WO2000052044A1 - Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof - Google Patents

Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof Download PDF

Info

Publication number
WO2000052044A1
WO2000052044A1 PCT/US2000/005612 US0005612W WO0052044A1 WO 2000052044 A1 WO2000052044 A1 WO 2000052044A1 US 0005612 W US0005612 W US 0005612W WO 0052044 A1 WO0052044 A1 WO 0052044A1
Authority
WO
WIPO (PCT)
Prior art keywords
tadg
protein
seq
fragment
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/005612
Other languages
English (en)
French (fr)
Inventor
Timothy J. O'brien
Lowell J. Underwood
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Arkansas at Fayetteville
University of Arkansas at Little Rock
Original Assignee
University of Arkansas at Fayetteville
University of Arkansas at Little Rock
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Arkansas at Fayetteville, University of Arkansas at Little Rock filed Critical University of Arkansas at Fayetteville
Priority to AU37209/00A priority Critical patent/AU765471B2/en
Priority to CA2362830A priority patent/CA2362830C/en
Priority to JP2000602268A priority patent/JP4558948B2/ja
Priority to EP00916045A priority patent/EP1157035A4/en
Publication of WO2000052044A1 publication Critical patent/WO2000052044A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6472Cysteine endopeptidases (3.4.22)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates generally to the fields of cellular biology and diagnosis of neoplastic disease. More specifically, the present invention relates to a transmembrane serine protease termed Tumor Associated Differentially-Expressed Gene- 12 (TADG-12), which is overexpressed in ovarian carcinoma.
  • TADG-12 Tumor Associated Differentially-Expressed Gene- 12
  • Tumor cells rely on the expression of a concert of proteases to be released from their primary sites and move to distant sites to inflict lethality. This metastatic nature is the result of an aberrant expression pattern of proteases by tumor cells and also by stromal cells surrounding the tumors [1-3]. For mo st tumors to become metastatic, they must degrade their surrounding extracellular matrix components, degrade basement membranes to gain access to the bloodstream or lymph system, and repeat this process in reverse fashion to settle in a secondary host site [3-6]. All of these processes rely upon what now appears to be a synchronized protease cascade. In addition, tumor cells use the power of proteases to activate growth and angiogenic factors that allow the tumor to grow progressively [1].
  • proteases have been associated directly with tumor growth, shedding of tumor cells and invasion of target organs. Individual classes of proteases are involved in, but not limited to (1) the digestion of stroma surrounding the initial tumor area, (2) the digestion of the cellular adhesion molecules to allow dissociation of tumor cells; and (3) the invasion of the basement membrane for metastatic growth and the activation of both tumor growth factors and angiogenic factors.
  • the prior art is deficient in the lack of the complete identification of the proteases overexpressed in carcinoma, therefore, deficient in the lack of a tumor marker useful as a n indicator of early disease, particularly for ovarian cancers.
  • TADG-12 a transmembrane serine protease
  • the present invention fulfills this long-standing need and desire in the art.
  • the present invention discloses TADG-12, a n e w member of the Tumor Associated Differentially-Expressed Gene (TADG) family, and a variant splicing form of TADG-12 (TADG- 12N) that could lead to a truncated protein product.
  • TADG-12 is a transmembrane serine protease overexpressed in ovarian carcinoma. The entire cD ⁇ A of TADG-12 has been identified (SEQ ID No. 1). This sequence encodes a putative protein of 454 amino acids (SEQ ID No. 2) which includes a potential transmembrane domain, an LDL receptor like domain, a scavenger receptor cysteine rich domain, and a serine protease domain.
  • TADG-12 is expressed at the cell surface, an d it may be used as a molecular target for therapy or a diagnostic marker.
  • a DNA fragment encoding a TADG-12 protein selected from the group consisting of: (a) an isolated DNA fragment which encodes a TADG-12 protein; (b) an isolated DNA fragment which hybridizes to isolated DNA fragment of (a) above and which encodes a TADG-12 protein; and (c) an isolated DNA fragment differing from the isolated DNA fragments of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein.
  • the DNA fragment has a sequence shown in SEQ ID No. 1 or SEQ ID No. 3.
  • th ere is provided a vector/host cell capable of expressing the DNA of th e present invention.
  • an isolated and purified TADG-12 protein encoded by DNA selected from the group consisting of: (a) isolated DNA which encodes a TADG-12 protein; (b) isolated DNA which hybridizes to isolated DNA of (a) above and which encodes a TADG-12 protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) above in codon sequence due to th e degeneracy of the genetic code, and which encodes a TADG-12 protein.
  • the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • a method for detecting expression of a TADG-12 protein comprising the steps of: (a) contacting mRNA obtained from the cell with the labeled hybridization probe; an d (b) detecting hybridization of the probe with the mRNA.
  • the present invention further provides methods for diagnosing a cancer or other malignant hyperplasia by detecting the TADG-12 protein or mRNA disclosed herein.
  • a method of inhibiting expression of endogenous TADG-12 mRNA in a cell by introducing a vector into the cell, wherein the vector comprises a DNA fragment of TADG-12 in opposite orientation operably linked to elements necessary for expression.
  • a method of inhibiting expression of a TADG-12 protein in a cell by introducing an antibody directed against a TADG- 12 protein or fragment thereof.
  • a method of targeted therapy b y administering a compound having a targeting moiety specific for a TADG-12 protein and a therapeutic moiety.
  • the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • the present invention still further provides a method of vaccinating an individual against TADG-12 by inoculating th e individual with a TADG-12 protein or fragment thereof.
  • the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • the TADG-12 fragment includes the truncated form of TADG-12N pep tide having a sequence shown in SEQ ID No. 8, and a 9-residue up to 12-residue fragment of TADG-12 protein.
  • an immunogenic composition comprising a n immunogenic fragment of a TADG-12 protein and an appropriate adjuvant.
  • the TADG-12 fragment includes the truncated form of TADG-12N peptide having a sequence shown in SEQ ID No. 8, and a 9-residue up to 12-residue fragment of TADG-12 protein.
  • Figure I A shows that the expected PCR product of approximately 180 bp and the unexpected PCR product of approximately 300 bp using the redundant serine protease primers were not amplified from normal ovary cDNA (Lane 1) b u t were found in abundance from ovarian tumor cDNA (Lane 2). The primer sequences for the PCR reactions are indicated by horizontal arrows.
  • Figure IB shows that TADG-12 was subcloned from th e 180 bp band while the larger 300 bp band was designated TADG- 12N. The sequences were found to overlap for 180 bp (SEQ ID No. 5 for nucleotide sequence, SEQ ID No.
  • Figure 2 shows that Northern blot analysis for TADG- 12 revealed three transcripts of 2.4, 1.6 and 0.7 kilobases. These transcripts were found at significant levels in ovarian tumors and cancer cell lines, but the transcripts were found only at low levels in normal ovary.
  • Figure 3 shows an RNA dot blot (CLONTECH) probed for TADG-12.
  • the transcript was detectable (at background levels) in all 50 of the human tissues represented with the greatest abundance of transcript in the heart. Putamen, amygdala, kidney, liver, small intestine, skeletal muscle, and adrenal gland were also found to have intermediate levels of TADG-12 transcript.
  • Figure 4 shows the entire cDNA sequence for TADG- 12 (SEQ ID No. 1) with its predicted open reading frame of 454 amino acids (SEQ ID No. 2).
  • TADG- 12 SEQ ID No. 1
  • SEQ ID No. 2 th e Kozak's consensus sequence for the initiation of translation and the poly-adenylation signal are underlined.
  • a potential transmembrane domain is boxed.
  • the LDLR- A domain is underlined with a solid line.
  • the SRCR domain is underlined with a broken line.
  • the residues of the catalytic triad of the serine protease domain are circled, and the beginning of the catalytic domain is marked with an arrow designated as a potential proteolytic cleavage site.
  • the * represents the stop codon that terminates translation.
  • Figure 5 A shows the 35 amino acid LDLR-A domain of TADG-12 (SEQ ID No. 13) aligned with other LDLR-A motifs from the serine protease TMPRSS2 (U75329, SEQ ID No. 14), th e complement subunit C8 (P07358, SEQ ID No. 9), two LDLR-A domains of the glycoprotein GP300 (P98164, SEQ ID Nos. 1 1 - 12), and the serine protease matriptase (AF118224, SEQ ID No. 10).
  • TADG-12 has its highest similarity with the other serine proteases for which it is 54% similar to TMPRSS2 and 53% similar to matriptase.
