mit folgender Grammatik implementiert (Grammatik für binäre Zufallszahlen beliebiger Länge):The random number generator is implemented with the following grammar (grammar for binary random numbers of any length):
G = (Σ, V, R, S) mit Σ:= {0, 1 , s, e}, V:={S),G = (Σ, V, R, S) with Σ: = {0, 1, s, e}, V: = {S),
R:= {R: = {
S := sA A->0A A->1A A->e } wobei s:= Start e:= EndeS: = sA A-> 0A A-> 1A A-> e} where s: = start e: = end
Mit dieser Grammatik können Wörter über dem oben angegebenen Terminalalphabet Σ:= {0, 1 , s, θ} gebildet werden. Alle Wörter der Sprache L beginnen mit „s" und hören mit „e" auf, dazwischen befindet sich eine zufällige Anzahl (auch 0) zufälliger Bits („0" und „1").This grammar can be used to form words above the terminal alphabet Σ: = {0, 1, s, θ} given above. All words of the language L begin with "s" and end with "e", in between there is a random number (also 0) of random bits ("0" and "1").
Beispiel: Wörter aus der Sprache L, die nach R gebildet werden: S->sA->seExample: Words from the language L that are formed after R: S-> sA-> se
S->sA->s1A->s1eS-> sA-> s1A-> s1e
S->sA->s0A->s00A->s001 A->s0010A->s001 OeS-> sA-> s0A-> s00A-> s001 A-> s0010A-> s001 Oe
S->sA->s1 A->s10A->s100A->s1000A->s10000A->s100000A->s1 OOOOOe Die als Wörter der Spache L erzeugten Binärmuster können als Buchstaben, Zahlen, alphanumerische Zeichen oder Zeichenketten gelesen werden. Liest man sie als die Binärdarstellung von Zahlen, so sind diese Binärmuster in Dezimaldarstellung: 0 (leer) 1 2S->sA-> s1 A->s10A->s100A->s1000A->s10000A->s100000A-> s1 OOOOOe The binary patterns generated as words of language L can be read as letters, numbers, alphanumeric characters or character strings. If you read them as the binary representation of numbers, then these binary patterns are in decimal notation: 0 (empty) 1 2
32 und können als Zufallszahlen verwendet werden. Zur in vitro Implementierung eignen sich prinzipiell beliebige Sequenzen, solange sie eindeutig und zueinander maximal unähnlich sind. Z.B. können folgende Algomere verwendet werden: sA: agctttatatctccatttgccctagtgaag aatatagaggtaaacgggatcacttcaacc32 and can be used as random numbers. In principle, any sequences are suitable for in vitro implementation, as long as they are clear and maximally dissimilar to one another. For example, the following algomers can be used: sA: agctttatatctccatttgccctagtgaag aatatagaggtaaacgggatcacttcaacc
A->0A: ttggcgagatatcaacgccaccccttgctt gctctatagttgcggtggggaacgaaaaccA-> 0A: ttggcgagatatcaacgccaccccttgctt gctctatagttgcggtggggaacgaaaacc
A->1A: ttggcgacccgggaaacaactattgctagt gctgggccctttgttgataacgatcaaaccA-> 1A: ttggcgacccgggaaacaactattgctagt gctgggccctttgttgataacgatcaaacc
A->e: ttggtgcgggagttggaagcaactacgatg acgccctcaaccttcgttgatgctacctagA-> e: ttggtgcgggagttggaagcaactacgatg acgccctcaaccttcgttgatgctacctag
Die dazu benötigten Sequenzen sind handelsüblich. Sie können z.B. bestellt werden als 40nmol, PAGE gereinigt (ARK-Scientific, Darmstadt) und z.B. 100μM in Aqua dest. aufgenommen werden (empfohlene Lagerung bei -20°C). Aus den Sequenzen werden, wie im erfindungsgemäßen Schritt IV beschrieben, Algomere hergestellt. Diese Algomere werden, wie im erfindungsgemäßen Schritt V beschrieben, zu Logomeren polymerisiert und können gemäß dem erfindungsgemäßen Verfahren zum Auslesen von Information aus informationstragenden Polymeren (wie oben beschrieben) ausgelesen werden. Derart erzeugte Zufallszahlen sind in Abbildung 6 zu sehen.The sequences required for this are commercially available. You can e.g. ordered as 40nmol, PAGE cleaned (ARK-Scientific, Darmstadt) and e.g. 100μM in aqua dest. be included (recommended storage at -20 ° C). As described in step IV according to the invention, algomers are prepared from the sequences. As described in step V according to the invention, these algomers are polymerized to logomers and can be read out according to the method according to the invention for reading information from information-carrying polymers (as described above). Random numbers generated in this way can be seen in Figure 6.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Verschlüsselung von Logomeren:The methods described above enable, for example, the encryption of logomers:
Die in Logomeren enthaltene Information kann verschlüsselt werden. Dazu fungiert mindestens einer der für die Auslese-PCR benötigten Primer als geheimer Schlüssel (siehe Abbildung 11 ). Bevorzugt ist dies einer der in den Terminatoren primenden Primer. Ist die Sequenz dieses Primers (Schlüsselsequenz) und der Primer selbst nur autorisierten Zugreifern bekannt, so ist die in den derart verschlüsselten Logomeren enthaltene Information auch nur autorisierten Zugriffen zugänglich.The information contained in logomers can be encrypted. For this purpose, at least one of the primers required for the readout PCR acts as a secret key (see Figure 11). This is preferably one of the primers priming in the terminators. Is the If the sequence of this primer (key sequence) and the primer itself are only known to authorized accesses, the information contained in the logomers encrypted in this way is only accessible to authorized accesses.
Um ein Auslesen der in den Logomeren enthaltenen Information ohne diesen Schlüssel zu verhindern, müssen weitere Vorkehrungen getroffen werden. Versuche, die Verschlüsselung zu brechen, können darauf beruhen, über die Vervielfältigung nicht-geheimer Sequenzen auch die Logomere zu lesen. Sofern bakterielle Vektoren zur Klonierung von Logomeren verwendet werden, könnte ein potentieller Angreifer z.B. versuchen, die gesamte Klonierungssite mit PCR zu vervielfältigen und dann mit Sequenzierung zu lesen oder über die zur Selektion benötigten Resistenzgene in die Klonierungssite "hineinzulesen". Auch könnten die Elongatoren selbst als Ansatzpunkte für ein PCR-basiertes Lesen der geheimen Sequenz(en) dienen.In order to prevent the information contained in the logomers from being read out without this key, further precautions must be taken. Attempts to break the encryption can be based on reading the logomeres by duplicating non-secret sequences. If bacterial vectors are used to clone logomers, a potential attacker could e.g. attempt to replicate the entire cloning site using PCR and then read with sequencing or "read" into the cloning site using the resistance genes required for selection. The elongators themselves could also serve as starting points for PCR-based reading of the secret sequence (s).
Solchen Angriffsversuchen ist gemein, daß sie über nicht-geheime Sequenzen versuchen könnten, die Schlüsselsequenz zu entschlüsseln und darüber die verschlüsselte Sequenz zu lesen. Eine Abwehr derartiger Angriffsversuche kann dadurch erfolgen, daß zum Informationstransport über Logomere immer nur vollständig geheime Sequenzen verwendet werden. Jedoch ist dies evtl. zu aufwendig und kostenträchtig. Stattdessen oder ergänzend dazu können die informationstragenden Logomere mit Sequenzen (Scheinsequenzen) versetzt werden, die dieselben potentiellen Angriffspunkte (z.B. Bits, Resistenzgene) enthalten, jedoch jeweils andere Schlüsselsequenzen. Durch diese Scheinsequenzen laufen potentielle Angiffsversuche ins Leere, weil für den nicht-autorisierten Zugreifer alle Einzelsequenzen ununterscheidbar und dadurch die verschlüsselten Informationen verborgen sind. Mit je mehr Scheinsequenzen ein Logomer versetzt ist, um so schwieriger wird es, die Schlüsselsequenz zu brechen. Das Verfahren entspricht einer molekularen Steganografie und wird exemplarisch anhand der Verschlüsselung von Zeichen eines 1 -Byte Alphabetes gezeigt:Common to such attacks is that they could try to decrypt the key sequence and read the encrypted sequence using non-secret sequences. Such attempts to attack can be prevented by using only completely secret sequences for information transport via logomers. However, this may be too complex and costly. Instead or in addition to this, the information-carrying logomers can be mixed with sequences (dummy sequences) which contain the same potential points of attack (e.g. bits, resistance genes), but each have different key sequences. These bogus sequences make potential attempts to attack empty, because for the unauthorized access attacker all individual sequences are indistinguishable and the encrypted information is hidden. The more dummy sequences a logomer is mixed with, the more difficult it becomes to break the key sequence. The procedure corresponds to a molecular steganography and is shown as an example using the encryption of characters from a 1-byte alphabet:
Es sei die verwendete Grammatik G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, 1 , skey, s0, Si, s2, ..., SM , s , e}, wobei f e IN, f > 1. skθy ist der geheime Schlüssel. Für eine Schlüssellänge von I ist dann die maximale theoretische Verschlüsselung Keymax = a', die maximal verwendbare Verschlüsselung Keyeff = a'"d, wobei d die Anzahl der Basen angibt, in der sich ein Scheinschlüssel von dem richtigen Schlüssel unterscheiden muß, damit in der Auslese- PCR kein Scheinschlüssel die richtige Sequenz lesen und umgekehrt der richtige Schlüssel kein Scheinlogomer (sondern nur das Ziellogomer) auslesen kann. Für hochspezifische PCR Konditionen kann d > 1 werden. Weiterhin gibt Keyimp = Anzahl Scheinschlüssel + 1 die tatsächlich verwendete Verschlüsselung und Keymin = 1 + x die minimale Verschlüsselung an. Dabei ist x die zu einer minimalen Verschlüsselung nötige Anzahl von Scheinlogomeren. Diese kann im Falle der Verwendung von n Logomeren als Informationsträger größer als n gewählt werden. Für Zeichenketten ergibt sich automatisch eine zusätzliche Verschlüsselung, weil hier die für einen potentiellen Angreifer unbekannte Reihenfolge der Zeichen zusätzlich verschlüsselnd wirkt. Beispiel: Für eine Grammatik mit Zeichenketten von n 1 -Byte Zeichen wird folgendeLet us use the grammar G = (Σ, V, R, S) with terminal alphabet Σ: = {0, 1, s key , s 0 , Si, s 2 , ..., SM, s, e}, where fe IN, f> 1. s kθy is the secret key. For a key length of I, the maximum theoretical encryption Key max = a ', the maximum usable encryption Key eff = a'"d , where d indicates the number of bases in which a dummy key must differ from the correct key, so in the readout PCR no key code can read the correct sequence and vice versa the correct key cannot read a key logomer (only the target logomer). For highly specific PCR conditions d can become> 1. Furthermore key imp = number of key codes + 1 gives the actually used encryption and Key min = 1 + x indicates the minimum encryption. x is the number of false logomers required for minimum encryption. If n logomers are used as information carriers, this can be selected to be greater than n. Additional encryption is automatically provided for character strings because here is the row unknown to a potential attacker sequence of characters also has an encryption effect. Example: For a grammar with strings of n 1 -byte characters the following is used
Grammatik G verwendet:Grammar G uses:
Es sei G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, 1 , skeyo, skeyι, skθy2 skeyn-ι, skeyn. s0, Si, s2 Sf.ι, st, e}, wobei n,f ε IN, n > 1. n gibt dabei die Anzahl der verwendeten echten Schlüssel, f die Anzahl der verwendeten Scheinschlüssel an; die verwendete Variablenmenge V und die verwendete Regelmenge R sind dabei wahlfrei und abhängig von der zu kodierenden Information.Let G = (Σ, V, R, S) with terminal alphabet Σ: = {0, 1, s key o, s key ι, s kθy2 s keyn -ι, s key n. S 0 , Si, s 2 S f .ι, s t , e}, where n, f ε IN, n> 1. n indicates the number of real keys used, f the number of dummy keys used; the set of variables V used and the set of rules R used are optional and depend on the information to be encoded.
Grammatiken mit anderer Zeichenkodierung funktionieren analog. Die für die Implementierung in vitro benötigten Sequenzen werden nach dem NFR-Verfahren, wie in den erfindungsgemäßen Schritten II und III beschrieben, hergestellt. Algomere und Logomere werden, wie in den erfindungsgemäßen Schritten IV - V beschrieben, hergestellt, die erhaltenen Logomere vorzugsweise mittels des unter Vereinzelung und Vervielfältigung von Logomeren durch Klonierung beschriebenen Verfahrens isoliert und vervielfältigt. Die solcherart erzeugten Logomere können, wie bereits als Auslese-PCR beschrieben, ausgelesen werden, wobei - wie beschrieben - einer der zum Auslesen benötigten Primer, bevorzugt einer der in den Terminatoren primenden Primer, als geheimer Schlüssel fungiert. Mit der oben beschriebenen Grammatik werden zusätzlich zu den informationstragenden Logomeren „Scheinsequenzen" („Scheinlogomere") erzeugt, die einen nicht-autorisierten Auslese-Zugriff auf die in den Logomeren enthaltenen Informationen verhindern sollen. Das Verfahren kann für alle Anwendungen von Logomeren benutzt werden und hat u.a. den Vorzug, durch die Spezifität des als geheimer Schlüssel benutzten Primers sehr effektiv zu sein.Grammars with other character encodings work analogously. The sequences required for implementation in vitro are produced by the NFR method, as described in steps II and III according to the invention. Algomers and logomers are prepared as described in steps IV-V according to the invention, and the logomers obtained are preferably isolated and reproduced by means of the process described by separating and multiplying logomers by cloning. The logomers generated in this way can, as already described as readout PCR, be read out, with - as described - one of the primers required for the readout, preferably one of the primers priming in the terminators, acting as a secret key. With the grammar described above, "sham sequences" ("sham logomers") are generated in addition to the information-bearing logomers, which are intended to prevent unauthorized readout access to the information contained in the logomers. The method can be used for all logomer applications and has, among other things. the advantage of being very effective due to the specificity of the primer used as a secret key.
Basierend auf der beschriebenen Methode können symmetrische und asymmetrische Verschlüsselungsverfahren implementiert werden. Für ein symmetrisches Verschlüsselungsverfahren reicht es, daß sich die Teilnehmer A und B einer Kommunikation auf eine geheimgehaltene Schlüsselsequenz einigen. Teilnehmer B verschlüsselt eine als Logomer gespeicherte Nachricht an A, indem B Logomere nur mit den geheimen Terminatoren herstellt und seine Nachricht mit zusätzlichen Logomeren versetzt, die andere Terminatoren tragen. Nur A ist es dann möglich, das zum Auslesen benötigte Primerpaar bereitzustellen, da nur A die benötigte Terminatorsequenz kennt.Based on the described method, symmetrical and asymmetrical encryption methods can be implemented. For a symmetrical encryption method, it is sufficient for subscribers A and B of a communication to agree on a secret key sequence. Subscriber B encrypts a message to A stored as a logomer by B producing logomers only with the secret terminators and adding additional logomers that carry other terminators to his message. Only A is then able to provide the primer pair required for reading, since only A knows the terminator sequence required.
Ein asymmetrisches Verschlüsselungsverfahren erfordert dagegen zusätzlichen Aufwand, z.B. den Einsatz von Molekülen mit irregulären Formen (siehe z.B. Abbildung 12 und Abbildung 13): Will ein Kommunikationsteilnehmer B eine verschlüsselte Nachricht an A schicken, so bekommt er von A einen öffentlichen Schlüssel, den er zur Verschlüsselung der als Logomer repräsentierten Nachricht verwenden kann. Der öffentliche Schlüssel von A besteht aus einem Paar von Terminatoren und einem Pool zusätzlicher Scheinterminatoren mit ähnlichen Eigenschaften, jedoch abweichenden Sequenzen und anderen 3'-Überhangsequenzen. Von den echten Terminatoren ist lediglich die 3' Überhangsequenz bekannt, mit der sie an die - öffentlich bekannten - Elongatoren verknüpft werden kann. Zur Verschlüsselung einer Nachricht erzeugt B Logomere, wobei er in der Symbolpolymerisationsreaktion den von A öffentlich bereitgestellten Schlüssel (enthaltend Terminatoren und Scheinterminatoren) verwendet. Die Art und Weise der Terminatoren gewährleistet nun, daß lediglich A in der Lage ist, die solcherart verschlüsselte Nachricht wieder zu lesen: Da nur A die tatsächliche Sequenz der echten Terminatoren kennt, ist nur A in der Lage, die als Logomere verschlüsselte Nachricht über Auslese-PCR wieder zu lesen.An asymmetrical encryption procedure, on the other hand, requires additional effort, e.g. the use of molecules with irregular shapes (see e.g. Figure 12 and Figure 13): If a communication subscriber B wants to send an encrypted message to A, he receives a public key from A, which he uses for encryption who can use the message represented as a logomer. A's public key consists of a pair of terminators and a pool of additional dummy terminators with similar properties, but different sequences and other 3 'overhang sequences. Of the real terminators, only the 3 'overhang sequence is known, with which it can be linked to the - publicly known - elongators. To encrypt a Message generates B logomers, using the key (containing terminators and dummy terminators) made publicly available by A in the symbol polymerization reaction. The nature of the terminators now ensures that only A is able to read the message encrypted in this way: since only A knows the actual sequence of the real terminators, only A is able to read the message encrypted as logomers -PCR read again.
Weil der öffentliche Schlüssel potentiell über die bekannte Überhangsequenz zu den Elongatoren angreifbar ist (weil die Scheinterminatoren diese Überhangsequenz nicht besitzen dürfen, kann ein potentieller Angreifer eine beliebige Sequenz an die echten Terminatoren knüpfen, wodurch die Sequenz der Terminatoren identifiziert werden kann), werden als Terminatoren Moleküle auf der Basis irregulärer Formen, z. B. auf der Basis der in Abbildung 12 gezeigten Y-förmigen Moleküle verwendet. Die gezeigten Y-förmigen Moleküle lassen sich zu weiter verzweigten baumartigen Molekülen zusammensetzen. Die Wurzel eines solchen als Baum realisierten Terminatormoleküls enthält dann die zu den Elongatoren kompatible Überhangsequenz, während nur eine der Äste des Baumes die echte Terminatorsequenz enthält. Da die verschlüsselte Nachricht wie oben beschrieben zusätzlich mit Scheinlogomeren versetzt ist, kann dann nur A, der die echte Terminatorsequenz kennt, aus der Menge der Moleküle die richtige Nachricht durch Verknüpfen mit dem kompatiblen Vektor herausfiltern, wohingegen ein potentieller Angreifer ohne Kenntnis der echten Terminatorsequenz dies nicht kann.Because the public key is potentially vulnerable to the elongators via the known overhang sequence (because the fake terminators must not have this overhang sequence, a potential attacker can link any sequence to the real terminators, whereby the sequence of the terminators can be identified), are termed terminators Molecules based on irregular shapes, e.g. B. used on the basis of the Y-shaped molecules shown in Figure 12. The Y-shaped molecules shown can be assembled into further branched tree-like molecules. The root of such a terminator molecule implemented as a tree then contains the overhang sequence compatible with the elongators, while only one of the branches of the tree contains the real terminator sequence. Since the encrypted message is also supplemented with dummy logomers as described above, only A who knows the real terminator sequence can then filter out the correct message from the set of molecules by linking it to the compatible vector, whereas a potential attacker without knowledge of the real terminator sequence can can not.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Verschlüsselung mit Echtzeit-Identifizierung:The methods described above enable encryption with real-time identification, for example:
Ohne das Auslesen der in verschlüsselten Logomeren enthaltenen Informationen kann das Vorhandensein der Schlüsselsequenz selbst Auskunft darüber geben, ob ein gekennzeichnetes Produkt echt ist, oder nicht. Die Information über die Authentizität des gekennzeichneten Produktes kann dabei über einen Prozeß, bei dem der Schlüsselprimer als Hybridisierungssonde einer Fluoreszenz-Nachweisreaktion dient, verifiziert oder falsifiziert werden.Without reading out the information contained in encrypted logomers, the presence of the key sequence itself can provide information as to whether a labeled product is genuine or not. The information about the authenticity of the labeled product can be verified or falsified using a process in which the key primer serves as a hybridization probe for a fluorescence detection reaction.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zur Verschlüsselung von Information.Another object of the present invention is therefore the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for encrypting information.
