WO2000056763A1 - Nouveau polypeptide et ses derives, homologues et analogues - Google Patents

Nouveau polypeptide et ses derives, homologues et analogues Download PDF

Info

Publication number
WO2000056763A1
WO2000056763A1 PCT/AU2000/000210 AU0000210W WO0056763A1 WO 2000056763 A1 WO2000056763 A1 WO 2000056763A1 AU 0000210 W AU0000210 W AU 0000210W WO 0056763 A1 WO0056763 A1 WO 0056763A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
nucleic acid
acid molecule
helminth
infection
Prior art date
Application number
PCT/AU2000/000210
Other languages
English (en)
Inventor
Keith William Savin
Vanessa Renee Cook
Yaping Chen
Jennifer Louise Sexton
Esther Apos
Lachlan Robert Wilson
Tamarae Marilyn Griffiths
Susan Elizabeth Newton
Original Assignee
Novartis Ag
Agriculture Victoria Services Pty. Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag, Agriculture Victoria Services Pty. Ltd. filed Critical Novartis Ag
Priority to AU31372/00A priority Critical patent/AU3137200A/en
Publication of WO2000056763A1 publication Critical patent/WO2000056763A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/10—Anthelmintics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
    • C07K14/4354—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the present invention relates generally to a novel polypeptide and its derivatives, homologues, and analogues which polypeptide is obtainable from a helminth, and more particularly a nematode, or produced by recombinant or chemically synthetic means.
  • the polypeptide and its derivatives, homologues and analogues of the present invention may be used in the manufacture of a composition which is capable of inducing protection in helminth-susceptible animals to infection by said helminth and/or to reduce, inhibit or otherwise retard growth, viability and/or egg fecundity of said helminth and/or to ameliorate the symptoms of helminth infection.
  • Another aspect of the present invention contemplates a method of controlling helminth, and more particularly nematode, infection, growth, viability and/or egg fecundity and/or ameliorating the symptoms of helminth infection by the administration of a polypeptide from said helminth or a derivative, homologue, or analogue of said polypeptide.
  • sequence identifier i.e. ⁇ 400>1, ⁇ 400>2, etc.
  • a sequence listing is provided after the claims.
  • a summary of the sequence identifiers is given just prior to the Examples.
  • Helminth parasites and in particular nematodes infect or infest a wide range of animals, including humans and cause widespread and significant disease.
  • Helminth parasites are a major contributor of lost production of livestock animals and require expensive and labour-intensive control measures.
  • Major disease causing helminths include species of Ostertagia and Haemonchus as well as members of the families Trichostrongylus, Nematodirus, Dictyocaulus, Cooperia, Trichuris, Oesophagostomum, Bunostomum and Mestastrongylus.
  • the control of nematode parasites has mainly been through the use of anthelmintic chemicals combined with pasture management which can have undesirable environmental and occupational hygiene implications. For this reason, alternative forms of control are particularly desirable.
  • Haemonchus contortus One of the major gastrointestinal nematodes is Haemonchus contortus. This organism is a blood-feeding parasite and resides in the abomasum of sheep and goats. The organism causes particular difficulties in sub-tropical regions and is difficult to control due to extensive pasture contamination resulting from its high fecundity. The immunological control of helminth infection has not proved particularly successful except for the cattle lungworm Dictyocaulus viviparus. Although a number of vaccine candidates have been reported for Haemonchus contortus (e.g. see International Patent Publication No. WO88/00835 and Munn et al, 1987) there is a need to develop further and more efficacious helminth vaccines.
  • helminth polypeptide useful in inducing protection of susceptible animals to helminth infection. More particularly, a novel polypeptide has been identified from Haemonchus contortus and produced by recombinant means. This class of novel polypeptides provides active molecules, which can be used in the preventive and curative vaccination of mammals against helminths.
  • one aspect of the present invention provides a polypeptide or a derivative, homologue or analogue thereof capable of inducing a protective effect against a helminth when administered to an animal infected with or susceptible to infection by said or related helminth.
  • the polypeptide is preferably derivable from a nematode and is referred to herein as "NP" for "nematode polypeptide”.
  • the present invention is exemplified herein in relation to the isolation and the use of an NP derivable from Haemonchus spp, the present invention extends to NP's from all helminths.
  • the present invention encompasses NP's from the following helminths: trematodes (e.g. of the genus Fasciola), cestodes (tapeworms), nematodes (roundworms) and acanthocephala (thornyheaded worms) which cause severe diseases in humans and animals.
  • trematodes e.g. of the genus Fasciola
  • cestodes tapeeworms
  • nematodes roundworms
  • acanthocephala thornyheaded worms
  • nematode group which can cause severe diseases in mammals and fowl, for example in sheep, pigs, goats, cattle, horses, donkeys, dogs, cats, guinea pigs, cage-birds.
  • Typical representatives of such nematodes are: Haemonchus, Trichostrongylus, Ostertagia, Nematodirus, Cooperia, Ascaris, Bunostomum, Oesphagostomum, Charbertia, Trichuris, Strongylus, Trichonema, Dictyocaulus, Capillaria, Heterakis, Toxocara, Ascaridia, Oxyuris, Ancylostoma, Uncinaria, Toxascaris and Parascaris.
  • Parasites of the families Filariidae and Setariidea are found in internal cell tissue and internal organs, e.g. in the heart, blood vessels, lymph vessels and in subcutaneous tissue. In this connection, particular mention is to be made of the dog heartworm, Dirofilaria immitis.
  • Important nematodes parasitic in dogs and cats embrace Dirofilaria immitis; Dirofilaria repens; Toxocara cati; Toxocara canis; Toxascaris leonina; Ancylostoma tubaeforme; Ancylostoma caninum; Ancylostoma braziliense, Uncinara stenocephala; and Trichuris vulpis.
  • Another aspect of the present invention is the successful control of pathogenic nematodes in humans such as those which occur in the alimentary tract.
  • Typical representatives of this type belong to the genera Ancylostoma, Necator, Ascaris, Strongyloides, Trichinella, Capillaria, Trichuris and Enterobius.
  • Other important parasitic nematodes of the genera Wuchereria, Brugia, Onchocerca and Loa of the family Filariidae and the genus Dracunculus of the family Dracunculidae, which occur in the blood, in tissue and various organs, are also encompassed by the present invention.
  • the NP comprises multiple repeats and is more preferably in the form of a polyprotein.
  • Reference herein to "NP" includes reference to mutants, fragments, parts, portions or other derivatives including antigenic fragments or precursors thereof as well as homologues, mimetics, mimotopes, analogues, monomeric forms and functional equivalents thereof.
  • such derivatives, homologues, mimetics, mimotopes, analogues, monomeric forms and functional equivalents are capable of inducing a protective effect against a nematode when administered to an animal infected with or susceptible to infection by said or related helminth.
  • An NP precursor may be a large protein comprising "repeat" subunits which is processed such as by proteolysin.
  • a "monomeric” form includes a single “repeat” portion of said NP. Multimeric forms may include two or more "repeat” subunits or parts thereof. A monomeric form may be fused to another molecule such as a peptide, polypeptide or protein or a repeat unit from another nematode-derived molecule. The multimeric or polyprotein forms of the NP may also be fused to a peptide, polypeptide or protein. Such modular molecules may be useful in increasing the range of parasites to which protection is sought.
  • Non-functional derivatives are also contemplated in the subject invention which may be useful as antagonists, agonists, to generate antibodies or in diagnostic assays.
  • a non-functional derivative includes, for example, peptides of from about 10 amino acids to about 30 amino acids or from about 15 amino acids to about 25 amino acids.
  • protection effect is used in its broadest context to include complete prevention of helminth infection, growth, viability and/or fecundity as well as reduced infection, growth, viability and/or fecundity and also includes various levels of amelioration of symptoms of helminth infection. Even a partial reduction in helminth numbers or ability to spread is useful in controlling helminth infection in animals.
  • the term “protective effect” can also be measured by increased productivity of a group of animals.
  • Another aspect of the present invention provides an NP as hereinbefore defined from a nematode said NP being capable of inducing a protective effect against a nematode when administered to animals infected with or susceptible to infection by said or related nematode.
  • the nematode may be a blood-feeding or non-blood feeding parasite.
  • the NP is from a blood-feeding parasite such as but not limited to Haemonchus species.
  • the NP is from H contortus.
  • the polypeptide i.e. the NP
  • substantially pure describes a molecule such as a polypeptide which has been separated from components that naturally accompany it.
  • a molecule is substantially pure when at least 60%, more preferably at least 75%, more preferably at least 90%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction) in a sample is the molecule of interest. Purity can be measured by any appropriate method, e.g. in the case of polypeptides, by chromatography, gel electrophoresis or ⁇ PLC analysis.
  • a molecule such as a polypeptide is also substantially purified when it is essentially free of naturally associated components when it is separated from the native contaminants which accompany it in its natural state.
  • isolated includes a substantially pure preparation and emphasizes that the molecule is in a non-naturally occurring form.
  • NP includes its derivatives, homologues, mimotopes, analogues, monomeric forms or functional equivalents.
