WO2000052462A1 - Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities - Google Patents
Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities Download PDFInfo
- Publication number
- WO2000052462A1 WO2000052462A1 PCT/US2000/005465 US0005465W WO0052462A1 WO 2000052462 A1 WO2000052462 A1 WO 2000052462A1 US 0005465 W US0005465 W US 0005465W WO 0052462 A1 WO0052462 A1 WO 0052462A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vegf
- dna
- ischemia
- cells
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0271—Chimeric vertebrates, e.g. comprising exogenous cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0375—Animal model for cardiovascular diseases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- This invention relates to VEGF-B deficient animals and their heart abnormalities. Methods are provided for using VEGF-B deficient animals to screen for substances to counteract heart abnormalities and for diagnosing heart diseases, particularly diseases characterized by a loss of VEGF-B expression.
- the two major components of the mammalian vascular system are the endothelial and smooth muscle cells.
- the endothelial cells form the lining of the inner surface of all blood vessels and lymphatic vessels in the mammal.
- the formation of new blood vessels can occur by two different processes, vasculogenesis or angiogenesis (for review see Risau, W. , Nature 386:671-674 (1997) ) .
- Vasculogenesis is characterized by the in si tu differentiation of endothelial cell precursors to mature endothelial cells and association of these cells to form vessels, such as occurs in the formation of the primary vascular plexus in the early embryo.
- angiogenesis the formation of blood vessels by growth and branching of pre-existing vessels, is important in later embryogenesis and is responsible for the blood vessel growth which occurs in the adult .
- Angiogenesis is a physiologically complex process involving proliferation of endothelial cells, degradation of extracellular matrix, branching of vessels and subsequent cell adhesion events.
- angiogenesis is tightly controlled and limited under normal circumstances to the female reproductive system.
- angiogenesis can be switched on in response to tissue damage.
- solid tumors are able to induce angiogenesis in surrounding tissue, thus sustaining tumor growth and facilitating the formation of metastases (Folkman, J., Nature Med. 1:27-31, (1995) ) .
- metastases Felkman, J., Nature Med. 1:27-31, (1995)
- Angiogenesis is also involved in a number of pathologic conditions, where it plays a role or is involved directly in different sequelae of the disease.
- Some examples include neovascularization associated with various liver diseases, neovascular sequelae of diabetes, neovascular sequelae to hypertension, neovascularization in post-trauma, neovascularization due to head trauma, neovascularization in chronic liver infection (e.g. chronic hepatitis), neovascularization due to heat or cold trauma, dysfunction related to excess of hormone, creation of hemangiomas and restenosis following angioplasty.
- FGFs fibroblast growth factors
- PDGF platelet-derived growth factor
- TGF ⁇ transforming growth factor alpha
- HGF hepatocyte growth factor
- VEGFs vascular endothelial growth factors
- RTKs endothelial receptor tyrosine kinases
- VEGF-B described in International Patent Application PCT/US96/02957 (WO 96/26736) and in U.S. Patents 5,840,693 and 5,607,918 by Ludwig Institute for Cancer Research and The University of Helsinki
- VEGF-C or VEGF2 described in Joukov et al , EMBO J. 15:290-298 (1996) , Lee et al , Proc. Natl. Acad. Sci. USA 93 : 1988-1992 (1996), and U.S. Patents 5,932,540 and 5,935,540 by Human Genome Sciences, Inc
- VEGF-D described in International Patent Application No. PCT/US97/14696
- VEGF3 described in International Patent Application No. PCT/US95/07283 (WO 96/39421) by Human Genome Sciences, Inc.
- Each VEGF family member has between 30% and 45% amino acid sequence identity with VEGF.
- the VEGF family members share a VEGF homology domain which contains the six cysteine residues which form the cystine-knot motif.
- Functional characteristics of the VEGF family include varying degrees of mitogenicity for endothelial cells, induction of vascular permeability and angiogenic and lymphangiogenic properties.
- VEGF Vascular endothelial growth factor
- VEGF vascular endothelial growth factor
- angiogenesis is required for normal development and physiology. Processes such as embryogenesis, wound healing, and corpus luteum formation, all involve angiogenesis and angiogenic factors .
- VEGF mRNA levels increase suggesting a direct correlation between the expression of VEGF and the healing process.
- a defect in VEGF regulation might be associated with wound healing disorders (Frank, S., et al , J. Biol . Chem. 2705:12607-12613 (1995)).
- VEGF-B vascular endothelial cell mitogen
- VEGF is a member of a family of proteins structurally related to platelet-derived growth factor (PDGF) .
- PDGF is a potent mitogen for smooth muscle cells, glial cells, and several other cell types.
- the members of the PDGF family are characterized by the presence of eight conserved cysteme residues. In their active, physiological state, the proteins are dimers formed by disulfide bonding, by both inter- and intramolecular bonds, at the eight cysteme residues.
- the family members are related m their mitogenic actions, especially on endothelial and related cell types.
- VEGF-B Vascular endothelial growth factor B
- VEGF-B vascular endothelial growth factor B
- PlGF PlGF (Placental Growth Factor)
- VEGF-B plays a role vascularization of adult and embryonic tissues, and in muscle tissue m particular.
- VEGF-B acts also as an angiogenic mitogen.
- Northern blots show VEGF-B mRNA a variety of mouse and human tissues, including heart, brain, and skeletal muscle.
- RT-PCR assays have demonstrated the presence of VEGF-B mRNA melanoma, normal skin, and muscle.
- VEGF-B is expressed throughout many tissues mammals but most abundantly m heart, skeletal muscle, and pancreas. The expression pattern of VEGF-B is different from that of VEGF, although both are expressed m many tissues (Olofsson, B. et al , Proc. Natl. Acad. Sci. USA 93:2576-2581 (1996)).
- VEGF-B The mouse and human genes for VEGF-B are almost identical, and both span about 4 kb of DNA.
- the genes are composed of seven exons and their exon- tron organization resembles that of the VEGF and PlGF genes (G ⁇ mmond et al , Genome Res. 6:124-131
- the isoforms have an identical N-terminal domain of 115 amino acid residues, excluding the signal sequence, while the C-terminal domains differ.
- the common N-terminal domain is encoded by exons 1-5. Differential use of the remaining three exons gives rise to the two splice isoforms.
- an insertion of 101 bp introduces a frame-shift and a stop of the coding region of VEGF-B 157 cDNA.
- the two VEGF-B isoforms have differing C- terminal domains .
- the different C-terminal domains of the two splice iosforms of VEGF-B affect their biochemical and cell biological properties.
- the C-terminal domain of VEGF-B 167 os structurally related to the corresponding region in VEGF, with several conserved cysteine residues and stretches of basic amino acid residues. Thus, this domain is highly hydrophilic and basic and, accordingly, VEGF-B 167 will remain cell-associated on secretion, unless the producing cells are treated with heparin or high salt concentrations.
- the cell-associated molecules binding VEGF-B 167 are likely to be cell surface or pericellular heparin sulfate proteoglycans . It is likely that the cell-association of this isoform occurs via its unique basic C-terminal region.
- the C-terminal domain of VEGF-B 186 has no significant similarity with known amino acid sequences in the databases.