  • FIG. 5B shows the SRCR domain of TADG-12 (SEQ ID No. 17) aligned with other domain family members including th e human macrophage scavenger receptor (P21757, SEQ ID No. 16), human enterokinase (P98073, SEQ ID No. 19), bovine enterokinase (P21758, SEQ ID No. 15), and the serine protease TMPRSS2 (SEQ ID No. 18).
  • TADG-12 shows its highest similarity within this region to the protease TMPRSS2 at 43%.
  • Figure 5C shows th e protease domain of TADG-12 (SEQ ID No.
  • Figure 6 shows semi-quantitative PCR analysis th at was performed for TADG-12 (upper panel) and TADG-12V (lower panel).
  • the TADG-12 transcript was found to b e overexpressed in 41 of 55 carcinomas.
  • the TADG-12V transcript was found to be overexpressed in 8 of 22 carcinomas examined. Note that the samples in the upper panel are not necessarily the same as the samples in the lower panel.
  • Figure 7 shows immunohistochemical staining of normal ovary and ovarian tumors which were performed using a polyclonal rabbit antibody developed to a TADG-12 specific peptide. No significant staining was detected in normal ovary ( Figure 7 A). Strong positive staining was observed in 22 of 2 9 carcinomas examined.
  • Figures 7B and 7C represent a serous and mucinous carcinoma, respectively. Both show diffuse staining throughout the cytoplasm of tumor cells while stromal cells remain relatively unstained.
  • Figure 8 is a model to demonstrate the progression of
  • TADG-12 within a cellular context.
  • th e TADG-12 transcript is appropriately spliced and the resulting protein is capable of being expressed at the cell surface where the protease may be cleaved to an active form.
  • the role of th e remaining ligand binding domains has not yet been determined, but one can envision their potential to bind other molecules for activation, internalization or both.
  • the TADG-12N transcript which occurs in some tumors, may be the result of mutation and/or poor mR ⁇ A processing may be capable of producing a truncated form of TADG-12 that does not have a functional protease domain.
  • this truncated product may pre sent a novel epitope at the surface of tumor cells.
  • TADG-12 Tumor Associated Differentially-expressed Gene-12
  • TADG-12 Tumor Associated Differentially-expressed Gene-12
  • TADG-12 appears to be overexpressed in many ovarian tumors.
  • the extracellular nature of TADG-12 may render tumors susceptible to detection via a TADG-12 specific assay.
  • TADG- 12V a splicing variant of TADG-12, named TADG- 12V, was detected a t elevated levels in 35% of the tumors that were examined.
  • TADG- 12V encodes a truncated form of TADG-12 with an altered amino acid sequence that may be a unique tumor specific target for future therapeutic approaches.
  • the TADG-12 cDNA is 2413 base pairs long (SEQ ID No. 1 ) encoding a 454 amino acid protein (SEQ ID No. 2).
  • the availability of the TADG-12 and/or TADG-12V gene opens the way for a number studies that can lead to various applications.
  • the TADG-12 and/or TADG-12N gene can be used as a diagnostic or therapeutic target in ovarian carcinoma and other carcinomas including breast, prostate, lung and colon.
  • cDNA shall refer to the DNA copy of the mRNA transcript of a gene.
  • derived amino acid sequence shall mean the amino acid sequence determined b y reading the triplet sequence of nucleotide bases in the cDNA.
  • screening a library shall refer to the process of using a labeled probe to check whether, under the appropriate conditions, there is a sequence complementary to the probe present in a particular DNA library.
  • screening a library could be performed by PCR.
  • PCR refers to th e polymerase chain reaction that is the subject of U.S. Patent Nos. 4,683,195 and 4,683,202 to Mullis, as well as other improvements now known in the art.
  • the amino acid described herein are preferred to be in the "L” isomeric form. However, residues in the "D” isomeric form can be substituted for any L-amino acid residue, as long as th e desired functional property of immunoglobulin-binding is retained by the polypeptide.
  • NH2 refers to the free amino group present a t the amino terminus of a polypeptide.
  • COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J Biol. Chem., 243 :3552-59 (1969), abbreviations for amino acid residues are known in the art.
  • amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino- terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues.
  • a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
  • a “vector” is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a “DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) i n its either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure of th e molecule, and does not limit it to any particular tertiary forms .
  • this term includes double-stranded DNA found, inter alia, i n linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes.
  • i n linear DNA molecules e.g., restriction fragments
  • viruses e.g., viruses
  • plasmids e.g., viruses
  • chromosomes e.g., chromosomes
  • a DNA "coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences.
  • a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • a "promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription a t levels detectable above background.
  • RNA polymerase a transcription initiation site, as well a s protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters often, b u t not always, contain "TATA” boxes and “CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the - 1 0 and -35 consensus sequences.
  • An "expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • a “signal sequence” can be included near the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct th e polypeptide to the cell surface or secrete the polypeptide into th e media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes an d eukaryotes .
  • the term "oligonucleotide”, as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more th an three.
  • primer refers to a n oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed u nder conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in th e presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH.
  • the primer may be either single-stranded or double-stranded and must b e sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent.
  • the exact length of the primer will depend upon many factors, including temperature, source of primer and use the method.
  • the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
  • the primers herein are selected to be "substanti" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands . Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that th e primer sequence has sufficient complementary with the sequence or hybridize therewith and thereby form the template for the synthesis of the extension product. As used herein, the terms “restriction endonucleases” and “restriction enzymes” refer to enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
  • a cell has been "transformed” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by th e ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing th e transforming DNA.
  • a “clone” is a population of cells derived from a single cell or ancestor by mitosis.
  • a “cell line” is a clone of a primary cell that is capable of stable growth in vitro for m any generations .
  • Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and mo st preferably at least about 90% or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing th e sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
  • a "heterologous" region of the DNA construct is a n identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature.
  • th e gene when the heterologous region encodes a mammalian gene, th e gene will usually be flanked by DNA that does not flank th e mammalian genomic DNA in the genome of the source organism.
  • coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
  • the labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others.
  • a number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.
  • a particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.
  • Proteins can also be labeled with a radioactive element or with an enzyme.
  • the radioactive label can be detected by any of the currently available counting procedures.
  • the preferred isotope may be selected from 3 H, "C, 32 p, 35 S , 36 C 1, 5 i r , 57 o , 58 Q), 59 Fe , 9 ⁇ ; 1251, 1311, and 186Re .
  • Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques .
  • the enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, ⁇ -glucuronidase, ⁇ -D-glucosidase, ⁇ -D- galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase.
  • 3,654,090, 3,850,752, and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
  • a particular assay system developed and utilized in the art is known as a receptor assay.
  • th e material to be assayed is appropriately labeled and then certain cellular test colonies are inoculated with a quantitiy of both the label after which binding studies are conducted to determine th e extent to which the labeled material binds to the cell receptors. I n this way, differences in affinity between materials can b e ascertained.
  • an assay useful in the art is known as a "cis/trans” assay. Briefly, this assay employs two genetic constructs, one of which is typically a plasmid that continually expresses a particular receptor of interest when transfected into an appropriate cell line, and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a receptor/ligand complex.