  • Reference herein to "NP” includes molecules or fragments or precursors thereof which are capable of inducing a protective response such as a protective immune response leading to the production of immune effector molecules, antibodies or cells which damage, inhibit or kill the parasite and thereby protect the host from clinical or sub- clinical disease including loss of productivity.
  • the term "NP” also includes fragments and derivatives useful as antagonists, agonists, antigenic fragments and as diagnostic reagents.
  • the present invention provides an isolated NP as hereinbefore defined from H contortus or related organism said NP being capable of inducing a protective effect in animals against infection by H. contortus or related organism when administered to said animal before or during infection with H. contortus or related organism.
  • the preferred NP is from H. contortus and is encoded by a nucleotide sequence substantially comprising the sequence as set forth in ⁇ 400>1 or a nucleotide sequence having at least 60% similarity to ⁇ 400>1 or a nucleotide sequence capable of hybridizing to ⁇ 400>1 under low stringency conditions.
  • the NP comprises an amino acid sequence substantially as set forth in ⁇ 400>2 or an amino acid sequence having at least 60% similarity thereto.
  • Another aspect of the present invention is directed to an isolated NP as hereinbefore defined from H contortus or related nematode said NP having one or more of the following characteristics:
  • (ii) comprises an amino acid sequence substantially as set forth in ⁇ 400>2;
  • (iii) is encoded by a nucleotide sequence substantially as set forth in ⁇ 400>1 or a nucleotide sequence having at least 60% similarity to ⁇ 400>1 or a nucleotide sequence which is capable of hybridizing to ⁇ 400>1 under low stringency conditions.
  • the NP has at least two and more preferably all three of the aforementioned characteristics.
  • the present invention is directed to an isolated polypeptide or a derivative, homologue, or analogue thereof capable of inducing a protective effect against a nematode when administered to an animal infected with or susceptible to infection by said or related nematode wherein the isolated polypeptide comprises the following characteristics:-
  • (ii) comprises an amino acid sequence substantially as set forth in ⁇ 400>2 or an amino acid sequence having at least 60% similarity to ⁇ 400>2; (iii) is encoded by a nucleotide sequence substantially as set forth in ⁇ 400>1 or a nucleotide sequence having at least about 60% similarity to ⁇ 400>1 or a nucleotide sequence which is capable of hybridizing to ⁇ 400>1 under low stringency conditions.
  • similarity includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity” includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, “similarity” includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity.
  • references to describe sequence relationships between two or more polynucleotides or polypeptides include “reference sequence”, “comparison window”, “sequence similarity”, “sequence identity”, “percentage of sequence similarity”, “percentage of sequence identity”, “substantially similar” and “substantial identity”.
  • a “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length.
  • two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window” refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence.
  • the comparison window may comprise additions or deletions (i.e., gaps) of about 20%) or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
  • sequence similarity and “sequence identity” as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
  • a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) or the identical amino acid residue (e.g.
  • sequence identity will be understood to mean the "match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
  • Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15%) v/v formamide and from at least about 1M to at least about 2M salt for hybridization, and at least about 1M to at least about 2M salt for washing conditions.
  • low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions.
  • Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16%> v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridization, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31%o v/v to at least about 50%o v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridization, and at least about 0.01M to at least about 0.15M salt for washing conditions.
  • medium stringency which includes and encompasses from at least about 16%> v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridization, and at least about 0.5M to at least about 0.9M salt for washing conditions
  • high stringency which includes and encompasses from at least about 31%o v/v to at least about 50%
  • T m of a duplex DNA decreases by 1°C with every increase of 1%> in the number of mismatch base pairs (Bonner and Laskey, 1974).
  • Formamide is optional in these hybridization conditions.
  • particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1%) w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 65°C.
  • the present invention is particularly exemplified with reference to clone 65E for H. contortus which comprises the nucleotide sequence set forth in ⁇ 400>1.
  • the present invention further contemplates any repeat region within the H. contortus NP transcript and its use in a composition such as a vaccine to facilitate the induction of a protective effect when administered to a particular animal.
  • Particularly preferred repeat regions comprise nucleotide sequences which hybridize to ⁇ 400>1 under low, moderate or high stringency conditions and or which are at least about 60%> similar to all or part of ⁇ 400>1.
  • the sequence comparison is made after optimal alignment.
  • Reference herein to "NP" or " ⁇ 400>1" includes reference to all repeat regions of the H. contortus NP transcript.
  • a “derivative” includes a mutant, portion, part or fragment of a nucleotide or amino acid sequence.
  • Useful derivatives comprise single or multiple amino acid or nucleotide substitutions, additions and or deletions to the NP amino acid sequence or the nucleotide sequence encoding the NP.
  • Particularly useful derivatives of NP include a single, isolated “repeat” portion of the polypeptide. Such repeat or monomeric portions may be used to generate modular molecules comprising monomers of a range of NP molecules or one or more monomers fused to other peptides, polypeptides or proteins.
  • Amino acid insertional derivatives of the NP of the present invention include amino and/or carboxyl terminal fusions as well as intra-sequence insertions of single or multiple amino acids.
  • Insertional amino acid sequence variants are those in which one or more amino acid residues are introduced into a predetermined site in the NP although random insertion is also possible with suitable screening of the resulting product.
  • Deletional variants are characterized by the removal of one or more amino acids from the sequence.
  • Substitutional amino acid variants are those in which at least one residue in the sequence has been removed and a different residue inserted in its place.
  • the amino acids are generally replaced by other amino acids having like properties, such as hydrophobicity, hydrophilicity, electronegativity, bulky side chains and the like.
  • Amino acid substitutions are typically of single residues.
  • Amino acid insertions will usually be in the order of about 1-10 amino acid residues and deletions will range from about 1-20 residues.
  • deletions or insertions are made in adjacent pairs, i.e. a deletion of two residues or insertion of two residues.
  • Homologues include functionally, structurally or stereochemically similar polypeptides from, for example, other related helminths and in particular nematodes such as other species of Haemonchus.
  • Analogues and mimetics include molecules which contain non-naturally occurring amino acids as well as molecules which do not contain amino acids but nevertheless behave functionally the same as the NP.
  • Analogues of the subject NP's contemplated herein include modifications to side chains, incorporation of unnatural amino acids and or their derivatives during peptide synthesis and the use of crosslinkers and other methods which impose conformational constraints on the peptide molecule or their analogues.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and or D- isomers of amino acids.
  • All these types of modifications may be important to stabilize the subject NP. This may be important if used, for example, in the manufacture of a vaccine or therapeutic composition or in detection assays.
  • the present invention further contemplates chemical equivalents of the subject polypeptides.
  • Chemical equivalents may not necessarily be derived from the subject NP itself but may share certain conformational or functional similarities. Alternatively, chemical equivalents may be specifically designed to mimic certain physiochemical properties of the polypeptides. Chemical equivalents may be chemically synthesized or may be detected following, for example, natural product screening. Preferably, a chemical equivalent is a functional equivalent.
  • Functionally-equivalent variants of the novel NP's and their fragments and precursors are functionally-equivalent variants of the novel NP's and their fragments and precursors.
  • “Functionally-equivalent” is used herein to define proteins related to or derived from the native protein, where the amino acid sequence has been modified by single or multiple amino acid substitutions, addition and/or deletion and also sequences where the amino acids have been chemically modified, including by deglycosylation or glycosylation, but which nonetheless retain protective activity such as raising host protective antibodies and or functional immunity against the parasites.
  • Such functionally-equivalent variants mentioned above include natural biological variations (e.g. allelic variants or geographical variations within a species) and derivatives prepared using known techniques.
  • functionally-equivalent proteins may be prepared either by chemical peptide synthesis or in recombinant form using the known techniques of site-directed mutagenesis, random mutagenesis, or enzymatic cleavage and or ligation of nucleic acids.