- the hydrophobic character of the C-terminal domain of VEGF-B 186 contrasts with the properties of the hydrophilic and basic C- terminal domain of VEGF-B 167 This is supported by the observation that VEGF-B 186 does not remain cell -associated on its secretion. Recent evidence indicates that this isoform is proteolytically processed, which regulates the biological properties of the protein (Olofsson et al , Proc. Natl. Acad. Sci. USA, 95:11709-11714 (1998)).
- VEGF-B Like its related mitogenic proteins, VEGF-B exists as a disulflde-lmked homodimers m vivo . Both isoforms of VEGF-B also form heterodimers with VEGF, consistent with the conservation of the eight cysteine residues involved m mter- and intramolecular disulfide bonding of PDGF-like proteins. Furthermore, co-expression of VEGF-B and VEGF in many tissues suggests that VEGF-B-VEGF heterodimers occur naturally. Heterodimers of VEGF-B 167 -VEGF remain cell -associated. In contrast, heterodimers of VEGF-B 186 and VEGF are freely secreted from cells m a culture medium.
- VEGF also forms heterodimers with PlGF (DiSalvo, et al , J. Biol. Chem. 270:7717-7723 (1995)).
- PlGF Denssion Growth Factor
- the production of heterodimeric complexes between the members of this family of growth factors could provide a basis for a diverse array of angiogenic or regulatory molecules .
- receptor tyrosme kinases are glycoprotems , which consist of an extracellular domain capable of binding a specific growth factor (s), a transmembrane domain, which is usually an alpha- helical portion of the protein, a ⁇ uxtamembrane domain, which is where the receptor may be regulated by, e.g., protein phosphorylation, a tyrosme kmase domain, which is the enzymatic component of the receptor and a carboxy-terminal tail, which in many receptors is involved in recognition and binding of the substrates for the tyrosine kinase .
- s specific growth factor
- transmembrane domain which is usually an alpha- helical portion of the protein
- ⁇ uxtamembrane domain which is where the receptor may be regulated by, e.g., protein phosphorylation
- a tyrosme kmase domain which is the enzymatic component of the receptor and a carboxy-terminal
- VEGFR-1 Flt-1
- VEGFR-2 VEGFR-2
- KDR/Flk-1 VEGFR-3 (Flt4), Tie and Tek/Tie-2. These receptors differ in their specificity and affinity. All of these have the intrinsic tyrosine kinase activity which is necessary for signal transduction.
- VEGFR-1 The only receptor tyrosine kinases known to bind VEGFs are VEGFR-1, VEGFR-2 and VEGFR-3.
- VEGFR-1 and VEGFR-2 bind VEGF with high affinity, and VEGFR-1 also binds PlGF.
- VEGF-B binds to VEGFR-1 with high affinity, but not to VEGFR-2 or -3 (Olofsson et al, Proc. Natl. Acad. Sci. USA, 95:11709-11714 (1998)).
- VEGF-C has been shown to be the ligand for VEGFR-3, and it also activates VEGFR-2 (Joukov et al , The EMBO Journal 15:290-298
- VEGF-D binds to both VEGFR-2 and VEGFR-3 (Achen et al , Proc. Natl. Acad. Sci. USA 95:548-553 (1998)).
- a ligand for Tek/Tie-2 has been described in International Patent Application No. PCT/US95/12935 (WO 96/11269) by Regeneron Pharmaceuticals, Inc. The ligand for Tie has not yet been identified.
- the VEGF receptor was found to specifically bind the VEGF 1S5 isoform via the exon 7 encoded sequence, which shows weak affinity for heparin (Soker et al , Cell 92:735-745 (1998)). Surprisingly, the receptor was shown to be identical to human neuropilin-1 (NP-1) , a receptor involved in early stage neuromorphogenesis. PlGF-2 also appears to interact with NP-1
- VEGFR-1, VEGFR-2 and VEGFR-3 are expressed differently by endothelial cells.
- both VEGFR-1 and VEGFR-2 are expressed in blood vessel endothelia (Oelrichs et al , Oncogene 8:11-18 (1992); Kaipainen et al, J. Exp. Med. 178:2077-2088 (1993); Dumont et al , Dev. Dyn. 203:80-92 (1995); Fong et al , Dev. Dyn. 207:1-10 (1996)) and VEGFR-3 is mostly expressed in the lymphatic endothelium of adult tissues (Kaipainen et al , Proc. Natl. Acad. Sci. USA 9:3566-3570 (1995)). VEGFR-3 is also expressed in the blood vasculature surrounding tumors .
- VEGFR-1 is mainly expressed in endothelial cells during development, it can also be found in hematopoetic precursor cells during early stages of embryogenesis (Fong et al , Nature 376:66-70 (1995)). In adults, monocytes and macrophages also express this receptor (Barleon et al , Blood 87:3336-3343
- VEGFR-1 is expressed by most, if not all, vessels (Breier et al , Dev. Dyn. 204:228-239 (1995); Fong et al , Dev. Dyn. 207:1-10 (1996)).
- Transgenic animal models are useful tools to study the functions and physiological activities of proteins, and a variety of such animals have been produced for this purpose.
- One particular technique for producing transgenic animals involves the process of homologous recombination. In homologous recombination, all or part of a genomic sequence is replaced with another DNA containing homologous sequences. Through transgenic manipulation and homologous recombination, a gene or part of a gene in the cells of an animal can be changed. Changing the gene to encode a protein that no longer functions as the native protein does creates a null mutant or null allele. (See, for example, U.S. Patent No. 5,557,032.)
- VEGF transgenic embryos has not produced findings on the angiogenic properties or tumor growth modulating properties of all VEGF-like proteins.
- these factors are still incompletely understood, and there remains a need for means which can be used to evaluate the activities of angiogenic growth factors such as VEGF-B, as well as their roles in the various disease states discussed above, and/or which are useful to develop and/or evaluate other angiogenic peptides.
- the invention involves use of transgenic animals that contain a mutated VEGF-B gene.
- the VEGF- B gene was mutated through a homologous recombination process.
- the transgenic animals of the invention may be useful in elucidating the effects of VEGF-B and/or other cytokines on physiological phenomena such as permeability, inflammation and/or tissue repair.
- the animals or cells derived from the animals are useful in screening assays to identify angiogenic and/or tumor growth modulating compounds.
- the animals can also be used in methods to test VEGF-B agonists for in vivo distribution and function and non-toxicity and VEGF-B containing molecules.
- the invention provides a method for using a transgenic, non-human animal containing at least one nonfunctional mutated VEGF-B allele.
- the transgenic animal is produced by introducing a transgenic DNA into embryonic stem cells of a non-human animal, preferably a mouse.
- the transgenic DNA has a region homologous with a sequence of VEGF-B.
- a cell is selected where the transgenic DNA has integrated into the genomic DNA of the stem cell at the site of at least one copy of an endogenous, genomic VEGF-B sequence. This cell is introduced into a blastocyst of a developing animal and allowed to develop into a transgenic animal .
- the transgenic DNA used to produce transgenic animals useful in the method of the invention comprises a sequence of nucleotides from the VEGF-B gene which has been changed, mutated, or modified m a number of ways known m the art.
- the DNA used to generate the transgenic animals can contain a number of different DNA sequences. The selection of an appropriate sequence depends on the desired effect. For example, at least one codon for cysteine can be changed or deleted.