Die oben beschriebenen Verfahren ermöglichen beispielsweise einen Test der Qualität von Oligonukleotiden: Ein typisches Problem bei der Herstellung von Oligonukleotiden, z.B. für molekularbiologischeThe methods described above allow, for example, a test of the quality of oligonucleotides: A typical problem in the production of oligonucleotides, for example for molecular biological
Zwecke, ist die Qualitätskontrolle derselben, die aufgrund des Herstellungsprozesses und der schwankenden Qualität der verwendeten Chemikalien problematisch ist. Das in den erfindungsgemäßen Schritten I - V beschriebene Verfahren kann benutzt werden, die Qualität von Oligonukleotiden zu testen. Dazu wird eine binäre Grammatik wie die für den Zufallszahlengenerator (s.o.) oder eine unäre Grammatik wie die zur Herstellung von Molekulargewichtsstandards (s.u.) zur Erzeugung beliebig langer Logomere verwendet. Bei ansonsten identischen Bedingungen ist dann die Länge der aus einer Symbolpolymerisation (Schritt V des erfindungsgemäßen Verfahrens) erhaltenen Logomere direkt proportional zur Qualität der verwendeten Oligonukleotide: Je länger die elektrophoretisch sichtbar gemachten Logomere sind, desto besser ist die Qualität der verwendeten Oligonukleotide. Ein Beispiel für die aus einer Symbolpolymerisation erhaltene Leiter unterschiedlich langer Logomere findet sich unter Abbildung 3. Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zur Qualitätskontrolle synthetisch hergestellter Oligonukleotide.Purpose is the quality control of the same, which is problematic due to the manufacturing process and the fluctuating quality of the chemicals used. The method described in steps I-V according to the invention can be used to test the quality of oligonucleotides. For this purpose, a binary grammar such as that for the random number generator (see above) or a unary grammar such as that for the production of molecular weight standards (see below) is used to generate logomers of any length. Under otherwise identical conditions, the length of the logomers obtained from a symbol polymerization (step V of the method according to the invention) is directly proportional to the quality of the oligonucleotides used: the longer the logomers made electrophoretically visible, the better the quality of the oligonucleotides used. An example of the conductors of logomers of different lengths obtained from a symbol polymerization can be found in Figure 3. Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for quality control of synthetically produced oligonucleotides.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung von Logomeren als Marker und SignaturenThe methods described above enable, for example, the production of logomers as markers and signatures
Aufgrund der Fähigkeit, prinzipiell beliebige Informationen darzustellen, lassen sich die hier beschriebenen Logomere als Marker verwenden, um Erzeugnisse, Produkte, Stoffe und Geräte zu kennzeichnen.Due to the ability to display any information in principle, the logomers described here can be used as markers to identify products, products, substances and devices.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, als Marker oder Signaturen.Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, as markers or signatures.
Die Logomere können als "binäres Etikett" verwendet werden, das einem Erzeugnis hinzugefügt wird und Informationen über das derart gekennzeichnete Erzeugnis enthält. DieThe logomers can be used as a "binary label" that is added to a product and contains information about the product so labeled. The
Logomere können dabei z.B. Informationen über a) Hersteller b) Produkt (z.B. Seriennummer) c) Verwendungszweck d) Stoffklasse e) Gefahrenklasse f) Qualität g) Reinheit h) Produktions- und Verfallsdatum enthalten. Es lassen sich damit nahezu beliebige Produkte und Erzeugnisse mit nahezu beliebigen Informationen versehen. Da die Logomere ungiftig und biologisch abbaubar sind, können sie auch für hochsensible Produkte wie Nahrungsmittel, Medikamente und pharmazeutische Erzeugnisse eingesetzt werden.For example, logomers can contain information about a) manufacturer b) product (e.g. serial number) c) intended use d) substance class e) hazard class f) quality g) purity h) production and expiry date. Almost any product and product can be provided with almost any information. Since the logomers are non-toxic and biodegradable, they can also be used for highly sensitive products such as food, medicines and pharmaceutical products.
Gekennzeichnete Erzeugnisse können z.B. sein: a) chemische Erzeugnisse, z.B. Lacke, Farben, Öle, Schmier- und Treibstoffe, Lösungsmittel, Tinte usw. b) flüssige Materialien: Lösungen, Suspensionen, Emulsionen c) gentechnische Erzeugnisse d) Nahrungsmittel, z.B. zur Kennzeichnung gentechnisch veränderter Bestandteile oder dem Monitoring von Nahrungsmitteln während des Produktionsprozesses e) Medikamente und pharmazeutische Erzeugnisse f) Papiererzeugnisse, Dokumente, Geld g) GeräteLabeled products can e.g. be: a) chemical products, e.g. Varnishes, paints, oils, lubricants and fuels, solvents, inks etc. b) liquid materials: solutions, suspensions, emulsions c) genetic engineering products d) foodstuffs, e.g. to identify genetically modified components or to monitor foodstuffs during the production process e) drugs and pharmaceutical products f) paper products, documents, money g) devices
Der Bedarf zur Kennzeichnung von Produkten besteht in den unterschiedlichsten Bereichen und aufgrund unterschiedlicher Anforderungen. Gründe für eine Kennzeichnung können z.B. sein: Qualitätssicherung beim Produktionsprozeß, Überwachung der Produktreinheit und Vermeidung von Kontaminationen, Schutz vor Fälschung und Produktpiraterie, Nachweis bestimmter Produktbestandteile, Produktkennzeichnung mit beliebigen Produktinformationen. Dieser Bedarf stellt sich auch in besonders sensiblen Bereichen, etwa bei der Kennzeichnung von Nahrungsmitteln, medizinischen und pharmazeutischen Erzeugnissen und gentechnisch hergestellten oder veränderten Erzeugnissen. Hier ist es wünschenswert, daß Informationen über das jeweilige Produkt direkt am Produkt verfügbar sind, insbesondere wenn Verwechselungen oder Fälschungen vermieden werden sollen und auch die Identifikation unterschiedlicher Bestandteile eines Erzeugnisses gewünscht ist. Es gibt zahlreiche Beispiele für den Bedarf von Produktkennzeichnungen. Z.B. können Logomere als Seriennummern eingesetzt werden, die in Autolacke gemischt werden, wodurch der Fahrzeughalter im Versicherungsfall (z.B. Unfall oder Diebstahl) identifiziert werden kann. Durch Produktkennzeichnungen könnte die Qualität und Reinheit chemischer Erzeugnisse überwacht und Kontaminationen vermieden werden. Ein permanentes Problem ist die Fälschung von Dokumenten, Unterschriften und Geld, die hochentwickelte Kennzeichnungsverfahren nötig macht.The need to label products exists in a wide variety of areas and due to different requirements. Reasons for labeling can e.g. be: quality assurance in the production process, monitoring of product purity and avoidance of contamination, protection against counterfeiting and product piracy, proof of certain product components, product labeling with any product information. This need also arises in particularly sensitive areas, such as the labeling of foods, medical and pharmaceutical products and genetically engineered or modified products. It is desirable here that information about the respective product is available directly on the product, in particular if mix-ups or counterfeits are to be avoided and the identification of different components of a product is also desired. There are numerous examples of the need for product labeling. For example, logomeres can be used as serial numbers, which are mixed in car paints, whereby the vehicle owner can be identified in the event of an insurance claim (e.g. accident or theft). Product labeling could monitor the quality and purity of chemical products and prevent contamination. A constant problem is the falsification of documents, signatures and money, which makes sophisticated labeling processes necessary.
Vor allem vor dem Hintergrund von Tierkrankheiten und -seuchen (BSE, Schweinepest, Salmonellenvergiftungen usw.) stellt sich das Problem der Qualitätssicherung von Nahrungsmitteln und der Kennzeichnung von Endprodukten, um kontaminierte Produkte vom Verbrauch fernzuhalten. Ein weiteres Problem sind Nahrungsmittel, die gentechnisch hergestellte Bestandteile enthalten. Diese Bestandteile können ohne ein Kennzeichnungsverfahren im Endprodukt überhaupt nicht oder nur sehr schwer nachgewiesen werden. Das Problem stellt sich insbesondere dadurch, daß viele Nahrungsmittel Bestandteile unterschiedlicher Herkunft enthalten und die Produktionswege teilweise undurchschaubar sind. Das Problem der Kennzeichnung stellt sich z.B. auch im Bereich von Blutprodukten, wo z.B. durch Pooling Kontaminationen auftreten können. Auch wäre es hier z.T. wünschenswert, Informationen über Identität, Herkunft, Produktions- und Verfallsdatum direkt mit dem Produkt verfügbar zu haben. Ähnliches gilt auch für Medikamente und pharmazeutische Produkte.Especially against the background of animal diseases and diseases (BSE, swine fever, salmonella poisoning, etc.), the problem of quality assurance of food and labeling of end products arises in order to keep contaminated products away from consumption. Another problem is foods that contain genetically engineered ingredients. These components cannot be detected at all or only with great difficulty in the end product without a labeling method. The problem arises in particular because many foods contain components of different origins and the production routes are sometimes obscure. The problem of labeling also arises, for example, in the area of blood products, where contamination can occur, for example, through pooling. It would also be desirable in some cases to have information about identity, origin, date of production and expiry available directly with the product. The same applies to medicines and pharmaceutical products.
Bisher verwendet man zur Kennzeichnung und Markierung von Farben, Lacken, Treibstoffen, usw. verschiedene Kohlenstoffverbindungen, Polyaniline, Flüssigkristalle oder andere chemische Verbindungen. Diese Stoffe und Verbindungen haben unterschiedliche Schwächen: sie sind z.T. toxisch, nur schwer biologisch abbaubar, die verfügbare Informationskapazität ist stark eingeschränkt, sie wechselwirken chemisch mit bestimmten Stoffen oder sind nur teuer und aufwendig herzustellen.So far, various carbon compounds, polyanilines, liquid crystals or other chemical compounds have been used for the marking and marking of paints, varnishes, fuels, etc. These substances and compounds have different weaknesses: toxic, difficult to biodegrade, the available information capacity is very limited, they interact chemically with certain substances or are expensive and expensive to manufacture.
Für den Einsatz zur Kennzeichnung von sensiblen und hochsensiblen Erzeugnissen wie Nahrungsmitteln oder Medikamenten sind die genannten Stoffe und Verbindungen aufgrund der genannten Nachteile überhaupt nicht geeignet. Die Anforderungen, die sich für ein Kennzeichnungsverfahren von beliebigen Erzeugnissen stellen umfassen zumindest:Because of the disadvantages mentioned, the substances and compounds mentioned are not suitable at all for use in labeling sensitive and highly sensitive products such as food or medication. The requirements for a labeling process for any product include at least:
Die Kennzeichnung sollte direkt im oder am Erzeugnis verfügbar sein; die Kennzeichnung sollte gut nachweisbar sein; die Kennzeichnung muß gesundheitlich unbedenklich sein. Gegenüber den bisher verwendeten Verbindungen haben die hier beschriebenen Logomere folgende Vorzüge:The label should be available directly in or on the product; the labeling should be easy to demonstrate; the labeling must be harmless to health. The logomers described here have the following advantages over the previously used compounds:
Kodierung beliebiger Informationen, hohe Speicherkapazität, gesundheitlich unbedenklich, - chemisch, biologisch, pharmakologisch und genetisch neutral, leicht biologisch abbaubar (Biomoleküle), keine Umweltbelastung, sehr gute Nachweisbarkeit, hohe Kompatibilität zu bestehenden Techniken der Informatik und Molekularbiologie (PCR),Coding of any information, high storage capacity, harmless to health, - chemically, biologically, pharmacologically and genetically neutral, easily biodegradable (biomolecules), no pollution, very good detectability, high compatibility with existing IT and molecular biology techniques (PCR),
Informationen können verschlüsselt werden und eignen sich auch zu Authentifizierung und Verschlüsselung,Information can be encrypted and is also suitable for authentication and encryption,
Identifikation einzelner Bestandteile in Produktmischungen, billig in großen Mengen herzustellen (Klonierung, Vervielfältigung mit Bakterien in Fermentern).Identification of individual components in product mixtures, cheap to manufacture in large quantities (cloning, duplication with bacteria in fermenters).
Diese Eigenschaften machen Logomere für die genannten Aufgaben sehr viel besser geeignet als die bestehenden Techniken. Überdies erschließen sich Einsatzbereiche, die mit den bisherigen Techniken nicht möglich waren. Aufgrund der Eigenschaften nukleinsäurebasierter Logomere können diese auch zurThese properties make logomers much more suitable for the tasks mentioned than the existing techniques. In addition, areas of application open up that were not possible with previous techniques. Due to the properties of nucleic acid-based logomers, these can also be used for
Kennzeichnung von besonders sensiblen Produkten wie Nahrungsmitteln und pharmazeutischen Erzeugnissen verwendet werden.Labeling of particularly sensitive products such as food and pharmaceutical products can be used.
Die Gründe dafür liegen zum einen in der chemischen Beschaffenheit nukleinsäurebasierter Logomere und zum anderen in der Kodierung von Informationen in Logomeren:The reasons for this lie on the one hand in the chemical nature of nucleic acid-based logomers and on the other hand in the coding of information in logomers:
1 ) Als "Grundbausteine des Lebens" sind Nukleinsäuren Elementarbausteine aller bisher bekannten biologischen Lebensformen. Daher können sie aufgrund ihrer chemischen Beschaffenheit für keinen bekannten biologischen Organismus schädlich sein ("biochemische Kompatibilität"). Aufgrund der enthaltenen genetischen Informationen (des enthaltenen Programmes) können Nukleinsäuren jedoch sehr wohl potentiell schädlich sein, wenn sie in einem Organismus abgelesen werden: Falls sie etwa für giftige Proteine kodieren oder (wie im Falle viralen Erbgutes) einen jeweiligen Zielorganismus "umprogrammieren" können. Die hier verwendeten Logomere können jedoch aus den im Folgenden genannten Gründen keine für einen Organismus schädlichen Informationen enthalten.1) As "basic building blocks of life", nucleic acids are elementary building blocks of all previously known biological life forms. Therefore, due to their chemical nature, they cannot be harmful to any known biological organism ("biochemical compatibility"). However, based on the genetic information contained (the program included), nucleic acids can very well be potentially harmful if they are read in an organism: if they code for toxic proteins or (as in the case of viral genetic material) can "reprogram" a respective target organism. However, the logomers used here cannot contain any information harmful to an organism for the reasons mentioned below.
2) Logomere enthalten keine genetischen, d.h. biologisch relevanten Informationen ("semantische Inkompatibilitäf): Bezüglich der enthaltenen Informationen entsprechen Logomere Buchstaben, Zahlen oder Folgen von Buchstaben und Zahlen in Binärkodierung, die für uns oder einen Computer, jedoch nicht für den genetischen Apparat eines Organismus lesbar sind. Für einen biologischen Organismus sind sie schlicht "Unsinnscode".2) Logomers contain no genetic, i.e. Biologically relevant information ("semantic incompatibility"): With regard to the information contained, logomeres correspond to letters, numbers or sequences of letters and numbers in binary coding that are legible for us or a computer, but not for the genetic apparatus of an organism. For a biological organism it simply "nonsense code".
3) Logomere, insbesondere die Algomere, aus denen sie aufgebaut sind, sind zu kurz um auch nur zufällig biologisch relevante Informationen zu enthalten.3) Logomers, in particular the algomers from which they are built, are too short to contain biologically relevant information by chance.
4) Um jede Eventualität (der unwahrscheinliche Fall, daß die Binärinformationen der Logomere auf irgendeine Weise von irgendeinem Organismus als genetisch relevante4) Any contingency (the unlikely event that the binary information of the logomeres is somehow genetically relevant by any organism
Information interpretiert wird) auszuschließen, werden die zur Kodierung von Symbolen verwendeten Sequenzen im Falle sensibler Anwendungsbereiche mit Stopcodons versehen, so daß sie niemals von einem biologischen Organismus abgelesen werden können. 5) Als elementare Bestandteile aller biologischen Organismen sind Nukleinsäuren in unserer Umwelt allgegenwärtig. Sie werden in kürzester Zeit abgebaut.To exclude information is interpreted), the sequences used for coding symbols are provided with stop codons in the case of sensitive areas of application, so that they can never be read by a biological organism. 5) As elementary components of all biological organisms, nucleic acids are omnipresent in our environment. They will be dismantled in no time.
Um als Marker eingesetzt zu werden, können Logomere nach den in den erfindungsgemäßen Schritten I - V beschriebenen Verfahren erzeugt und nach den erfindungsgemäßen oben beschriebenen Verfahren vervielfältigt werden. Je nach Einsatzbereich können zur Vervielfältigung der Logomere verschiedene Verfahren und verschiedene Aufarbeitungsprozesse vorgenommen werden. Zur Kennzeichnung petrochemischer Erzeugnisse z.B. können Logomere durch Klonierung in Bakterien vervielfältigt werden. Um unnötige Kontaminationen zu vermeiden, können die erhaltenen Bakterien lysiert werden. Eine spezielle Aufreinigung der Logomer-DNA ist im Allgemeinen nicht nötig. Zur Herstellung von Logomeren für sensible und hochsensible Produkte ist dagegen ein aufwendigeres Vervielfältigungs- und Aufreinigungsverfahren nötig. Ziel ist dabei der Erhalt möglichst reiner Logomere. Um biologische Zwischenschritte zu vermeiden, kann die Vervielfältigung - wie erfindungsgemäß beschrieben - mit PCR vorgenommen werden. Sollte eine Vervielfältigung durch Klonierung vorgenommen werden, so ist die Aufreinigung der erhaltenen DNA aus Bakterien nötig. Sind die Logomere in bakteriellen Vektoren kloniert, so ist ein gezielter Abbau dieser Resistenzgene (z. B. durch Restriktionsenzyme) Bestandteil einer weiteren Aufarbeitung.In order to be used as a marker, logomers can be generated by the methods described in steps I-V according to the invention and reproduced using the methods described above according to the invention. Depending on the area of application, different methods and different work-up processes can be carried out to reproduce the logomers. To label petrochemical products, for example, logomers can be duplicated by cloning in bacteria. The bacteria obtained can be lysed to avoid unnecessary contamination. A special purification of the logomer DNA is generally not necessary. In contrast, the production of logomeres for sensitive and highly sensitive products requires a more complex duplication and purification process. The goal is to preserve the purest possible logomers. In order to avoid intermediate biological steps, the duplication - as described according to the invention - can be carried out with PCR. If duplication is to be carried out by cloning, the DNA obtained from bacteria must be purified. If the logomers are cloned in bacterial vectors, a targeted breakdown of these resistance genes (e.g. by restriction enzymes) is part of a further workup.