  • Functionally-equivalent variants according to the invention also include analogues in different parasite genera or species.
  • Reference herein to the NP of the present invention should be read as including reference to all forms of the NP including, by way of example, isoforms, monomeric, dimeric and multimeric forms and peptide fragments of the NP as well as homologues and functional equivalents.
  • amino acid variants referred to above may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulations. Techniques for making substitution mutations at predetermined sites in DNA having known or partially known sequence are well known and include, for example, Ml 3 mutagenesis. The manipulation of DNA sequence to produce variant proteins which manifest as substitutional, insertional or deletional variants are conveniently described, for example, in Sambrook et al. (1989).
  • recombinant or synthetic mutants and derivatives of the NP of the present invention include single or multiple substitutions, deletions and/or additions of any molecule associated with the enzyme such as carbohydrates, lipids and or proteins or polypeptides.
  • the NP is a recombinant molecule produced by the expression of a cDNA or genomic sequence in a suitable host cell.
  • nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding an NP as hereinbefore defined which NP is capable of inducing a protective effect against a helminth and in particular a nematode when administered to an animal infected with or susceptible to infection by said or related nematode.
  • the NP is from a blood-feeding nematode such as but not limited to a species of Haemonchus. More preferably, the NP is from H. contortus or related organism.
  • the nucleic acid molecule encodes an amino acid sequence substantially as set forth in ⁇ 400>2 or an amino acid sequence having at least 60% similarity to ⁇ 400>2.
  • the nucleic acid molecule is in isolated or substantially pure form.
  • the present invention is directed to an isolated nucleic acid molecule comprising a sequence of nucleotides substantially as set forth in ⁇ 400>1 or a sequence having at least about 60%) similarity to ⁇ 400>1 or a sequence capable of hybridizing to ⁇ 400>1 under low stringency conditions.
  • the nucleic acid molecule may be a genomic or cDNA sequence or an RNA or RNA:DNA hybrid. With respect to the sequence having a genomic sequence, it may also be defined by reference to a non-coding portion thereof such as, but not limited to, a promoter sequence or a regulatory sequence.
  • the nucleic acid molecule is resident in a vector such as but not limited to an expression vector.
  • the expression vector may be capable of replication and/or expression in prokaryotic and or eukaryotic cells.
  • expression vectors operable in E. coli or other bacteria or insect cells are particularly useful in the practice of the present invention.
  • Other useful cell types include yeast, mammalian cells and C. elegans.
  • the present invention extends to nucleotide sequences which encode an NP including functional and non-functional variants thereof.
  • Such molecules may be obtained by using conventional methods well known in the art.
  • Non- functional variants are also contemplated by the present invention such as molecules useful as antisense molecules, sense molecules (for co- suppression), primers and probes.
  • Other non-functional variants include chemical derivatives or analogues of nucleotides and nucleosides. Such chemical derivatives and analogues also include pyrimidme C5 propyne modifications and phosphothiorite modifications. All such variants are encompassed herein by the term "nucleic acid molecule".
  • NP's according to the present invention may be prepared in recombinant form by expression in a host cell containing a recombinant DNA molecule which comprises a nucleotide sequence as broadly defined above, operatively linked to an expression control sequence, or a recombinant DNA cloning vehicle or vector containing such a recombinant DNA molecule.
  • Synthetic polypeptides expressed in this manner form a further aspect of this invention (the term "polypeptide” is used herein to include both full-length protein and shorter length peptide sequences).
  • the NP so expressed may be a fusion polypeptide comprising all or a portion of NP according to the invention and an additional polypeptide coded for by the DNA of the recombinant molecule fused thereto.
  • This may for example be -galactosidase, glutathione-S-transferase, hepatitis core antigen, a polyhistidine tag or any of the other polypeptides commonly employed in fusion proteins in the art.
  • aspects of the invention thus include cloning and expression vectors containing the DNA coding for an antigen of the invention and methods for preparing recombinant nucleic acid molecules according to the invention, comprising inserting nucleotide sequences encoding the antigen into vector nucleic acid, e.g. vector DNA.
  • expression vectors include appropriate control sequences such as for example translational (e.g. start and stop codons, ribosomal binding sites) and transcriptional control elements (e.g. promoter-operator regions, termination stop sequences) linked with the nucleic acid molecules of the invention.
  • a vector according to the present invention includes plasmids and viruses (including both bacteriophage and eukaryotic viruses) which are well known and documented in the art, and may be expressed in a variety of different expression systems, also well known and documented in the art.
  • Suitable viral vectors include baculovirus and also adenovirus and vaccinia viruses. Many other viral vectors are described in the art.
  • the present invention also includes transformed or transfected prokaryotic or eukaryotic host cells, or transgenic organisms containing a nucleic acid molecule according to the subject invention as defined above.
  • host cells may for example include prokaryotic cells such as E. coli, eukaryotic cells such as yeasts or the baculovirus-insect cell system, transformed mammalian cells and transgenic animals and plants. Particular mention may be made of transgenic nematodes (see, for example, Fire, 1986).
  • a further aspect of the invention provides a method for preparing an NP as hereinbefore defined which method comprises culturing a host cell containing a nucleic acid molecule encoding all or a portion of said NP under conditions whereby said NP is expressed and recovering said NP so produced.
  • the nucleic acid molecule is a cDNA molecule in a vector such as pFastBac-Htc (Life Technologies) which is capable of expressing the cDNA in insect cells such as Spodoptera frugiperda (S 9) or High Five (Trademark) cells (Trichoplusia ni) [Invitrogen Corporation].
  • the cDNA insert encoding NP is present in a bacterial expression vector such as pET30a (Novagen) which is capable of expressing the cDNA in E. coli.
  • the cDNA insert encoding NP is present in a baculovirus vector such as a baculovirus secretion vector.
  • NP of the present invention and nucleic acid molecules encoding same have a range of uses including the treatment of helminth and in particular nematode infection. Accordingly, another aspect of the present invention contemplates the use of NP to induce a protective effect against helminth and more particularly nematode infection.
  • the nematode is H. contortus or a related species.
  • one form of treatment is the administration of the NP to induce a protective effect.
  • the protective effect may be through a range of mechanisms including competitive antagonism of the naturally occurring NP or its ligand or production of a protective immune response including induction of immune cells and/or antibodies.
  • another aspect of the present invention contemplates a method of inducing protection in a helminth-susceptible animal to infection by said helminth, said method comprising administering to said animal an effective amount of an NP to reduce, inhibit or otherwise retard the growth, viability and/or egg fecundity of said helminth and/or to ameliorate the symptoms of helminth infection.
  • Yet another aspect of the present invention provides a method for controlling helminth infection, growth, viability and/or egg fecundity and/or ameliorating the symptoms of helminth infection, said method comprising administering to an animal infected with or susceptible to infection with said helminth an effective amount of an NP to reduce, inhibit or otherwise retard the growth, viability and/or egg fecundity of said helminth and/or to ameliorate the symptoms of helminth infection.
  • Still yet another aspect of the present invention is directed to the use of a polypeptide in the manufacture of a medicament to induce a protective effect against helminth infection or spread.
  • Another aspect of the present invention provides a composition comprising an NP as hereinbefore defined and one or more pharmaceutically acceptable carriers and/or diluents and/or adjuvants.
  • the vaccine composition may be prepared using NP's of the present invention prepared and stored as ready-to-use liquid formulations.
  • the aqueous solution is generally applicable, but the formulation can also be adapted to the specific type of administration.
  • the pharmaceutical formulation can also contain non-ionic surfactants that carry no discrete charge when dissolved in aqueous media and are selected from ethoxylated esters of fatty acids and triglycerides.
  • the NP formulation may also contain stabilizing agents such as methionines, ascorbic acid, and preservatives such as propylene glycol.
  • the NP's of the present invention are administered parenterally, precutaneously or even by implant.
  • the administration is carried out via intramuscular, subcutaneous, intradermal or intravenous injection, most preferably subcutaneously.
  • the active agents according to the present invention are generally administered using a pharmaceutically acceptable vehicle or excipient.
  • Suitable vehicles are, for example, water, saline, mannitol, dextran, amino acids, glycerol, or the like, in various combinations.
  • the vehicle may contain auxiliary substances such as wetting or emulsifying agents, preservatives and pH buffering agents.
  • the NP is typically in range from about 0.001% to about 95%> w/w of the compositions administered, or even higher or lower if appropriate.