- the resulting animal may produce a VEGF-B with an altered ability to form dimers with native VEGF-B or another PDGF- like protein. In a preferred embodiment, seven of the eight cysteine residues of VEGF-B have been deleted, resulting m a null mutant of VEGF-B.
- the invention provides a method for screening compounds for the ability to effect angiogenesis or to modulate tumor growth or progression or to increase the musculature of the heart m a transgenic animal .
- the method comprises introducing the compound to a transgenic animal and detecting the vascular development m the animal.
- the method comprises introducing a tumor cell into a transgenic animal, introducing a compound into the same animal, and detecting the tumor development m the animal.
- a method for screening a compound for the ability to restore or detectably effect activity of the VEGF-B gene product comprising adding a compound to an appropriate cell line or introducing the compound into a transgenic animal can be devised.
- Transgenic animals and cell lines generated according to this invention can be used in these methods.
- Such animal or cell line systems can also be used to select compounds, which could be able to restore or to modulate the activity of the VEGF-B gene and/or angiogenesis.
- the compound may be in the form of a protein (recombinant or synthesized in vi tro, for example) or in the form of DNA encoding VEGF-B or an analog of VEGF-B.
- the DNA could be incorporated into a liposome structure, as exemplified in Lui et al., Nature Biotechnology, 15:167-172 (1997).
- the DNA or protein could also be provided to VEGF-B knock out mice embryos at the 8-16 cell embryonic stage.
- the transgenic animals obtained with the mutant VEGF-B gene sequence can be used to generate double transgenic animals.
- the mutant VEGF-B transgenic animal can be mated with other transgenic animals of the same species or with naturally occurring mutant animals of the same species.
- the resulting double transgenic animal, or cells derived from it, can be used in the same applications as the mutant parent transgenic animal.
- mutate or modify nucleic acid sequences can be used to generate VEGF-B mutant animals, cell lines, or sequences useful in this invention. Such methods include, but are not limited to, point mutations, site-directed mutagenesis, deletion mutations, insertion mutations, mutations obtainable from homologous recombination, and mutations obtainable from chemical or radiation treatment of DNA or cells bearing the DNA. PCR analysis or DNA sequencing is used to determine the mutation generated if desired or necessary. The mutant animals, cell lines or sequences are then used in the DNA sequences, systems, assays, methods or processes described. The mutated or modified DNA will, by definition, be different, or not identical to the genomic DNA.
- Mutant animals are also created by mating a first transgenic animal containing the sequences described here or made available by this invention, with a second animal.
- the second animal can contain DNA that differs from the DNA contained in the first animal. In such a way, various lines of mutant animals can be created.
- recombinant DNA techniques are available to mutate the DNA sequences described here, as above, link these DNA sequences to expression vectors, and express the VEGF-B protein or mutant.
- the VEGF-B mutant can thus be analyzed for biochemical or behavioral activity. In such a way, mutated DNA sequences can be generated that prevent the expression of an efficient VEGF-B.
- modified VEGF-B DNA refers to a sequence of nucleotides from the VEGF-B gene that has been modified by an in vi tro or recombinant DNA technique.
- the modified VEGF-B DNA does not contain the exact sequence of nucleotides as the gene from the embryonic stem cells into which the transgenic DNA is to be introduced. Modifications including deletions, substitutions, and insertions of nucleotides into the VEGF-B DNA sequence are specifically included.
- one particular modified VEGF-B DNA contains a deletion of part of exon three and all of exon 4 of the mouse VEGF-B DNA sequence.
- the restriction map of the VEGF-B locus ( Figures 1 and 3) can be used to design numerous modified VEGF-B DNAs by deleting at least one restriction fragment.
- the methods of the invention provide useful models for deciphering the angiogenic and tumor growth modulating activity of various substances, including angiogenic growth factors such as VEGF-B.
- Therapeutic, diagnostic, and regulatory uses for VEGF-B can be determined from model systems employing the transgenic animals with altered VEGF-B genes.
- the transgenic animals may be used according to the invention in the development of treatment protocols based upon the ability of VEGF-B to influence physiological phenomena such as permeability, inflammation and/or tissue repair.
- the methods of the invention are useful to evaluate other polypeptides or small molecules for VEGF-B-like activity such as angiogenic activity or the activity that VEGF-B may have on endothelial cell gene expression which could affect their fundamental characteristics, e.g. the uptake of nutrients from the bloodstream to a particular tissue .
- the transgenic animals may be used according to the invention to elucidate the developmental and homeostatic functions of VEGF-B by monitoring and comparing the effects of different physiological stresses applied to wildtype (+/+) , heterozygote (+/-) and null allele (-/-) animals.
- the effects of VEGF-B on blood clotting times could be monitored through the use of wounding assays; the effects of VEGF-B on tumor growth could be determined by monitoring the proliferation of implanted tumor cells; the effects of VEGF-B on physical activity could be discovered by comparative physical activity studies, and/or the effects of VEGF-B on stress reactions could be determined through application of severe stresses such as exposure to compressed air.
- VEGF-B effects of VEGF-B on heart rate, cardiac output (e.g. blood pressure) and/or heamodynamic properties could be assayed by using the transgenic animals of the invention in procedures analogous to those described by Zhou et al . , Nature Medicine 4:201-07 (1998) .
- VEGF-B The role of VEGF-B in normal heart function can be investigated by comparing VEGF-B deficient mice (-/-) and normal (+/+) litter mates. Loss of VEGF-B expression reveals some significant differences. These differences indicate that the deficient animals have atrioventricular (AV) conduction defects and signs that may indicate ischemia of the myocardium.
- AV atrioventricular
- a further aspect of the invention provides a method for screening a compound for atrioventricular conduction or ischemia modulating activity.
- This method comprises introducing the compound being screened into a VEGF-B deficient non-human animal, and assaying the effect on atrioventricular conduction or ischemia in this animal .
- This method may also be used to screen more than one compound for atrioventricular conduction or ischemia modulating activity from example when screening a phage, peptide or combinatorial library.
- Representative of a soluble peptide library and its use is R. A. Houghten, Gene, 137:7-11 (1993) .
- An example of a random peptide-presenting phage library is Barry et al , Nat. Med.
- Another related aspect is directed to a method of treatment or alleviation of atrioventricular conduction defects or ischemia comprising the step of administering an effective atrioventricular conduction defect or ischemia alleviating amount of VEGF-B, or a fragment or analog thereof having the biological activity of VEGF-B.
- analog or “functional analog” refers to a modified form of the full-length or a fragment thereof of VEGF-B in which at least one amino acid substitution has been made such that said analog retains substantially the same biological activity as the unmodified form of the full-length or a fragment thereof of VEGF-B in vivo and/or in vi tro .
- biological activity of VEGF-B is to be understood to mean the ability to stimulate one or more of endothelial cell proliferation, differentiation, migration, survival or angiogenesis or vascular permeability.
- VEGF-B polypeptides and VEGF-B analogs used in the treatment or alleviation of atrioventricular conduction defects or ischemia also may be employed in combination with a pharmaceutically acceptable non-toxic salt thereof, and a pharmaceutically acceptable solid or liquid carrier or adjuvant.
- compositions may be in the form of solutions, suspensions, tablets, capsules, creams, salves, elixirs, syrups, wafers, ointments or other conventional forms.