Logomere können zur Kennzeichnung eines Produktes unmittelbar mit diesem verbunden werden. Sie können z.B. in flüssige Stoffe gemischt werden oder auf feste Stoffe aufgebracht werden. Im Falle gentechnischer Erzeugnisse können die Logomere mithilfe von Rekombinations- und Klonierungstechniken kovalent mit dem zu kennzeichnenden Produkt verbunden werden. Die Kennzeichnung von Stoffen und Produkten durch Logomere ermöglichen u.a. das Monitoring von Produktionsprozessen, die Qualitätskontrolle, die Identifikation einzelner Bestandteile und den quantitativen und qualitativen Nachweis von Kontaminationen.Logomers can be directly connected to a product to identify it. You can e.g. mixed into liquid substances or applied to solid substances. In the case of genetically engineered products, the logomers can be covalently linked to the product to be labeled using recombination and cloning techniques. The labeling of substances and products with logomers enables, among other things. monitoring of production processes, quality control, the identification of individual components and the quantitative and qualitative detection of contamination.
Ein Aspekt der vorliegenden Erfindung wird im folgenden am Beispiel der Herstellung Computer-kompatibler Daten (Bytes/Multibytes) aus Nukleinsäuren und ihrer Verwendung zur Markierung unterschiedlicher Materialien erläutert, schränkt die Erfindung jedoch nicht auf dieses Beispiel ein:One aspect of the present invention is explained below using the example of the production of computer-compatible data (bytes / multibytes) from nucleic acids and their use for labeling different materials, but the invention is not restricted to this example:
1. Es wird eine Kodierung von Bytes und Multibytes in Form von Nukleinsäuren definiert. 2. Geeignete Sequenzen zur Repräsentation von Bytes und Multibytes werden konstruiert.1. A coding of bytes and multibytes in the form of nucleic acids is defined. 2. Suitable sequences for representing bytes and multibytes are constructed.
3. Eine Bibliothek (Library) von Byte-repräsentierenden Nukleinsäuren wird in vitro hergestellt.3. A library of byte representing nucleic acids is made in vitro.
4. Bytes werden zu Multibytes verknüpft.4. Bytes are linked to form multibytes.
5. Biochips werden zur Identifikation von Bytes und Multibytes hergestellt. 6. Unterschiedliche (organische und anorganische) Materialien und Gegenstände sowie einzelne Gene werden mit Bytes oder Multibytes gekennzeichnet (und ggfs. verschlüsselt). 7. Die Information gekennzeichneter Materialien, Gegenstände oder einzelner Gene wird ausgelesen (und ggfs. zu entschlüsselt).5. Biochips are used to identify bytes and multibytes. 6. Different (organic and inorganic) materials and objects as well as individual genes are identified with bytes or multibytes (and if necessary encrypted). 7. The information on marked materials, objects or individual genes is read out (and possibly too decrypted).
Erläuterung zu 1 :Explanation to 1:
Die Repräsentation von Daten mit Nukleinsäuren soll gewährleisten, daß die Daten Computerkompatibel sind. Zu diesem Zweck wird als universellste Darstellung von Computerdaten die Repräsentation von Bytes und Multibytes gewählt. Dazu wird eine Grammatik GC32 definiert, GC32 = (∑, V, R, S) mit Terminalalphabet Σ:= {xn, om, sm, em}, Variablenalphabet V:= {A, B, C}, Startsymbol S und Regelmenge R:={S:=oA, A→smB,The representation of data with nucleic acids is intended to ensure that the data are computer compatible. For this purpose, the most universal representation of computer data is the representation of bytes and multibytes. For this, a grammar G C32 is defined, G C32 = (∑, V, R, S) with terminal alphabet Σ: = {x n , o m , s m , e m }, variable alphabet V: = {A, B, C} , Start symbol S and rule set R: = {S: = oA, A → s m B,
B→Cem, C→xn}, wobei n, m e IN, n = {0, 1 255 } und m > 0. Die Grammatik beschreibt dieB → Ce m , C → x n }, where n, me IN, n = {0, 1 255} and m> 0. The grammar describes the
Konstruktion von Molekülen der Form osxe, wobei x alle Bytewert zwischen 0 und 255 annehmen kann, s Bytepositionen beschreibt und o und e für das Verketten von Einzelbytes zu Multibytes vorgesehen ist (siehe Abbildung 29 und Abbildung 30). Zur Vereinfachung des Herstellungsprozesses werden Restriktionssites als Variablen verwendet. Außerdem müssen die verwendeten Nukleinsäuren logische, physikalische, chemische und biologische Eigenschaften haben. Insbesondere müssen/sollen sie einfach zu vervielfältigen, einfach zu lesen sein und auf definierte Weise mit biologischen Sequenzen interagieren. Zu diesem Zweck werden datenrepräsentierende Nukleinsäuren so definiert, daß a) sie Bytes darstellen b) auch komplexere Datenstrukturen (Multibytes) darstellen können c) einzelne Bytes zu Multibytes verknüpft werden können d) sie mit einem Biochip gelesen werden können e) sie selbst zur Herstellung von 1 -Byte und Multibyte Biochips dienen können f) einzelne Bytes und Multibytes mit PCR vervielfältigt werden können g) klonierbar sind h) mit anderen Nukleinsäuren so verknüpft werden können, daß sie diese markieren i) möglichst wenige Restriktionssites tragenConstruction of molecules of the form osxe, where x can assume all byte values between 0 and 255, s describes byte positions and o and e are intended for concatenating single bytes to multibytes (see Figure 29 and Figure 30). Restriction sites are used as variables to simplify the manufacturing process. In addition, the nucleic acids used must have logical, physical, chemical and biological properties. In particular, they must / should be easy to reproduce, be easy to read and interact with biological sequences in a defined manner. For this purpose, data-representative nucleic acids are defined in such a way that a) they represent bytes b) they can also represent more complex data structures (multibytes) c) individual bytes can be linked to form multibytes d) they can be read with a biochip e) they can be used to produce 1 byte and multibyte biochips can be used f) individual bytes and multibytes can be reproduced with PCR g) can be cloned h) can be linked to other nucleic acids in such a way that they mark them i) carry as few restriction sites as possible
a) Damit die datenrepräsentierenden Nukleinsäuren Bytes darstellen können, müssen genau 256 eindeutige Sequenzen alle Werte eines Bytes repräsentieren. Dazu enthalten die molekularen Bytes eine eindeutige Sequenz x, von der es 256 verschiedene Allele gibt. Diese Allele werden als x0 bis x255 bezeichnet und enumerieren genau alle Bytewerte (x0 =a) So that the data-representing nucleic acids can represent bytes, exactly 256 unique sequences must represent all values of a byte. For this purpose, the molecular bytes contain a unique sequence x, of which there are 256 different alleles. These alleles are called x 0 to x 255 and enumerate exactly all byte values (x 0 =
0, xi = 1 x255 = 255) (siehe Abbildung 25, Abbildung 26, Abbildung 27, Abbildung 28 und Sequenzprotokoll). b) Um komplexere Datenstrukturen (Multibytes) wie z.B. 32-Bit Zahlen und Strings darstellen zu können, werden die Bytemoleküle so konstruiert, daß sie mit einer Positionsinformation versehen werde. Diese ist in Form der Sequenz s enthalten (siehe Abbildung 25,0, xi = 1 x 255 = 255) (see Figure 25, Figure 26, Figure 27, Figure 28 and sequence listing). b) In order to be able to represent more complex data structures (multibytes) such as 32-bit numbers and strings, the byte molecules are constructed in such a way that they are provided with position information. This is contained in the form of the sequence s (see Figure 25,
Abbildung 26, Abbildung 27, Abbildung 28 und Sequenzprotokoll). Jede Position ist durch eine eindeutige Sequenz S| dargestellt. Mit den verschiedenen Allelen von s werden dann alle Bytepositionen enumeriert (s0 = Position 0, s-i = Position 1 , ... usw.). c) Obwohl es im Prinzip zur Darstellung von Multibytes ausreicht, die darzustellenden Daten auf unabhängige Bytes mit den entsprechenden Positionsinformationen zu verteilen (als mehrsträngige Multibytes: z.B. können, um einen Lack mit einer 4 Byte langen Seriennummer zu versehen, 4 einzelne Bytes die jeweils genau eine Positionsinformation von s0 bis s3 besitzen unabhängig voneinander in den Lack gemischt werden), ist es manchmal zweckmäßig, Bytes direkt zu einsträngigen Multibytes zu verknüpfen. Dazu tragen die Bytes die Sequenzen o und e (siehe Abbildung 25 bis Abbildung 28 undFigure 26, Figure 27, Figure 28 and sequence listing). Each position is identified by a unique sequence S | shown. All byte positions are then enumerated with the different alleles of s (s 0 = position 0, si = position 1, ... etc.). c) Although it is sufficient to display multibytes, it is sufficient to distribute the data to be displayed on independent bytes with the corresponding position information (as multi-stranded multibytes: for example, to provide a varnish with a 4-byte serial number, 4 individual bytes each exactly have position information from s 0 to s 3 mixed independently of each other in the paint), it is sometimes useful to link bytes directly to single-stranded multibytes. The bytes have the sequences o and e (see Figure 25 to Figure 28 and
Sequenzprotokoll), mit denen sie sich durch Ligation oder overlap assembly und PCR zu einsträngigen Multibytes verknüpfen lassen (siehe Abbildung 29 und Abbildung 30). Diese einstängigen Multibytes können dann ihrerseits als Marker verwendet werden. Im Falle des parallel overlap assembly werden die einzelnen Bytes mit einem geeigneten Restriktionsenzym (hier: EcoRV siehe Abbildung 28) ausgeschnitten. d) Datenrepräsentierende Nukleinsäuren können z.B. mithilfe von Sequenzierern gelesen werden. Damit sie jedoch möglichst einfach und schnell gelesen werden können, ist insbesondere vorgesehen, sie mithilfe von Biochips zu lesen. Dazu werden Biochips hergestellt, die alle 256 verschiedenen x-Sequenzen einzelsträngig (und damit alle Bytewerte) aufsteigend geordnet enthalten (siehe Abbildung 32 und Abbildung 33). Solchermaßen hergestellte Biochips sind ebenfalls Gegenstand der vorliegendenSequence listing) that they can use through ligation or overlap assembly and PCR have single-stranded multibytes linked (see Figure 29 and Figure 30). These single-string multibytes can then be used as markers. In the case of the parallel overlap assembly, the individual bytes are cut out with a suitable restriction enzyme (here: EcoRV see Figure 28). d) Data-representative nucleic acids can be read using sequencers, for example. However, in order that they can be read as simply and quickly as possible, it is particularly intended to read them using biochips. For this purpose, biochips are produced that contain all 256 different x-sequences in single-stranded order (and thus all byte values) in ascending order (see Figure 32 and Figure 33). Biochips produced in this way are also the subject of the present invention
Erfindung. Das Auslesen eines bestimmten Bytewertes x, erfolgt dann durch Denaturieren des entsprechenden Datenmoleküls zu Einzelsträngen und Hybridisieren mit dem Chip. Dabei werden die hybridisierten Sequenzen analog der typischen Funktionsweise von Biochips markiert, z.B. durch Fluoreszenzmarkierung. Nach dem Hybridisieren von Datenmolekül mit einem 1 -Byte Chip enthält man dadurch genau eine markierte Position auf dem Biochip, die damit genau den Bytewert bezeichnet (siehe Abbildung 36). Z.B. hybridisiert das Datenmolekül, das die Sequenz x192 trägt, genau an der Position 192 im Chip, und kann anhand der Position innerhalb des Chips identifiziert werden. e) Da das Prinzip des Auslesens von Datenmolekülen mithilfe des Biochips auf der Hybridisierung komplementärer Sequenzen beruht, werden die Bytes so konstruiert, daß sie gleichzeitig zur Herstellung der entsprechenden Biochips dienen können. Dazu tragen die Bytemoleküle enzymatische Restriktionssites, so daß aus einem vollständigen Bytemolekül entweder die x enthaltende Subsequenz oder die s und x enthaltende Subsequenz ausgeschnitten werden können. Diese Subsequenzen werden dann denaturiert und auf einen Chipträger gespottet. Um einen 1 -Byte Chip herzustellen werden alle 256 x-Sequenzen aufsteigend geordnet auf den Chip aufgetragen. Dadurch ist es möglich, eine Sequenz mit vorher unbekanntem x anhand iherer Hybridisierungsposition zu identifizieren. Verwendet man nur die x Subsequenz für die Herstellung des 1 -Byte Chips, so enthält man als X-Chips bezeichnete Chips (siehe Abbildung 32), verwendet man die s und x enthaltende Subsequenz, so erhält man die als SX-Chips bezeichneteInvention. A specific byte value x is then read out by denaturing the corresponding data molecule into single strands and hybridizing with the chip. The hybridized sequences are labeled analogously to the typical functioning of biochips, for example by fluorescent labeling. After the data molecule has been hybridized with a 1-byte chip, this contains exactly one marked position on the biochip, which thus precisely denotes the byte value (see Figure 36). For example, the data molecule that carries the sequence x 192 hybridizes exactly at position 192 in the chip and can be identified on the basis of the position within the chip. e) Since the principle of reading out data molecules using the biochip is based on the hybridization of complementary sequences, the bytes are constructed in such a way that they can simultaneously serve to produce the corresponding biochips. For this purpose, the byte molecules carry enzymatic restriction sites, so that either the sub-sequence containing x or the sub-sequence containing s and x can be cut out of a complete byte molecule. These sub-sequences are then denatured and spotted on a chip carrier. In order to produce a 1-byte chip, all 256 x sequences are applied to the chip in ascending order. This makes it possible to identify a sequence with previously unknown x based on its hybridization position. If you only use the x sub-sequence for the production of the 1-byte chip, you contain chips called X-chips (see Figure 32), if you use the sub-sequence containing s and x, you get the ones called SX chips
Chips (siehe Abbildung 33). Sowohl X- als auch SX-Chips können auch zu Multibyte Chips kombiniert werden. Eine weitere Voraussetzung für das Herstellen von Biochips ist die Verfügbarkeit ausreichender Mengen von Sequenzen. Dazu kann man die Bytemoleküle entweder direkt mit Oligosynthesizem herstellen, sie klonieren oder aus wenigen Template-Molekülen mit PCR vervielfältigen. f) Um gezielt einzelne Bytes (z.B. aus einsträngigen Multibytes) zu vervielfältigen, können die als o, s, und e bezeichneten Subsequenzen als priming sites dienen (siehe Abbildung 25, Abbildung 26, Abbildung 27, Abbildung 28). g) Um klonierbar zu sein tragen die Bytemoleküle sticky ends die zu Restriktionssites kompatibel sind (z.B. Xhol und Xbal, siehe Abbildung 28). h) Damit Bytes und Multibytes leichter mit beliebigen Nukleinsäuren verknüpft werden können, können entweder durch Ligation oder durch overlap assembly und PCR weitereChips (see Figure 33). Both X and SX chips can also be combined to form multibyte chips. Another requirement for the production of biochips is the availability of sufficient quantities of sequences. To this end, the byte molecules can either be produced directly with oligosynthesizem, cloned or duplicated from a few template molecules using PCR. f) In order to specifically reproduce individual bytes (e.g. from single-stranded multibytes), the sub-sequences designated as o, s, and e can serve as priming sites (see Figure 25, Figure 26, Figure 27, Figure 28). g) To be clonable, the byte molecules carry sticky ends that are compatible with restriction sites (eg Xhol and Xbal, see Figure 28). h) To make it easier to link bytes and multibytes with any nucleic acids, more can be done either by ligation or by overlap assembly and PCR
Terminatoren (Adaptoren) an Bytes und Multibytes angehängt werden (siehe AbbildungTerminators (adapters) are attached to bytes and multibytes (see figure
29 und Abbildung 30). Diese Adaptoren tragen dazu Restriktionssites oder Rekombinationssites, so daß sie entweder durch Restriktion und Ligation oder durch29 and Figure 30). For this purpose, these adapters carry restriction sites or recombination sites, so that they either by restriction and ligation or by
Rekombination mit anderen Nukleinsäuren verknüpft werden können. Dies ist insbesondere zur Kennzeichnung von Nukleinsäuren, insbesondere Genen vorteilhaft. i) Im Zusammenhang mit der Verknüpfung von Bytes und Multibytes mit anderenRecombination can be linked to other nucleic acids. This is particularly advantageous for labeling nucleic acids, especially genes. i) In connection with the linking of bytes and multibytes with others
Nukleinsäuren ist es vorteilhaft, daß insbesondere Multibytes nur wenige Restriktionssites tragen, damit der Verwender von Nukleinsäuren die mit Bytes und Multibytes versehen sind, möglichst wie gewohnt damit arbeiten kann und möglichst auf keine Restriktionssites verzichten muß, die ansonsten die Bytes zerstören. Daher sind die Bytes so konstruiert, daß nach der Herstellung von einsträngigen Multibytes von allen Restriktionssites, die aufIt is advantageous for nucleic acids that, in particular, multibytes carry only a few restriction sites, so that the user of nucleic acids which are provided with bytes and multibytes can work with them as usual as possible and, if possible, does not have to do without restriction sites which would otherwise destroy the bytes. Therefore, the bytes are constructed so that after the production of single-stranded multibytes from all restriction sites that are on
Sequenzpalindromen der Länge 6 beruhen nur noch die Restriktionssites Aflll, Nhel und Ncol in den Multibytes enthalten sind und daher nicht ohne weiteres z.B. für mit Multibytes markierte Nukleinsäuren verwendet werden können. Ggfs. lassen sich sogar die noch verbleibenden Restriktionssites aus den Bytes und Multibytes entfernen ohne die Byte undSequence palindromes of length 6 are based only on the restriction sites Aflll, Nhel and Ncol in the multibytes and therefore not easily e.g. can be used for nucleic acids labeled with multibytes. If necessary. you can even remove the remaining restriction sites from the bytes and multibytes without the bytes and
Positionsinformationen zu verlieren, indem man Multibytes mit PCR und mutiertenLosing position information by using PCR and mutated multibytes
Primern so vervielfältigt, daß die Restriktionssites blockiert werden.Primers reproduced in such a way that the restriction sites are blocked.
Erläuterung zu 2:Explanation to 2:
Die zur Implementierung benötigten Sequenzen werden mithilfe des bereits beschriebenen NFR-Verfahrens synthetisiert. Die Sequenzen sind so konstruiert, daß alle Sequenzen untereinander möglichst unähnlich sind. Die x-Subsequenzen haben einen GC-Anteil von 50%, die o-, s- und e-Sequenzen haben einen GC-Anteil von 66%, Multibytes enthalten 3 Sequenzpalindrome der Länge 6, die jeweils einmal von Aflll, Nhel und Ncol erkannt werden.The sequences required for implementation are synthesized using the NFR method already described. The sequences are constructed in such a way that all sequences are as dissimilar as possible. The x-sub-sequences have a GC portion of 50%, the o-, s- and e-sequences have a GC portion of 66%, multibytes contain 3 sequence palindromes of length 6, each recognized once by Aflll, Nhel and Ncol become.