  • Parenteral administration may be conventionally accomplished by subcutaneous, intradermal, intramuscular, and even intravenous injection. Needle-less air-blast injection devices may be equally used. Parenteral administration is well known in the art and may be carried out in ways usual in the animal veterinary or human medical art.
  • Sustained action of the active agent to achieve prolonged release can be obtained by formulating the protein in a matrix that will physically inhibit rapid dissolution.
  • the formulated matrix is injected into the animal's body where it remains as a depot from which the protein is slowly released.
  • Useful adjuvants are polymers and copolymers of lactides and glycosides.
  • gelling agents like aluminium, calcium or magnesium monostearate, or carbohydrates (cellulose, pectin, dextran derivatives), polysiloxanes or proteins (gelatin, collagen) could extend the releasing time of the active agents of the present invention after parenteral application.
  • Percutaneous administration is also meant to include implantation of controlled release devices, e.g.
  • implantable matrices from polymeric materials can be used subcutaneously to deliver the compound over the required period of time. This can also be achieved by implantation of minipumps containing aqueous solutions of the protein. Such implantation techniques are also well known in the art and often used in medical treatment.
  • Polysiloxane carriers are described in the art for a variety of hormonal delivery forms and may be adapted to the release of the active agents of the present invention.
  • a collagen delivery system for the release of antibiotics is described in the German Offenlegungsschrift DE- 3,429,038. This system can also be adapted for the present invention.
  • Slow release formulations and other pharmaceutical or veterinary formulations of the inventive polypeptide can be prepared by adapting, for example, polypeptide or protein-containing formulations already described in the art.
  • composition including a vaccine is greatly used in combination with an adjuvant.
  • adjuvant includes any substance or means which facilitates antigen presentation, antigen targeting and immune modulation.
  • Antigen presentation includes a way in which a particular molecule is presented in a vaccine.
  • Antigen targeting includes the efficiency which a particular molecule is presented to appropriate effector cells of the immune system.
  • Immune modulation includes any processing of antigens or their epitopes by immune effector cells resulting in a facilitating effect on a particular immune response.
  • Adjuvants may be particulate or non-particulate.
  • particulate antigens include aluminium salts, water-in-oil emulsions, oil-in-water emulsions and ISCOMS, liposomes, proteosomes, micro-encapsulation or other substances such as stearyltyrosine and gamma- inulin and algammulin.
  • non-particulate adjuvants include saponin, QuilA, peptides such as but not limited to muramyl dipeptides and analogues, desmuramylpeptides and lipopeptides, surface active molecules such as non-ionic block copolymers and trehalose dimycolate, nucleic acid derivatives such as synthetic polynucleotides, hypoxanthine derivatives and pyrimidones, sulfur containing compounds such as levamisole, carbohydrate polymers such as lentinan and DEAE dextran, cytokines such as but not limited to the interleukins and interferons and lipid molecules such as fat-soluble vitamins and lipopolysaccharide derivatives.
  • a “therapeutically effective amount” includes reference to a “therapeutically effective vaccine dose” and encompasses the complete or partial prevention of helminth infection, growth, viability and or fecundity as well as reduced infection, growth, viability and/or fecundity and prevention of re-infection, and also includes various levels of amelioration of symptoms of helminth infection.
  • the "effective amount” also includes partial reduction in helminth number.
  • the dosages of the active agents of the present invention can be easily determined in view of this disclosure by one of ordinary skill in the art by running routine trials with appropriate controls. Comparison of the appropriate treatment groups to the controls will indicate whether a particular dosage provides a protective effect.
  • the effective dosage may vary depending on the mode of administration. If administered intramuscularly, subcutaneously, intradermally or intravenously, effective dosages may depend on the age of the animal. Typically, dosages are in the range of from about 2 ⁇ g to about 1000 ⁇ g per injection per animal and more preferably 20 ⁇ g to about 200 ⁇ g per injection per animal. More typically, the dose is at least about 50-100 ⁇ g per injection per animal. Typically, a primary immunization is given followed by one or more booster immunizations given 2-8 weeks apart. Other modes of administration are contemplated by the present invention and include intranasal, intraperitoneal, intrathecal, rectal, infusion and intrapulmonary administration. Administration may also be by injection, nasal drip, aerosol, infusion through the skin or membrane surfaces or ingestion.
  • a particularly useful form of the vaccine is a recombinant vaccine comprising a vaccine vector, such as but not limited to a virus vector (e.g. a vaccinia virus vector) or bacterial cell capable of expressing an NP or the vaccine may comprise a polypeptide produced by a vaccine vector.
  • a vaccine vector such as but not limited to a virus vector (e.g. a vaccinia virus vector) or bacterial cell capable of expressing an NP or the vaccine may comprise a polypeptide produced by a vaccine vector.
  • the present invention clearly extends to recombinant vaccine compositions in which the NP at least is contained within killed vaccine vectors prepared, for example, by heat, formalin or other chemical treatment, electric shock or high or low pressure forces.
  • the NP of the vaccine is generally synthesized in a live vaccine vector which is killed prior to administration to an animal.
  • a live vector or nucleic acid molecule may be administered.
  • the vaccine vector expressing the NP may be non-pathogenic or attenuated.
  • non-pathogenic or attenuated viruses and bacteria which express NP and non-pathogenic or attenuated viruses which express NP and which are contained within a non-pathogenic or attenuated host cell.
  • Attenuated or non-pathogenic host cells include those cells which are not harmful to an animal to which the subject vaccine is administered.
  • live vaccines can comprise an attenuated virus vector expressing the NP or a host cell comprising same, which is capable of replicating in an animal to which it is administered, albeit producing no adverse side-effects therein.
  • Such vaccine vectors may colonize the gut or other organ of the vaccinated animal.
  • live vaccine vectors are efficacious by virtue of their ability to continually express the NP in the host animal for a time and at a level sufficient to confer protective immunity against a pathogen which expresses an immunogenic equivalent of said NP.
  • the present invention clearly encompasses the use of such attenuated or non-pathogenic vectors and live vaccine preparations.
  • the vaccine vector may be a virus, bacterial cell or a eukaryotic cell such as an avian, porcine or other mammalian cell or a yeast cell or a cell line such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDCK cell lines.
  • Suitable prokaryotic cells include Mycobacterium spp., Corynebacterium spp., Salmonella spp., Escherichia coli, Bacillus spp. and Pseudomonas spp, amongst others.
  • Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1987; Sambrook et al, 1989).
  • Suitable viral vectors include but are not limited to vaccinia virus and adenovirus.
  • Such cells and cell lines are capable of expression of a genetic sequence encoding an NP of the present invention in a manner effective to induce a protective effect in the animal.
  • a non-pathogenic bacterium could be prepared containing a recombinant sequence capable of encoding an NP.
  • the recombinant sequence would be in the form of an expression vector under the control of a constitutive or inducible promoter.
  • the bacterium would then be permitted to colonize suitable locations in an animal's gut and would be permitted to grow and produce the recombinant NP in amount sufficient to induce a protective response against a nematode.
  • the vaccine can be a DNA vaccine comprising a DNA molecule encoding an NP of the present invention and which is injected into muscular tissue or other suitable tissue in an animal under conditions sufficient to permit transient expression of said DNA to produce an amount of NP effective to induce a protective response.
  • the NP in a suitable vector system.
  • the NP can be expressed by:
  • nucleic acid molecule comprising the coding region of the nucleotide sequence set forth in Figure 1 or a protein-encoding homologue, analogue or derivative of the sequence set forth in Figure 1 selected from the group consisting of:
  • nucleotide sequences that hybridize under at least low stringency hybridization, preferably under at least moderate stringency conditions, and even more preferably under high stringency conditions, to the complement of the nucleotide sequence set forth in Figure 1 ;
  • nucleotide sequences that encode the amino acid sequence set forth in Figure 1 or a homologue, analogue or derivative thereof, including, for example, a mimotope of the amino acid sequence set forth in Figure 1;
  • nucleotide and amino acid sequences in Figure 1 correspond to ⁇ 400>1 and ⁇ 400>2.
  • nucleic acid molecule in an expressible format is a protein-encoding region of a nucleic acid molecule placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in the vaccine vector system.
  • promoter includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner.
  • promoter is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operatively associated, and which encodes the NP.
  • Preferred promoters can contain additional copies of one or more specific regulatory elements, to further enhance expression and or to alter the spatial expression and/or temporal expression of the said nucleic acid molecule.