  • one of the plasmids would be a construct that results in expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to the luciferase gene in which the response element to th e particular receptor is inserted.
  • the compound under test is a n agonist for the receptor
  • the ligand will complex with the receptor, and the resulting complex will bind the response element and initiate transcription of the luciferase gene.
  • the resulting chemiluminescence is then measured photometrically, and dose response curves are obtained and compared to those of known ligands.
  • the foregoing protocol is described in detail in U.S. Patent No. 4,981 ,784.
  • the term "host” is meant to include not only prokaryotes but also eukaryotes such as yeast, plant and animal cells.
  • a recombinant DNA molecule or gene which encodes a human TADG-12 protein of the present invention can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art.
  • a vector containing coding sequences for the gene which encodes a huma TADG-12 protein of the present invention for purposes of prokaryote transformation.
  • Prokaryotic hosts may include E. coli, S. tymph imurium , Serratia marcescens and Bacillus subtilis.
  • Eukaryotic hosts include yeasts such as Pichia pastoris, mammalian cells and insect cells.
  • expression vectors containing promoter sequences which facilitate the efficient transcription of th e inserted DNA fragment are used in connection with the host.
  • the expression vector typically contains an origin of replication, promoter(s), terminator(s), as well as specific genes which are capable of providing phenotypic selection in transformed cells.
  • the transformed hosts can be fermented and cultured according to means known in the art to achieve optimal cell growth.
  • the invention includes a substantially pure DNA encoding a TADG-12 protein, a strand of which DNA will hybridize at high stringency to a probe containing a sequence of at least 1 5 consecutive nucleotides of the sequence shown in SEQ ID No. 1 or SEQ ID No. 3.
  • the protein encoded by the DNA of this invention may share at least 80% sequence identity (preferably 85%, more preferably 90%, and most preferably 95%) with the amino acids listed in SEQ ID No. 2 or SEQ ID No. 4. More preferably, the DNA includes the coding sequence of the nucleotides of Figure 4 (SEQ ID No. 1), or a degenerate variant of such a sequence.
  • the probe to which the DNA of the invention hybridizes preferably consists of a sequence of at least 2 0 consecutive nucleotides, more preferably 40 nucleotides, even more preferably 50 nucleotides, and most preferably 1 00 nucleotides or more (up to 100%) of the coding sequence of th e nucleotides listed in Figure 4 (SEQ ID No. 1) or the complement thereof.
  • Such a probe is useful for detecting expression of TADG- 12 in a human cell by a method including the steps of (a) contacting mRNA obtained from the cell with the labeled hybridization probe; and (b) detecting hybridization of the probe with the mRNA.
  • This invention also includes a substantially pure DNA containing a sequence of at least 15 consecutive nucleotides (preferably 20, more preferably 30, even more preferably 50, and most preferably all) of the region from nucleotides 1 to 2413 of the nucleotides listed in SEQ ID No. 1, or of the region from nucleotides 1 to 2544 of the nucleotides listed in SEQ ID No. 3.
  • the present invention also comprises antisense oligonucleotides directed against this novel DNA. Given the teachings of th e present invention, a person having ordinary skill in this art would readily be able to develop antisense oligonucleotides directed against this DNA.
  • high stringency DNA hybridization and wash conditions characterized by high temperature and low salt concentration, e.g., wash conditions of 65°C at a salt concentration of approximately 0.1 x SSC, or the functional equivalent thereof.
  • high stringency conditions may include hybridization at about 42°C in the presence of about 50% formamide; a first wash at about 65°C with about 2 x SSC containing 1% SDS; followed by a second wash at about 65°C with about 0.1 x SSC.
  • substantially pure DNA is meant DNA that is not part of a milieu in which the DNA naturally occurs, by virtue of separation (partial or total purification) of some or all of th e molecules of that milieu, or by virtue of alteration of sequences that flank the claimed DNA.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into th e genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by polymerase chain reaction (PCR) or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence, e.g., a fusion protein. Also included is a recombinant DNA which includes a portion of the nucleotides shown in SEQ ID No. 3 which encodes a n alternative splice variant of TADG-12 (TADG- 12V).
  • the DNA may have at least about 70% sequence identity to the coding sequence of the nucleotides listed in SEQ ID No. 1 or SEQ ID No. 3, preferably at least 75% (e.g. at least 80%); and most preferably at least 90%.
  • the identity between two sequences is a direct function of the number of matching or identical positions. When a subunit position in both of the two sequences is occupied by the same monomeric subunit, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then they are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity.
  • the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 7 5 nucleotides, and most preferably 100 nucleotides. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
  • the present invention comprises a vector comprising a DNA sequence which encodes a human TADG-12 protein and th e vector is capable of replication in a host which comprises, in operable linkage: a) an origin of replication; b) a promoter; and c) a DNA sequence coding for said protein.
  • the vector of the present invention contains a portion of the DNA sequence shown in SEQ ID No. 1 or SEQ ID No. 3.
  • a "vector" may be defined as a replicable nucleic acid construct, e.g., a plasmid or viral nucleic acid. Vectors may be used to amplify and/or express nucleic acid encoding a TADG-12 protein.
  • An expression vector is a replicable construct in which a nucleic acid sequence encoding a polypeptide is operably linked to suitable control sequences capable of effecting expression of the polypeptide in a cell.
  • control sequences include a transcriptional promoter and/or enhancer, suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. Methods which are well known to those skilled in the art can be used to construct expression vectors containing appropriate transcriptional and translational control signals. See for example, the techniques described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual (2nd Ed.), Cold Spring Harbor Press, N.Y.
  • a gene and its transcription control sequences are defined a s being "operably linked" if the transcription control sequences effectively control the transcription of the gene.
  • Vectors of th e invention include, but are not limited to, plasmid vectors and viral vectors.
  • Preferred viral vectors of the invention are those derived from retroviruses, adenovirus, adeno-associated virus, SV40 virus, or herpes viruses.
  • substantially pure protein is meant a protein which has been separated from at least some of those components which naturally accompany it.
  • the protein is substantially pure when it is at least 60%, by weight, free from th e proteins and other naturally-occurring organic molecules with which it is naturally associated in vivo.
  • the purity of the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight.
  • a substantially p ure TADG-12 protein may be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid encoding an TADG-12 polypeptide; or by chemically synthesizing the protein.
  • Purity can be measured by any appropriate method, e.g., column chromatography such as immunoaffinity chromatography using an antibody specific for TADG-12, polyacrylamide gel electrophoresis, or HPLC analysis.
  • a protein is substantially free of naturally associated components when it is separated from at least some of those contaminants which accompany it in its natural state.
  • a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be, b y definition, substantially free from its naturally associated components.
  • substantially pure proteins include eukaryotic proteins synthesized in E. coli, other prokaryotes, o r any other organism in which they do not naturally occur.
  • th e invention also includes fragments (e.g., antigenic fragments) of the TADG-12 protein.
  • fragment as applied to a polypeptide, will ordinarily be at least 10 residues, more typically at least 20 residues, and preferably at least 30 (e.g., 50) residues in length, but less than the entire, intact sequence.
  • Fragments of the TADG- 12 protein can be generated by methods known to those skilled in the art, e.g., by enzymatic digestion of naturally occurring or recombinant TADG-12 protein, by recombinant DNA techniques using an expression vector that encodes a defined fragment of TADG-12, or by chemical synthesis.
  • TADG-12 The ability of a candidate fragment to exhibit a characteristic of TADG-12 (e.g., binding to an antibody specific for TADG-12) can be assessed b y methods described herein.