Erläuterung zu 3: Die Bytemoleküle können direkt mit Hilfe eines Oligosynthesizers hergestellt werden. Um größere Mengen von Bytemolekülen herzustellen ist es jedoch oft zweckmäßig, eine Klonbibliothek anzulegen, die alle Bytemoleküle enthält. Erläuterung zu 4: Bytes können aufgrund der enthaltenen Bytepositionsinformation auch ohne direkt miteinander verknüpft zu werden Multibytes darstellen (logische Verknüpfung zu mehrsträngigen Multibytes). Es ist jedoch für einige Anwendungen, z.B. die Kennzeichnung von Nukleinsäuresträngen zweckmäßig, die einzelnen Bytes auch physikalisch zu einem Multibyte zu verknüpfen (einsträngiges Multibyte, siehe Abbildung 30 und Abbildung 31). Dazu werden die einzelnen Bytes entweder durch Ligation oder durch overlap assembly und PCR miteinander verknüpft. Erläuterung zu 5: Biochips zum Lesen von Bytes und Multibytes werden mit Untereinheiten der Moleküle hergestellt, die als Bytes fungieren. Grundsätzlich gibt es zumindest 2 Architekturen: den X-Chip (siehe Abbildung 32), der mit x- Subsequenzen (siehe Abbildung 25 bis Abbildung 28) und den SX-Chip (siehe Abbildung 33), der mit sx-Subsequenzen (siehe Abbildung 25 bis Abbildung 28) hergestellt wird. Beide Chips sind 1 -Byte Chips und können zu Multibyte Chips kombiniert werden. Die prinzipielle Funktionsweise ist ähnlich: Das Auslesen der Information von Datenmolekülen erfolgt durch Hybridisieren mit dem Chip. Anhand der Hybridisierungsposition des Datenmoleküls läßt sich sein Bytewert ablesen. Dadurch wird es auch möglich, Multibyte Chips als Datenspeicher (ROM und RAM) zu verwenden: Das Hybridisieren des Chips mit einem spezifischen Datenmolekül entspricht dem Zuweisen eines Wertes an eine Speicherzelle. Durch Denaturieren (z.B. über Temperaturerhöhung oder pH-Wert Änderung) wird die Speicherzelle wieder gelöscht. Darüber hinaus können spezifische Sequenzen die mit dem Chip hybridisiert werden auch mit optisch aktiven Molekülen unterschiedlicher Farbe versehen werden, so daß sich auch gezielt Farbmuster erzeugen lassen, so daß sich Multibyte Chips auch als Display verwenden lassen. Kombiniert man Sequenzen unterschiedlicher Schmelztemperatur mit optisch aktiven Molekülen verschiedener Farbe, so kann auch eine Farbanzeige im Sinne eines Thermometers erfolgen. Der Unterschied zwischen X-Chip und SX-Chip besteht darin, daß der SX-Chip zusätzlich zum Bytewert auch die Byteposition lesen (und speichern) kann. Vorteil des X-Chip ist, daß man sehr große Multibyte-Arrays aus identischen X-Chips herstellen kann. Vorteil des SX-Chips ist, daß sich damit einsträngige Multibyte- Moleküle lesen lassen, ohne daß man die einzelnen Bytes getrennt voneinander hybridisieren müßte.Explanation of 3: The byte molecules can be produced directly using an oligosynthesizer. In order to produce larger quantities of byte molecules, however, it is often advisable to create a clone library that contains all of the byte molecules. Explanation of 4: Due to the byte position information it contains, bytes can also represent multibytes without being directly linked to each other (logical link to multi-line multibytes). However, for some applications, e.g. the labeling of nucleic acid strands, it is advisable to physically link the individual bytes to form a multibyte (single-stranded multibyte, see Figure 30 and Figure 31). For this purpose, the individual bytes are linked to one another either by ligation or by overlap assembly and PCR. Explanation of 5: Biochips for reading bytes and multibytes are produced with subunits of the molecules that act as bytes. Basically there are at least 2 architectures: the X chip (see Figure 32), the one with x sub-sequences (see Figure 25 to Figure 28) and the SX chip (see Figure 33), the one with sx sub-sequences (see Figure 25 up to Figure 28). Both chips are 1-byte chips and can be combined to form multibyte chips. The principle of operation is similar: The information from data molecules is read out by hybridization with the chip. The byte value can be read from the hybridization position of the data molecule. This also makes it possible to use multibyte chips as data storage (ROM and RAM): hybridizing the chip with a specific data molecule corresponds to assigning a value to a memory cell. The memory cell is erased again by denaturing (eg by increasing the temperature or changing the pH value). In addition, specific sequences that are hybridized with the chip can also be provided with optically active molecules of different colors, so that color patterns can also be generated in a targeted manner, so that multibyte chips can also be used as a display. If you combine sequences of different melting temperatures with optically active molecules of different colors, you can also display a color in the sense of a thermometer. The difference between the X-Chip and SX-Chip is that the SX-Chip can read (and save) the byte position in addition to the byte value. The advantage of the X chip is that very large multibyte arrays can be made from identical X chips. The advantage of the SX chip is that it can be used to read single-stranded multibyte molecules without having to hybridize the individual bytes separately.
Erläuterung zu 6: Über die Adaptoren L und R (siehe Abbildung 29 und Abbildung 30) lassen sich Sequenzen mit Bytes und Multibytes verbinden, die dazu dienen, diese mit Nukleinsäuren zu verbinden. Dazu enthalten die Adaptoren z.B. geeignete Restriktionssites oder Rekombinationssites. Z.B. läßt sich das ein Multibyte mithilfe von geeigneten Restriktionssites in einem Plasmid klonieren, wodurch dieses Plasmid eine Kennzeichnung erhält. Diese kann z.B. in einer 32-Bit Seriennummer bestehen (siehe Abbildung 31 ). Ein anderes Anwendungsbeispiel ist das Anbringen von Rekombinstionssites an ein Datenmolekül, wodurch dieses z.B. in nicht- kodierende Regionen (z.B. Introns) von Genen eingebracht werden kann, wodurch diese gekennzeichnet werden. Erläuterung zu 7: Die Information von Materialien, Gegenständen und Molekülen, die mit Datenmolekülen gekennzeichnet wurden lassen sich dadurch auslesen, daß man sie aus dem gekennzeichneten Material extrahiert, ggfs. aufreinigt, ggfs. mit PCR amplifiziert und dann entweder sequenziert oder durch Hybridisieren mit einem Byteoder Multibyte-Chip wie oben identifiziert.Explanation for 6: The adapters L and R (see Figure 29 and Figure 30) can be used to connect sequences with bytes and multibytes, which serve to connect these with nucleic acids. For this purpose, the adapters contain, for example, suitable restriction sites or recombination sites. For example, a multibyte can be cloned into a plasmid using suitable restriction sites, as a result of which this plasmid is labeled. This can consist, for example, of a 32-bit serial number (see Figure 31). Another example of application is the attachment of recombinant sites to a data molecule, which means that this can be introduced, for example, into non-coding regions (for example introns) of genes, thereby marking them. Explanation of 7: The information of materials, objects and molecules which have been labeled with data molecules can be read out by extracting them from the labeled material, if necessary purifying them, if necessary amplifying them with PCR and then either sequenced or by hybridizing with a Byte or multibyte chip as identified above.
Die oben beschriebenen Verfahren ermöglichen somit die eindeutige Kennzeichnung von organischen und anorganischen Materialien und Gegenständen sowie von Nukleinsäure-Konstrukten und Genen.The methods described above thus enable organic and inorganic materials and objects as well as nucleic acid constructs and genes to be clearly identified.
Die oben beschriebenen Verfahren ermöglichen außerdem die Herstellung von Datenspeichern und optischen Displays: Zum Zwecke der Speicherung von Computerdaten werden Multibyte-Arrays verwendet. Das Schreiben eines einzelnen Byte erfolgt durch das Hybridisieren eines 1 -Byte Chips mit einer (ggfs. optisch markierten) Nukleinsäure, die genau einmal eine definierte x-Sequenz enthält, die dem zu schreibenden Wert entspricht (z.B. x192). Das Auslesen der Daten erfolgt analog dem Auslesen biologischer DNA-Arrays, z.B. durch Scannen. Das Löschen von Daten erfolgt durch Denaturieren und ggfs. nachträgliches Waschen.The methods described above also enable the production of data memories and optical displays: multibyte arrays are used for the purpose of storing computer data. A single byte is written by hybridizing a 1-byte chip with a (possibly optically marked) nucleic acid that contains exactly once a defined x sequence that corresponds to the value to be written (eg x 192 ). The data are read out analogously to the reading of biological DNA arrays, for example by scanning. Data is deleted by denaturing and, if necessary, washing it afterwards.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung einzelner Moleküle, Nukleinsäuren und gentechnisch hergestellter oder veränderterThe methods described above enable, for example, the labeling of individual molecules, nucleic acids and genetically engineered or modified ones
Erzeugnisse:Products:
Die hier beschriebenen Logomere können zur Kennzeichnung gentechnisch hergestellter oder veränderter Erzeugnisse verwendet werden.The logomers described here can be used to label genetically engineered or modified products.
Bisher werden insbesondere zur Identifikation gentechnisch hergestellter oder veränderterSo far, genetically engineered or modified ones have been used to identify them
Erzeugnisse in Nahrungsmitteln "klassische" molekularbiologische Methoden wie PCR, Restriktionsverdau, Southernblot-Hybridisierung und Sequenzierung verwendet. Mit diesenProducts used in food "classic" molecular biological methods such as PCR, restriction digestion, Southern blot hybridization and sequencing. With these
Methoden ist jedoch eine Charakterisierung gentechnischer Erzeugnisse und Bestandteile noch sehr aufwendig und erfordert für jedes zu charakterisierende Erzeugnis eigeneMethods, however, characterizing genetic engineering products and constituents is still very complex and requires separate products for each product to be characterized
Methoden und Verfahren.Methods and procedures.
Insgesamt gibt es bisher kein universelles Kennzeichnungsverfahren für gentechnisch hergestellte Erzeugnisse. Ein solches Kennzeichnungsverfahren muß mehrere Kriterien erfüllen: die Kennzeichnung muß gesundheitlich absolut unbedenklich sein, die Kennzeichnung sollte untrennbar mit dem gekennzeichneten Produkt verbunden sein, die Kennzeichnung sollte fälschungssicher sein, die Kennzeichnung sollte genügend Informationen speichern können, die Kennzeichnung sollte in geringen Mengen nachweisbar und lesbar sein. Der Einsatz nukleinsäurebasierter Logomere zur Kennzeichnung gentechnischer Erzeugnisse erfüllt diese Kriterien und hat darüber hinaus folgende Vorzüge: - Logomere können nahezu beliebige Informationen speichern; einzelne Bestandteile können schnell und hochempfindlich nachgewiesen werden; zum Auslesen der Informationen kann eine bis ins Detail standardisierte Methode eingesetzt werden (Ausleseverfahren nach dem erfindungsgemäßen Verfahrens, dabei können standardisierte Primer verwendet werden); - die Sequenz der gesuchten Gene kann vollkommen unbekannt sein; die Sequenz der nachgewiesenen Gene kann geheim sein, ohne daß die Identifizierung oder Authentifizierung eingeschränkt ist; zusätzliche Sicherheitsmechanismen können zusätzlich durch Verschlüsselung implementiert werden.So far there is no universal labeling method for genetically engineered products. Such a labeling procedure must meet several criteria: the labeling must be absolutely harmless to health, the labeling should be inseparable from the labeled product, the labeling should be tamper-proof, the label should be able to store enough information, the label should be detectable and legible in small quantities. The use of nucleic acid-based logomers for labeling genetic engineering products fulfills these criteria and has the following advantages: - logomers can store almost any information; individual components can be detected quickly and with high sensitivity; a method that is standardized down to the last detail can be used to read out the information (reading method according to the method according to the invention, standardized primers can be used here); - The sequence of the genes sought can be completely unknown; the sequence of the genes detected can be secret without the identification or authentication being restricted; additional security mechanisms can also be implemented using encryption.
Im Einzelnen geht man zur Kennzeichnung von gentechnisch erzeugten oder veränderten Erzeugnissen beispielsweise folgendermaßen vor:Specifically, the procedure for labeling genetically engineered or modified products is as follows:
Zur Herstellung von Markern wird eine beliebige geeignete Grammatik, z.B. wie die für den Zufallszahlengenerator, das 1 -Byte Alphabet oder für Zeichenketten bereits beschriebene, verwendet. Aus den mit der Grammatik erzeugten Zeichen werden die zur Darstellung von Markern benötigten Zeichen entnommen und dem zu kennzeichnenden Erzeugnis hinzugefügt. Dazu können die als Logomere hergestellten Zeichen auf folgende Weise in das zu kennzeichnende Erzeugnis eingebracht werden: a) durch Beimischung; hierbei werden Logomere, wie in den erfindungsgemäßen Verfahren beschrieben, hergestellt, isoliert und vervielfältigt. b) durch Klonierung, wie im erfindungsgemäßen Verfahren beschrieben; Abbildung 6 zeigt z.B. die Kennzeichnung bakterieller Klone durch Logomere, die durch Verwendung der bereits beschriebenen Grammatik für den Zufallszahlengenerator hergestellt wurden. c) durch Restriktion und Ligation; hierbei werden Logomere erfindungsgemäß hergestellt, isoliert und vervielfältigt. Die solcherart gewonnenen Logomere werden jetzt durchAny suitable grammar, e.g. such as the one already described for the random number generator, the 1-byte alphabet or for character strings. The characters required for the representation of markers are taken from the characters generated with the grammar and added to the product to be labeled. For this purpose, the characters produced as logomers can be introduced into the product to be labeled as follows: a) by admixture; here logomers are produced, isolated and reproduced as described in the method according to the invention. b) by cloning, as described in the process according to the invention; Figure 6 shows e.g. the identification of bacterial clones by logomers, which were produced using the grammar already described for the random number generator. c) by restriction and ligation; Here, logomers are produced, isolated and reproduced according to the invention. The logomers obtained in this way are now through
Restriktion und Ligation mit der zu kennzeichnenden Nukleinsäure verbunden. Dazu können die oben beschriebenen Terminatoren (siehe Abbildung 2) und Adaptoren (siehe Abbildung 30) gewünschte Restriktionssites tragen. d) durch den Einsatz rekombinativer Techniken; hierbei werden Logomere erfindungsgemäß hergestellt, isoliert und vervielfältigt. Die solcherart gewonnenen Logomere werden jetzt durch den Einsatz rekombinativer Techniken in das zu kennzeichnende Erzeugnis eingebracht. Dazu kann z. B. die Methoden des Gene-Targeting durch homologe Rekombination [Capecchi M.R., Altering the genome by homologous recombination. Science, 244(4910), 1288-1292, (1989)] oder z.B. das Cre-loxP System [Kilby, N. J., Snaith, M. R. & Murray, J. A., Site-specific recombinases: tools for genome engineering,Restriction and ligation associated with the nucleic acid to be labeled. For this purpose, the terminators described above (see Figure 2) and adapters (see Figure 30) can carry the desired restriction sites. d) through the use of recombinant techniques; Here, logomers are produced, isolated and reproduced according to the invention. The logomers obtained in this way are now introduced into the product to be labeled using recombinant techniques. For this, e.g. B. the methods of gene targeting by homologous recombination [Capecchi M.R., Altering the genome by homologous recombination. Science, 244 (4910), 1288-1292, (1989)] or e.g. the Cre-loxP system [Kilby, N.J., Snaith, M.R. & Murray, J.A., Site-specific recombinases: tools for genome engineering,
Trends Genet., 9, 413-421 , (1993)] verwendet werden. Z.B. können erfindungsgemäß erhaltene Logomere mit Hilfe dieser Techniken vor oder hinter eine bestimmte Nukleinsäuresequenz (Gen) gesetzt werden, die sie bezeichnen sollen. In diesem Falle wird ein Logomer gewissermaßen als "Etikett" an ein gentechnisches Produkt "angeheftet" und kann Auskunft über Hersteller, Produktgruppe, Gefahrenklasse, Verfallsdatum o.a. geben (siehe Abbildung 15).Trends Genet., 9, 413-421, (1993)] can be used. For example, according to the invention obtained logomers with the aid of these techniques are placed in front of or behind a specific nucleic acid sequence (gene) which they are intended to denote. In this case, a logomer is "attached" to a genetic product as a kind of "label" and can provide information about the manufacturer, product group, hazard class, expiry date or the like (see Figure 15).
Das Verfahren eigent sich insbesondere zur Kennzeichnung einzelner Moleküle, insbesondere einzelner Nukleinsäuren, besonders bevorzugt einzelner Gene.The method is particularly suitable for labeling individual molecules, in particular individual nucleic acids, particularly preferably individual genes.
Das Verfahren eignet sich z.B. für alle Organismen (Mikroorganismen, Pflanzen, Tiere). Z.B. lassen sich Klone von Mikroorganismen oder Pflanzen kennzeichnen. Das Verfahren eignet sich auch für die Kennzeichnung von Lebensmitteln und für die Kennzeichnung von Rindern zur Bekämpfung der Rinderseuche BSE.The method is suitable e.g. for all organisms (microorganisms, plants, animals). For example, clones of microorganisms or plants can be labeled. The method is also suitable for labeling food and for labeling cattle to combat BSE disease.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung von NahrungsmittelnFor example, the methods described above enable food to be labeled
Aufgrund von Krankheiten, Seuchen oder Kontaminationen können Nahrungsmittel gesundheitsschädlich oder gefährlich sein. Beispiele sind Krankheiten wie BSE, Schweinepest, Salmonellenvergiftungen. Es kann wünschenswert sein, Produkt und Hersteller identifizieren zu können, um notfalls bestimmte Produkte und Produktreihen umgehend aus dem Handel zu nehmen, untersuchen zu können und geeignete Gegenmaßnahmen zu ergreifen. Für hochsensible Erzeugnisse wie Nahrungsmittel gelten dabei die Kriterien für die Kennzeichnung gentechnischer Erzeugnisse insbesondere (siehe: Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung einzelner Moleküle, Nukleinsäuren und gentechnisch hergestellter oder veränderter Erzeugnisse).Due to illnesses, epidemics or contamination, food can be harmful or dangerous. Examples are diseases such as BSE, swine fever, salmonella poisoning. It may be desirable to be able to identify the product and manufacturer in order to be able to immediately take certain products and product series out of the market, to examine them and to take appropriate countermeasures. For highly sensitive products such as food, the criteria for labeling genetic engineering products apply in particular (see: The methods described above enable, for example, the labeling of individual molecules, nucleic acids and genetically engineered or modified products).
Insgesamt gibt es auch für gentechnisch hergestellte Nahrungsmittel bisher kein universelles Kennzeichnungsverfahren. Bisher ist die Identifikation gentechnisch hergestellter oder veränderter Bestandteile in Nahrungsmitteln daher noch schwierig und aufwendig. Es werden dazu "klassische" molekularbiologische Methoden wie PCR, Restriktionsverdau, Southernblot- Hybridisierung und Sequenzierung verwendet, um diese Erzeugnisse zu charakterisieren. Aufgrund der Rinderseuche BSE wurde speziell für die Kennzeichnung von Rindern und deren Produkten (Rindfleisch und Milch) ein immunologisches Kennzeichnungsverfahren vorgeschlagen, das auf der Immunisierung der zu markierenden Tiere mit spezifischen Proteinen basiert ("Ohrmarke im Blut soll BSE Rinder aufspüren", Süddeutsche Zeitung Nr. 283, 08.12.1998, Seite v2/9). Durch die dadurch verursachte Produktion spezifischer Antikörper im jeweils gekennzeichneten Zieltier, die mutmaßlich in allen Geweben nachzuweisen ist, kann die Kennzeichnung über einen Immun-Assay (ELISA) wieder gelesen werden. Ein solches Verfahren ist jedoch prinzipiell auf höhere Wirbeltiere beschränkt. Außerdem ist die für das Verfahren verfügbare Informationsmenge sehr begrenzt, die informationstragenden Proteine sind nicht hitzebeständig und das Verfahren erfordert vergleichsweise hohe Mengen Substanz für Immunisierung und Nachweisreaktion.Overall, there is no universal labeling procedure for genetically engineered foods. So far, the identification of genetically engineered or modified components in food has therefore been difficult and time-consuming. "Classic" molecular biological methods such as PCR, restriction digestion, Southern blot hybridization and sequencing are used to characterize these products. Due to the BSE epidemic, an immunological labeling process was proposed specifically for the labeling of cattle and their products (beef and milk), which is based on the immunization of the animals to be labeled with specific proteins ("ear tags in the blood should detect cattle BSE", Süddeutsche Zeitung Nr 283, 08.12.1998, page v2 / 9). As a result of the production of specific antibodies in the identified target animal, which can presumably be detected in all tissues, the identification can be read again using an immunoassay (ELISA). In principle, however, such a method is limited to higher vertebrates. In addition, the amount of information available for the process is very limited Proteins carrying information are not heat-resistant and the method requires comparatively large amounts of substance for immunization and detection reaction.
Auch im Fall von Nahrungsmitteln können Logomere auf Nukleinsäurebasis, wie bereits unter Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung einzelnerIn the case of foodstuffs too, logomers based on nucleic acids, as already described under The methods described above, allow, for example, the labeling of individual