  • Placing a nucleic acid molecule under the regulatory control of i.e., "in operative association with” or “operably linked to” a promoter sequence means positioning the molecule such that expression is controlled by the promoter sequence. Promoters are generally, but not necessarily, positioned 5' (upstream) to the genes that they control.
  • a preferred amount is from about 0.1 ⁇ g/ml to about 5 mg/ml in a volume of about 0.05 to about 5 ml.
  • the DNA can be present in "naked” form or it can be administered together with an agent facilitating cellular uptake (e.g., in liposomes or cationic lipids).
  • an agent facilitating cellular uptake e.g., in liposomes or cationic lipids.
  • the important feature is to obtain sufficient expression of the nucleotide sequence encoding the immunogen in the cells of the animal after injection to induce a protective immune response. Dosage regime can be adjusted to provide the optimum therapeutic response.
  • Still another aspect of the present invention is directed to antibodies to the NP of the present invention as hereinbefore defined.
  • Such antibodies may be monoclonal or polyclonal.
  • the antibodies of the present invention are particularly useful for as therapeutic or diagnostic agents.
  • the NP's of the present invention may be used, for example, as an antigen to screen for naturally occurring antibodies to NP in infected animals.
  • specific antibodies to the NP may be used to screen for NP or an antigenic derivative or relative in a sample.
  • the effectiveness or otherwise of a vaccination can also be monitored by the instant antibodies.
  • Techniques for such assays are well known in the art and include, for example, sandwich assays and ELIS A.
  • the NP is particularly useful in screening for antibodies to NP or a related polypeptide and, hence, provide a diagnostic protocol for detecting the presence or likelihood of the presence of a nematode in a biological sample or for assessing the effectiveness of a vaccination. It is also useful for assisting in the diagnosis of nematode infection in animals carrying or otherwise infected by this organism.
  • the present invention provides a method for detecting the presence of a nematode and in particular a species of Haemonchus such as H. contortus in a biological sample, said method comprising contacting said biological sample with a NP from said nematode or related species or an antibody-binding portion or fragment thereof for a time and under conditions sufficient for a complex to form between said NP and an antibody, if present in said biological sample, and then detecting said complex.
  • the present invention further extends to the use of the subject NP in the manufacture of a medicament to induce a protective effect against helminth infection or spread.
  • the nematode is a blood-feeding parasite such as a species of Haemonchus for example H contortus.
  • the preferred NP comprises an amino acid sequence set forth in ⁇ 400>2 or an amino acid sequence having at least about 60% similarity thereto.
  • Figure 1 is a representation of the nucleotide [ ⁇ 400>1] and deduced amino acid [ ⁇ 400>2] sequences of clone 65E (NP). The 3-letter code is given for the amino acid sequence.
  • Figure 2 is a photographic representation of a Northern blot of H. contortus mRNA probed with an antisense oligonucleotide based on clone 65E cDNA sequence.
  • the position of the NP mRNA transcripts are marked with an arrow.
  • Figure 3 is a photographic representation of a Northern blot of H. contortus mRNA probed with the cDNA insert from clone 65E cDNA.
  • the position of the NP mRNA transcripts are marked with an arrow.
  • Figure 4 is a photographic representation of a Western blot of H. contortus parasite extracts and excretory-secretory (E/S) products probed with sheep antibodies raised to baculovirus- expressed recombinant 65E protein.
  • Figure 5 is a representation of nucleotide [ ⁇ 400>3] and corresponding amino acid [ ⁇ 400>4] sequence of clone 65E insert in the pFastBac-HTc vector at the cloning junction.
  • the His x 6 tag is underlined and the Not I site which was used to clone the 65E NP fragment into the vector is shown in bold. Other selected restriction sites in the vector multiple cloning site are indicated.
  • the first amino acid following the Not I site (Val) derives from the linker-adaptors used in construction of the cDNA library.
  • Cloning vector pFastBac-HTc information is from Life Technologies.
  • Figure 6 is a representation of the expression of recombinant clone 65E in Sf9 cells using the pFastBac-Htc vector.
  • the position of the NP protein is marked with an arrow.
  • Figure 7 is a photographic representation showing purified clone 65E produced using the
  • Baculovirus vector pFastBac-Htc Baculovirus vector pFastBac-Htc.
  • the position of the NP protein is marked with an arrow.
  • Figure 8 is a representation of nucleotide [ ⁇ 400>6] and corresponding amino acid [ ⁇ 400>7] sequence of clone 65E insert in the pET30a vector at the cloning junction.
  • the His x 6 tag is underlined and the Not I site which was used to clone the 65E NP fragment into the vector is shown in bold. Other selected restriction sites in the vector multiple cloning site are indicated.
  • the first amino acid following the Not I site (Val) derives from the linker-adaptors used in construction of the cDNA library.
  • Cloning vector pET30a information is from Novagen.
  • Figure 9 is a photographic representation of the expression of recombinant clone 65E in E. coli cells using the pET30a vector.
  • Figure 10 is a photographic representation showing purified clone 65E produced using the E. coli vector pET30a.
  • BSA Bovine serum albumin
  • the position of the NP protein is marked with an arrow.
  • Figure 11 is a photographic representation showing a trial of serum antibody responses in sheep immunized with recombinant NP produced using the pFastBac-Htc vector in insect cells. Key:
  • Pre-bleeds serum samples taken prior to immunization with NP protein.
  • Pre-challenge serum samples taken after three immunizations with NP protein, prior to challenge with infective H. contortus L3.
  • Each serum is assayed at a 1/1,000 and 1/10,000 dilution (left to right), except for the pre- challenge bleed for sheep no 4800, which is only assayed at 1:1,000.
  • Figure 12 is a photographic representation showing titration of a trial of serum antibody responses in sheep after 3 vaccinations with NP produced in insect cells using pFastBac- ⁇ tc.
  • Each serum is tested at a 1/90,000, 1/270,000 and 1/810,000 dilution (from right to left).
  • Figure 13 is a photographic representation showing a trial of serum antibody responses in sheep to vaccination with NP protein produced using pFastBac- ⁇ tc in insect cells in comparison with vaccination with NP protein produced using pET30a in E. coli.
  • Each serum is assayed at a 1/1,000 and 1/10,000 dilution (left to right).
  • Messenger RNA mRNA or poly A+ RNA was purified by chromatography on oligo dT cellulose (Sigma Aldrich).
  • a cDNA library was constructed from the mRNA by Clontech Laboratories Inc., U.S.A., using the vector ⁇ ZAPII.
  • the cDNA was cloned into the ⁇ ZAPII Not I site via cloning adaptors containing restriction sites for Not I.
  • the library contained 5 x 10 independent clones with an average insert size of 1.5 kilobase pairs (kbp) and a range of 0.5 - 4.5 kbp.
  • the library was screened by hybridization with an oligonucleotide probe (5 '-GCTGGAATCCGTGTCATCATGATCACCGGAGACAACAAG-3 ' ⁇ 400>7) designed against a Caenorhabditis elegans calcium ATPase. Briefly, 20,000 plaque forming units (pfu) were plated on Escherichia coli BB4 cells at 2,000 pfu per 135 mm plate and plaques were allowed to form overnight at 37°C. Plaque lifts were taken in duplicate onto ⁇ ybond N filters (Amersham Australia) as described by Sambrook et al. (1989) and DNA UV-cross-linked to the filters using a Stratalinker (Stratagene).
  • Filters were pre-hybridized at 40°C in hybridization buffer (6 x SSC (90 mM NaCl, 9 mM Na-citrate), 0.25% w/v skim milk powder, 0.2% w/v sodium dodecyl sulphate (SDS), 10 mM EDTA, 40 mM Na-phosphate, p ⁇ 7-8) for 2 hours.
  • the oligonucleotide probe was labelled with ⁇ - 32 P-dCTP (Bresatech Pty Ltd, Australia) using terminal transferase (Promega Corporation) in the manufacturer's buffer for IV2 hours at room temperature. The probe was added to the pre-hybridization mix and hybridization carried out overnight at 40°C. Filters were washed 3 times in 5 x SSC at 40°C and exposed to X-ray film at -70°C with an intensifying screen. Putative positive clones were re-screened until purified stocks were obtained.
  • Plasmid DNA was prepared from 10 ml cultures using cetyl-trimethyl ammonium bromide (CTAB) as described by Del Sal et al. (1989) and insert sizes determined by digestion with Not I followed by agarose gel electrophoresis.
  • CTAB cetyl-trimethyl ammonium bromide
  • flanking vector primers Ml 3 universal: 5'- GTAAAACGACGGCCAGT-3' ⁇ 400>15; and T3: 5'- CAATTAACCCTCACTAAAG 3' ⁇ 400>9
  • Dye Deoxy Terminator kits Applied Biosystems. Sequence data were analyzed using SeqEd software (Applied Biosystems). Database searches were carried out using the BLAST programs (Altschul, 1990) with the non-redundant databases on the NCBI computer using the Australian National Genome Information Service (ANGIS) as an interface.
  • ANGIS Australian National Genome Information Service
  • clone ID number 65E contained an insert of approximately 2.0 kbp.
  • Clone 65E was tentatively assigned to a group of proteins which are secreted by parasites or are associated with cuticles and which consist of a series of repeating subunits. These subunits are separated by consensus cleavage sites for the subtilisin class of serine endoprotease (K R.X.K/R.R) (Barr, 1991). Cleavage yields multiples of the subunits of various sizes, giving a laddered appearance on SDS-polyacrylamide gel electrophoresis (SDS- PAGE); hence they are also known as "ladder proteins".
  • plasmid DNA was prepared from the original 65E clone in pBluescript SK+ (obtained by excision from the ⁇ ZAPII clone isolated by library screening) and purified using a CsCl gradient (Sambrook et al, 1989).
  • the purified plasmid DNA was digested with Kpn I and Eco RV and exonuclease IH deletions were generated using the Erase-a-Base kit (Promega) according to the manufacturer's instructions. Twelve samples were taken at 30-second intervals and the deletants from each time point cloned in pBluescript SK+.