  • Purified TADG-12 or antigenic fragments of TADG-12 can be used to generate new antibodies or to test existing antibodies (e.g., as positive controls in a diagnostic assay) by employing standard protocols known to those skilled in the art. Included in this invention are polyclonal antisera generated by using TADG-12 or a fragment of TADG-12 as th e immunogen in, e.g., rabbits. Standard protocols for monoclonal and polyclonal antibody production known to those skilled in this art are employed. The monoclonal antibodies generated by this procedure can be screened for the ability to identify recombinant TADG-12 cDNA clones, and to distinguish them from known cDNA clones.
  • TADG-12 proteins which are encoded at least in part by portions of SEQ ID No. 1 or SEQ ID No. 3, e.g., products of alternative mRNA splicing or alternative protein processing events, or in which a section of TADG-12 sequence has been deleted.
  • the fragment, or the intact TADG-12 polypeptide may be covalently linked to another polypeptide, e.g. which acts as a label, a ligand or a means to increase antigenicity.
  • the invention also includes a polyclonal or monoclonal antibody which specifically binds to TADG-12.
  • the invention encompasses not only an intact monoclonal antibody, but also a n immunologically-active antibody fragment, e.g., a Fab or (Fab)2 fragment; an engineered single chain Fv molecule; or a chimeric molecule, e.g., an antibody which contains the binding specificity of one antibody, e.g., of murine origin, and the remaining portions of another antibody, e.g., of human origin.
  • the antibody, or a fragment thereof may be linked to a toxin or to a detectable label, e.g. a radioactive label, non-radioactive isotopic label, fluorescent label, chemiluminescent label, paramagnetic label, enzyme label, o r colorimetric label.
  • a detectable label e.g. a radioactive label, non-radioactive isotopic label, fluorescent label, chemiluminescent label, paramagnetic label, enzyme label, o r colorimetric label.
  • suitable toxins include diphtheria toxin, Pseudomonas exotoxin A, ricin, and cholera toxin.
  • suitable enzyme labels include malate hydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, acetylcholinesterase, etc.
  • suitable radioisotopic labels include 3 H, 125 L 1 31 I, 32 P, 35 S, 14 C, etc.
  • Paramagnetic isotopes for purposes of in vivo diagnosis can also be used according to the methods of this invention.
  • elements that are useful in magnetic resonance imaging.
  • Schaefer e t al., ( 1989) JACC 14, 472-480 Shreve et al., (1986) Magn. Reson. Med. 3, 336-340; Wolf, G. L., (1984) Physiol. Chem. Phys. Med. NMR 16, 93-95; Wesbey et al., (1984) Physiol. Chem. Phys. Med. NMR 16, 145-155; Runge et al., (1984) Invest. Radiol.
  • fluorescent labels include a fluorescein label, an isothiocyalate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an ophthaldehyde label, a fluorescamine label, etc.
  • chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridiniu ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, a n aequorin label, etc.
  • Also within the invention is a method of detecting TADG-12 protein in a biological sample, which includes the steps of contacting the sample with the labeled antibody, e.g., radioactively tagged antibody specific for TADG-12, and determining whether the antibody binds to a component of th e sample.
  • the invention provides a number of diagnostic advantages and uses.
  • the TADG-12 protein disclosed in the present invention is useful in diagnosing cancer in different tissues since this protein is highly overexpressed in tumor cells.
  • Antibodies (or antigen-binding fragments thereof) which bind to an epitope specific for TADG-12 are useful in a method of detecting TADG-12 protein in a biological sample for diagnosis of cancerous or neoplastic transformation.
  • This method includes the steps of obtaining a biological sample (e.g., cells, blood, plasma, tissue, etc.) from a patient suspected of having cancer, contacting the sample with a labeled antibody (e.g., radioactively tagged antibody) specific for TADG-12, and detecting the TADG-12 protein using standard immunoassay techniques such as an ELISA.
  • a biological sample e.g., cells, blood, plasma, tissue, etc.
  • a labeled antibody e.g., radioactively tagged antibody
  • Antibody binding to the biological sample indicates that the sample contains a component which specifically binds to an epitope within TADG-12.
  • a standard Northern blot assay can be u sed to ascertain the relative amounts of TADG-12 mRNA in a cell or tissue obtained from a patient suspected of having cancer, in accordance with conventional Northern hybridization techniques known to those of ordinary skill in the art.
  • This Northern assay uses a hybridization probe, e.g. radiolabelled TADG-12 cDNA, either containing the full-length, single stranded DNA having a sequence complementary to SEQ ID No. 1 or SEQ ID No. 3, or a fragment of that DNA sequence at least 20 (preferably at least 30, more preferably at least 50, and most preferably at least 1 00 consecutive nucleotides in length).
  • the DNA hybridization probe can be labeled by any of the many different methods known to those skilled in this art.
  • Antibodies to the TADG-12 protein can be used in a n immunoassay to detect increased levels of TADG-12 protein expression in tissues suspected of neoplastic transformation. These same uses can be achieved with Northern blot assays an d analyses .
  • the present invention is directed to DNA fragment encoding a TADG-12 protein selected from the group consisting of:
  • the DNA has the sequence shown in SEQ ID No. 1 or SEQ ID No. 3. More preferably, the DNA encodes a TADG- 12 protein having the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • the present invention is also directed to a vector and/or a host cell capable of expressing the DNA of the present invention.
  • the vector contains DNA encoding a TADG- 12 protein having the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • Representative host cells include bacterial cells, yeast cells, mammalian cells and insect cells.
  • the present invention is also directed to an isolated and purified TADG-12 protein coded for by DNA selected from th e group consisting of: (a) isolated DNA which encodes a TADG-12 protein; (b) isolated DNA which hybridizes to isolated DNA of (a) above and which encodes a TADG-12 protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein.
  • the isolated and purified TADG-12 protein has the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
  • the present invention is also directed to a method of detecting expression of the TADG-12 protein described herein, comprising the steps of: (a) contacting mRNA obtained from the cell with the labeled hybridization probe; and (b) detecting hybridization of the probe with the mRNA.
  • a method for diagnosing a cancer by detecting a TADG- 12 protein in a biological sample, wherein the presence or absence of a TADG-12 protein indicates the presence or absence of a cancer.
  • the biological sample is selected from th e group consisting of blood, urine, saliva, tears, interstitial fluid, ascites fluid, tumor tissue biopsy and circulating tumor cells.
  • the detection of TADG-12 protein is by means selected from the group consisting of Northern blot, Western blot, PCR, dot blot, ELIZA sandwich assay, radioimmunoassay, DNA array chips and flow cytometry.
  • Such method is used for detecting an ovarian cancer, breast cancer, lung cancer, colon cancer, prostate cancer and other cancers in which TADG-12 is overexpressed.
  • a method for detecting malignant hyperplasia b y detecting a TADG-12 protein or TADG-12 mRNA in a biological sample. Further by comprising the TADG-12 protein or TADG-12 mRNA to reference information, a diagnosis or a treatment can b e provided.
  • PCR amplification is used for detecting TADG-12 mRNA, wherein the primers utilized are selected from the group consisting of SEQ ID Nos. 28-31.
  • detection of a TADG-12 protein is by immunoaffinity to a n antibody directed against a TADG-12 protein.
  • a method of inhibiting expression of endogenous TADG-12 mRNA in a cell by introducing a vector comprising a DNA fragment of TADG-12 in opposite orientation operably linked to elements necessary for expression.
  • the vector produces TADG-12 antisense mRNA in the cell, which hybridizes to endogenous TADG-12 mRNA, thereby inhibiting expression of endogenous TADG-12 mRNA.
  • a method of inhibiting expression of a TADG-12 protein by introducing an antibody directed against a TADG-12 protein or fragment thereof.
  • the binding of the antibody to the TADG-12 protein or fragment thereof inhibits the expression of the TADG-12 protein.
  • TADG-12 gene products including the truncated form can be used for targeted therapy.
  • a compound having a targeting moiety specific for a TADG-12 protein and a therapeutic moiety is administered to an individual in need of such treatment.
  • the targeting moiety is selected from the group consisting of an antibody directed against a TADG-12 protein and a ligand or ligand binding domain that binds a TADG- 12 protein.
  • the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4. Still preferably, th e therapeutic moiety is selected from the group consisting of a radioisotope, a toxin, a chemotherapeutic agent, an immune stimulant and a cytotoxic agent. Such method can be used for treating an individual having a disease selected from the group consisting of ovarian cancer, lung cancer, prostate cancer, colon cancer and other cancers in which TADG-12 is overexpressed.
  • a method of vaccinating, or producing a n immune response in, an individual against TADG-12 by inoculating the individual with a TADG-12 protein or fragment thereof by inoculating the individual with a TADG-12 protein or fragment thereof.
  • the TADG-12 protein or fragment thereof lacks TADG- 12 activity, and the inoculation elicits an immune response in the individual, thereby vaccinating the individual against TADG-12.
  • the individual has a cancer, is suspected of having a cancer or is at risk of getting a cancer.
  • TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4, while TADG-12 fragment has a sequence shown in SEQ ID No.
  • an immunogenic composition comprising an immunogenic fragment of a TADG-12 protein and an appropriate adjuvant.
  • the immunogenic fragment of the TADG-12 protein has a sequence shown in SEQ ID No. 8, or is a 9-residue fragment up to a 20-residue fragment. Examples of 9 - residue fragment are shown in SEQ ID Nos. 35, 36, 55, 56, 83, 84, 97, 98, 119, 120, 122, 123 and 136.
  • th e specimen is retrieved and placed on ice.
  • the specimen was th en taken to the resident pathologist for isolation and identification of specific tissue samples.
  • the sample was frozen in liquid nitrogen, logged into the laboratory record and stored at -80°C. Additional specimens were frequently obtained from th e Cooperative Human Tissue Network (CHTN). These samples w ere prepared by the CHTN and shipped on dry ice. Upon arrival, these specimens were logged into the laboratory record and stored at - 80°C.
  • CHTN Cooperative Human Tissue Network
  • ovarian tumors (4 benign tumors, 10 low malignant potential tumors and 55 carcinomas) and 10 normal ovaries were obtained from surgical specimens and frozen in liquid nitrogen.
  • mRNA and cDNA synthesis were carried out by the methods described previously [14-16].
  • mRNA was isolated by using a RiboSep mRNA isolation kit (Becton Dickinson Labware). In this procedure, poly A+ mRNA was isolated directly from the tissue lysate using the affinity chromatography media oligo(dT) cellulose.
  • cDNA was synthesized with 5.0 ⁇ g of mRNA b y random hexamer priming using 1st strand cDNA synthesis kit (CLONTECH).
  • Redundant primers forward 5 ' - TGGGTIGTIACIGCIGCICA(CT)TG -3' (SEQ ID No. 26) and reverse 5 ' - A(AG)IA(AG)IGCIATITCITTICC-3' (SEQ ID No. 27), for the consensus sequences of amino acids surrounding the catalytic triad for serine proteases were used to compare the PCR products from normal and carcinoma cDNAs. The appropriate bands were ligated into Promega T-vector plasmid and the ligation product was used to transform JM109 cells (Promega) grown on selection media. After selection of individual colonies, they were cultured and plasmid DNA was isolated by means of the Wizard miniprep DNA purification system (Promega).
  • Nucleotide sequencing w as performed using PRISM Ready Reaction Dye Deoxy terminator cycle sequencing kit (Applied Biosystems). Applied Biosystems Model 373A DNA sequencing system was used for direct cDNA sequence determination. The original TADG-12 subclone was randomly labeled and used as a probe to screen an ovarian tumor cDNA library b y standard hybridization techniques [11 ,15].
  • the library w as constructed in ⁇ ZAP using mRNA isolated from the tumor cells of a stage Ill/grade III ovarian adenocarcinoma patient. Three overlapping clones were obtained which spanned 23 1 5 nucleotides. The final 99 nucleotides encoding the most 3' sequence including the poly A tail was identified by, homology with clones available in the GenBank EST database.
  • TADG-12 The mRNA overexpression of TADG-12 w as determined using a quantitative PCR. Quantitative PCR w as performed according to the procedure as previously reported [16] . Oligonucleotide primers were used for: TADG-12, forward 5 ' - GAAACATGTCCTTGCTCTCG-3' (SEQ ID No. 28) and reverse 5 ' - ACTAACTTCCACAGCCTCCT-3' (SEQ ID No. 29); the variant TADG-12, forward 5'-TCCAGGTGGGTCTAGTTTCC-3' (SEQ ID No. 30), reverse 5 , . CTCTTTGGCTTGTACTTGCT _ ⁇ (SEQ ID No.
  • ⁇ -tubulin forward 5'- CGCATCAACGTGTACTACAA -3' (SEQ ID No. 32) and reverse 5 ' - TACGAGCTGGTGGACTGAGA -3' (SEQ ID No. 33).
  • ⁇ -tubulin w a s utilized as an internal control.
  • the PCR reaction mixture consists of cDNA derived from 50 ng of mRNA, 5 pmol of sense an d antisense primers for both the TADG-12 gene and the ⁇ -tubulin gene, 200 ⁇ mol of dNTPs, 5 ⁇ Ci of ⁇ - 32 PdCTP and 0.25 unit of Taq DNA polymerase with reaction buffer (Promega) in a final volume of 25 ⁇ l.
  • the target sequences were amplified in parallel with the ⁇ -tubulin gene. Thirty cycles of PCR were carried out in a Thermal Cycler (Perkin-Elmer Cetus). Each cycle of PCR included 3 0 seconds of denaturation at 94%C, 30 seconds of annealing at 60%C and 30 seconds of extension at 72%C. The PCR products w ere separated on 2% agarose gels and the radioactivity of each PCR product was determined by using a Phospho Imager (Molecular Dynamics). The present study used the expression ratio (TADG- 12/ ⁇ -tubulin) as measured by phosphoimager to evaluate gene expression and defined the value at mean + 2SD of normal ovary as the cut-off value to determine overexpression. The student' s t test was used for comparison of the mean values of normal ovary and tumors.
  • sequencing reactions were carried out using PRISMTM Ready Reaction Dye DeoxyTM terminators (Applied Biosystems cat# 401384) according to the manufacturer's instructions. Residual dye terminators were removed from the completed sequencing reaction using a Centri-sepTM spin column (Princeton Separation cat.# CS-901). An Applied Biosystems Model 373A DNA Sequencing System was available and was used for sequence analysis. EXAMPLE 6
  • Polyclonal rabbit antibodies were generated b y immunization of white New Zealand rabbits with a poly-lysine linked multiple antigen peptide derived from the TADG-12 carboxy-terminal protein sequence NH -WIHEQMERDLKT-COOH
  • Immunohistochemical staining was performed using a Vectastain Elite ABC Kit (Vector). Formalin fixed and paraffin embedded specimens were routinely deparaffinized and processed using microwave heat treatment in 0.01 M sodium citrate buffer (pH 6.0). The specimens were incubated with normal goat s erum in a moist chamber for 30 minutes. TADG-12 peptide antibody was allowed to incubate with the specimens in a moisture chamber for 1 hour. Excess antibody was washed away with phosphate buffered saline. After incubation with biotinylated anti-rabbit IgG for 30 minutes, the sections were then incubated with ABC reagent (Vector) for 30 minutes. The final products were visualized using the AEC substrate system (DAKO) a nd sections were counterstained with hematoxylin before mounting. Negative controls were performed by using normal serum instead of the primary antibody.
  • DAKO AEC substrate system
  • the sequence of the subclones from the 180bp band (SEQ ID No. 5 ) was found to be homologous to the sequence identified in th e larger, unexpected band (SEQ ID No. 7) except that the larger b and had an additional insert of 133 nucleotides ( Figure IB).
  • the smaller product of the appropriate size encoded for a protein sequence (SEQ ID No. 6) homologous to other known proteases while the sequence with the insertion (SEQ ID No. 8) encoded for a frame shift from the serine protease catalytic domain and a subsequent premature translational stop codon.
  • TADG-12 variants from four individual tumors were also subcloned and sequenced. It was found that the sequence and insert to be identical.
  • the genomic sequences for these cDNA derived clones were amplified by PCR, examined and found to contain potential AG/GT splice sites that would allow for the variant transcript production.
  • the catalytic domain subclone was randomly labeled and used to probe Northern blots representing normal ovarian tissue, ovarian tumors and the cancer cell lines SW626, CAOV3, HeLa, MD-MBA- 435S and MD-MBA-231 ( Figure 2). Three transcripts of 2.4, 1 .6 and 0.7 kilobases were observed. In blots of normal and ovary tumor the smallest transcript size 0.7 kb was lowly expressed in normal ovary while all transcripts (2.4, 1.6 and 0.7 kb) w ere abundantly present in serous carcinoma.
  • RNA dot blot was probed representing 50 human tissues and determined that this clone is weakly expressed in all tissues represented ( Figure 3). It w as found most prominently in heart, with intermediate levels in putamen, amygdala, kidney, liver, small intestine, skeletal muscle, and adrenal gland.
  • ovarian tumor cDNA library constructed in ⁇ ZAP was screened by standard hybridization techniques using th e catalytic domain subclone as a probe. Two clones that overlapped with the probe were identified and sequenced and found to represent 2316 nucleotides. The 97 nucleotides at the 3' end of the transcript including the poly-adenylation signal and the poly (A) tail were identified by homology with clones available in GenBank's EST database. This brought the total size of th e transcript to 2413 bases (SEQ ID No. 1, Figure 4). Subsequent screening of GenBank's Genomic Database revealed that TADG-12 is homologous to a cosmid from chromosome 17. This cosmid has the accession number AC015555.
  • the identified cDNA includes an open reading frame that would produce a predicted protein of 454 amino acids (SEQ ID No. 2), named Tumor Associated Differentially-Expressed Gene 1 2 (TADG-12).
  • SEQ ID No. 2 Tumor Associated Differentially-Expressed Gene 1 2
  • the sequence has been submitted to the GenBank database and granted the accession # AF201380.
  • this protein contains several domains including an amino-terminal cytoplasmic domain, a potential Type II transmembrane domain followed by a low-density lipoprotein receptor-like class A domain (LDLR-A), a scavenger receptor cysteine rich domain (SRCR), and an extracellular serine protease domain.
  • LDLR-A low-density lipoprotein receptor-like class A domain
  • SRCR scavenger receptor cysteine rich domain
  • extracellular serine protease domain an extracellular serine protease domain.
  • TADG-12 contains a highly hydrophobic stretch of amino acids that could serve as a potential transmembrane domain, which would retain the amino terminus of the protein within the cytoplasm and expose th e ligand binding domains and protease domain to the extracellular space.
  • This general structure is consistent with other known transmembrane proteases including hepsin [17], and TMPRSS2 [18], and TADG-12 is particularly similar in structure to th e TMPRSS2 protease.
  • the LDLR-A domain of TADG-12 is represented by th e sequence from amino acid 74 to 108 (SEQ ID No. 13).
  • the LDLR-A domain was originally identified within the LDL Receptor [19] as a series of repeated sequences of approximately 40 amino acids, which contained 6 invariant cysteine residues and highly conserved aspartate and glutamate residues. Since that initial identification, a host of other genes have been identified which contain motifs homologous to this domain [20].
  • proteases have been identified which contain LDLR-A motifs including matriptase, TMPRSS2 and several complement components. A comparison of TADG-12 with other known LDLR-A domains is shown in Figure 5A.
  • TADG-12 contains another extracellular ligand binding domain with homology to th e group A SRCR family.
  • This family of protein domains typically is defined by the conservation of 6 cysteine resides within a sequence of approximately 100 amino acids [23].
  • the SRCR domain of TADG-12 is encoded by amino acids 109 to 206 (SEQ ID No. 17), and this domain was aligned with other SRCR domains and found to have between 36 and 43% similarity ( Figure 5B).
  • TADG-12 only has 4 of the 6 conserved cysteine residues. This is similar to the SRCR domain found in the protease TMPRSS2.
  • the TADG-12 protein also includes a serine protease domain of the trypsin family of proteases.
  • An alignment of the catalytic domain of TADG-12 with other known proteases is shown in Figure 5C. The similarity among these sequence ranges from 4 8 to 55%, and TADG-12 is most similar to the serine protease TMPRSS2 which also contains a transmembrane domain, LDLR-A domain and an SRCR domain.
  • RIVGG conserved amino acid motif downstream from the SRCR domain that is a potential cleavage/activation site common to many serine proteases of this family [25].
  • TADG-12 is trafficked to the cell surface where the ligand binding domains are capable of interacting with extracellular molecules and th e protease domain is potentially activated.
  • TADG-12 also contains conserved cysteine residues (amino acids 208 and 243) which in other proteases form a disulfide bond capable of linking th e activated protease to the other extracellular domains.
  • the original TADG-12 subclone was identified a s highly expressed in the initial redundant-primer PCR experiment.
  • the TADG-12 variant form (TADG-12V) with the insertion of 1 3 3 bp was also easily detected in the initial experiment.
  • TADG-12V TADG-12 variant form
  • a previously authenticated semi-quantitative PCR technique was employed [16].
  • the PCR analysis co-amplified a product for ⁇ -tubulin with either a product specific to TADG-12 or TADG-12V in the presence of a radiolabelled nucleotide.
  • TADG-12 was separated by agarose gel electrophoresis and a phosphoimager was used to quantitate the relative abundance of each PCR product. Examples of these PCR amplification products are shown for both TADG-12 and TADG- 12V in Figure 6.
  • Normal expression was defined as the mean ratio of TADG-12 (or TADG- 12V) to ⁇ -tubulin +/- 2SD as examined in normal ovarian samples .
  • overexpression was defined as >2SD from th e normal TADG- 12/ ⁇ -tubulin or TADG- 12V/ ⁇ -tubulin ratio.
  • Table 1 and Table 2 TADG-12 w as found to be overexpressed in 41 of 55 carcinomas examined while the variant form was present at aberrantly high levels in 8 of 22 carcinomas. As determined by the student's t test, these differences were statistically significant (p ⁇ 0.05).
  • TADG-12 is found in a diffuse pattern throughout the cytoplasm indicative of a protein i n a trafficking pathway. TADG-12 is also found at the cell surface in these tumor samples as expected. It should be noted that th e antibody developed and used for immunohistochemical analysis would not detect the TADG- 12V truncated protein.
  • TADG-12 The full-length cDNA encoding a novel multi-domain, cell-surface serine protease w as cloned, named TADG-12.
  • the 454 amino acid protein contains a cytoplasmic domain, a type II transmembrane domain, an LDLR-A domain, an SRCR domain and a serine protease domain.
  • TADG-12 has some extracellular proteolytic functions.
  • TADG-12 also has a variant splicing form that is present in 35% of the tumors studied. This variant mRNA would lead to a truncated protein that may provide a unique peptide sequence on the surface of tumor cells.
  • This protein contains two extracellular domains which might confer unusual properties to this multidomain molecule. Although the precise role of LDLR-A function with regard to proteases remains unclear, this domain certainly has the capacity to bind calcium and other positively charged ligands [21 ,22] . This may play an important role in the regulation of the protease o r subsequent internalization of the molecule.
  • the SRCR domain w as originally identified within the macrophage scavenger receptor and functionally described to bind lipoproteins. Not only are SRCR domains capable of binding lipoproteins, but they may also bind to molecules as diverse as polynucleotides [23].
  • TADG-12 like TMPRSS2 has only four of six cysteine residues conserved within its SRCR domain. This difference may allow for different structural features of these domains that confer unu sual ligand binding properties.
  • th e CD6 encoded SRCR is well documented. In the case of CD6, th e SRCR domain binds to the cell adhesion molecule ALCAM [23] .
  • SRCR domains are certainly capable of cell adhesion type interactions, but their capacity to bind other types of ligands should be considered.
  • FIG. 8 presents a working model of TADG-12 with the information disclosed in the present invention. Two transcripts are produced which lead to the production of either TADG-12 or the truncated TADG- 12V proteins. Either of these proteins is potentially targeted to the cell surface. TADG-12 is capable of becoming an activated serine protease while TADG- 12V is a truncated protein product that if at the cell surface m ay represent a tumor specific epitope.
  • the problem with treatment of ovarian cancer today remains the inability to diagnose the disease at an early stage. Identifying genes that are expressed early in the disease process such as proteases that are essential for tumor cell growth [26] is an important step toward improving treatment. With this knowledge, it may be possible to design assays to detect the highly expressed genes such as the TADG-12 protease described here or previously described proteases to diagnose these cancers at an earlier stage. Panels of markers may also provide prognostic information and could lead to therapeutic strategies for individual patients. Alternatively, inhibition of enzymes such as proteases may be an effective means for slowing progression of ovarian cancer and improving the quality of patient life. Other features of TADG-12 and TADG-12V must be considered important to future research too. The extracellular ligand binding domains are natural targets for drug delivery systems. The aberrant peptide associated with the TADG- 12V protein may provide an excellent target drug delivery or for immune stimulation.
  • Tanimoto, et al. Increased Expression of Protease M in Ovarian Tumors. Tumor Biology, In Press, 2000. 13. Tanimoto, H., et al., Proc. Of the Amer. Assoc. for Cane. Research 39:648, 1998.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2000/005612 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof Ceased WO2000052044A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU37209/00A AU765471B2 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
CA2362830A CA2362830C (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
JP2000602268A JP4558948B2 (ja) 1999-03-03 2000-03-02 卵巣癌において過剰発現される膜貫通型セリンプロテアーゼおよびその使用
EP00916045A EP1157035A4 (en) 1999-03-03 2000-03-02 TRANSMEMBRANE SERINE PROTEASE OVEREXPRESSED IN EGG STOCK CARCINOMA AND ITS APPLICATIONS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/261,416 US6291663B1 (en) 1999-03-03 1999-03-03 TADG-12: a novel transmembrane serine protease overexpressed in a ovarian carcinoma
US09/261,416 1999-03-03