Moleküle, Nukleinsäuren und gentechnisch hergestellter oder veränderter Erzeugnisse beschrieben, zur Kennzeichnung eingesetzt werden. Logomere können dabei Informationen über Hersteller, Verfallsdatum, Seriennummer u.a. enthalten. Das Verfahren zurMolecules, nucleic acids and genetically engineered or modified products described can be used for labeling. Logomers can provide information about the manufacturer, expiry date, serial number, etc. contain. The procedure for
Kennzeichnung von Nahrungsmitteln ist dabei dasselbe, wie bereits unter Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung einzelner Moleküle,Labeling of food is the same as already under The methods described above enable, for example, the labeling of individual molecules,
Nukleinsäuren und gentechnisch hergestellter oder veränderter Erzeugnisse beschrieben. Mithilfe der dort aufgeführten gentechnischen Rekombinations- undNucleic acids and genetically engineered or modified products described. With the help of the recombinant and
Klonierungstechniken können einzelne Organismen gekennzeichnet werden, sodaß ein einzelner Organismus sowie alle seine Nachfahren identifizierbar sind. Das Kennzeichnungsverfahren durch Logomere ermöglicht dadurch: ein Monitoring des Zielproduktes über den gesamten Herstellungs- undCloning techniques can be used to identify individual organisms so that a single organism and all of its descendants can be identified. The labeling process using logomers thus enables: monitoring of the target product across the entire manufacturing and
Verarbeitungsprozesses bis zum Endverbraucher, eine einheitliche, schnelle und einfache Identifikation einzelner Bestandteile.Processing to the end user, a uniform, quick and easy identification of individual components.
Als Beimischung eignen sich Logomere auf Nukleinsäurebasis zur Kennzeichnung von Getränken.As an admixture, logomers based on nucleic acids are suitable for labeling beverages.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Kennzeichnung medizinischer und pharmazeutischer ProdukteThe methods described above enable, for example, the labeling of medical and pharmaceutical products
Aufgrund der Nichttoxizität eignen sich Logomere auf Nukleinsäurebasis zur Kennzeichnung sensibler und hochsensibler Erzeugnisse. Neben Nahrungsmitteln sind dies auch medizinische und pharmazeutische Produkte. Um Verwechselungen, Kontaminationen und Fälschungen ausschließen zu können, können Logomere z.B. medizinischen und pharmazeutischen Produkten beigemischt werden.Due to the non-toxicity, logomers based on nucleic acids are suitable for labeling sensitive and highly sensitive products. In addition to food, these are also medical and pharmaceutical products. In order to avoid confusion, contamination and counterfeiting, logomers can e.g. medical and pharmaceutical products.
Der Vorteil der Kennzeichnung durch Logomere ist dabei, daß die Kennzeichnung unmittelbar mit dem gekennzeichneten Erzeugnis verbunden ist und daß sich Erzeugnisse z.B. individuell kennzeichnen lassen. Auf diese Weise ist ein Monitoring des Herstellungsprozesses möglich, Erzeugnisse lassen sich auch nach mehrmaligem Umfüllen eindeutig identifizieren und Kontaminationen sowie das Poolen von Proben können nachgewiesen werden. Mithilfe von Logomeren läßt sich z.B. im Falle von Blutkonserven Herstellungs- und Verfallsdatum, Blutgruppe und Hersteller kennzeichnen. Die oben beschriebenen Verfahren ermöglichen beispielsweise Authentifizierung und FälschungssicherungThe advantage of labeling with logomers is that the label is directly linked to the labeled product and that products can be individually labeled, for example. In this way, the manufacturing process can be monitored, products can be clearly identified even after repeated decanting, and contamination and pooling of samples can be detected. With the help of logomers, for example in the case of preserved blood, the date of manufacture and expiry, blood group and manufacturer can be identified. The methods described above enable authentication and counterfeit protection, for example
Logomere können zur Authentifizierung von Erzeugnissen, Gegenständen und Geräten verwendet werden. Dazu werden Logomere vorzugsweise erfindungsgemäß erzeugt und vervielfältigt.Logomeres can be used to authenticate products, objects and devices. For this purpose, logomers are preferably generated and reproduced according to the invention.
Werden solcherart erhaltene Logomere auf Erzeugnisse, Gegenstände und Geräte an-/ aufgebracht oder zugemischt, so können die in Logomeren enthaltenen erfindungsgemäß jederzeit wieder ausgelesen werden. Sollten zur Erzeugung der Logomere Verschlüsselungstechniken verwendet werden, wie bereits beschrieben, so erfordert das Auslesen autorisierten Zugriff.If logomers obtained in this way are applied / applied or mixed to products, objects and devices, the logomers contained in logomers can be read out again at any time according to the invention. If encryption techniques are used to generate the logomeres, as already described, the readout requires authorized access.
Beispielsweise können erfindungsgemäß erhaltene Logomere in wässriger Lösung (vorzugsweise zu 103 bis 1018 Molekülen/μl) unmittelbar zur Kennzeichnung auf Dokumente aufgebracht werden. Als solches können sie als Echtheitszertifikat des solcherart markierten Dokumentes dienen. Zum Auslesen der als Kennzeichner dienenden Logomere wird einfach ein kleines Schnipsel des Papiers (1 mm2 ist ausreichend) als Template einer erfindungsgemäßen PCR-Auslesereaktion verwendet. Ein Beispiel findet sich in Abbildung 16. In dem zugrundeliegenden Ausleseexperiment wurde zum Test des Prinzips ein Logomer in wässriger Lösung in ca. 109 Molekülen/μl auf 3M Postlt Papier ca. 1 Stunde getrocknet und 1mm2 des Post-Its als Template einer Auslese-PCR verwendet. Es können Dokumente beliebiger Papierqualität verwendet werden, z.B. 80g/m2 Standardkopierpapier. Dasselbe Verfahren eignet sich auch zur Kennzeichnung von Geld oder Geldscheinen, wobei hier Vorteile darin bestehen, auch bereits gedruckte Scheine markieren zu können, - Seriennummern vergeben zu können, Verschlüsselung einzusetzen.For example, logomers obtained according to the invention can be applied in aqueous solution (preferably at 10 3 to 10 18 molecules / μl) directly to documents for identification. As such, they can serve as a certificate of authenticity for the document marked in this way. To read out the logomers used as identifiers, a small snippet of paper (1 mm 2 is sufficient) is used as a template for a PCR readout reaction according to the invention. An example can be found in Figure 16. In the underlying readout experiment, a logomer was dried in aqueous solution in approx. 10 9 molecules / μl on 3M Postlt paper for approx. 1 hour and 1mm 2 of the post-its as a template for a readout to test the principle -PCR used. Documents of any paper quality can be used, eg 80g / m 2 standard copy paper. The same procedure is also suitable for the identification of money or banknotes, with the advantages here being that markings that have already been printed can also be marked, - serial numbers can be assigned, encryption can be used.
Um Dokumente möglichst in Echtzeit auf Authentizität prüfen zu können, kann einer der zum Auslesen in der PCR benutzten Primer auch als Hybridisierungsonde für eine nachfolgende Färbe-Nachweisreaktion (z.B. mit einem interkalierenden Farbstoff, z.B. Ethidiumbromid) verwendet werden.In order to be able to check documents for authenticity in real time if possible, one of the primers used for reading in the PCR can also be used as a hybridization probe for a subsequent staining detection reaction (e.g. with an intercalating dye, e.g. ethidium bromide).
Ein weiteres Beispiel ist die Authentifizierung flüssiger Lösungen, Suspensionen und Emulsionen mit Logomeren. So kann etwa Tinte mit Logomeren individuell markiert werden, so daß Unterschriften damit auf Echtheit überprüft werden können. Ein weiteres Beispiel ist die Kennzeichnung von Automobilen durch das Versetzen des Autolackes mit Logomeren. Dabei werden Logomere dem Autolack (oder anderen Bestandteilen des KFZ) als Beimischung zugesetzt. Die zugesetzten Logomere können dabei Informationen über Seriennummer, Hersteller, Fahrzeugtyp o.a. Angaben enthalten. Aufgrund dieser Informationen kann im Falle von Unfall, Diebstahl oder illegaler Entsorgung ein Fahrzeug identifiziert werden. Ein Vorteil der hier beschriebenen Methode liegt darin, daß schon Lackspuren zur Identifikation des Fahrzeuges ausreichen, was insbesondere bei Unfällen von Interesse sein kann. Ein weiterer Vorteil ist, daß die Identität eines Fahrzeuges nur sehr aufwendig zu fälschen ist. Dazu müßten erstens alle gekennzeichneten Bestandteile entfernt, zweitens eine gefälschte Identität eingerichtet werden. Dieses Unterfangen ist alleine durch den mechanischen Aufwand sehr schwierig, außerdem läßt sich durch den Einsatz kryptografischer Methoden das Nachmachen und Nachahmen von Kennungen beliebig erschweren. Zum Auslesen der als Logomere enthaltenen Informationen, werden dieAnother example is the authentication of liquid solutions, suspensions and emulsions with logomers. For example, ink can be individually marked with logomers so that signatures can be checked for authenticity. Another example is the labeling of automobiles by adding logomeres to the car paint. Here, logomers are added to the car paint (or other components of the vehicle) as an admixture. The added logomers can contain information about the serial number, manufacturer, vehicle type or the like. Based on this information, a vehicle can be identified in the event of an accident, theft or illegal disposal. An advantage of the method described here is that traces of paint are sufficient to identify the vehicle, which is particularly the case with Accidents may be of interest. Another advantage is that the identity of a vehicle is very difficult to falsify. First of all, all marked components would have to be removed, secondly, a fake identity had to be established. This endeavor is very difficult due to the mechanical effort alone, and the use of cryptographic methods can make it difficult to copy and imitate identifiers. To read out the information contained as logomers, the
Logomere aus dem Lack isoliert und können dann wie in der Beschreibung zum Auslesen der in Logomeren enthaltenen Information, vorzugsweise durch PCR, ausgelesen werden. Dazu wird eine Probe des Lackes entnommen, mit einem geeigneten Lösungsmittel (Terpentin o.a.) gelöst und mit gleichem Volumen Wasser versetzt. Durch nachfolgende Zentrifugation werden hydrophile und hydrophobe Bestandteile getrennt. Daraufhin nimmt man die wässrige Phase auf (worin sich die hydrophilen nukleinsäurebasierten Logomere befinden) und fällt die enthaltenen Logomere nach den üblichen Methoden (z.B. wie in [J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)] beschrieben). Nach der Fällung können die erhaltenen Logomere nach den erfindungsgemäßen Verfahren, z.B. durch Auslese-PCR, ausgelesen werden.Logomers isolated from the lacquer and can then be read out, as in the description, for reading out the information contained in logomers, preferably by PCR. For this purpose, a sample of the paint is taken, dissolved with a suitable solvent (turpentine or similar) and mixed with the same volume of water. Subsequent centrifugation separates hydrophilic and hydrophobic components. The aqueous phase is then taken up (in which the hydrophilic nucleic acid-based logomers are located) and the logomers contained are precipitated by the customary methods (for example as in [J. Sambrook, EF Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989 )] described). After the precipitation, the logomers obtained can be processed by the processes according to the invention, e.g. by readout PCR.
Daher sind weitere Gegenstände der vorliegenden Erfindung die Verwendungen informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zum Zwecke der Qualitätssicherung, der Fälschungssicherung, der Kennzeichnung von Lebensmitteln, der Kennzeichnung gentechnischer, chemischer, medizinischer und pharmazeutischer Erzeugnisse, der Kennzeichnung von Organismen, der Kennzeichnung von Dokumenten, der Kennzeichnung von Geld, der Kennzeichnung von Gegenständen und Maschinen, der Kennzeichnung von Lösungen, Suspensionen und Emulsionen sowie der Authentifizierung von Personen und Gegenständen.Therefore, the present invention furthermore relates to the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for the purpose of quality assurance, counterfeit protection, labeling of foods, labeling of genetic engineering, chemical, medical and pharmaceutical products, labeling of organisms, labeling of documents, the marking of money, the marking of objects and machines, the marking of solutions, suspensions and emulsions as well as the authentication of people and objects.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung von MolekulargewichtsstandardsThe methods described above enable, for example, the production of molecular weight standards
Zu den typischen Verfahren der molekularbiologischen Analytik gehört die elektrophoretische Längenauftrennung von DNA- und RNA-Fragmenten. Um die Länge solcher Fragmenten bei der Elektrophorese zu bestimmen, verwendet man üblicherweise einen Molekulargewichtsstandard ("Leiter"), der Fragmente bekannter Länge enthält und zum Vergleich mit den Fragmenten der zu analysierenden Proben dient.The typical methods of molecular biological analysis include the electrophoretic length separation of DNA and RNA fragments. In order to determine the length of such fragments in electrophoresis, a molecular weight standard (“ladder”) is usually used, which contains fragments of known length and is used for comparison with the fragments of the samples to be analyzed.
Bisher gibt es Molekulargewichtsstandards, die entweder unregelmäßige Leitern enthalten (z.B. Boehringer V, Boehringer Mannheim, Katalog Nr.: 821 705) oder regelmäßige Leitern mit regelmäßigen Fragment-Längenabständen (z.B. 50bp Leiter Gibco BRL, Life Technologies, Katalog Nr. 10416-014). Keine der bisherigen Leitern hat dabei kürzere Längenabstände als 10bp (z.B. 10bp Leiter Gibco BRL, Life Technologies, Katalog Nr. 10821-015). Mit den hier beschriebenen Verfahren können gezielt DNA Fragmente verschiedener Länge und definierter Längenabstände hergestellt werden. Diese Fragmente können alsSo far there have been molecular weight standards that either contain irregular conductors (e.g. Boehringer V, Boehringer Mannheim, catalog no .: 821 705) or regular conductors with regular fragment-length spacings (e.g. 50bp conductor Gibco BRL, Life Technologies, catalog no. 10416-014) . None of the previous conductors has shorter distances than 10bp (e.g. 10bp Gibco BRL, Life Technologies, Catalog No. 10821-015). With the methods described here, DNA fragments of different lengths and defined length spacings can be produced in a targeted manner. These fragments can be used as
Molekulargewichtsstandards genutzt werden, wobei das Verfahren erlaubt, prinzipiell beliebigeMolecular weight standards are used, the method allowing, in principle, any
Längen und beliebige Längenabstände zu realisieren. Insbesondere sind Längenabstände bis hinab zu 1 bp Abstand, also Molekulargewichtsstandards höchster Auflösung, möglich.Realize lengths and any length distances. In particular, length spacings down to 1 bp spacing, ie molecular weight standards of the highest resolution, are possible.
Das Verfahren beruht darauf, Logomere als Template einer Auslese-PCR zu verwenden, deren Resultat ein Gemisch von DNA Fragmenten definierter Länge und definierterThe method is based on using logomers as a template for a readout PCR, the result of which is a mixture of DNA fragments of defined length and defined
Längenabstände ist. Es basiert auf den bereits beschriebenen erfindungsgemäßen Verfahren zur Erzeugung und dem Auslesen von Logomeren. DNA Fragmente verschiedener Länge in sehr kurzen, regelmäßigen Abständen können erhalten werden, wenn ein unäres Polymer als Template einer Auslese-PCR mit verschachtelten Primern fungiert. Der 5'-Primer primt in der Start-Sequenz des Polymers. Als gegenläufige 3' Primer fungiert eine Gruppe von Primern, die verschachtelt in dem Elongator ansetzt (in Abbildung 17 dargestellt als 3 Ebenen gegeneinander versetzter Primer). Da das Polymer aus Wiederholungen nur eines Elongator-Moleküls besteht, erhält man für n Wiederholungen und m verschachtelte 3' Primer n*m Banden. Das Verfahren funktioniert auch spiegelbildlich mit einem im Ende-Terminator primenden Primer und dementsprechen gegenläufigen 5' Primern. Die erhaltenen Banden können als Molekulargewichtsstandards z.B. in Elektrophoresen eingesetzt werden.Length distances is. It is based on the previously described methods for generating and reading out logomers. DNA fragments of different lengths at very short, regular intervals can be obtained if a unary polymer acts as a template for a readout PCR with nested primers. The 5 'primer primes in the start sequence of the polymer. The opposite 3 'primer is a group of primers that are nested in the elongator (shown in Figure 17 as 3 levels of primers offset against each other). Since the polymer consists of repetitions of only one elongator molecule, one obtains n * m bands for n repetitions and m nested 3 'primers. The process also works in mirror image with a primer priming in the end terminator and correspondingly opposite 5 'primers. The bands obtained can be used as molecular weight standards, for example in electrophoresis.
Für hochauflösende Moiekulargewichtsstandards ist die Verwendung unärer Logomere und verschachtelter Primer am zweckmäßigsten. Jedoch ist das Verfahren nicht darauf beschränkt, da im Prinzip alle im erfindungsgemäßen Schritt I beschriebenen Grammatiken verwendet werden können. Unäre Logomere beliebiger Länge können mit einer Grammatik G = (Σ, V, R, S) mit Terminalalphabet Σ:= {0, s, e}, Variablenmenge V:={A}, Startsymbol S und Regelmenge R:=For high-resolution molecular weight standards, the use of unary logomers and nested primers is most appropriate. However, the method is not restricted to this, since in principle all grammars described in step I according to the invention can be used. Unary logomers of any length can be written with a grammar G = (Σ, V, R, S) with terminal alphabet Σ: = {0, s, e}, variable set V: = {A}, start symbol S and rule set R: =
{{
S:=sA A->aAS: = sA A-> aA
A->eA-> e
} hergestellt werden. Sollte es nötig sein, unäre Logomere definierter Länge herzustellen, muß dementsprechend die Variablenmenge und damit auch die Zahl der Elongatoren größer gewählt werden (wie z.B. in der Grammatik zur Implementierung eines 1-Byte Alphabets bereits beschrieben). Je nach gewünschter Länge der zu erzeugenden DNA Fragmente kann außerdem die Länge der Algomere variiert werden.} getting produced. If it is necessary to produce unary logomers of a defined length, the number of variables and thus the number of elongators must be chosen accordingly (as already described in the grammar for implementing a 1-byte alphabet). Depending on the desired length of the DNA fragments to be generated, the length of the algomers can also be varied.
Die so erzeugten Logomere können nach den erfindungsgemäßen Verfahren vereinzelt und vervielfältigt werden. Das Erzeugen von DNA-Fragmenten definierter Länge und definierter Längenabstände erfolgt vorzugsweise mit PCR analog dem erfindungsgemäßen Verfahren zum Auslesen von Logomeren. Für hochauflösende Molekulargewichtsstandards wird pro Elongator mindestens ein Primer, meistens sogar eine Anzahl mehrerer Primer verwendet, die gegeneinander verschoben sind. Die Anzahl der Primer pro Elongator ist abhängig von den gewünschten Längenabständen. Ist etwa gewünscht, Algomere der Länge 30bp zu verwenden und sollen die Längen der erzeugten DNA Fragmente jeweils 10bp Unterschied haben, so sind pro Elongator drei Primer, die jeweils genau 10bp gegeneinander verschoben sind, eingesetzt werden.The logomers produced in this way can be separated and reproduced using the methods according to the invention. DNA fragments of defined length and defined length spacings are preferably generated using PCR analogously to the method according to the invention for reading out Logomeres. For high-resolution molecular weight standards, at least one primer is used per elongator, usually even a number of several primers that are shifted from one another. The number of primers per elongator depends on the desired length spacing. If, for example, it is desired to use algomers with a length of 30 bp and if the lengths of the DNA fragments generated should each have a 10 bp difference, then three primers, each shifted exactly 10 bp against each other, are to be used.