  • Plasmid DNA was purified from twelve individual colonies in duplicate from each time point using a spin miniprep kit (QIAGEN) and sequenced using T7 primer (5'GTAATACGACTCACTATAG 3' ⁇ 400>8) as described above. To confirm the DNA sequence, the other strand was also sequenced by subcloning the 65E cDNA insert into pBluescript KS+ to obtain the opposite orientation, repeating the exonuclease deletion experiment and sequencing deletant clones with the T3 primer (5' CAATTAACCCTCACTAAAG 3' ⁇ 400>9).
  • phosphate hybridization buffer 7 w/v SDS, 0.25 M NaPO 4 , p ⁇ 6.5, 1 mM EDTA, 0.15 mg/ml herring sperm DNA.
  • GTGATGGCGGCAATGAATTCTTCAATCTTG-3' ⁇ 400>10) was labelled with ⁇ - 32 P- dCTP using terminal transferase (Promega) in buffer supplied by the manufacturer for VA hours at room temperature.
  • the probe was hybridized to the blot in phosphate hybridization buffer without herring sperm DNA at 42°C overnight.
  • the blot was washed 2 15 min in 6 x SSC/0.1% w/v SDS, 2 x 15 min in 2 x SSC/0.1% v/v SDS then 2 x 15 min in 0.5 x SSC/0.1% w/v SDS, and exposed to X-ray film at -70°C.
  • clone 65E represents about 35-40% of the NP transcript.
  • the transcript was detected in adult mRNA only, suggesting that expression was confined to the adult stages of the parasite.
  • the Northern blot was stripped of the oligonucleotide probe by incubation in 1 mM Tris, pH 7.5, 1 mM EDTA, 0.1% w/v SDS at 95°C for 10 min and re-hybridized with the entire clone 65E cDNA insert.
  • the 65E cDNA fragment was labelled with ⁇ - 32 P- CTP using a Prime-a-Gene labelling system (registered trademark; Promega) under conditions specified by the manufacturer.
  • the blot was pre-hybridized and hybridized in phosphate buffers as described above, then washed 3 x 15 min in 0.1 x SSC/0.1%> w/v SDS at 42°C, 50°C and 65°C, respectively, and exposed to X-ray film for 2 hours at -70°C.
  • Hybridization to 2 transcripts at approximately 5.0-5.5 kbp was again detected predominantly in the young adult mRNA population (Figure 3A).
  • Re-exposure of the blot to the X-ray film for 9 days showed that there was expression of the NP transcripts in the larval stages, but at very low levels compared to expression in adults ( Figure 3B).
  • Exsheathed L3, in vitro cultured early L4 and adult H. contortus parasites were stored frozen at -70°C until use.
  • frozen parasites were ground to a powder in a mortar and pestle with liquid nitrogen. The powder was resuspended in phosphate buffered saline (PBS), pH 7.2, and clarified by centrifugation for 15 min at 13,000g at 4°C. The supernatant (aqueous-soluble fraction) was decanted and stored frozen at -70°C.
  • PBS phosphate buffered saline
  • the pellet was resuspended in 150 mM NaCl, 5 mM EDTA, 50 mM Tris, pH 8.0, 0.5% v/v Triton X-100 and rotated at 4°C for 1 hr. Following clarification by centrifugation for 15 min at 13,000g, 4°C, the supernatant (detergent-soluble fraction) was decanted and stored frozen at -70°C. Both buffers were supplemented with protease inhibitors (Trademark; Complete, EDTA-free, Protease Inhibitor Cocktail Tablets, Roche).
  • E/S (excretory/secretory) antigens from adult parasites adults harvested from infected sheep, were rinsed in PBS prior to resuspending in RPMI medium (no phenol red) supplemented with 20 mg/1 gentamycin (Sigma), 600 mg/1 benzylpenicillin (CSL) and 1 g/1 streptomycin (CSL) at a concentration of 20 parasites/ml. Parasites were cultured in 6 well tissue culture plates (5 ml/well) for 4 hr at 37°C in an atmosphere of 5% v/v CO .
  • the supernatant (supplemented with protease inhibitors (Trademark; Complete, EDTA-free, Protease Inhibitor Cocktail Tablets, Roche) and lmM EDTA), was clarified for 10 min at 3,000 rpm and concentrated in dialysis tubing (3,500 dalton cut-off) covered in aquacide (Calbiochem). The concentrate was stored at -70°C.
  • L3 were activated by agitation in Earle's Balanced Salt Solution (EBSS), pH 7.2 at 40°C for 15min. CO 2 was vigorously bubbled into the closed culture vessel for 15 min to initiate larval exsheathment. The CO 2 in the flask was released after 90 min and agitation continued for a further 24 hr. Exsheathed L3 (xL3) were migrated over a series of sieves (37, 20 and 20 ⁇ m) to separate from the L2 cuticles and debris.
  • EBSS Earle's Balanced Salt Solution
  • ⁇ L3 were axenized by resuspending the larvae in axenization fluid (140 mM NaCl, 5 mM KC1, 10 mM glucose, 20 mM Na 2 HPO 4 , 5 mM NaH 2 PO 4 , 600 mg/1 benzylpenicillin and 1 g/1 streptomycin, 10 mg/1 amphotericin B and 40 mg/1 gentamycin), changing the buffer 4 times over a period of 2 hr.
  • axenization fluid 140 mM NaCl, 5 mM KC1, 10 mM glucose, 20 mM Na 2 HPO 4 , 5 mM NaH 2 PO 4 , 600 mg/1 benzylpenicillin and 1 g/1 streptomycin, 10 mg/1 amphotericin B and 40 mg/1 gentamycin
  • Protease inhibitors (Trademark; Complete, EDTA-free, Protease Inhibitor Cocktail Tablets, Roche) and 1 mM EDTA were added immediately. The larvae were placed back into culture in fresh medium for a further 24 hr. The day 5 xL3/L4 E/S was harvested similarly. Both batches of E/S were concentrated in dialysis tubing (3,500 dalton cut-off) covered in aquacide (Calbiochem) and stored at -70°C until use.
  • Membranes were blocked in 5% w/v skim milk powder (Blotto) in PBS containing 0.05% v/v Tween 20 (PBST) for a minimum of 30 min prior to incubation in the NP-specific primary antibody.
  • the NP-specific antibody used was a pool from two sheep which had been vaccinated with NP expressed in baculovirus infected insect cells. The antibody was diluted 1/1,000 in PBST containing 5%> w/v Blotto and incubated with the Western blot at room temperature for 1 hr.
  • Bound antibody was detected using a donkey anti-sheep antibody conjugated to horse-radish peroxidase (Sigma) at a 1/1,000 dilution in PBST, 5% w/v Blotto for 1 hr at room temperature.
  • Antibody complexes were detected using the chemiluminescence substrate, BM Chemiluminescence Blotting Substrate (POD) (Boehringer Mannheim) as per the manufacturer's instructions.
  • POD BM Chemiluminescence Blotting Substrate
  • NP protein was detected as a ladder of immunoreactive bands of approximately 80, 70, 40 and 30 kD in the aqueous extract of adult parasites. A weak reaction to similar bands was seen in the xL3 extracts ( Figure 4). NP was abundant in the E/S of both adult and day 4 in vitro cultured xL3/L4. The 40kD band was not detected in the E/S of the Day 5 in vitro cultured L4.
  • Recombinant proteins were produced using the recombinant baculovirus/insect cell system.
  • the Bac-to-Bac system (Life Technologies) was used.
  • the Not I fragment from clone 65E was subcloned into the baculovirus transfer vector pFastBac Htc (Life Technologies), placing it in frame with the N-terminal His-tag (His x 6) ( Figure 5). Plasmid DNA was prepared using a Jetstar kit (Trademark; GENOMED) and sequenced as described above, using the flanking baculovirus vector primers #1337 (5'- GAAACCATGTCGTACTACCATCAC-3' ⁇ 400>11) and #1336 (5'- TATGGCTGATTATGATCCTCT-3' ⁇ 400>12), to determine orientation and confirm the reading frame.
  • the clone was transposed into DHlOBac cells (Life Technologies) according to the manufacturer's instructions, and bacmid DNA purified using the Jetstar kit (Trademark; GENOMED) according to instructions.
  • the bacmid DNAs were transfected into Spodoptera frugiperda (S ⁇ ) cells (Invitrogen Corporation) using Cellfectin (Life Technologies) according to the manufacturer's instructions.
  • Recombinant virus from the transfection was harvested and amplified and the amplified virus stock used to infect a 100 ml spinner culture of S ⁇ cells. Cells were harvested 72 hours after infection by centrifugation at 2,500 rpm for 10 minutes.
  • the cells were resuspended in 15 ml PBS and sonicated for 30 seconds on ice.
  • the insoluble material was removed by centrifugation at 15,000 rpm for 10 minutes and the supernatant (aqueous soluble material) retained.
  • the residual pellet was resuspended in 15 ml PBS, re- sonicated and re-centrifuged to yield a second PBS-soluble fraction.
  • the residual pellet was resuspended in 15 ml PBS.
  • Expression of NP in aliquots of these samples was analysed by Coomassie Blue-stained SDS-PAGE using a 10%> w/v resolving gel ( Figure 6).
  • a protein of approximately 80 kDa was produced by the insect cells infected with the recombinant baculovirus vector. The protein was present at high levels in the total cell suspension sample and most of the protein was extracted in the first PBS extract. Thus, the protein is produced in aqueous soluble form.
  • NP For production of NP from the pFastBac vector, spinner cultures of S ⁇ cells grown in Grace's Insect Cell medium (Life Technologies) supplemented with 10% v/v fetal calf serum (CSL Ltd), 1%) v/v fiingizone (Life Technologies) and 1 ⁇ g/ml gentamycin (Sigma), were infected with the recombinant virus at a multiplicity of infection (MOI) of 0.1. After 96 hours growth at 26°C, the cells were harvested by centrifugation and stored at -20°C until processed.
  • MOI multiplicity of infection
  • the cells were thawed by the addition of PBS, disrupted by sonication for 30 seconds on ice and the insoluble material pelleted by centrifugation at 1,500 g for 10 minutes.
  • the soluble proteins in the supernatant were passed through a 0-22 ⁇ m filter.
  • the filtrate was then loaded onto a nickel-NTA column (QIAGEN), after which the column was washed with binding buffer (500 mM NaCl, 20 mM Tris, pH 8.0, 5 mM imidazole). Bound protein was eluted in binding buffer containing 500 mM imidazole.
  • Recombinant proteins were stored at -70°C and transported on dry ice for use in vaccine trials. Aliquots of the proteins were also retained for use in the assessment of antibody responses.
  • Recombinant proteins were produced in E. coli using the pET30a vector (Novagen).
  • the 2 kb Not I fragment was subcloned into pET30a and transformed into E. coli DH5c. cells. Kanamycin resistant transformants were picked and mini-prep plasmid DNA was prepared by alkaline lysis according to Sambrook et al. (1989) and analyzed by digestion with Not I to confirm the presence of the 65 ⁇ insert. The orientation of the clones was determined by DNA sequencing using flanking vector primers (pET30 forward primer 5' CTGGTCTGGTGCCACGCGGTTCTG 3' ⁇ 400>13, and pET30 reverse primer Novagen # 69337-1 5'GCTAGTTATTGCTCAGCGGTGGCA 3' ⁇ 400>14) as previously described.