- Compositions comprising a peptide of the invention will contain from about 0.1% to 90% by weight of the active compound (s), and most generally from about 10% to 30%.
- a sterile formulation preferably a suitable soluble salt form of the VEGF-B, such as hydrochloride salt
- a pharmaceutical diluent such as pyrogen-free water (distilled) , physiological saline or 5% glucose solution.
- a suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, e.g. an ester of a long chain fatty acid such as ethyl oleate.
- Suitable routes include oral, subcutaneous, intramuscular, intraperitoneal or intravenous injection, parenteral, topical application, implants etc.
- an effective amount of a peptide of the invention or antibody is administered to an organism in need thereof in a dose between about 0.1 and 100 mg/kg body weight, and more preferably 1 to 10 mg/kg body weight.
- Monitoring the progression of the therapy, patient side effects, and circulating polypeptide levels will provide additional guidance for an optimal dosing regimen.
- Topical application of VEGF-B, or a fragment or analog thereof may be used in a manner analogous to VEGF.
- Another method of treatment or alleviation of atrioventricular conduction defects or ischemia comprises the step of administering an effective amount of a nucleic acid sequence encoding for VEGF-B, or a fragment or analog thereof having the biological activity of VEGF-B, where said nucleic acid is capable of encoding an effective amount of said VEGF-B, or a fragment or analog thereof to treat or alleviate the atrioventricular conduction defect or ischemia.
- the nucleic acid sequence preferably is operably linked with a promoter sequence.
- the nucleic acid can be naked and/or in a vector or liposome.
- Preferred vectors of the invention are expression vectors in which a nucleic acid according to the invention is operatively connected to one or more appropriate promoters and/or other control sequences, such that when an appropriate cell is transformed or transfected with the nucleic acid cloned into the vector, it is capable of expressing the polypeptide of the invention.
- the most preferred vectors are those suitable for transfection for gene therapy, such as adenoviral-, vaccinia- or retroviral -based vectors or liposomes. A variety of such vectors is known in the art .
- Another aspect of the invention provides a method for diagnosing heart disease in a test subject that involves taking an electrocardiogram and looking for prolongation of the PQ interval and/or depression of the ST complex (or U-wave) .
- a still further aspect of the invention provides methods for diagnosing heart disease characterized by a loss of VEGF-B expression in a test subject. These methods can involve looking for the loss of VEGF-B expression either by looking for a lack of amplification of VEGF-B DNA using the polymerase chain reaction or a lack of detection of the binding of a specific binding reagent to VEGF-B.
- the specific binding reagent is preferably an antibody to VEGF-B. The most preferred antibody is a monoclonal antibody to VEGF-B.
- the antibody according to the invention may be labeled with a detectable label.
- the antibody may be coupled to a suitable supermagnetic, paramagnetic, electron dense, ecogenic or radioactive or non-radioactive agent for imaging.
- radioactive agents/labels include a radioactive atom or group, such as 125 I or 32 P.
- non-radioactive agents/labels include enzymatic labels, such as horseradish peroxidase or fluorimetric labels, such as fluorescein-5-isothiocyanate (FITC) . Labeling may be direct or indirect, covalent or non-covalent .
- Fig. 1 is a schematic representation of a strategy for producing a null mutation of the mouse VEGF-B gene
- Fig. 2 shows agarose gel electrophoresis of PCR amplifications of tail DNA from the F2 generation of litter-mate homozygote VEGF-B (+/+), heterozygote (+/-) and homozygote knock out mice for the VEGF-B locus (-/-) ;
- Fig. 3 shows a detailed restriction map of the mouse VEGF-B locus. Restriction enzymes and corresponding symbols are listed below;
- FIG. 4 shows a schematic drawing of the procedures used to generate a transgenic vector targeted for the mouse VEGF—B locus.
- constructs A-E, described below, are shown m an exemplified method to generate a transgenic vector targeted to the mouse VEGF-B locus;
- Figs. 5a and 5b are Northern blots of RNA from heart and skeletal muscle tissues of wild type (+/+), heterozygote (+/-) and knock-out (-/-) mice,
- Fig. 6 is a graph comparing the growth of a transplanted tumor m litter-mate homozygous VEGF-B (+/+) and VEGF-B deficient (-/-) mice, and
- Fig. 7A and 7B are typical electrocardiograms from litter- mate homozygous VEGF-B (+/+) and VEGF-B deficient (-/-) mice.
- null allele refers to gene sequences encoding an altered protein as compared to the wildtype protein.
- null mutation refers to gene sequences encoding an altered protein as compared to the wildtype protein.
- null mutant is altered in a manner resulting in a protein substantially incapable of its primary function.
- a VEGF-B null mutant is a DNA sequence encoding a protein that no longer stimulates growth of vascular endothelial cells or which fails to exhibit any of the other effects of VEGF-B discussed above.
- structures related to other biochemical functions of VEGF-B, such as heparin binding and dimerization may be present in the protein encoded by the null allele.
- the term “null mutant” can refer to the animal or cell bearing a gene sequence of an altered protein, as discussed above .
- Transgenic DNA refers to DNA that is capable of being introduced into a cell so that the DNA is incorporated into the genome of the cell.
- the cell may be capable of giving rise to a transgenic animal, which contains the transgenic DNA.
- the transgenic DNA is constructed as a vector, a transgenic vector, for administration into a particular cell.
- Such a vector need not be in a particular structural form, such as a circular form.
- modified VEGF-B DNA refers to a VEGF-B nucleotide sequence from an animal which has been modified by one or more point mutations, site-directed mutagenesis, deletion mutations, insertion mutations, mutations obtainable from homologous recombination, and/or mutations obtainable from chemical or radiation treatment of DNA or cells bearing the DNA, or which is linked to another DNA sequence, such as a marker sequence, which is not associated with wildtype VEGF—B DNA in nature.
- the modified VEGF-B DNA may retain some or all of the activities of wild-type VEGF-B DNA, e.g. Flt-1 receptor binding motif .
- VEGF-B gene and DNA sequences referred to herein are not limited to genes or sequences from mouse or human. Any animal species can be used as a source of the VEGF-B gene. In the recombinant sequences incorporated into a transgenic DNA, the sequences homologous to the VEGF-B gene in a particular embryonic cell need not be from the same species as the embryonic cell.
- transfected cells are injected into embryos at a stage at which they are capable of integrating the transfected cells, for example, at the blastocyte stage.
- the embryo is then replanted into a surrogate mother, resulting in chimeric offspring possessing the transgenic DNA.
- all that is required is the appropriate embryonic stem cell from an animal.
- Embryonic stem cells are available from a number of sources. These include mice, rats, cows, pigs, sheep, and other animals.
- ES embryonic stem
- sources these include mice, rats, cows, pigs, sheep, and other animals.
- Manipulating the Mouse Embryo A laboratory Manual, edited by B. Hogan, R. Beddington, F. Constantini and E. Lacy, Cold Spring Harbor Laboratory Press, (1994) describes manipulating the mouse embryo.
- transgenic DNA can be microinjected into appropriate cells.
- Viral vectors can be used to introduce the DNA into appropriate cells and the genome of those cells (See, for example, Tsukui et al . , Nature Biotechnology 14:982-985 (1996)) .
- Cells can also be manipulated in vi tro through transfection and electroporation methods (See Ausubel (1989) and Hogan (1994)).
- transgenic DNA incorporates into a cell genome through either random integration or homologous recombination.
- Persons skilled in the art are familiar with strategies for increasing the relative frequency of homologous recombination versus random integration, in ES cells and other cells, in order to identify and isolate cells wherein homologous recombination has occurred (see, Ausubel (1989), U.S. Patent No. 5,557,032, and Hogan (1994) , for example) .
- the design of transgenic DNA vectors may involve incorporating some portion of the cellular sequence into the transgenic DNA, or a sequence homologous to the cellular sequence. That portion must be sufficiently homologous to the cellular sequence to allow the transgenic DNA and the cellular DNA to hybridize in vivo, for homologous recombination to occur.
- the transgenic DNA to be inserted into an embryonic stem cell preferably comprises 5 1 and 3' regions of homology. These regions of homology function to promote the process of homologous recombination in the embryonic stem cell.
- homologous recombination does not occur for each cell where the transgenic DNA has been introduced.
- some of the cells may incorporate the transgenic DNA at only one cellular sequence while other cells will incorporate the transgenic DNA into more than one cellular sequence, or even into every cellular sequence.
- both homozygous and heterozygous animals may be produced from the ES cells subjected to homologous recombination with the transgenic DNA.
- a homozygous animal may be mated with wildtype animals to produce further transgenic animals heterozygotic for the transgenic DNA.
- mice carrying mutant VEGF-B alleles were generated.
- One VEGF-B allele in the mice was functionally inactivated by the technique of homologous recombination. Mice generated from these cells, thus, carried one mutant and one wildtype VEGF-B allele.
- Fig. 1 is composed of four subparts, 1A through ID, and is a schematic representation of the strategy followed in producing a null mutation of the mouse VEGF-B gene.
- Fig. 1A is a schematic illustration of the exon-intron organization of the mouse VEGF-B gene.
- the transgenic DNA construct of Fig. 1 C) was used to generate a mutant VEGF-B allele.
- the construct contains a 5' homologous fragment (Notl/blunted Spel) and a 3' homologous fragment (blunted Kpnl/Hindlll) of the VEGF-B gene, which flank the pPGK-neocassette (neo) .
- Fig. ID shows the locations of the DNA probes used to identify wildtype and mutant alleles of VEGF-B in Southern blot analysis.
- Example 1 Selection of VEGF-B Sequences Useful as Transgene .
- the DNA used to generate a transgenic animal can contain a number of different DNA sequences. The selection of an appropriate sequence depends on the desired effect. For example, if an animal possessing a null mutant of VEGF-B is desired, the transgenic DNA contains sequences encoding a protein that is incapable of VEGF-B primary function as a vascular endothelial cell mitogen. While assays to determine the mitogenic activity of a mutated protein may be used, structural information on the VEGF-B gene can also be used to accurately deduce the effect of a particular mutation scheme.
- VEGF-B is a member of the PDGF family of growth factors. As the members of the family are structurally related, the effects of mutations on other PDGF family members can be extrapolated to indicate the effect on VEGF-B. Accordingly, a mutation in VEGF producing a particular effect can likely result in the same or similar effect in VEGF-B. Likewise, mutations in the other members of the PDGF family can be used to create mutations in the VEGF-B gene.
- the gene for mouse VEGF-B first was cloned from a mouse ⁇ FIXII -library (Stratagene; La Jolla, CA) using pcif-2 as the probe. The details of this procedure are described in Olofsson et al . , J “ . Biol . Chem . , 271:19310-19317 (1996) (specifically incorporated herein by reference) . Three ⁇ -clones denoted 10, 11 and 12, each carrying about 20 kb of mouse genomic DNA, were isolated and characterized. A detailed restriction map of the genomic DNA was generated by digestion of the ⁇ DNA with different restriction enzymes followed by identification of the restriction fragments by Southern blotting. Various 32 P-labeled oligonucleotide probes obtained from the sequence of the mouse cDNA clones were used in the Southern blotting.
- the information obtained from the restriction map of the ⁇ DNA harboring the VEGF-B gene was used to select a DNA for transgenesis .
- the DNA selected depends on the properties, characteristics, genotype, or phenotype the transgenic animal is to possess. Various properties, characteristics, genotypes, or phenotypes may be desired.
- an animal in which the VEGF-B DNA has been linked to a marker sequence such as ⁇ - galactosidase, green fluorescent protein, or luciferase or the like known in the art, may be desired for assays to determine the localization of expressed VEGF-B protein.
- VEGF-B DNA operably linked to highly inducible promoter or promoter directing expression in mammary tissue may be desired for purposes of obtaining VEGF-B protein from the animal.
- Many promoters or expression systems that may be used are known in the art.
- mutant VEGF-B sequences once operably inserted into a transgenic animal, may provide research animals for determining the molecular basis of angiogenesis or tumor development .
- a null allele of the VEGF-B gene is desired.
- the gene product of the null allele would be nonfunctional with respect to the angiogenic properties of VEGF-B.
- Animals with a null allele of VEGF-B can be useful in a variety of assays to identify compounds that effect angiogenesis in an animal, for example.
- null alleles One method for producing a null allele involves deleting or modifying the DNA sequence to prevent the formation of intramolecular or intermolecular disulfide bonds, or both. Specifically, regions encoding cysteine residues known to or believed to be involved in disulfide bonding are deleted. Alternatively, individual cysteine residues are mutated by a point mutation or site-directed mutagenesis procedure, many of which are known in the art. However, null alleles can be produced in a number of other ways. From the restriction map of VEGF-B, for example, convenient restriction sites can be selected for creating deletion mutants.
- null mutations there are many ways of creating a null mutation, including, but not limited to: (i) deleting the entire gene; (ii) deleting a critical protein-coding sequence; and (iii) deleting a transcription regulatory sequence. Null mutations may also occur if the mutation affects splicing, mRNA stability, etc. Also, insertions or substitutions that alter the reading frame or introduce premature stop codons may cause null mutations.
- Another method for producing a null mutant involves deleting those regions involved in receptor binding.
- structural information regarding receptor binding exists and is known in the art . That information can be used to delete related portions of the VEGF-B gene to create a null allele.
- VEGF-B binding to receptor Flt-1 and methods for identifying VEGF-B analogs that bind to receptor Flt-1 are discussed in co-pending U.S. application Serial No. 08/994,540, specifically incorporated herein by reference. That information can be used to generate null alleles for VEGF-B as well. From the discussion above, one skilled in the art will appreciate that a number of techniques known in the art can be used to design null alleles for VEGF-B. The invention, therefore, is not limited to the specifically exemplified deletion in generating a transgenic animal bearing a null allele of VEGF-B.
- Example 2 Production of Transgenic Vector with VEGF-B Deletion Mutant .
- VEGF-B seven out of the eight cysteine residues in the amino terminal domain of VEGF-B were removed. This deletion disrupts three intramolecular disulfide bonds as well as two intermolecuiar disulfide bonds used for covalent dimerization of the mature VEGF-B molecule.
- a 330 bp Spel -Kpnl fragment was deleted. The fragment contains part of exon 3 and the whole of exon 4 of the VEGF-B gene. Specifically, 33 amino acids encoded by the 3 ' part of exon 3 and all 24 amino acids of exon 4 were deleted.
- the resulting VEGF-B protein generated from the targeted allele is nonfunctional as it lacks these critical amino acids and the allele is a null allele .
- the starting materials for the generation of a recombinant transgenic vector lacking the SpeI ⁇ KpnI fragment of VEGF-B were a 10 kb NotI ⁇ HindIII fragment from ⁇ -clone 10, subcloned into plasmid pBluescriptTM (Stratagene) (construct A), and a 1.7 kb pPGK-neo cassette (Sibilia, M. Science 269 : 234-238 (1995)) cloned into pBluescript (construct B) .
- the 1.2 kb Kpnl/Hind III fragment used to generate the 3' region of the transgenic vector was isolated by digesting the 10 kb VEGF-B fragment from construct A with Kpnl, generating blunt ends from the Kpnl sticky ends with T4 polymerase, and finally cleaving with Hindlll. This and all subsequent fragments were isolated on low gelling temperature (LGT) agarose gels made in 1 x TBE (Tris Borate EDTA) buffer. The isolated 1.2 kb fragment was then ligated into EcoRV and HindiII digested pBluescript vector, resulting in construct C.
- LGT low gelling temperature
- the 5 ' fragment of the transgenic vector was isolated from construct A by cleaving with Notl/Spel .
- the isolated fragment was then ligated into Notl/Spel digested construct C to generate construct D.
- the pPGK-neo cassette was isolated by digesting construct B with NotI/HindiII and generating blunt ends with Klenow fragment. The resulting fragment was gel purified and then ligated into construct D digested with EcoRI and blunted with the Klenow fragment, resulting in construct E. This 11.2 kb vector with the pPGK-neo cassette inserted in the forward direction was chosen as the targeting vector for transgenesis .
- a schematic of constructs A-E is found in Figure 4.
- a Southern blot assay was used to confirm the identity of wildtype versus mutated alleles. Genomic DNA was digested with EcoRI and prepared for blotting. The 450 bp radiolabeled fragment, used as the probe in the screening procedure above, mainly encompassed sequences encoding exon 7 and the 3 ' non- translated region of the VEGF-B cDNA. This probe was generated by PCR using DNA from clone 10 as the template. The primers used in the PCR application were 5 ' -GTGAAGCTCCAGCCGAGCA (sense-strand) (SEQ IDNO: 1) and 5 ' -TAGTGTCTTCCATCTCTTT (antisense-strand) (SEQ ID NO: 2) . The mutant allele generated a genomic EcoRI restriction fragment of 6.5 kb while the wild-type allele generated a >20 kb fragment under these conditions.
- Example 3 Insertion of the Transgenic Vector Into Animal Cells.
- the vector containing the mutant VEGF-B (construct E) was transfected into E14.1 cells derived from the 129/SW mouse (Kuhn, R. et al., Science 254: 707-710 (1991)) by electroporation. Neomycin resistant clones were isolated by standard procedures and characterized. Manipulating the Mouse Embryo. A laboratory Manual edited by B. Hogan, R. Beddington, F. Constantini and E. Lacy, Cold Spring Harbor Laboratory Press, (1994) describes procedures for isolating and manipulating embryos (specifically incorporated herein by reference) .
- Genomic DNA from several hundred clones were isolated, EcoRI digested, and analyzed by Southern blotting. Using these procedures, three positive clones denoted la, 8f, and 9h, were identified by detecting the 6.5 kb band and also the wild-type 20 kb band. Probing a Southern blot with radiolabeled PKG-neo cassette also gave the expected 6.5 kb band for clones la and 9h. These data show that one allele of the two VEGF-B alleles in the ES cells has been correctly targeted by the construct and that ES cells containing the null allele for VEGF-B were generated.
- the chimera will be a mixture of Chincilla (patches of skin to which only ES cells contributed) , black (patches to which only host cells contributed) and brown or Agouti (patches of skin in which there was a mixture of 129/SW and C57B1/6 cells) .
- the chimeric animals are brown because the Agouti protein secreted from 129/SW cells will stimulate C57B1/6 hair follicle cells to process the melanin (black pigment) in such a way that the hair becomes brown.
- mice Male chimeric mice were mated with C57B1/6 wildtype females. The presence of brown mice in the offspring from these female mice indicated germline transmission of the transgenic DNA.
- DNA prepared from the tails of these Fl mice were analyzed by Southern blotting as above. Generally, 0.5 cm of tail tissue was surgically removed and used to prepare DNA samples. The 6.5 kb EcoRI fragment was present in 50% of the brown mice indicating that there was no selection against the targeted null allele of VEGF-B.
- the Fl mice carrying the targeted VEGF-B locus are heterozygotes as they also carry a wildtype allele for VEGF-B. The presence of normally developed Fl mice carrying one inactivated allele of VEGF-B show that gene dosage for VEGF-B is not critical for survival.
- Heterozygote Fl mice were crossed and tail DNA from the offspring was analyzed by Southern blotting and by PCR. The results obtained using the two techniques were identical and the details of the PCR genotyping procedure is given.
- the PCR amplifications were performed using standard conditions with tail DNA from the F2 offspring as the template.
- the wildtype allele was identified as a 316 bp amplified band using two primers located in exon 3 and exon 4. These primers were 5 ' - GCCCAGCTGTGTGACTGT (forward) (SEQ ID NO: 3) and 5'- CCCACCCCATGCTACACT (reverse) (SEQ ID NO : 4) , respectively.
- the targeted allele was identified as a 140 bp band using two primers located in the neomycin resistance gene. These primers were 5'- TGTTCTCCTCTTCCTCATCTCC (forward) (SEQ ID NO: 5) and 5'- ATTGTCTGTTGTGCCCAGTC (reverse) (SEQIDNO: 6), respectively.
- the results from the PCR amplifications are summarized in Fig. 2.
- the analyses showed that mice homozygous for the targeted allele of VEGF-B are viable and analysis of a large number of animals of the F2 generation gave a 1:2:1 ratio of wildtype, heterozygotes, and homozygote animals carrying the null allele.
- the null allele is inherited in a classical Mendelian fashion.
- VEGF-B knock out mice did not reveal any gross morphological changes compared to wildtype mice. However, it was observed that the heart of some of the transgenic VEGF-B mutant mice appeared to be malformed. The hearts were generally smaller in size than wild- type and the larger vessels appeared more dilated. These phenotypes indicate that the VEGF-B knock out mice could be used as models to screen compounds for an effect on heart tissue growth or development .
- Example 5 Detection of VEGF-B Nucleic Acids in Cell or Tissue Specimens .
- RNA or tissue specimens can be obtained by many convenient methods known in the art. Generally, centrifuged cell pellets or tissue samples are immediately frozen. Total RNA is isolated by the guanidinium isothiocyanate procedure [Chomczynski et al . , Anal. Biochem . , 162:156-159 (1987)]. cDNA is synthesized using 0.2 ⁇ g of random hexadeoxynucleotide primers, 5 units of murine reverse transcriptase, 5 ⁇ g of total RNA as a template and a first-strand cDNA synthesis kit (Pharmacia) . After incubation at 37°C for 1 hour, the reaction mixture was stored at —70°C.
- VEGF-B sense 5 ' -GCCATGTGTCACCTTCGCAG-3 '
- VEGF-B antisense 5 ' -TGTCCCTGGAAGAACACAGCC-3 '
- SEQ ID NO: 8 VEGF-B antisense: 5 ' -TGTCCCTGGAAGAACACAGCC-3 '
- SEQ ID NO: 9 ⁇ -actin antisense: 5 ' -GGAGTTGAAGGTAGTTTCGTG-3 ' (SEQ ID NO: 10)
- [ ⁇ - actin sequences comprise nucleotides 2105-2125 and 2411-2432 from Ng e
- Electrophoresis of 5 ⁇ l of the PCR reaction mix was performed in a 2% agarose gel containing ethidium bromide.
- the size marker DNA fragments ranged in length from 24 to 726 base pairs ( ⁇ X174 DNA/Hinf I marker from Promega, Madison, WI , USA).
- Example 6 Use of Cells and Tissue from Transgenic Animals.
- VEGF-B knock out mice appear smaller than wild-type, suggesting, inter alia , a usefulness in heart cell growth assays, heart rate assays, cardiac output assays or assays of other heamodynamic properties.
- Other uses in screening assays will be appreciated by one skilled in the art .
- cultures of the cells or tissue from transgenic animals can be used that contain at least one cell derived from the transgenic animal.
- the cells are grown as explants or separated by mechanical dispersion and grown as primary cultures.
- the cells are transformed into cell lines by transformation methods known in the art or by initially crossing the transgenic mouse with, for example, the H-2KtsA58 Mouse described by Jat et al . PNAS USA 88: 5096-5100 (1991) , or other related methods known in the art (see, for example, McClean, J.S., Tibtech 11:232 (1993) .
- the cross of the knock out mutant with the H-2K b tsA58 transgenic mouse would generate conditionally immortal lines of various cells.
- cells are initially grown at the permissive temperature for the ts (temperature sensitive) A58 T-antigen so that the cells can be cultured for many passages.
- the T-Ag immortalizes the cells.
- the cells are shifted to the non- permissive temperature to disable the activity of the T-Ag, the cells differentiate, thereby potentially generating many different cell lines from different tissues.
- Example 7 Assays for Angiogenicity and/or Tumor Growth Modulating Activity.
- a tissue sample such as heart explants from the VEGF-B knock out mice, which would also contain the responding cells, can be used to test VEGF-B analogs.
- the tissue sample or an explant is maintained in a solution as known in the art.
- Compounds, such as VEGF-B analogs or small molecules, are added to the tissue sample or explant and the effect on the tissue sample or explant analyzed. In this way, physiological effects such as angiogenicity, inhibiting or facilitating tumor growth, increase in musculature, or other effects associated with VEGF-B can be assayed for.
- One skilled in the art can rely on methods known in the art, such as those in Ausubel (1989) and Hogan (1994) for example, to devise particular embodiments.
- Example 8 Investigation of Expression of VEGF-B Transcripts.
- the expression of VEGF-B transcripts in heart and skeletal muscle was investigated by Northern blotting in wild-type mice (+/+) , heterozygote mice (+/-) and in the homozygous knockout mice (-/-) .
- VEGF-B deficient and wild type C57B1/6 mice were killed and different tissues were snap frozen and stored in -80°C until used.
- Total cellular RNA were prepared using the guanidinium thiocyanate/acid phenol method [see Chomczynski et al, Analytical Biochemistry, 162:156-159 (1987)].
- RNA from each sample was used per lane in a 1% agarose gel, running at 80 V for about 3 hours.
- the gel was subsequently transferred to a nylon membrane (HybondTM-N+, Amersham) followed by UV cross linking.
- Prehybridization was carried out for 2 hours in 5 x SSC, 5 x Denhardt solution, 0.5% SDS and 100 ⁇ g/ml of single- stranded DNA, followed by hybridization overnight with specific probes at 65 °C according to the manufacturer's protocol (Amersham) .
- the two probes used were (a) the full length mouse VEGF-B cDNA and (b) a probe covering the deleted portion of the VEGF-B gene in the null allele.
- a 1.8 kb VEGF-B 167 cDNA fragment was used to make the first probe using a random labelling kit (Amersham) following the recommended protocol.
- the second probe used in the Northern analysis was produced using a 148 bp fragment within the exons 3 and 4 of VEGF-B, which is replaced by the Neo gene in the null allele/targeting vector, and was labelled by a PCR method [see Konat et al . , PCR Technology, pp. 37-42, Griffin eds . , CRC Press, Boca Raton (1994)].
- Taq DNA polymerase and 32 P—dCTP were used in the labelling PCR with 30 cycles of 1 min at 94°C, 2 min at 58°C and 3 min at 72°C.
- FIG. 5a shows the results from the Northern blot using the full length mouse VEGF-B cDNA probe.
- Figure 5b shows the results from a probe covering the deleted portion of the VEGF-B in the null allele.
- Example 9 Transplantation and Measurement of Tumors.
- mice As tumor growth and metastasis formation is known to depend on the neovascularization of the tumor tissue, the growth of a transplanted tumor was investigated in litter-mate wild-type (+/+) and VEGF-B deficient (-/-) mice. Male VEGF-B deficient (- /-) and litter-mate homozygous C57B1/6 mice (+/+) were used in the test. Mouse T241 fibrosarcoma cells were injected intradermally . The 6 to 8 weeks old mice were anesthetized by methoxyflurane before implantation of the tumor cells.
- the result may be attributable to a direct effect on endothelial cell growth or to an indirect effect such as migration, degradation of extracellular matrix, etc.
- the results show that VEGF-B has a role in promoting tumor growth and indicate that anti -tumor strategies can be developed based on inhibition of the action of VEGF-B, for example by blocking the use of monoclonal antibodies to VEGF-B binding to VEGFR-1 or by small molecules binding to VEGFR-1, or by anti VEGF-B therapy, or by a combination of two or more of the foregoing.
- Example 10 Histological Examination of Heart Tissue from Normal and VEGF-B Deficient Mice.
- Example 11 Analysis of Expression of Angiogenic Factors in VEGF-B Deficient mice. Analysis of gene expression in heart from normal and VEGF-B deficient mice, by RNAse protection assays using radiolabelled cRNA probes, revealed that most genes investigated were normally expressed in the mutant animals. Normally expressed genes included the genes for VEGF, PlGF, PDGF A, PDGF receptors a and b, VEGF receptors 1 and 2, neuropilin 1, Tie 1 receptor, urokinase plaminogen activator, plasminogen activator inhibitor 1 and platelet endothelial cell adhesion molecule. The only gene whose expression was altered in the mutant mice was PDGF B (down about 30%, p > 0.05) . At present it is unclear what the altered expression of PDGF B means .
- Example 12 Heart abnormalities in VEGF-B deficient mice.
- VEGF-B deficient mice and normal litter mates were compared to look for heart abnormalities using a telemetry system (DATA Science, St. Paul, MN, USA) .
- the telemetry system consists of implantable transmitters (TA10ETA-F20) , telemetry receivers (RA1010) and a consolidation matrix (BCM100) that relays information from the telemetry receivers.
- TA10ETA-F20 implantable transmitters
- BCM100 consolidation matrix
- transmitters were implanted in the abdomen of the animals .
- the two electrodes were positioned close to the heart apex and subcutaneously on the right shoulder, respectively.
- the data acquisition system consists of a data translation (DT 2801) AD converter and the computer program PC-LAB v.5.0 (Axenborg and Hirsch, Comp . Meth. Progr. Biomed. 41:55-67, (1993)).
- the data obtained was further analyzed using an Excel macro program and the data was presented as locomotor activity counts per minute, body temperature and heart rate per minute .
- the ECG arrays were used to study heart rhythms. From the average ECGs, the PQ, QRS and QT intervals were calculated in milliseconds by the computer program PC-LAB v.5.0.
- the procedures used are described in Johansson and Thoren, Acta Physiol . Scand. 160:133-138 (1997) and are specifically incorporated by reference.
- the PQ interval is prolonged m the -/- animals as compared to +/+ animals (see also Table 1: 39.7 milliseconds versus 35.7 milliseconds, p>0.05) .
- AV atrioventricular
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Environmental Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Animal Husbandry (AREA)
- Wood Science & Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002363488A CA2363488A1 (en) | 1999-03-03 | 2000-03-03 | Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities |
| JP2000602624A JP2004513328A (ja) | 1999-03-03 | 2000-03-03 | 血管内皮増殖因子(vegf−b)欠損動物の心臓異常及びこれら心臓異常に関する方法 |
| AU36147/00A AU3614700A (en) | 1999-03-03 | 2000-03-03 | Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities |
| EP00914803A EP1166102A4 (en) | 1999-03-03 | 2000-03-03 | HEART ERRORS OF VEGF-DEFICIENT ANIMALS AND RELATED METHODS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16008399P | 1999-03-03 | 1999-03-03 | |
| US60/160,083 | 1999-03-03 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2000052462A1 true WO2000052462A1 (en) | 2000-09-08 |
Family
ID=22575449
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/005465 Ceased WO2000052462A1 (en) | 1999-03-03 | 2000-03-03 | Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP1166102A4 (https=) |
| JP (1) | JP2004513328A (https=) |
| CN (1) | CN1342264A (https=) |
| AU (1) | AU3614700A (https=) |
| CA (1) | CA2363488A1 (https=) |
| NZ (1) | NZ513780A (https=) |
| WO (1) | WO2000052462A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1581241A4 (en) * | 2001-06-20 | 2005-11-09 | Ludwig Inst Cancer Res | STIMULATION OF VASCULARIZATION WITH VEGF-B |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2741117A1 (en) * | 2008-10-30 | 2010-05-06 | Centre De Recherche Public De La Sante | Biomarkers for heart failure |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998036052A1 (en) * | 1997-02-18 | 1998-08-20 | Ludwig Institute For Cancer Research | Transgenic animal with recombinant vascular endothelial growth factor b (vegf-b) dna and uses thereof |
| US5840693A (en) * | 1995-03-01 | 1998-11-24 | Ludwig Institute For Cancer Research | Vascular endothelial growth factor-B |
-
2000
- 2000-03-03 NZ NZ513780A patent/NZ513780A/xx not_active Application Discontinuation
- 2000-03-03 CA CA002363488A patent/CA2363488A1/en not_active Abandoned
- 2000-03-03 WO PCT/US2000/005465 patent/WO2000052462A1/en not_active Ceased
- 2000-03-03 CN CN00804556A patent/CN1342264A/zh active Pending
- 2000-03-03 JP JP2000602624A patent/JP2004513328A/ja active Pending
- 2000-03-03 AU AU36147/00A patent/AU3614700A/en not_active Abandoned
- 2000-03-03 EP EP00914803A patent/EP1166102A4/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5840693A (en) * | 1995-03-01 | 1998-11-24 | Ludwig Institute For Cancer Research | Vascular endothelial growth factor-B |
| WO1998036052A1 (en) * | 1997-02-18 | 1998-08-20 | Ludwig Institute For Cancer Research | Transgenic animal with recombinant vascular endothelial growth factor b (vegf-b) dna and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP1166102A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1581241A4 (en) * | 2001-06-20 | 2005-11-09 | Ludwig Inst Cancer Res | STIMULATION OF VASCULARIZATION WITH VEGF-B |
| US7709450B2 (en) | 2001-06-20 | 2010-05-04 | Ludwig Institute For Cancer Research | Stimulation of vascularization with VEGF-B-186 |
Also Published As
| Publication number | Publication date |
|---|---|
| AU3614700A (en) | 2000-09-21 |
| JP2004513328A (ja) | 2004-04-30 |
| EP1166102A1 (en) | 2002-01-02 |
| CA2363488A1 (en) | 2000-09-08 |
| EP1166102A4 (en) | 2002-08-21 |
| NZ513780A (en) | 2001-09-28 |
| CN1342264A (zh) | 2002-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sharma et al. | Myostatin, a transforming growth factor‐β superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct | |
| US6441137B1 (en) | Expressed ligand-vascular intercellular signalling molecule | |
| US7976839B2 (en) | Growth differentiation factor-11 | |
| US20020150577A1 (en) | Use of antibodies specific for growth differentiation factor-11 | |
| CZ292453B6 (cs) | Izolovaná molekula nukleové kyseliny kódující TIE-2 ligand a její použití | |
| WO1998035019A1 (en) | Growth differentiation factor-11 | |
| AU724467B2 (en) | TIE-2 receptor ligand (TIE ligand-4) and its uses | |
| US6262337B1 (en) | Transgenic animal with recombinant vascular endothelial growth factor B (VEGF-B DNA) and uses thereof | |
| US20020164687A1 (en) | Platelet-derived growth factor C, DNA coding therefor, and uses thereof | |
| EP0658209A1 (en) | Endothelial lineage specific transcriptional regulatory element from tek | |
| WO2000052462A1 (en) | Heart abnormalities in vascular endothelial growth factor b (vegf-b) deficient animals and methods relating to these heart abnormalities | |
| US7034200B2 (en) | Non-human transgenic animals expressing platelet-derived growth factor C (PDGF-C) and uses thereof | |
| AU765832B2 (en) | Growth differentiation factor-11 | |
| US20100107265A1 (en) | Double-muscling in mammals | |
| US6846914B2 (en) | Tie-2 ligand-3 | |
| RU2242514C2 (ru) | Изолированный tie-лиганд-4 и его изолированный фибриногеноподобный домен; изолированная молекула нуклеиновой кислоты, кодирующая указанный лиганд; вектор, содержащий указанную нуклеиновую кислоту; способ получения клетки-хозяина, трансформированной указанным вектором; способ получения tie-лиганда-4; конъюгат, содержащий указанный лиганд; лиганд-тело, содержащее указанный фибриногеноподобный домен | |
| Detillieux et al. | The application of genetic mouse models to elucidate a role for fibroblast growth factor-2 in the mammalian cardiovascular system | |
| AU2003262440A1 (en) | Growth differentiation factor-11 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 00804556.9 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU CA CN JP KR NZ |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 36147/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 513780 Country of ref document: NZ |
|
| ENP | Entry into the national phase |
Ref document number: 2363488 Country of ref document: CA Ref document number: 2363488 Country of ref document: CA Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2000 602624 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000914803 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000914803 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2000914803 Country of ref document: EP |