Für die Synthese von Sequenzen zur Herstellung von Algomeren und Logomeren müssen die Anforderungen erfüllt werden, die bereits unter Schritt II des erfindungsgemäßen Verfahrens beschrieben wurden. Insbesondere gewährleistet das verwendete NFR-Verfahren dadurch, daß die jeweils als Template dienenden Teilsequenzen einen gleichen GC-Anteil besitzen können, den Einsatz verschachtelter Primer und die Ausgewogenheit des AT/GC Verhältnisses der erzeugten DNA Fragmente. Letzteres ist insbesondere angesichts dessen entscheidend, daß das Laufverhalten von DNA Fragmenten in der Elektrophorese nicht nur von der Länge, sondern auch von der Zusammensetzung der Fragmente abhängt. Dies gilt insbesondere für hochauflösende Molekulargewichtsstandards in denen es nur sehr geringe Längenabstände gibt.For the synthesis of sequences for the production of algomers and logomers, the requirements which have already been described under step II of the process according to the invention must be met. In particular, the NFR method used ensures that the partial sequences serving as templates can have the same GC content, the use of nested primers and the balance of the AT / GC ratio of the DNA fragments produced. The latter is particularly important in view of the fact that the running behavior of DNA fragments in electrophoresis depends not only on the length but also on the composition of the fragments. This applies in particular to high-resolution molecular weight standards in which there are only very small distances between lengths.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zur Herstellung von Molekulargewichtsstandards.Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for the production of molecular weight standards.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung polymerer DatenspeicherThe methods described above enable, for example, the production of polymeric data storage devices
Die beschriebenen Logomere können als RAM (Lesen und Schreiben) und ROM (nur Lesen) Datenspeicher hoher Kapazität und niedrigen Energieverbrauchs genutzt werden. Um eine möglichst hohe Informationsdichte zu gewährleisten und die Handhabung des Speichers möglichst einfach zu machen, werden die Logomere an einen festen Träger gebunden. Dies gewährleistet, daß die Logomere einzeln adressiert, d.h. einzeln geschrieben, gelesen und gelöscht werden können (siehe Abbildung 9).The described logomers can be used as RAM (read and write) and ROM (read only) data storage of high capacity and low energy consumption. To ensure the highest possible density of information and to make the handling of the memory as easy as possible, the logomers are bound to a solid support. This ensures that the logomers are addressed individually, i.e. can be written, read and deleted individually (see Figure 9).
Die benötigten Schreib- und Leseoperationen werden auf der Basis der im erfindungsgemäßen Schritt V und der unter Auslesen der in Logomeren enthaltenen Information beschriebenen enzymatischen Reaktionen durchgeführt, die ihrerseits durch Temperaturänderungen gesteuert werden. Die Temperaturänderungen können entweder per Laser oder durch Erhitzen und Abkühlen des festen Trägers z.B. in einem Thermozykler durchgeführt werden. Zum Schreiben wird eine Modifikation des oben beschriebenen Verfahrens der Symbolpolymerisation verwendet. Die Polymerisation findet an einem festen Träger statt, die Algomere werden durch wiederholte Restriktions-Ligationszyklen miteinander verkettet. Um einzelne, adressierbare Speicherzellen herzustellen, werden in bestimmten Abständen einzelsträngige "Ankermoleküle" irreversibel (durch UV-Bestrahlung oder im Ofen) an den Träger gebunden. Der solcherart mit Ankermolekülen versehene Träger kann nun reversibel mit Logomeren beschrieben werden, die in einem Löschvorgang wieder davon entfernt werden können.The required writing and reading operations are carried out on the basis of the enzymatic reactions described in step V according to the invention and the reading of the information contained in logomers, which in turn are controlled by temperature changes. The temperature changes can be carried out either by laser or by heating and cooling the solid support, for example in a thermal cycler. A modification of the symbol polymerization method described above is used for writing. The polymerization takes place on a solid support, the algomers are linked to one another by repeated restriction ligation cycles. In order to produce individual, addressable memory cells, single-stranded “anchor molecules” are irreversibly bound to the carrier (by UV radiation or in the oven). The support provided with anchor molecules in this way can now be reversibly described with logomers, which can be removed again in an erasing process.
Bei einem Schreibvorgang werden zuerst spezifische Algomere ("Starter-Algomere") durch Hybridisierung an die Ankermoleküle gebunden. Diese Starter-Algomere sind ihrerseits Ausgangspunkt einer Symbolpolymerisation, bei der weitere Algomere miteinander verkettet werden. Die Verkettung der Algomere erfolgt dabei, abweichend von dem im Schritt V des erfindungsgemäßen Verfahrens beschriebenen Vorgehen, durch wiederholte Zyklen von Restriktion und Ligation. Bei jedem Zyklus wird das jeweils letzte Algomer einer polymerisierenden Kette mit einem Restriktionsenzym geschnitten, so daß eine einzelsträngige Überhangsequenz (Elongationspunkt) entsteht, an die seinerseits das nächstfolgende Algomer durch Ligation gebunden werden kann.In a writing process, specific algomers ("starter algomers") are first bound to the anchor molecules by hybridization. These starter algomers in turn are the starting point for a symbol polymerization in which further algomers are linked together. In contrast to the procedure described in step V of the process according to the invention, the algomers are linked by repeated cycles of restriction and ligation. In each cycle, the last algomer of a polymerizing chain is cut with a restriction enzyme, so that a single-stranded overhang sequence (elongation point) is formed, to which in turn the next algomer can be bound by ligation.
Für den solcherart beschriebenen Schreibvorgang müssen die Algomere ein spezifischesFor the writing process described in this way, the algomers must have a specific one
Design aufweisen: a) Jedes zu schreibende Algomer besitzt eine einzelsträngige Überhangsequenz, mit der es an den Elongationspunkt eines Logomers binden kann. b) Ein Algomer, das nur eine einzelsträngige Überhangsequenz besitzt mit der es an einenDesign have: a) Each algomer to be written has a single-stranded overhang sequence with which it can bind to the elongation point of a logomer. b) An algomer that has only a single-stranded overhang sequence with which it is attached to one
Elongationspunkt binden kann, selbst aber keine Restriktionsschnittstelle besitzt, durch die es von Restriktionsenzymen erkannt werden kann und damit nicht alsCan bind the elongation point, but does not itself have a restriction interface through which it can be recognized by restriction enzymes and therefore not as
Elongationspunkt dienen kann, heißt Ende-Algomer. c) Jedes zu schreibende Algomer, das nicht das Ende-Algomer ist, besitzt ein doppelsträngiges Ende, worin sich die Erkennungssequenz für das jeweils gewählteElongation point can be called the end Algomer. c) Each algomer to be written that is not the end algomer has a double-stranded end, in which the recognition sequence for the selected one
Restriktionsenzym befindet. Bei einer Restriktion spaltet das Enzym das Algomer, so daß eine einzelsträngige Überhangsequenz entsteht, die ihrerseits selbst wieder als Elongationspunkt dienen kann. d) Jedes fertige Logomer besitzt genau ein Starter- und ein Ende-Algomer. Starter- und Ende-Algomere sind, entsprechend der oben gegebenen Definition, Terminatoren. e) Die Überhangsequenzen der Algomere sind kompatibel zu einem jeweils gewählten Restriktionsenzym, so daß ein zu verkettendes Algomer an den Elongationspunkt eines Logomers binden kann und der nachfolgend durch Restriktion entstehende Elongationspunkt identisch zu seinem Vorläufer ist. f) Die im Algomer auf die Überhangsequenz folgende Sequenz ist solcherart gewählt, daß ein verkettetes Algomer durch einen nachfolgenden Restriktionsvorgang nicht wieder abgespalten werden kann.Restriction enzyme is located. In the event of a restriction, the enzyme cleaves the algomer so that a single-stranded overhang sequence arises, which in turn can itself serve as an elongation point. d) Each finished logomer has exactly one starter and one end algomer. Starter and end algomers are, according to the definition given above, terminators. e) The overhang sequences of the algomers are compatible with a restriction enzyme chosen in each case, so that an algomer to be linked can bind to the elongation point of a logomer and the elongation point subsequently created by restriction is identical to its predecessor. f) The sequence following the overhang sequence in the algomer is selected in such a way that a linked algomer cannot be split off again by a subsequent restriction process.
Als fester Träger eignen sich Membranen wie Gene Screen Plus (DuPont, Biotechnology Systems, Katalog Nr.: NEF-986 oder NEF-987), Hybond-N (Amersham Life Sciences, Katalog Nr.: RPN 82N oder RPN 137N), Silizium-, Silicat-Oberflächen oder Glas. Die Ankermoleküle werden jeweils kovalent daran gebunden (UV-Bestrahlung oder Hitze).Membranes such as Gene Screen Plus (DuPont, Biotechnology Systems, catalog no .: NEF-986 or NEF-987), Hybond-N (Amersham Life Sciences, catalog) are suitable as solid supports No .: RPN 82N or RPN 137N), silicon, silicate surfaces or glass. The anchor molecules are each covalently bound to it (UV radiation or heat).
Damit die Moleküle einzeln adressierbar sind, müssen sie in regelmäßigen Abständen auf dem Träger angebracht werden. Als Restriktionsenzyme eignen sich handesübliche Enzyme, vorzugsweise solche, die nicht bei 65°C deaktiviert werden (z.B. Hindlll).So that the molecules can be addressed individually, they must be attached to the carrier at regular intervals. Suitable restriction enzymes are commercially available enzymes, preferably those that are not deactivated at 65 ° C (e.g. Hindlll).
Die Schreiboperationen basieren darauf, daß die zum Schreiben verwendeten Enzyme unterschiedliche Temperaturoptima haben. So liegt das Temperaturoptimum der zumThe writing operations are based on the fact that the enzymes used for writing have different temperature optima. So is the temperature optimum for
Verketten von Symbolen verwendeten Ligase bei 16°C, wohingegen die benötigten Restriktionsenzyme nur bei 37°C funktionieren. Dadurch ist das getaktete Schreiben von Symbolen in Zyklen von Restriktion und Ligation möglich.Chain of symbols used ligase at 16 ° C, whereas the required restriction enzymes only work at 37 ° C. This enables the clocked writing of symbols in cycles of restriction and ligation.
Da alle Lese- und Schreiboperationen mithilfe von Enzymen durchgeführt werden, ist es nötig, den Träger temperieren zu können. Dabei können, bei der Verwendung eines Thermozyklers und thermomanipulierbaren Materials, alle Speicherzellen simultan derselben Operation unterworfen werden. Alternativ können Speicherzellen einzeln und unabhängig voneinander zugegriffen werden, wenn ein entsprechend kleiner SchreibVLesekopf eingesetzt wird. Dieser Schreib-/Lesekopf muß einerseits als Pipettiervorrichtung für die benötigten Moleküle (Enzyme, Algomere) dienen und andererseits die für eine bestimmte Manipulation benötigte Temperatur erzeugen (z.B. mit Hilfe eines Lasers). Beim Löschvorgang wird ein Logomer durch Denaturierung vom jeweiligen Ankermolekül gelöst. Das Ankermolekül steht danach wieder für einen Schreibvorgang zur Verfügung. Für einen Lesevorgang wird ein Logomer durch Denaturierung von einem Ankermolekül gelöst. Es kann dann nach den erfindungsgemäßen Verfahren ausgelesen werden. Die beschriebenen Operationen Schreiben, Löschen, Lesen werden durch Enzyme bei verschiedenen Temperaturen durchgeführt. Dabei können, bei der Verwendung eines thermomanipulierbaren Materials, alle Speicherzellen simultan derselben Operation unterworfen werden. Alternativ können Speicherzellen einzeln und unabhängig voneinander zugegriffen werden, wenn ein entsprechend kleiner Schreib-/Lesekopf eingesetzt wird. Dieser Schreib-/Lesekopf muß einerseits als Pipettiervorrichtung dienen und andererseits die für eine bestimmte Manipulation benötigte Temperatur erzeugen.Since all reading and writing operations are carried out using enzymes, it is necessary to be able to temper the wearer. When using a thermocycler and thermally manipulable material, all memory cells can be subjected to the same operation simultaneously. Alternatively, memory cells can be accessed individually and independently of one another if a correspondingly small read / write head is used. This read / write head must serve on the one hand as a pipetting device for the required molecules (enzymes, algomers) and on the other hand must generate the temperature required for a certain manipulation (e.g. with the aid of a laser). During the deletion process, a logomer is detached from the respective anchor molecule by denaturation. The anchor molecule is then available again for a writing process. For a reading process, a logomer is detached from an anchor molecule by denaturation. It can then be read out using the method according to the invention. The operations described writing, erasing, reading are performed by enzymes at different temperatures. When using a material that can be manipulated thermally, all memory cells can be subjected to the same operation simultaneously. Alternatively, memory cells can be accessed individually and independently of one another if a correspondingly small read / write head is used. This read / write head must serve on the one hand as a pipetting device and on the other hand must generate the temperature required for a certain manipulation.
Der Vorteil des hier vorgestellten Polymerspeichers besteht gegenüber den bisher verwendeten Materialien in einer höheren Speicherdichte (DNA Moleküle haben eine Größe, die bei 10"10 m liegt), und einem sehr viel geringeren Energieverbrauch (zur Berechnung der in enzymatischen Reaktionen benötigten Energie siehe [L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021 -1024, (1994)]). Außerdem ergibt sich eine erheblich verbesserte Umweltverträglichkeit, weil die hier beschriebenen Polymere Biomoleküle ohne jegliche Toxizität sind. Der hier beschriebene Ansatz hat gegenüber den bisher für das DNA Computing verwendeten wässrigen Lösungen den Vorzug höherer Speicherdichte und der Adressierbarkeit einzelner Polymere. Ein weiterer Gegenstand der vorliegenden Erfindung ist daher ein polymerer Datenspeicher, umfassend erfindungsgemäße informationstragende Polymere, erfindungsgemäße Verfahren zur Verknüpfung von Molekülen, erfindungsgemäße Ausleseverfahren oder erfindungsgemäße Isolierungs- und Vervielfältigungsverfahren.The advantage of the polymer storage presented here is, compared to the materials previously used, a higher storage density (DNA molecules have a size that is 10 "10 m) and a much lower energy consumption (for the calculation of the energy required in enzymatic reactions see [LM Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)]). In addition, there is a significantly improved environmental compatibility because the polymers described here are biomolecules without any toxicity Aqueous solutions previously used for DNA computing preferred the higher storage density and the addressability of individual polymers. Another object of the present invention is therefore a polymeric data storage device, comprising information-carrying polymers according to the invention, methods for linking molecules according to the invention, readout methods according to the invention or isolation and duplication methods according to the invention.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung eines DNA ComputersThe methods described above enable, for example, the production of a DNA computer
Mithilfe der bereits beschriebenen Informationsdarstellung durch Algomere und Logomere kann ein DNA Computer konstruiert werden. Der DNA Computer umfaßt (s. Abbildung 10): a) Oligonukleotidsynthesizer b) Thermozykler c) Pipettiervorrichtung d) Vorrichtung zur Isolation von Polymeren e) Vorrichtung zur Auftrennung von Nukleinsäuren, z.B. Elektrophoresesystem f) Scanner g) Steuerungsrechner (Workstation, z.B. PC) Der DNA Computer ist konstruiert als ein Hybridsystem, bei dem einfache, rechenintensive Algorithmen oder die Speicherung von Daten mithilfe von DNA und den dazu benötigten Geräten (Geräte a) bis e)) vorgenommen werden und ein herkömmlicher Computer (vorzugsweise Workstation, z.B. PC) als Host und Steuerungsrechner dient. Der DNA Computers beinhaltet mindestens einen Thermozykler, der als „Informationsreaktor" dient und über den Steuerungsrechner gesteuert werden kann (z.B. MJ Research PTC-100, Eppendorf Mastercycler). In den Tubes oder Mikrotiterplatten des Thermozyklers befinden sich Molekülgemische aus Nukleinsäuren, Enzymen und weiteren chemischen Substanzen (z.B. Puffer, Nukleotide), die für die Algomer-Assemblierung (Schritt IV des erfindungsgemäßen Verfahrens) und die Symbolpolymerisation (Schritt V des erfindungsgemäßen Verfahrens) benötigt werden. Programmiert wird der DNA Computer durch die Implementierung von Algorithmen als Grammatiken (Schritt I des erfindungsgemäßen Verfahrens). Die für die Grammatiken jeweils benötigten Monomersequenzen werden durch das NFR-Verfahren und die Benutzung eines Oligonukleotidsynthesizers (z.B. ABI 392, ABI 398, ABI 3948 von Perkin-Eimer Applied Biosystems) hergestellt (Schritte II und III des erfindungsgemäßen Verfahrens). Diese Monomersequenzen gehen als Input in den Thermozykler ein, in dem die Algomer- Assemblierung (Schritt IV des erfindungsgemäßen Verfahrens) stattfindet. Die so gewonnenen Algomere werden in eine oder mehrere Reaktionskammern des Thermozyklers überführt, wo sie zu Logomeren verknüpft werden (Symbolpolymerisation, Schritt V des erfindungsgemäßen Verfahrens). Die so gewonnen Logomere werden in einer eigenen Vorrichtung isoliert und vervielfältigt. Diese Vorrichtung kann nach den Prinzipien arbeiten, die in dem erfindungsgemäßen Verfahren beschrieben worden sind. Nach Isolierung und Vervielfältigung können die Logomere gelesen werden. Dazu werden sie wiederum in einem Thermozykler erfindungsgemäß ausgelesen. Die aus dem Ausleseverfahren resultierenden Nukleinsäurefragmente können, wie bereits beschrieben, durch Gelelektrophorese gelesen werden. Hier dient das Gelelektrophoresegerät als Ausgabegerät des DNA Computers, die solcherart erhaltenen Bandenmuster werden von einem Scanner in den Steuerungsrechner eingelesen.A DNA computer can be constructed using the information representation by algomers and logomers already described. The DNA computer comprises (see Figure 10): a) oligonucleotide synthesizer b) thermocycler c) pipetting device d) device for isolating polymers e) device for separating nucleic acids, eg electrophoresis system f) scanner g) control computer (workstation, eg PC) DNA Computer is designed as a hybrid system, in which simple, computationally intensive algorithms or the storage of data using DNA and the necessary devices (devices a) to e)) are carried out and a conventional computer (preferably workstation, e.g. PC) as the host and control computer. The DNA computer contains at least one thermal cycler, which serves as an "information reactor" and can be controlled via the control computer (eg MJ Research PTC-100, Eppendorf Mastercycler). Molecular mixtures of nucleic acids, enzymes and other chemical substances are located in the tubes or microtiter plates of the thermal cycler Substances (eg buffers, nucleotides) which are required for the algomer assembly (step IV of the method according to the invention) and the symbol polymerization (step V of the method according to the invention) The DNA computer is programmed by implementing algorithms as grammars (step I of the The monomer sequences required in each case for the grammars are produced by the NFR method and the use of an oligonucleotide synthesizer (eg ABI 392, ABI 398, ABI 3948 from Perkin-Elmer Applied Biosystems) (steps II and III of the method according to the invention). These monomer sequences ge hen as an input into the thermocycler in which the algomer assembly (step IV of the method according to the invention) takes place. The algomers obtained in this way are transferred to one or more reaction chambers of the thermal cycler, where they are linked to form logomers (symbol polymerization, step V of the process according to the invention). The logomers obtained in this way are isolated and reproduced in a separate device. This device can operate on the principles work that have been described in the inventive method. After isolation and duplication, the logomers can be read. For this purpose, they are again read out according to the invention in a thermal cycler. As already described, the nucleic acid fragments resulting from the selection process can be read by gel electrophoresis. Here the gel electrophoresis device serves as the output device of the DNA computer, the band patterns obtained in this way are read into the control computer by a scanner.
Der Steuerungsrechner nimmt jetzt seinerseits aufgrund der solcherart erhaltenen Ergebnisse weitere Berechnungen und Steuerungen vor und setzt ggfs. weitere molekulare Reaktionen in Gang. Z.B. kann der Steuerungscomputer aufgrund erhaltener Ergebnisse die Neuimplementierung von Grammatiken (Herstellung von Oligomeren mit dem NFR- Verfahren) veranlassen. Auf diese Weise können die durch molekulare Verfahren als Logomere erhaltenen Informationen nicht nur als passive Daten sondern auch als Instruktionen (und Adressen) dienen. Dadurch ist ein sich selbst steuernder Prozeß verschiedener Algorithmen möglich, der für eine universelle Datenverarbeitung nötig ist.The control computer in turn now carries out further calculations and controls on the basis of the results obtained in this way and, if necessary, initiates further molecular reactions. For example, Based on the results obtained, the control computer can initiate the reimplementation of grammars (production of oligomers using the NFR method). In this way, the information obtained by molecular methods as logomers can serve not only as passive data but also as instructions (and addresses). This enables a self-controlling process of various algorithms, which is necessary for universal data processing.
Der DNA Computer verarbeitet dabei Informationen als Oligo- und Polymere. Als Speicherzellen der Daten dienen Klonierungsvektoren (Plasmide), die sich in flüssiger Lösung oder auf einem festen, adressierbaren Träger befinden. Der DNA Computer ist wie oben beschrieben mittels Grammatiken programmierbar und kann von einem herkömmlichen Computer, der als Steuerungsrechner und Host-System fungiert, gesteuert werden.The DNA computer processes information as oligo- and polymers. Cloning vectors (plasmids), which are in liquid solution or on a solid, addressable carrier, serve as storage cells for the data. The DNA computer is programmable as described above using grammars and can be controlled by a conventional computer, which acts as a control computer and host system.
Da der DNA Computer bestimmte Operationen in molaren Größenordnungen (z.B. die Symbolpolymerisation, wie in Schritt V des erfindungsgemäßen Verfahrens beschrieben, in 1012 - 1020 Elementaroperationen pro Sekunde) vornehmen kann, ist eine mögliche Anwendung die Berechnung einfacher, rechenintensiver Algorithmen. Jedoch kann der DNA Computer auch für andere Anwendungen, z.B. die Erzeugung bestimmter, regelmäßiger DNA Strukturen, die z.B. innerhalb der Nanotechnologie interessant sind, verwendet werden.Since the DNA computer can perform certain operations in molar orders of magnitude (for example symbol polymerization, as described in step V of the method according to the invention, in 10 12-10 20 elementary operations per second), one possible application is the calculation of simple, computationally intensive algorithms. However, the DNA computer can also be used for other applications, such as the generation of certain, regular DNA structures that are of interest, for example, within nanotechnology.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher ein DNA-Computer, umfassend erfindungsgemäße informationstragende Polymere. Ein weiterer Gegenstand der vorliegenden Erfindung ist ein DNA-Computer, in dem ein erfindungsgemäßes Ausleseverfahren und/oder erfindungsgemäße Isolierungs- und Vervielfältigungsverfahren eingesetzt werden. Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung kleinster molekularer Strukturen mit LogomerenAnother object of the present invention is therefore a DNA computer comprising information-carrying polymers according to the invention. Another object of the present invention is a DNA computer in which a readout method according to the invention and / or isolation and duplication methods according to the invention are used. The methods described above enable, for example, the production of the smallest molecular structures with logomers
Mit den hier beschriebenen Logomeren lassen sich kleinste molekulare Strukturen (Nanostrukturen) herstellen. Bausteine solcher Strukturen sind Algomere, die zu regelmäßigen Mustern von Logomeren zusammengefügt werden können. Z.B. können verschiedene Algomere mit unterschiedlichen Fremdmolekülen (Liganden) dotiert werden, um regelmäßige, höhermolekulare Muster der jeweiligen Liganden zu erhalten. Die Logomere fungieren dabei als "Skelett" molekularer Baugruppen von Liganden. Z.B. könnte ein binäres Logomer alternierende Muster leitfähiger und nicht-leitfähiger Liganden enthalten. Durch die Anordnung vieler Logomere auf einem festen Träger können so Leiterbahnen im Nanometerbereich entstehen.With the logomers described here, the smallest molecular structures (nanostructures) can be produced. The building blocks of such structures are algomers, which can be combined to form regular patterns of logomers. For example, Different algomers can be doped with different foreign molecules (ligands) in order to obtain regular, high molecular weight patterns of the respective ligands. The logomers act as a "skeleton" of molecular assemblies of ligands. For example, a binary logomer could contain alternating patterns of conductive and non-conductive ligands. The arrangement of many logomers on a solid support can result in conductor tracks in the nanometer range.
Als Liganden können aber auch Biomoleküle, Antikörper, optisch aktive Moleküle o.a. verwendet werden.Biomolecules, antibodies, optically active molecules or the like can also be used as ligands. be used.
Logomere können als "intelligenter" Klebstoff eingesetzt werden (siehe Abbildung 18). Dabei macht man sich die Hybridisierung komplementärer Nukleotide zunutze. Bringt man auf die zu verklebenden Flächen Logomere auf, die etwa kovalent an die zu verklebenden Flächen gebunden werden, so können ansonsten völlig identische Flächen nur dann verkleben, wenn sie komplementäre Sequenzen aufweisen, da nur jeweils Flächen komplementärer Nukleinsäuren Wasserstoffbrückenbindungen ausbilden. Die "Intelligenz" des Klebstoffes besteht also in einer durch die jeweils verwendeten Sequenzen hochselektiven Adhäsionswirkung. Dabei kann auch die Adhäsionsstärke für zu verklebende Flächen genau eingestellt werden: Zum einen kann über die Dichte der Logomere auf den jeweiligen Flächen deren Adhäsionsstärke eingestellt werden, zum anderen kann über das AT/GC Verhältnis der Logomere deren Schmelzpunkt variiert werden, so daß verklebte Flächen bei unterschiedlichen Temperaturen ihre Adhäsion verlieren. Aufgrund der Tatsache, daß hier unschädliche, leicht abbaubare Biomoleküle als Klebstoff verwendet werden, können derartige Klebstoffe auch zur medizinische Verwendung (z.B. Chirurgie, Mikrochirugie) eingesetzt werden. Eine andere Verwendung ist die Nutzung des beschriebenen Verfahrens in Hochpräzisions- und Authentifizierungsanwendungen.Logomeres can be used as an "intelligent" adhesive (see Figure 18). The hybridization of complementary nucleotides is used here. If logomers are applied to the surfaces to be bonded, which are covalently bonded to the surfaces to be bonded, otherwise completely identical surfaces can only be bonded if they have complementary sequences, since only surfaces of complementary nucleic acids form hydrogen bonds. The "intelligence" of the adhesive therefore consists in a highly selective adhesive effect due to the sequences used in each case. The adhesive strength for surfaces to be bonded can also be set precisely: on the one hand, the density of the logomers on the respective surfaces can be used to set their adhesive strength, and on the other hand, the melting point can be varied via the AT / GC ratio of the logomers, so that bonded surfaces lose their adhesion at different temperatures. Due to the fact that harmless, easily degradable biomolecules are used as an adhesive, such adhesives can also be used for medical use (e.g. surgery, micro-surgery). Another use is the use of the described method in high-precision and authentication applications.
Versetzt man die zur Herstellung von Logomeren verwendeten Algomeren mit Sequenzen zur Bindung von Liganden, so können stärkere Adhäsionswirkungen erreicht werden. Solche Liganden können im Falle von DNA DNA-bindenden Proteinen, z.B. spezifische, gegen DNA- Sequenzen gerichtete Antikörper sein. Diese können z.B. jeweils über einen weiteren Liganden untereinander verbunden werden (siehe Abbildung 19). Eine einfache, nichtprogrammierbare Adhäsionswirkung kann auch ohne Logomere erreicht werden, wenn die verwendeten Proteine (z.B. Antikörper) ihrerseits an die zu verklebenden Flächen binden können (wie z.B. Antikörper, wenn die zu verklebende Fläche ihr Antigen ist). Siehe dazu auch Abbildung 20. Einfachere Klebstoffe sind möglich, wenn, an bestimmte Flächen spezifisch bindende, Proteine gentechnisch hergestellt werden. Eine alternative Methode besteht darin, die zu verklebenden Flächen nicht über schwacheIf the algomers used for the production of logomers are mixed with sequences for binding ligands, stronger adhesion effects can be achieved. In the case of DNA-binding proteins, such ligands can be, for example, specific antibodies directed against DNA sequences. These can, for example, be connected to each other via another ligand (see Figure 19). A simple, non-programmable adhesive effect can also be achieved without logomers if the proteins used (for example antibodies) can in turn bind to the surfaces to be bonded (such as antibodies if the surface to be bonded is their antigen). See also Figure 20. Simpler adhesives are possible if proteins that bind specifically to certain areas are genetically engineered. An alternative method is to ensure that the surfaces to be glued are not weak
Wechselwirkung, sondern über kovalente Bindung miteinander zu verbinden. Abweichend vom oben vorgestellten Verfahren wird die Adhäsionskraft über die Dichte von Algomeren eingestellt. Dabei werden die zu verklebenden Flächen mit Algomeren, die zueinander jeweils komplementäre sticky ends tragen versehen. Diese können dann hybridisieren und durchInteraction, but to connect with each other via covalent bond. Deviating from the method presented above, the adhesive force is set via the density of algomers. The surfaces to be glued are provided with algomers, each of which has complementary sticky ends. These can then hybridize and go through
Ligation miteinander kovalent verbunden werden.Ligation are covalently linked together.
Mit Logomeren können Oberflächen unterschiedlichster Struktur und unterschiedlichster physikalischer Eigenschaften hergestellt werden. Den Anwendungen ist gemein, daß sich mit den Logomeren nahezu beliebige Muster im Nanometerbereich bilden lassen, die das Skelett kleinster molekularer Bauelemente sein können.Surfaces with a wide variety of structures and a wide range of physical properties can be produced with logomers. The applications have in common that almost any pattern in the nanometer range can be formed with the logomers, which can be the skeleton of the smallest molecular components.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zur Herstellung oder Bearbeitung kleinster molekularer Strukturen oder als molekularer Kleber.Another object of the present invention is therefore the use of information-bearing polymers, in particular the information-bearing polymers obtainable according to the invention, for the manufacture or processing of the smallest molecular structures or as a molecular adhesive.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die Herstellung nanotechnologischer Baukastensysteme.The methods described above enable, for example, the production of nanotechnological modular systems.
Mit dem oben beschriebenen NFR-Verfahren und dem "Parallel Extension" Verfahren können erstmals größere Grammatiken direkt in Moleküle übersetzt werden. Dabei sind diese Grammatiken nicht auf reguläre Grammatiken beschränkt. U. a. aufgrund der Wiederverwendbarkeit von Sequenzen lassen sich damit z.B. auch ψ-Moleküle [Matthias Scheffler, Axel Dorenbeck, Stefan Jordan, Michael Wüstefeld, Günter von Kiedrowski, Self- Assembly of Trisoligonucleotidyls: The Case for Nano-Acetylene and Nano-Cyclobutadiene. Angewandte Chemie Int. Ed., 38(22), 3312-3315, (1999)] und DX-Moleküle [Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two- dimensional DNA crystals, Nature, 394, 539-544, (1998)] programmieren.With the NFR method described above and the "parallel extension" method, larger grammars can be translated directly into molecules for the first time. These grammars are not limited to regular grammars. Among other things due to the reusability of sequences, e.g. also ψ molecules [Matthias Scheffler, Axel Dorenbeck, Stefan Jordan, Michael Wüstefeld, Günter von Kiedrowski, Self-Assembly of Trisoligonucleotidyls: The Case for Nano-Acetylene and Nano-Cyclobutadiene. Applied Chemistry Int. Ed., 38 (22), 3312-3315, (1999)] and DX molecules [Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two-dimensional DNA crystals, Nature , 394, 539-544, (1998)].
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung des NFR- Verfahrens, des "Parallel-Extension" Verfahrens und der Übersetzung von Grammatiken in Moleküle zur Herstellung von Komponenten nanotechnologischer Baukastensysteme.Another object of the present invention is therefore the use of the NFR method, the "parallel extension" method and the translation of grammars into molecules for the production of components of nanotechnological modular systems.
Die oben beschriebenen Verfahren ermöglichen beispielsweise die kontrollierte, programmierbare Herstellung von biologisch aktiven Nukleinsäuren.The methods described above enable, for example, the controlled, programmable production of biologically active nucleic acids.
Dazu setzt man z.B. als Terminale anstelle künstlicher Sequenzen zur Darstellung von Symbolen biologisch aktive Sequenzen wie Restriktionssites, Rekombinationssites,To do this, e.g. as terminals instead of artificial sequences to represent symbols, biologically active sequences such as restriction sites, recombination sites,
Centromere, Promotoren, Exons, Gene o.a. ein. Diese können dann auf kontrollierte, programmierbare Weise zu biologisch aktiven Konstrukten, z.B. zu Genen oder künstlichen Chromosomen zusammengesetzt werden.Centromeres, promoters, exons, genes or the like. These can then be controlled, programmable way to biologically active constructs, such as genes or artificial chromosomes.
Ein weiterer Gegenstand der vorliegenden Erfindung ist daher die Verwendung informationstragender Polymere, insbesondere der erfindungsgemäß erhältlichen informationstragenden Polymere, zur kontrollierten Herstellung biologisch aktiver Nukleinsäuren. Another object of the present invention is therefore the use of information-carrying polymers, in particular the information-carrying polymers obtainable according to the invention, for the controlled production of biologically active nucleic acids.
Referenzencredentials
Patente:Patents:
International Publication Inventor TitleInternational Publication Inventor Title
NumberNumber
US4683202 Kary B. Mullis, Kensington, Calif. Process for amplifying nucleic acid sequencesUS4683202 Kary B. Mullis, Kensington, Calif. Process for amplifying nucleic acid sequences
WO 97/07440 Adleman, Leonard, M; 18262 MOLECULAR COMPUTER Hastings Way, Northridge, CA 91326 (US)WO 97/07440 Adleman, Leonard, M; 18262 MOLECULAR COMPUTER Hastings Way, Northridge, CA 91326 (US)
WO 97/29117 GUARNIERI, Frank [US/US]; 62 A DNA-BASED COMPUTER Lake Street, Brooklyn, NY 11223 (US). BANCROFT, Frank, Carter [US/US]; 51 Dewey Street, Huntington Station, NY 11743 (US).WO 97/29117 GUARNIERI, Frank [US / US]; 62 A DNA-BASED COMPUTER Lake Street, Brooklyn, NY 11223 (US). BANCROFT, Frank, Carter [US / US]; 51 Dewey Street, Huntington Station, NY 11743 (US).
US5804373 Schweitzer; Allan Lee, Plainsboro, NJ Molecular automata utilizing Smith; Warren D. , Plainsboro, NJ Single- or double-strand oiigonucleotidesUS5804373 Schweitzer; Allan Lee, Plainsboro, NJ Molecular automata utilizing Smith; Warren D., Plainsboro, NJ Single- or double-strand oiigonucleotides
Veröffentlichungen:Publications:
L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021 -1024, (1994)L. M. Adleman, Molecular Computation of Solutions to Combinatoriai Problems, Science, 266, 1021-1024, (1994)
Breslauer, K.J., Frank, R., Blocker, H., Marky, L.A., Proc. Natl. Acad. Sei., 83, 3746-3750, 1989Breslauer, K.J., Frank, R., Blocker, H., Marky, L.A., Proc. Natl. Acad. Sci., 83, 3746-3750, 1989
Capecchi M.R., Altering the genome by homologous recombination. Science, 244(4910), 1288- 1292, (1989)Capecchi M.R., Altering the genome by homologous recombination. Science, 244 (4910), 1288-1292, (1989)
Chomsky, N., Three modeis for the description of language, JACM, 2:3, 113-124, (1956)Chomsky, N., Three modeis for the description of language, JACM, 2: 3, 113-124, (1956)
Chomsky, N., On certain formal properties of grammars, Inf. and Control, 2:2, 137-167, (1959)Chomsky, N., On certain formal properties of grammars, Inf. And Control, 2: 2, 137-167, (1959)
Chomsky, N., Formal properties of grammars, Handbook of Math. Psych., 2, 323-418, (1963)Chomsky, N., Formal properties of grammars, Handbook of Math. Psych., 2, 323-418, (1963)
Frank Guarnieri, Makiko Fliss, Carter Bancroft, Making DNA Add, Science, 273, 220-223, (1996)Frank Guarnieri, Makiko Fliss, Carter Bancroft, Making DNA Add, Science, 273, 220-223, (1996)
John E. Hopcroft, Formal Languages And Their Relation To Automata, (1969) Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209,John E. Hopcroft, Formal Languages And Their Relation To Automata, (1969) Jeffreys, Minisatellite reapeat coding as a digital approach to DNA typing, Nature, 354, 204-209,
(1991 )(1991)
Kilby, N. J., Snaith, M. R. & Murray, J. A., Site-specific recombinases: tools for genome engineering, Trends Genet., 9, 413-421 , (1993)Kilby, N.J., Snaith, M.R. & Murray, J.A., Site-specific recombinases: tools for genome engineering, Trends Genet., 9, 413-421, (1993)
Rolf Knippers, Molekulare Genetik, Georg Thieme Verlag, (1997)Rolf Knippers, Molecular Genetics, Georg Thieme Verlag, (1997)
Benjamin Lewin, Genes V, Oxford University Press, (1994)Benjamin Lewin, Genes V, Oxford University Press, (1994)
Lund, A.H., Duch, M., Pedersen, F.S, Increased cloning efficency by temperature-cycle ligation, Nucleic Acids Research, 24: (4), 800-801 , (1996)Lund, A.H., Duch, M., Pedersen, F.S, Increased cloning efficency by temperature-cycle ligation, Nucleic Acids Research, 24: (4), 800-801, (1996)
J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, A Laboratory Manual, (1989)
Jens Niehaus, DNA Computing: Bewertung und Simulation, Diplomarbeit am Fachbereich Informatik der Universität Dortmund, Lehrstuhl XI, 116-123, (1998)Jens Niehaus, DNA Computing: Evaluation and Simulation, diploma thesis at the Department of Computer Science at the University of Dortmund, Chair XI, 116-123, (1998)
Qi Ouyang, Peter D. Kaplan, Shumao Liu, Albert Libchaber, DNA Solution of the Maximal Clique Problem, Science, 278, 446-449, (1997)Qi Ouyang, Peter D. Kaplan, Shumao Liu, Albert Libchaber, DNA Solution of the Maximal Clique Problem, Science, 278, 446-449, (1997)
Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self-assembly of DNA: Some Theory and Experiments, Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996)Erik Winfree, Xiaoping Yang, Nadrian C. Seeman, Universal Computation via Self-assembly of DNA: Some Theory and Experiments, Proceedings of the 2nd DIMACS Meeting on DNA Based Computers, Princeton University, June 20-12, (1996)
Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two-dimensional DNA crystals, Nature, 394, 539-544, (1998)Erik Winfree, Furong Liu, Lisa A. Wenzler & Nadrian C. Seeman, Design and self-assembly of two-dimensional DNA crystals, Nature, 394, 539-544, (1998)
Matthias Scheffler, Axel Dorenbeck, Stefan Jordan, Michael Wüstefeld, Günter von Kiedrowski, Self-Assembly of Trisoligonucleotidyls: The Case for Nano-Acetylene and Nano-Cyclobutadiene. Angewandte Chemie Int. Ed., 38(22), 3312-3315, (1999) Matthias Scheffler, Axel Dorenbeck, Stefan Jordan, Michael Wüstefeld, Günter von Kiedrowski, Self-Assembly of Trisoligonucleotidyls: The Case for Nano-Acetylene and Nano-Cyclobutadiene. Applied Chemistry Int. Ed., 38 (22), 3312-3315, (1999)

Claims

Patentansprüche claims
I . Verfahren zur Herstellung von informationstragenden Polymeren, das umfaßt,I. A process for the preparation of information-bearing polymers, which comprises
I. eine reguläre Grammatik G = (Σ, V, R, S) mit einem endlichen Terminalalphabet Σ, einer endlichen Variablenmenge V, einer endlichen Regelmenge R und einem Startsymbol S zu definieren;I. to define a regular grammar G = (Σ, V, R, S) with a finite terminal alphabet Σ, a finite set of variables V, a finite set of rules R and a start symbol S;
II. das NFR-Verfahren (Niehaus-Feldkamp-Rauhe-Verfahren) zur Herstellung von Monomersequenzen; III. mit dem NFR-Verfahren eine in Schritt I definierte Grammatik zu implementieren, indem damit Monomersequenzen hergestellt werden, die die Regelmenge R einerII. The NFR process (Niehaus-Feldkamp-Rauhe process) for the production of monomer sequences; III. to implement a grammar defined in step I using the NFR method, by producing monomer sequences which the control set R a
Grammatik G eindeutig darstellen; IV. aus den in Schritt III hergestellten Monomersequenzen für jede Regel derDisplay grammar G clearly; IV. From the monomer sequences prepared in step III for each rule of
Regeimenge R von G ein die Regel repräsentierendes Oligomer zusammenzusetzen; V. die in Schritt IV zusammengesetzten Oligomere zu informationstragenden Polymeren zu verknüpfen.Regimen set R of G to assemble an oligomer representing the rule; V. to link the oligomers assembled in step IV to form information-carrying polymers.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, daß das Terminalalphabet Σ einer2. The method according to claim 1, characterized in that the terminal alphabet Σ one
Grammatik G die Terminale 0, 1 , n Startterminale s (s0, Si sn) und m Endterminale e (e0, e-i em), enthält, wobei n und m jeweils größer oder gleich 0 sind und eine natürliche Zahl darstellen.Grammar G contains the terminals 0, 1, n start terminals s (s 0 , Si s n ) and m end terminals e (e 0 , ei e m ), where n and m are each greater than or equal to 0 and represent a natural number.
3. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, daß die in Schritt III konstruierte Monomersequenz Nukleotide, insbesondere Ribonukleotide, besonders bevorzugt Desoxyribonukleotide umfaßt.3. The method according to claim 1 or 2, characterized in that the monomer sequence constructed in step III comprises nucleotides, in particular ribonucleotides, particularly preferably deoxyribonucleotides.
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, daß die in Schritt III konstruierte Monomersequenz Proteinerkennungssequenzen (z.B. Restriktionsschnittstellen, Proteinbindungsstellen, Stopcodons) umfaßt.4. The method according to claim 3, characterized in that the monomer sequence constructed in step III comprises protein recognition sequences (e.g. restriction sites, protein binding sites, stop codons).
5. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, daß man die Synthese der Monomersequenzen in Schritt II und III in vitro, vorzugsweise mittels eines Oligonukleotid-Synthezisers vornimmt. 5. The method according to any one of the preceding claims, characterized in that one carries out the synthesis of the monomer sequences in step II and III in vitro, preferably by means of an oligonucleotide synthesizer.
6. Verfahren zur Isolierung und Vervielfältigung von informationstragenden Polymeren, die nach einem der vorhergehenden Ansprüche erhalten wurden, dadurch gekennzeichnet, daß man in Schritt V erhaltene informationstragende Polymere in Klonierungsvektoren ligiert, kompetente Zellen mit diesen Vektoren transformiert und die erfolgreich transformierten Bakterien anhand von Selektionsmarkern selektioniert.6. A process for the isolation and duplication of information-carrying polymers which have been obtained according to one of the preceding claims, characterized in that ligating information-carrying polymers obtained in step V into cloning vectors, transforming competent cells with these vectors and selecting the successfully transformed bacteria on the basis of selection markers .
7. Verfahren zum Auslesen von Information aus informationstragenden Polymeren, die nach einem der vorhergehenden Ansprüche erhalten oder isoliert und vervielfältigt wurden, dadurch gekennzeichnet, daß man a) mindestens n-1 das informationstragende Polymer enthaltende Lösungen mit jeweils einem Paar gegenläufiger Primer versetzt, wobei n für die Zahl der als Elongatoren in dem Polymer enthaltenen Oligomere steht; b) mindestens n-1 PCR-Ansätze durchführt, wobei n für die Zahl der als Elongatoren in dem Polymer enthaltenen Oligomere steht und jeweils ein Primer eines jeden Paares in dem dem Elongator gegenüberliegenden Terminator primt und der andere Primer in dem Elongator selbst primt; c) die aus der PCR erhaltenen Polymer-Fragmente nach ihrer Länge durch Elektrophorese auftrennt und d) das aus der Elektrophorese erhaltene Muster optisch ausliest.7. A method for reading out information from information-carrying polymers obtained or isolated and reproduced according to one of the preceding claims, characterized in that a) at least n-1 solutions containing the information-carrying polymer are each mixed with a pair of opposing primers, where n represents the number of oligomers contained as elongators in the polymer; b) carries out at least n-1 PCR reactions, where n stands for the number of oligomers contained as elongators in the polymer and in each case one primer of each pair primes in the terminator opposite the elongator and the other primer primes in the elongator itself; c) the polymer fragments obtained from the PCR are separated according to their length by electrophoresis and d) optically reads the pattern obtained from the electrophoresis.
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, daß das Auslesen in Schritt d) automatisiert durch einen Scanner oder eine Sequenziermaschine erfolgt.8. The method according to claim 7, characterized in that the reading in step d) is carried out automatically by a scanner or a sequencing machine.
9. Informationstragendes Polymer, erhalten nach einem der Ansprüche 1 bis 6.9. Information-carrying polymer, obtained according to one of claims 1 to 6.
10. Zufallszahlengenerator, umfassend informationstragende Polymere, insbesondere Polymere nach Anspruch 9.10. random number generator, comprising information-carrying polymers, in particular polymers according to claim 9.
11. Polymerer Datenspeicher, umfassend informationstragende Polymere nach Anspruch 9.11. A polymer data storage device comprising information-carrying polymers according to claim 9.
12. DNA-Computer, umfassend informationstragende Polymere nach Anspruch 9.12. DNA computer, comprising information-carrying polymers according to claim 9.
13. Biochip, umfassend informationstragende Polymere nach Anspruch 9. 13. A biochip comprising information-carrying polymers according to claim 9.
14. Verwendung von informationstragenden Polymeren nach Anspruch 9 zur Herstellung von Molekulargewichtsstandards.14. Use of information-carrying polymers according to claim 9 for the production of molecular weight standards.
15. Verwendung von informationstragenden Polymeren nach Anspruch 9 zur Darstellung von Datenstrukturen.15. Use of information-carrying polymers according to claim 9 for the representation of data structures.
16. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 als Marker oder Signaturen.16. Use of information-carrying polymers, in particular polymers according to claim 9, as markers or signatures.
17. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Qualitätssicherung.17. Use of information-carrying polymers, in particular of polymers according to claim 9 for the purpose of quality assurance.
18. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Fälschungssicherung.18. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of preventing counterfeiting.
19. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung gentechnischer Erzeugnisse.19. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of labeling genetic engineering products.
20. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Lebensmitteln.20. Use of information-carrying polymers, in particular of polymers according to claim 9 for the purpose of labeling foods.
21. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Organismen.21. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of labeling organisms.
22. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung chemischer Erzeugnisse.22. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of labeling chemical products.
23. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung medizinischer und pharmazeutischer Erzeugnisse. 23. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of labeling medical and pharmaceutical products.
24. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Dokumenten.24. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of marking documents.
25. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Geld.25. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of identifying money.
26. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Gegenständen und Maschinen.26. Use of information-carrying polymers, in particular polymers according to claim 9 for the purpose of labeling objects and machines.
27. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Kennzeichnung von Flüssigkeiten, Lösungen, Suspensionen oder Emulsionen.27. Use of information-carrying polymers, in particular of polymers according to claim 9 for the purpose of labeling liquids, solutions, suspensions or emulsions.
28. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zur Verschlüsselung von Information.28. Use of information-carrying polymers, in particular polymers according to claim 9, for encrypting information.
29. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zum Zwecke der Authentisierung von Personen und Gegenständen.29. Use of information-carrying polymers, in particular polymers according to claim 9, for the purpose of authenticating people and objects.
30. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 als molekulare Kleber.30. Use of information-carrying polymers, in particular polymers according to claim 9, as molecular adhesives.
31. Verwendung von informationstragenden Polymeren nach Anspruch 9 zur Herstellung oder Bearbeitung kleinster molekularer Strukturen.31. Use of information-carrying polymers according to claim 9 for the production or processing of the smallest molecular structures.
32. Verwendung von informationstragenden Polymeren nach Anspruch 9 zur Qualitätskontrolle synthetisch hergestellter Oligonukleotide.32. Use of information-carrying polymers according to claim 9 for quality control of synthetically produced oligonucleotides.
33. Verwendung von informationstragenden Polymeren nach Anspruch 9 zur Herstellung von Biochips. 33. Use of information-carrying polymers according to claim 9 for the production of biochips.
34. 1 bis n-bytige Nukleinsäuren, insbesondere 1 bis n-bytige Nukleinsäuren erhalten nach einem der Ansprüche 1 bis 6.34. 1 to n-byte nucleic acids, in particular 1 to n-byte nucleic acids obtained according to one of claims 1 to 6.
35. 1 bis n-bytige Biochips, insbesondere 1 bis n-bytige Biochips erhalten nach einem der Ansprüche 1 bis 6.35. 1 to n-byte biochips, in particular 1 to n-byte biochips obtained according to one of claims 1 to 6.
36. Verwendung von Biochips, insbesondere von Biochips nach einem der Ansprüche 13, 33 und 35 als Datenspeicher.36. Use of biochips, in particular biochips according to one of claims 13, 33 and 35 as data storage.
37. Verwendung von Biochips, insbesondere von Biochips nach einem der Ansprüche 13, 33 und 35 zur Herstellung von optischen Anzeigegeräten oder Bildschirmen.37. Use of biochips, in particular biochips according to one of claims 13, 33 and 35 for the production of optical display devices or screens.
38. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zur Kennzeichnung einzelner Moleküle, insbesondere von Nukleinsäuren, besonders bevorzugt von Genen.38. Use of information-carrying polymers, in particular polymers according to claim 9, for identifying individual molecules, in particular nucleic acids, particularly preferably genes.
39. Verwendung von Nukleinsäuren zur Verschlüsselung von Information.39. Use of nucleic acids to encrypt information.
40. Verwendung von Nukleinsäuren zur Verschlüsselung von Information, dadurch gekennzeichnet, daß zur Entschlüsselung kurze Nukleinsäuresequenzen (Primer) als Schlüssel benutzt werden.40. Use of nucleic acids for encrypting information, characterized in that short nucleic acid sequences (primers) are used as keys for decryption.
41. Verwendung von informationstragenden Polymeren, insbesondere von Polymeren nach Anspruch 9 zur Verschlüsselung von Information, dadurch gekennzeichnet, daß das informationstragende Polymer in einer Vielzahl anderer Polymere verborgen ist.41. Use of information-carrying polymers, in particular of polymers according to claim 9 for encrypting information, characterized in that the information-carrying polymer is hidden in a large number of other polymers.
42. Verwendung von Polymeren zum Zwecke der Kennzeichnung, dadurch gekennzeichnet, daß die Polymere verschlüsselt sind.42. Use of polymers for the purpose of labeling, characterized in that the polymers are encrypted.
43. Herstellung biologisch aktiver Moleküle mit kontrolliertem, programmierbaren Verknüpfen von Sequenzen. 43. Production of biologically active molecules with controlled, programmable linking of sequences.
44. Herstellung biologisch aktiver Moleküle unter Verwendung von Algomeren.44. Production of biologically active molecules using algomers.
45. Verfahren zum Auslesen von Information aus informationstragenden Polymeren die aus den Ansprüchen 1 bis 6 erhalten oder isoliert und vervielfältigt wurden, dadurch gekennzeichnet, daß man zum Auslesen Biochips benutzt.45. A method for reading out information from information-carrying polymers which have been obtained from claims 1 to 6 or have been isolated and reproduced, characterized in that biochips are used for reading out.
46. Verwendung des NFR-Verfahrens zur Herstellung von Biochips.46. Use of the NFR process for the production of biochips.
47. Verwendung des NFR-Verfahrens zur Herstellung nanotechnologischer Komponenten oder von Komponenten nanotechnologischer Baukastensysteme. 47. Use of the NFR process for the production of nanotechnological components or of components of nanotechnological modular systems.
PCT/EP2000/002893 1999-03-31 2000-03-31 Information-carrying and information-processing polymers WO2000059917A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP00925150A EP1169330A2 (en) 1999-03-31 2000-03-31 Information-carrying and information-processing polymers
JP2000609427A JP2002541539A (en) 1999-03-31 2000-03-31 Information transmission and information processing polymer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE1999114808 DE19914808A1 (en) 1999-03-31 1999-03-31 Information-bearing polymers
DE19914808.2 1999-03-31

Publications (2)

Publication Number Publication Date
WO2000059917A2 true WO2000059917A2 (en) 2000-10-12
WO2000059917A3 WO2000059917A3 (en) 2001-02-01

Family

ID=7903204

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/002893 WO2000059917A2 (en) 1999-03-31 2000-03-31 Information-carrying and information-processing polymers

Country Status (4)

Country Link
EP (1) EP1169330A2 (en)
JP (1) JP2002541539A (en)
DE (1) DE19914808A1 (en)
WO (1) WO2000059917A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2376686A (en) * 2001-02-10 2002-12-24 Nat Inst Of Agricultural Botan Storage of encoded information within biological macromolecules
WO2004088585A2 (en) * 2003-03-31 2004-10-14 Council Of Scientific And Industrial Research A method for storing information in dna
WO2016149296A1 (en) * 2015-03-17 2016-09-22 Apdn (B.V.I.) Inc. Method for authenticating active pharmaceutical ingredients

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10120349B4 (en) * 2001-04-21 2004-10-28 Michael Schwertner Procedure for the detection of molecular binding events on affinity sensors
DE10236034A1 (en) * 2002-08-06 2004-02-19 Hilmar Rauhe New labeling material, useful in marking products for protection against counterfeiting, comprises nucleic acid encapsulated in soluble or meltable packaging
DE10260805A1 (en) 2002-12-23 2004-07-22 Geneart Gmbh Method and device for optimizing a nucleotide sequence for expression of a protein
JP2004329014A (en) * 2003-04-30 2004-11-25 Id Technica:Kk Identification additive for adding identification means having function to prevent falsifying behavior and material holding identification information and method for detecting misuse of material holding identification information
JP4752041B2 (en) * 2004-02-12 2011-08-17 独立行政法人 国立印刷局 Anti-counterfeit paper, method for manufacturing the paper, and method for identifying the paper
JP4619012B2 (en) * 2004-02-19 2011-01-26 トヨタ自動車株式会社 Construction method of 3D DNA network
JP2006094807A (en) * 2004-09-30 2006-04-13 Nissan Motor Co Ltd Informationized nucleic acid-carrying microparticle and method for producing the same
JP2006094814A (en) * 2004-09-30 2006-04-13 Nissan Motor Co Ltd Information nucleic acid and information nucleic acid composition using the same
JP2007237299A (en) * 2006-03-06 2007-09-20 Osaka Industrial Promotion Organization Method for assembling components using dna, base material for assembling components, and assembling components
DE102008008193A1 (en) 2008-02-08 2009-08-13 Schaeffler Kg Roller- or plain bearing forgery-proof marking of a valuable document, comprises a bearing body with a surface, and a marking that enables a clear identification of the bearing body and comprises a synthetic nucleic acid
DE102009060836B4 (en) 2009-12-29 2011-11-10 3Mach Gmbh soiling
JP5200069B2 (en) * 2010-07-27 2013-05-15 トヨタ自動車株式会社 3D DNA network

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139812A (en) * 1989-07-07 1992-08-18 Bioprobe Systems Method and apparatus for high security crypto-marking for protecting valuable objects
WO1997024699A1 (en) * 1995-12-29 1997-07-10 S. E. Axis Limited Authentication of articles
WO1998028320A2 (en) * 1996-12-06 1998-07-02 Nanotronics, Inc. Affinity based self-assembly systems and devices for photonic and electronic applications
US5804373A (en) * 1995-03-31 1998-09-08 Nec Research Institute, Inc. Molecular automata utilizing single- or double-strand oligonucleotides
WO1998047077A1 (en) * 1997-04-15 1998-10-22 Gmd - Forschungszentrum Informationstechnik Gmbh Parallel, universal and free-programmable information system for general computing operations

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5843661A (en) * 1996-04-24 1998-12-01 California Institute Of Technology Method for construction universal DNA based molecular turing machine

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5139812A (en) * 1989-07-07 1992-08-18 Bioprobe Systems Method and apparatus for high security crypto-marking for protecting valuable objects
US5804373A (en) * 1995-03-31 1998-09-08 Nec Research Institute, Inc. Molecular automata utilizing single- or double-strand oligonucleotides
WO1997024699A1 (en) * 1995-12-29 1997-07-10 S. E. Axis Limited Authentication of articles
WO1998028320A2 (en) * 1996-12-06 1998-07-02 Nanotronics, Inc. Affinity based self-assembly systems and devices for photonic and electronic applications
WO1998047077A1 (en) * 1997-04-15 1998-10-22 Gmd - Forschungszentrum Informationstechnik Gmbh Parallel, universal and free-programmable information system for general computing operations

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PISANTI N: "DNA computing: a survey" BULLETIN OF THE EUROPEAN ASSOCIATION FOR THEORETICAL COMPUTER SCIENCE, FEB. 1998, EUR. ASSOC. THEOR. COMPUT. SCI, NETHERLANDS, Nr. 64, Seiten 188-216, XP002148888 ISSN: 0252-9742 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2376686A (en) * 2001-02-10 2002-12-24 Nat Inst Of Agricultural Botan Storage of encoded information within biological macromolecules
GB2376686B (en) * 2001-02-10 2005-03-23 Nat Inst Of Agricultural Botan Storage of encoded information within biological macromolecules
WO2004088585A2 (en) * 2003-03-31 2004-10-14 Council Of Scientific And Industrial Research A method for storing information in dna
WO2004088585A3 (en) * 2003-03-31 2005-06-02 Council Scient Ind Res A method for storing information in dna
GB2416232A (en) * 2003-03-31 2006-01-18 Council Scient Ind Res A method for storing information in DNA
WO2016149296A1 (en) * 2015-03-17 2016-09-22 Apdn (B.V.I.) Inc. Method for authenticating active pharmaceutical ingredients

Also Published As

Publication number Publication date
WO2000059917A3 (en) 2001-02-01
EP1169330A2 (en) 2002-01-09
JP2002541539A (en) 2002-12-03
DE19914808A1 (en) 2000-10-19

Similar Documents

Publication Publication Date Title
Chen et al. Nanopore-based DNA hard drives for rewritable and secure data storage
US11713485B2 (en) Hybridization chain reaction methods for in situ molecular detection
CA2395874C (en) Dna-based steganography
WO2000059917A2 (en) Information-carrying and information-processing polymers
KR102212234B1 (en) Compositions and methods for sample processing
Van Etten et al. Radiation hybrid map of the mouse genome
Askary et al. In situ readout of DNA barcodes and single base edits facilitated by in vitro transcription
Hao et al. Data storage based on DNA
DE69837913T2 (en) PROCESS FOR THE MAKING OF NUCLEIC ACID
US6537747B1 (en) Data transmission using DNA oligomers
CN109477130A (en) The storage edited by iteration DNA
CN108138225A (en) The space orientation of nucleic acid sequence information
Shoshani et al. A molecular cryptosystem for images by DNA computing
CN107427808A (en) For preparing the method and system in nucleic acid sequencing library and the library with its preparation
DE202004021633U1 (en) Compositions for total genome amplification and genotyping
KR20210029147A (en) Compositions and methods for storing nucleic acid-based data
WO2005059096A2 (en) Methods for high fidelity production of long nucleic acid molecules with error control
Charles et al. Design of abiological digital poly (phosphodiester) s
Nguyen et al. On-chip fluorescence switching system for constructing a rewritable random access data storage device
Gogolok et al. STAR: a simple TAL effector assembly reaction using isothermal assembly
Raza et al. An outlook on the current challenges and opportunities in DNA data storage
AU2021227278A1 (en) RNA detection and transcription-dependent editing with reprogrammed tracrrnas
WO2016090130A1 (en) Methods of synthesizing polynucleotides
Park et al. Emerging strategies in infohybrid systems
EP1865070A1 (en) Method for marking a product using nucleic acids to determine its identity and origin

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 609427

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000925150

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000925150

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09937727

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 2000925150

Country of ref document: EP