  • Plasmid DNA from a pET30a subclone confirmed as being in the correct orientation was re- transformed into E. coli BL21pLysS cells for expression of NP.
  • 10 ml overnight cultures were grown from single colonies in LB broth supplemented with kanamycin (50 ⁇ g/ml) and chloramphenicol (34 ⁇ g/ml).
  • Fresh 10 ml cultures were inoculated with 1 ml of the overnight cultures and grown at 37°C with shaking until the optical density at 600 nm (OD600) reached 0.6. IPTG ( .
  • NP protein Solubility of the NP protein
  • 1 ml of culture was pelleted, resuspended in 1 ml of PBS containing TPCK protease inhibitor (50 ⁇ g/ml; Sigma) and sonicated for 5 x 10 second bursts on ice to disrupt the cells.
  • the insoluble material was pelleted at 12,000 rpm in a benchtop microcentrifuge and the supernatant (aqueous soluble protein) removed.
  • the pellet was resuspended in 0.2 ml of 8 M urea in PBS and sonicated and centrifuged as above.
  • the supernatant (urea soluble protein) was removed and the pellet resuspended in 0.2 ml of reducing SDS sample buffer containing 8M urea and sonicated and centrifuged as above, and the supernatant (SDS soluble protein) removed. All samples were analyzed by SDS-PAGE and by Western blotting. The samples were heated to 90°C for 5 min and 5 ⁇ l samples electrophoresed on duplicate SDS-PAGE gels using a 10%o w/v resolving gel. One gel was stained with Coomassie Blue, and the second gel was transferred to a PVDF membrane Western blot and blocked with 5% w/v Blotto-PBST as described earlier.
  • the membrane was incubated with primary anti-His antibody (Clontech) diluted 1/2,000 in 5% w/v Blotto/PBST for 60 min, then washed 3 times for 5 min in PBST.
  • the membrane was incubated with horse radish peroxidase conjugated anti-mouse Ig (Silenus) diluted 1/1,000 in 5%> w/v Blotto/PBST for 60min and re-washed 3 times for 5 min each in PBST.
  • the reaction was detected by incubating the membrane for 1 min in a solution of ECL substrate (Boehringer Mannheim) according to the manufacturer's specifications and exposed to X-ray film.
  • the expressed NP protein was found to be soluble in the aqueous fraction and the SDS-soluble fraction ( Figure 9B). The NP protein is therefore expressed in the soluble fraction in E. coli and it is assumed that the material seen in the latter fraction is derived from disruption of additional, previously un-lysed cells during sonication in SDS-sample buffer.
  • NP protein Large scale production of NP protein was performed by fermentation using a B. Braun Biotech International fermentor with a 2 L vessel (1.5 L working volume).
  • a 10 ml overnight culture of clone 65E in pET30a in E. coli BL21pLysS cells was added to 100 ml LB and incubated at 37°C with shaking for 5 hours.
  • 20 ml of this fresh culture was used to inoculate 1 L of batch medium (0.6 % w/v Na 2 HPO 4 , 0.3% w/v KH 2 PO 4 , 0.3% w/v (NH 4 ) 2 SO 4 , 5% w/v glucose, 30 mM MgSO .7H 2 0, 50 ⁇ g/ml kanamycin, 34 ⁇ g/ml chloramphenicol) in the fermenter vessel.
  • the fermentation was allowed to proceed for 15 hours, then IPTG added to a final concentration of 1 mM to induce NP protein expression, and the fermentation continued for a further 3 hours.
  • the dissolved oxygen level was maintained at 30%> and the pH was maintained at 6.8 by the addition of NH 4 OH.
  • the culture was fed with increasing amounts of batch feed medium (29% glucose, 0.14 M MgSO , 2.9% yeast extract, 360 ⁇ g ml kanamycin, 243 ⁇ g/ml chloramphenicol) and frothing was controlled by the regulated addition of anti-foam (DOW Corning 1510 silicon antifoam).
  • the fermentation culture was harvested by centrifugation at 4°C at 7,000 rpm for 20 min.
  • the cell pellets were resuspended in 1 L PBS plus 50 ⁇ M TPCK (Boehringer) and the cells disrupted by sonication (25 bursts of 10 sec on ice).
  • the sonicate was centrifuged at 15,000 rpm for 25 min at 4°C and supernatants (aqueous fraction) pooled and filtered through 0.45 ⁇ m filters.
  • the filtrate was loaded on a 2 ml bed volume nickel-NTA column (QIAGEN), and the column washed with 25 volumes of binding buffer (500 mM NaCl, 20 mM Tris, pH 8.0, 5 mM imidazole).
  • the bound NP protein was eluted with increasing concentrations of imidazole (from 25 to 200 mM) in binding buffer, and samples of the eluted fractions analysed by SDS- PAGE using a 10% w/v resolving gel. Fractions from the 200 mM elution contained the highest purity of NP protein and were pooled ( Figure 10) for use in Vaccine Trial number 2.
  • the yield of purified NP protein was 10 mg from the 1.2 L fermentation.
  • the concentration of the NP was adjusted to 200 ⁇ g/ml or 400 ⁇ g/ml with binding buffer and the antigen frozen at - 70°C in aliquots of 700 ⁇ g or 1,400 ⁇ g.
  • Recombinant proteins were stored at -70°C and transported on dry ice for use in vaccine trials. Aliquots of the proteins were also retained for use in the assessment of antibody responses.
  • the control group received Tris buffer (pH 8.0) and the vaccine group received NP from the pFastBac baculovirus vector prepared as described above.
  • the vaccine or Tris buffer was formulated by emulsification with Freund's Complete Adjuvant (FCA) for the first immunization and with Freund's Incomplete Adjuvant (FIA) for the second and third immunizations.
  • FCA Freund's Complete Adjuvant
  • FIA Freund's Incomplete Adjuvant
  • 0.5 ml of buffer or antigen was emulsified with 0.5 ml adjuvant to give a vaccine volume of 1 ml and a vaccine dose of 100 ⁇ g NP.
  • Lambs were injected on days -70, -42 and -14 via the subcutaneous route into the wool-less area on the thoracic side of the axilla. Assessment of antibody responses
  • Blood samples (10 ml) were collected from the jugular vein of each lamb on days -70, -42, -14, 0 and 35. The blood was allowed to coagulate and the serum separated by centrifugation and stored at -15°C. Serum samples from days -70 and 0 were assessed for antibody responses.
  • Antibody responses were assessed on bleeds taken before vaccination (day -70, pre-bleeds) and after 3 vaccinations (day 0; pre-challenge bleeds) at a 1:1,000 and 1:10,000 dilution (Figure 11). All 5 vaccinated sheep raised a response to the injected NP which was easily detectable in the pre-challenge bleeds and there was no significant difference between the sheep in their response. There was no detectable antibody response in the pre-bleeds (prior to vaccination; Figure 11), not was there any response in control sheep vaccinated with PBS in Freund's adjuvants. Pre-challenge antibody response in the vaccinated sheep were further analyzed on another Western blot at dilutions of 1:90,000, 1:270,000 and 1:810,000 (Figure 12), but again no significant differences were observed between sheep in their response.
  • PCVs Packed cell volumes
  • Faecal egg counts were measured on days 28 and 34.
  • the lambs in the NP vaccine group shed 44%> fewer eggs than the control group, but this difference was not statistically significant. However, two lambs had markedly reduced FECs (numbers 4788, 4792) and a third also had lower FECs than any of the controls (number 4794), indicating that the vaccine may have had some effect in reducing parasite burdens.
  • the lambs in the NP vaccine group had a 28%> average lower ETWC than the control group, but this difference was not statistically significant. However, two lambs had markedly reduced ETWCs (numbers 4788, 4792) and a third also had lower ETWCs than any of the controls (number 4794), indicating that the vaccine may have had some effect in reducing parasite burdens.
  • the control group received Tris buffer (pH 8.0) and the vaccine groups received 100 ⁇ g/shot or 200 ⁇ g/shot of NP from the pFastBac-Htc baculovirus vector in S ⁇ insect cells, or 100 ⁇ g/shot or 200 ⁇ g/shot of NP prepared from the pET30a vector in E. coli.
  • the vaccines or Tris buffer were formulated by emulsification with FCA or FIA and administered as described for Vaccine Trial number 1 on days -70, -42 and -14.
  • Antibody responses were assessed by Western blotting using samples from the retained aliquot of NP protein produced using the pFastBac-Htc vector (2 ⁇ g), as described for Vaccine Trial number 1. All vaccinated sheep raised a response to NP which was easily detectable in the pre- challenge bleeds and there was no significant differences between the sheep in their responses ( Figure 13). There was no detectable antibody response in the pre-bleeds (prior to vaccination), not was there any response in control sheep vaccinated with PBS in Freund's adjuvants (not shown).
  • PCVs Packed cell volumes
  • Faecal egg counts were measured on days 24, 28, 32 and 36. Results, given as eggs per gram of faeces (epg) are shown in Table 5.
  • the lambs in all four of the NP vaccine groups had slightly lower mean ETWCs than the control group, ranging from a reduction of 19 - 25%, but this difference was not statistically significant.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne, d'une manière générale, un nouveau polypeptide et ses dérivés, homologues et analogues, lequel polypeptide peut être obtenu à partir d'un helminthe, et plus particulièrement à partir d'un nématode, ou produit par des moyen de recombinaison ou de synthèse chimique. Le polypeptide et ses dérivés, homologues et analogues de la présente invention peut être utilisé dans la fabrication d'une composition capable d'induire une protection chez des animaux sensibles aux helminthes contre des infections provoquées par lesdits helminthes et/ou pour réduire, inhiber ou encore retarder la croissance, la viabilité et/ou la fécondité des oeufs desdits helminthes et/ou afin de traiter les symptômes d'infection helminthique. Un autre aspect de la présente invention concerne une méthode de lutte contre les helminthes, et plus particulièrement les nématodes, les infections, la croissance, la viabilité et/ou la fécondité des oeufs et/ou de traitement des symptômes d'infection helminthique par l'administration d'un polypeptide tiré desdits helminthes ou d'un dérivé, homologue ou analogue dudit polypeptide.
PCT/AU2000/000210 1999-03-18 2000-03-16 Nouveau polypeptide et ses derives, homologues et analogues WO2000056763A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU31372/00A AU3137200A (en) 1999-03-18 2000-03-16 A novel polypeptide and its derivatives, homologues and analogues