Publications (1)

Publication Number Publication Date
WO2000052044A1 true WO2000052044A1 (en) 2000-09-08

Family

ID=22993212

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/005612 Ceased WO2000052044A1 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof

Country Status (6)

Country Link
US (2) US6291663B1 (https=)
EP (1) EP1157035A4 (https=)
JP (1) JP4558948B2 (https=)
AU (1) AU765471B2 (https=)
CA (1) CA2362830C (https=)
WO (1) WO2000052044A1 (https=)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001057069A3 (en) * 2000-02-02 2002-02-21 Transgene Sa Targeting peptides
WO2001057194A3 (en) * 2000-02-03 2002-03-28 Corvas Int Inc Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
WO2001083781A3 (en) * 2000-04-28 2002-07-11 Millennium Pharm Inc 14094, a novel human trypsin family member and uses thereof
EP1354948A4 (en) * 2000-12-22 2004-06-30 Kazusa Dna Res Inst Foundation NEW GENES ASSOCIATED WITH CANCER
EP1349485A4 (en) * 2000-11-14 2005-11-09 Corixa Corp COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF OVARIAL CARCINOMA
US7105333B2 (en) 2001-03-27 2006-09-12 Deadreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and methods based thereon
US7112430B2 (en) 2001-05-14 2006-09-26 Dendreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon
US7125703B2 (en) 2001-03-13 2006-10-24 Dendreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon
US7172892B2 (en) 2001-03-22 2007-02-06 Dendreon Corporation Nucleic acid molecules encoding serine protease CVSP14, the encoded polypeptides and methods based thereon
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
JP2008289482A (ja) * 2000-11-14 2008-12-04 Corixa Corp 卵巣癌の治療および診断のための組成物および方法
US7598051B2 (en) 1999-09-10 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
EP2311863A1 (en) * 2001-03-05 2011-04-20 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer
US8039603B2 (en) 2001-03-05 2011-10-18 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030022293A1 (en) * 1997-09-18 2003-01-30 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030039648A1 (en) * 1998-09-16 2003-02-27 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US20030113842A1 (en) * 1998-03-11 2003-06-19 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
IL139988A0 (en) * 1998-06-01 2002-02-10 Urogenesys Inc Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
US7037667B1 (en) 1998-06-01 2006-05-02 Agensys, Inc. Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
US6902892B1 (en) * 1998-10-19 2005-06-07 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US6942978B1 (en) * 1999-03-03 2005-09-13 The Board Of Trustees Of The University Of Arkansas Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US6797504B1 (en) * 2000-09-08 2004-09-28 Dendreon San Diego Llc Inhibitors of serine protease activity of matriptase or MTSP1
US7700341B2 (en) 2000-02-03 2010-04-20 Dendreon Corporation Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
US7265216B2 (en) * 2000-03-02 2007-09-04 The Board Of Trustees Of The University Of Arkansas System Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US20040086875A1 (en) * 2001-11-05 2004-05-06 Agee Michele L. Novel proteins and nucleic acids encoding same
WO2003088898A2 (en) * 2002-04-17 2003-10-30 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
AU2002357004A1 (en) * 2001-11-20 2003-06-10 Dendreon San Diego Llc Nucleic acid molecules encoding serine protease 17, the encoded polypeptides and methods based thereon
US20040001801A1 (en) * 2002-05-23 2004-01-01 Corvas International, Inc. Conjugates activated by cell surface proteases and therapeutic uses thereof
US20090163386A1 (en) * 2002-11-27 2009-06-25 Elementis Specialties, Inc. Compositions for drilling fluids useful to produce flat temperature rheology to such fluids over a wide temperature range and drilling fluids containing such compositions
US7799742B2 (en) * 2008-03-07 2010-09-21 Elementis Specialties Inc. Equivalent circulating density control in deep water drilling
US7345010B2 (en) 2002-11-27 2008-03-18 Elementis Specialties, Inc. Compositions for drilling fluids useful to provide flat temperature rheology to such fluids over a wide temperature range and drilling fluids containing such compositions
WO2004099779A1 (en) * 2003-05-05 2004-11-18 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with human transmembrane serine protease 3 (tmprss3)
JP4880484B2 (ja) * 2004-02-20 2012-02-22 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 唾液mRNAプロファイリング、バイオマーカーならびに関連した方法およびキット
KR101543622B1 (ko) 2006-10-17 2015-08-11 온코세라피 사이언스 가부시키가이샤 Mphosph1 또는 depdc1 폴리펩티드를 발현하는 암에 대한 펩티드 백신
JP5564730B2 (ja) 2011-08-12 2014-08-06 オンコセラピー・サイエンス株式会社 Mphosph1ペプチドおよびそれを含むワクチン
SG11201802286PA (en) 2015-10-08 2018-04-27 Oncotherapy Science Inc Mphosph1-derived peptide, and vaccine including same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041656A1 (en) * 1997-03-19 1998-09-24 The Board Of Trustees Of The University Of Arkansas Compositions and method for the early diagnosis of ovarian cancer

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7014993B1 (en) * 1997-08-21 2006-03-21 The Board Of Trustees Of The University Of Arkansas Extracellular serine protease
US5972616A (en) * 1998-02-20 1999-10-26 The Board Of Trustees Of The University Of Arkansas TADG-15: an extracellular serine protease overexpressed in breast and ovarian carcinomas
ES2263865T3 (es) * 1998-03-25 2006-12-16 Genentech, Inc. Homologo humano de neurotrimina.
AU1205901A (en) * 1999-10-14 2001-04-23 Board Of Trustees Of The University Of Arkansas, The Tumor antigen derived gene-16 (tadg-16): a novel extracellular serine protease and uses thereof
EP1252300B1 (en) * 2000-02-03 2011-01-19 Dendreon Corporation Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
AU6802801A (en) * 2000-03-01 2001-09-24 Genentech Inc Secreted and transmembrane polypeptides and nucleic acids encoding the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041656A1 (en) * 1997-03-19 1998-09-24 The Board Of Trustees Of The University Of Arkansas Compositions and method for the early diagnosis of ovarian cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENECORE VERSION 4.5 20 October 1999 (1999-10-20), "National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index" *
See also references of EP1157035A4 *
TANIMOTO ET. AL.: "Cloning and expression of TADG-15, a novel serine: protease expressed in ovarian cancer", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 39, March 1998 (1998-03-01), pages - 648 (ABSTRACT #4414), XP002929501 *
THAN N G, ET AL.: "A NEW PLACENTAL PROTEIN FAMILY WITH ONCODEVELOPMENTAL SIGNIFICANCE:CLONING AND SEQUENCE ANALYSIS OF THE HUMAN PLACENTAL PROTEIN 17 (PP17) FAMILY", TUMOR BIOLOGY, KARGER, BASEL, CH, no. SUPPL. 02, 1 January 1998 (1998-01-01), CH, pages 33, XP002929300, ISSN: 1010-4283 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7985843B2 (en) 1999-09-10 2011-07-26 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
US7598051B2 (en) 1999-09-10 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
WO2001057069A3 (en) * 2000-02-02 2002-02-21 Transgene Sa Targeting peptides
WO2001057194A3 (en) * 2000-02-03 2002-03-28 Corvas Int Inc Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
WO2001083781A3 (en) * 2000-04-28 2002-07-11 Millennium Pharm Inc 14094, a novel human trypsin family member and uses thereof
US7071004B1 (en) 2000-04-28 2006-07-04 Millennium Pharmaceuticals, Inc. 14094, a novel human trypsin family member and uses thereof
JP2008289482A (ja) * 2000-11-14 2008-12-04 Corixa Corp 卵巣癌の治療および診断のための組成物および方法
EP1349485A4 (en) * 2000-11-14 2005-11-09 Corixa Corp COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF OVARIAL CARCINOMA
US7375199B2 (en) 2000-12-22 2008-05-20 Kazusa Dna Research Institute Foundation Cancer-associated genes
EP1354948A4 (en) * 2000-12-22 2004-06-30 Kazusa Dna Res Inst Foundation NEW GENES ASSOCIATED WITH CANCER
US8008437B2 (en) 2000-12-22 2011-08-30 Kazusa Dna Research Institute Foundation Cancer-associated genes
EP2311863A1 (en) * 2001-03-05 2011-04-20 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer
US8039603B2 (en) 2001-03-05 2011-10-18 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer
US7125703B2 (en) 2001-03-13 2006-10-24 Dendreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon
US7172892B2 (en) 2001-03-22 2007-02-06 Dendreon Corporation Nucleic acid molecules encoding serine protease CVSP14, the encoded polypeptides and methods based thereon
US7105333B2 (en) 2001-03-27 2006-09-12 Deadreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and methods based thereon
US7112430B2 (en) 2001-05-14 2006-09-26 Dendreon Corporation Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon

Also Published As

Publication number Publication date
CA2362830A1 (en) 2000-09-08
JP4558948B2 (ja) 2010-10-06
EP1157035A1 (en) 2001-11-28
AU765471B2 (en) 2003-09-18
CA2362830C (en) 2012-08-21
EP1157035A4 (en) 2005-06-08
US6294663B1 (en) 2001-09-25
AU3720900A (en) 2000-09-21
US6291663B1 (en) 2001-09-18
JP2002537791A (ja) 2002-11-12

Similar Documents

Publication Publication Date Title
US6942978B1 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US6294663B1 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US7939321B2 (en) TADG-15: an extracellular serine protease overexpressed in carcinomas
AU750932B2 (en) TADG-15: an extracellular serine protease overexpressed in breast and ovarian carcinomas
EP1887082A2 (en) TADG-15: An extracellular serine protease overexpressed in carcinomas
EP1007627B1 (en) Extracellular serine protease
US20060205054A1 (en) Extracellular serine protease
US7759103B2 (en) Extracellular serine protease
US7157084B2 (en) Extracellular serine protease
US7265216B2 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US7083790B2 (en) Extracellular serine protease

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000916045

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2362830

Country of ref document: CA

Ref country code: CA

Ref document number: 2362830

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 602268

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 37209/00

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2000916045

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 37209/00

Country of ref document: AU