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AUPP9297 1999-03-18
AUPP9297A AUPP929799A0 (en) 1999-03-18 1999-03-18 A novel molecule

Publications (1)

Publication Number Publication Date
WO2000056763A1 true WO2000056763A1 (fr) 2000-09-28

Family

ID=3813494

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2000/000210 WO2000056763A1 (fr) 1999-03-18 2000-03-16 Nouveau polypeptide et ses derives, homologues et analogues

Country Status (4)

Country Link
AR (1) AR022954A1 (fr)
AU (1) AUPP929799A0 (fr)
CO (1) CO5210982A1 (fr)
WO (1) WO2000056763A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3527984A1 (fr) * 2008-05-19 2019-08-21 IDEXX Laboratories, Inc. Procédés, dispositifs, kits et compositions pour détecter le ver rond

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988000835A1 (fr) * 1986-08-07 1988-02-11 Edward Albert Munn Production et emploi d'agents anthelmintiques et d'antigenes protecteurs
WO1989000163A1 (fr) * 1987-07-07 1989-01-12 Biotechnology Australia Pty. Ltd. Vaccins contre les nematodes parasites rencontres chez l'animal

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988000835A1 (fr) * 1986-08-07 1988-02-11 Edward Albert Munn Production et emploi d'agents anthelmintiques et d'antigenes protecteurs
WO1989000163A1 (fr) * 1987-07-07 1989-01-12 Biotechnology Australia Pty. Ltd. Vaccins contre les nematodes parasites rencontres chez l'animal

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
JASMER D.P. ET AL.: "Haemonchus contortus Ga1 antigens related, phospholipase C-sensitive, apical gut membrane proteins encoded as a polyprotein and related from the nematode during infection", PROC. NATL. ACAD. SCI. USA, MICROBIOLOGY,, vol. 93, August 1996 (1996-08-01), pages 8642 - 8647 *
MUNN E.A. ET AL.: "Vaccination against Heamonchus contortus with denatured forms of the protective antigen H11", PARASITE IMMUNOLOGY,, vol. 19, 1997, pages 243 - 248 *
MUNN E.A. ET AL.: "Vaccination of young lambs by means of a protein fraction extracted from adult Haemonchus contortus", PARASITOLOGY,, vol. 94, no. PT2, April 1987 (1987-04-01), pages 385 - 397 *
NEWTON S.E.: "Progress on vaccination against Haemonchus contortus", INTERNATIONAL JOURNAL OF PARASITOLOGY,, vol. 25, no. 11, 1995, pages 1281 - 1289 *
SMITH S.K. ET AL.: "Immunisation of sheep with an integral membrane glycoprotein complex of Haemonchus contortus and with its jamor polypeptide components", RESEARCH VETERINARY SCIENCE,, vol. 60, 1996, pages 1 - 6 *
SMITH T.S. ET AL.: "Strategies for vaccination against gastro-intestinal nematodes", REVUE SCIENTIFIQUE ET TECHNIQUE INTERNATIONAL OFFICE OF EPIZOO, vol. 9, no. 2, June 1990 (1990-06-01), pages 577 - 595 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10429388B2 (en) 2007-06-15 2019-10-01 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm and hookworm
US10942180B2 (en) 2007-06-15 2021-03-09 Idexx Laboratories, Inc. Methods, devices, kits and compositions for detecting roundworm, whipworm and hookworm
EP3527984A1 (fr) * 2008-05-19 2019-08-21 IDEXX Laboratories, Inc. Procédés, dispositifs, kits et compositions pour détecter le ver rond

Also Published As

Publication number Publication date
AR022954A1 (es) 2002-09-04
AUPP929799A0 (en) 1999-04-15
CO5210982A1 (es) 2002-10-30

Similar Documents

Publication Publication Date Title
US7968695B2 (en) Nucleic acids encoding recombinant 56 and 82 kDa antigens from gametocytes of Eimeria maxima and their uses
US6534638B1 (en) Recombinant DNA molecules encoding aminopeptidase enzymes and their use in the preparation of vaccines against helminth infections
US8629260B2 (en) Anti-arthropod vector vaccines, methods of selecting and uses thereof
Taylor et al. Production and testing of Schistosoma japonicum candidate vaccine antigens in the natural ovine host
CN111925423B (zh) 一种抗o型口蹄疫的疫苗组合物及其制备方法和应用
RU2130072C1 (ru) Фрагмент днк, кодирующий иммуногенный поверхностный полипептид мерозоитов, иммуногенный полипептид (варианты) и способ его получения, рекомбинантная плазмидная днк и способ ее получения, способ получения рекомбинантного вируса вакцины, способ получения микроорганизма, вакцина против кокцидиоза птицы
JPH08505772A (ja) 新たな寄生蠕虫蛋白質
AU2002316558A1 (en) Nucleic acids encoding recombinant 56 and 82 kDa antigens from gametocytes of Eimeria maxima and their uses
EP0529019B1 (fr) Vaccin contre les nematodes
WO2000056763A1 (fr) Nouveau polypeptide et ses derives, homologues et analogues
CA2498249C (fr) Vaccin contre l'ostertagia
AU2007321235B2 (en) Novel sequences of Haemonchus contortus, immunogenic compositions, methods for preparation and use thereof
US6060281A (en) Parasitic helminth PLA2 proteins and nucleic acid molecules
GB2327346A (en) Parasite vaccine

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase