WO2000050625A1 - Methods of making nucleotides - Google Patents

Abstract

The present invention relates to an enzymatic method of making nucleotides. Specifically, the invention provides an efficient process for synthesizing substantially pure, high quality nucleotides in large scale. The invention also relates to kits and compositions used in the methods of the invention. The invention also concerns enzymes used in the methods of the invention (particularly recombinant enzymes including fusion proteins), to vectors containing genes encoding such enzymes, and to host cells containing such vectors or genes.

Description

Methods Of Making Nucleotides

Background of the Invention

Field of the Invention

The present invention essentially consists of using a coupled enzymatic reaction wherein the end product of the reaction is preferably used as a catalyst in the first step of the reaction. Once the reaction is "primed" with a small amount of product, the reaction will accelerate as more catalyst, i.e. the end product, is made. The result is that the final mixture is not contaminated with any undesired triphosphate such as ATP.

Description of Background Art

Summary of the Invention

Ribonucleoside triphosphates (NTPs) and deoxyribonucleoside triphosphates (dNTPs) are commonly made from the appropriate monophosphate or nucleoside by chemical synthesis. These reactions require a dry atmosphere and use chemicals that pose safety and disposal problems. The first step of the nucleotide synthesis according to a preferred aspect of the present invention involves converting the appropriate ribonucleoside or deoxyribonucleoside monophosphateor derivatives thereof (e.g., xNMP) into the appropriate ribonucleoside or deoxyribonucleoside diphosphate or derivatives thereof (e.g., xNDP) in the presence of a enzyme capable of converting the xNMP into the xNDP, and a phosphate donor.

Preferably, the phosphate donor is a catalytic amount of the desired ribonucleotide or deoxyribonucleoside triphosphate or derivatives thereof (e.g., xNTP) to prime the reaction. According to a preferred embodiment, the enzyme may be any kinase and preferably is a base specific nucleoside monophosphate kinase (NMK). The second step of the synthesis involves converting the xNDP into the desired xNTP in the presence of an enzyme capable of converting the xNDP into the xNTP, and a phosphate donor. According to a preferred embodiment, the enzyme in this step may be any kinase and preferably is a pyruvate kinase (PYK) and the phosphate donor may be any phosphate donor and preferably is phosphoenolpyruvate, PEP. In a more preferred embodiment, the phosphate donors are obtained by an enzymatic reaction. Most preferably, the phosphate donors are synthesized and supplied enzymatically during the nucleotide synthesis process of the invention. In a preferred aspect, the phosphate donor PEP is obtained from the reaction of D(-)3-phosphoglyceric acid (3-PGA) in the presence of the enzymes phosphoglycerate mutase (PGM) and enolase (ENO). Alternatively, PEP may be generated enzymatically from any other precursor including 2- phosphoglyceric acid (2-PGA). In another aspect, the phosphate donor may be made by chemical or other means or obtained commercially. Preferred phosphate donors include PEP, 1,3-diphosphoglycerate, and xNTPs.

The multiple enzymatic steps are preferably accomplished simultaneously in a reaction chamber or vessel. Thus, in a preferred aspect, the one or more enzymatic reactions to make the phosphate donors and the one or more enzymatic reactions to make the desired nucleotides are accomplished in a batch process. The reaction steps may however also be carried out separately, wherein the products from a previous reaction are added to the next reaction in separate steps. Alternatively, the reaction may be carried out as a combination of a batch process and separate steps, where some of the enzymatic steps are accomplished at the same time in one reaction chamber while others are done separately and added to the reaction chamber.

More generally, the present invention relates to a method of making one or more xNMPs comprising (a) mixing one or more nucleosides or derivatives thereof, an enzyme capable of converting said nucleosides into said xNMPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said one or more xNMPs. The present invention also relates to a method of making one or more xNDPs comprising

(a) mixing one or more xNMPs, an enzyme capable of converting said xNMPs into xNDPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNDPs. The present invention further relates to a method of making one or more xNTPs comprising (a) mixing one or more xNDPs, an enzyme capable of converting said xNDPs into xNTPs and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNTPs. In a preferred aspect of these methods, the phosphate donors are supplied in the reaction by an enzymatic process. Thus, such methods may further comprise mixing one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

Furthermore, the present invention generally relates to a method of making one or more xNDPs comprising (a) mixing one or more nucleosides or derivatives thereof, one or more enzymes capable of converting said nucleosides into xNMPs and converting said xNMPs into xNDPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNDPs. The present invention also relates to a method of making one or more xNTPs comprising (a) mixing one or more xNMPs, one or more enzymes capable of converting said xNMPs into xNDPs and converting said xNDPs into xNTPs, and one or more phosphate donors; and

(b) incubating said mixture under conditions sufficient to make the desired xNTPs. The present invention further relates to a method of making one or more xNTPs comprising (a) mixing one or more nucleosides or derivatives thereof, one or more enzymes capable of converting said nucleosides into xNMPs, converting said xNMPs into xNDPs, and converting said xNDPs into xNTPs and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNTPs. In a preferred aspect of these methods, the phosphate donors are supplied in the reaction by an enzymatic process. Thus, such methods may further comprise mixing one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors. The present invention also relates to compositions comprising (a) one or more nucleosides or derivatives thereof; (b) at least one enzyme capable of converting said nucleosides into xNMPs; and (c) one or more phosphate donors. The present invention also relates to a composition comprising (a) one or more xNMPs; (b) at least one enzyme capable of converting said xNMPs into xNDPs; and (c) one or more phosphate donors. The present invention further relates to a composition comprising (a) one or more xNDPs; (b) at least one enzyme capable of converting said xNDPs into xNTPs; and (c) one or more phosphate donors. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

Furthermore, the present invention relates to a composition comprising

(a) one or more nucleosides or derivatives thereof; (b) one or more enzymes capable of converting said nucleosides into xNMPs and converting said xNMPs into xNDPs; and (c) one or more phosphate donors. The present invention further relates to a composition comprising (a) one or more xNMPs;

(b) one or more enzymes capable of converting said xNMPs into xNDPs and converting said xNDPs into xNTPs; and (c) one or more phosphate donors. Furthermore, the present invention relates to a composition comprising (a) one or more nucleosides or derivatives thereof; (b) one or more enzymes capable of converting said nucleosides into xNMPs, converting said xNMPs into xNDPs, and converting said xNDPs into xNTPs; and (c) one or more phosphate donors. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

The present invention also concerns a composition comprising at least one enzyme capable of converting one or more nucleosides or derivatives thereof into xNMPs and at least one enzyme capable of converting xNMPs into xNDPs; a composition comprising at least one enzyme capable of converting xNMPs into xNDPs and at least one enzyme capable of converting xNDPs into xNTPs; and a composition comprising at least one enzyme capable of converting one or more nucleosides or derivatives thereof into a xNMPs, at least one enzyme capable of converting xNMPs into xNDPs, and at least one enzyme capable of converting xNDPs into xNTPs. Such compositions may further comprise one or more phosphate donors, one or more phosphate donor substrates and/or one or more enzymes capable of converting such substrates into phosphate donors.

The present invention further relates to kits for the enzymatic preparation for nucleotides. Such kits comprise at least one component selected from the group consisting of one or more enzymes capable of converting a nucleoside into xNMP, xNMP into xNDP, and/or xNDP into xNTP; one or more enzymes capable of converting one or more phosphate donor substrates into one or more phosphate donors; one or more phosphate donors; one or more phosphate donor substrates; one or more substrates for making the desired nucleotides (e.g., nucleosides, xNMPs, and xNDPs); and instructions or protocols for carrying out the methods of the invention.

The present invention permits the large scale production of high quality nucleotides which may be used in amplification (PCR), sequencing, labeling and cDNA synthesis. Thus, the invention relates to nucleotides produced by the methods of the invention and to the use of such nucleotides in standard molecular biology techniques.

The present invention also relates to the cloning and overexpression of kinases, particularly adenine monophosphate kinase (AMK), guanosine monophosphate kinase (GMK), cytidine monophosphate kinase (CMK), thymidine monophosphate kinase (TMK) and pyruvate kinase (PYK) useful in the invention, as well as the cloning and overexpression of enzymes for synthesizing a phosphate donor, particularly PGM and ENO. The expressed enzymes are preferably substantially pure (e.g., >95% pure) which improves the quality of the resulting synthesized product. In a preferred aspect, such enzymes are expressed as fusion proteins, preferably having an amino and/or carboxy tag sequence. Such tag sequences are preferably used to assist in isolation and purification of the desired enzyme. Thus, the invention relates to recombinantly produced enzymes (preferably as fusion proteins) used in the invention, to vectors containing genes encoding such enzymes and to host cells containing such vectors.

Other preferred embodiments of the present invention will be apparent to one of ordinary skill in the art in view of the following drawings and description of the invention.

Brief Description of the Drawings

Figure 1 is a flowchart representing synthesis of xNTP according to a preferred embodiment of the present invention.

Figure 2 is a flowchart representing the 1,3-diphosphoglycerate enzymatic method to supply phosphate donor according to a preferred embodiment of the present invention. Enzymes include gly cerol-3 -phosphate dehydrogenase (1), triose phosphate isomerase (2), glyceraldehyde-3- phosphate dehydrogenase (3), kinases (4 and 5), and lactate dehydrogenase (6). Inputs are outlined in bold. NAD and xNTP are cofactors that are added in small amounts.

Figure 3 is a flowchart representing the citric acid enzymatic method to supply phosphate donor according to a preferred embodiment of the present invention. The enzymes including aconitase (1), isocitrate dehydrogenase (2), alpha-ketoglutarate dehydrogenase (3), kinases (4 and 5), and lactate dehydrogenase (6). Inputs are outlined in bold. NAD and xNTP are cofactors that are added in small amounts. Figure 4 is a flowchart representing the ribulose 1,5-bisphosphate enzymatic method to supply phosphate donor according to a preferred embodiment of the present invention. The include ribulose- 1-5-bisphosphate carboxylase (1), PGM (2), ENO (3), and kinases (4 and 5). Inputs are outlined in bold. xNTP is a cofactor that is added in small amounts. Figure 5 is a flowchart representing the glutamate enzymatic method to supply phosphate donor according to a preferred embodiment of the present invention. The enzymes include glutamate dehydrogenase (1), alpha- ketoglutarate dehydrogenase (2), kinase (3), succinyl CoA synthetase (4), and lactate dehydrogenase (5). Inputs are outlined in bold. NAD and xNTP are cofactors that are added in small amounts.

Figure 6 is a flowchart representing the use of a single kinase (PKP) for converting xNMP to xNDP and xNDP to xNTP, using PEP as a phosphate donor.

Figure 7 is a flowchart representing the use of a single kinase (PKP) for converting nucleoside into xNTP, using PEP as a phosphate donor.

Figure 8 is a flowchart representing the use of two kinases (PKP and pyruvate kinase) to convert xNMP to xNTP, using PEP as a phosphate donor.

Figure 9 is a graph representing the pH profile of dATP synthesis.

Figure 10 is a graph representing synthesis yield of dGTP and GTP.

Figure 11 is a graph representing dTTP synthesis on a 3 mmol scale as a function of time as measured by HPLC. Figure 12 is a graph representing the effect of equivalents of 3 -PGA on dTTP yield.

Figure 13 represents HPLC analysis of the reaction product of the enzymatic synthesis of dATP using ATP as a catalyst. A representative HPLC chromatogram is depicted, with absorbance plotted as a function of time (in minutes). The time of elution (retention time, in minutes) is displayed above each peak.

Figure 14 represents HPLC analysis of the purification product of the enzymatic synthesis of dATP using ATP as a catalyst. A representative HPLC chromatogram is depicted, with absorbance plotted as a function of time (in minutes). The time of elution (retention time, in minutes) is displayed above each peak.

Figure 15 represents HPLC analysis of the reaction product of the enzymatic synthesis of dATP using dATP as a catalyst. A representative

HPLC chromatogram is depicted, with absorbance plotted as a function of time (in minutes). The time of elution (retention time, in minutes) is displayed above each peak. Figure 16 represents HPLC analysis of the purification product of the enzymatic synthesis of dATP using dATP as a catalyst. A representative HPLC chromatogram is depicted, with absorbance plotted as a function of time (in minutes). The time of elution (retention time, in minutes) is displayed above each peak.

Figure 17 is a graph representing an assay of CMK by coupling the reaction to NADH oxidation using excess PYK and lactate dehydrogenase as a function of time.

Figure 18 schematically depicts plasmid pAMP-AMK.

Figure 19 schematically depicts plasmid pROEX-AMK.

Figure 20 schematically depicts plasmid pAMP-TMK.

Figure 21 schematically depicts plasmid pROEX-TMK.

Figure 22 schematically depicts plasmid pAMP-CMK.

Figure 23 schematically depicts plasmid pROEX-CMK.

Figure 24 schematically depicts plasmid pAMP-GMK.

Figure 25 schematically depicts plasmid pROEX-GMK.

Figure 26 schematically depicts plasmid pAMP-PGM.

Figure 27 schematically depicts plasmid pROEX-PGM.

Figure 28 schematically depicts plasmid pAMP-PYK-CHis.

Figure 29 schematically depicts plasmid pTrcN-PYK-CHis.

Figure 30 schematically depicts plasmid pAMP-ENO.

Figure 31 schematically depicts plasmid pROEX-ENO.

Detailed Description of the Invention

In order to provide a clearer and consistent understanding of the specification and claims, including the scope to be given such termds, the following definitions are provided.

As used herein, nucleoside refers to a nitrogen base bound to a sugar molecule. The term includes compounds such as adenine, cytidine, guanosine, thymidine, uridine, and AIDS drugs that inhibit reverse transcriptase such as

AZT, ddC and ddl, and derivatives thereof. The nucleoside may be detectably labeled (e.g. radioactive labels, fluorescent labels, chemiluminescent labels, bioluminescent labels, biotin labels and enzyme labels) or unlabeled.

As used herein, nucleotide refers to a base-sugar-phosphate combination, including the corresponding monophosphates, diphosphates and triphosphates. Nucleotides are monomeric units of a nucleic acid sequence

(DNA and RNA). The term nucleotide includes ribonucleoside triphosphates such as ATP, CTP, GTP and UTP and derivatives thereof. The term further includes deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [αSldATP, 7-deaza-dGTP and 7-deaza-dATP. The term nucleotide as used herein also refers to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Illustrated examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddlTP, and ddTTP. The term nucleotide also includes the monophosphate and diphosphate corresponding to the above listed triphosphates. Nucleotides and derivatives thereof are generally referred to herein as xNMP for the nucleotide monophosphate and its derivatives, xNDP for the nucleotide diphosphate and its derivatives and xNTP for the nucleotide triphosphate and its derivatives. According to the present invention, the nucleotide may be unlabeled or detectably labeled. Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, biotin labels and enzyme labels.

As used herein, xNTP may represent any ribonucleoside triphosphate (NTP) or any deoxyribonucleoside triphosphate (dNTP) and derivatives thereof such as dideoxyribonucleoside triphosphates (ddNTPs) and derivatives thereof. Similarly, xNMP may represent any ribonucleoside monophosphate (NMP) or any deoxyribonucleoside monophosphate (dNMP) and derivatives thereof, and xNDP may represent any ribonucleoside diphosphate (NDP) or any deoxyribonucleoside diphosphate (dNDP) and derivatives thereof. Therefore, according to the present invention, any nucleoside or derivative thereof, xNMP or xNDP may be used as the starting material to make the corresponding desired product. For example, to make the derivative nucleotide ddNTP, the starting material may be ddNMP or ddNDP. According to the present invention, the starting material may also be the respective nucleoside or derivative thereof.

Other nucleotides that can be made by method of the invention include nucleotides with oxidized, alkylated or methylated bases, for example thymine glycol, 8-oxoguanine, 4,6-diamino-5-formamidopyrimidine, urea, 3- methyladenine, 7-methyl-guanine, or 6-methylguanine. Nucleotides with modified bases can be used to study the process of mutagenic DNA replication and repair, which has been shown to be involved in carcinogenesis. The methods of the present invention can also be used to synthesize triphosphates of anti-AIDS pharmaceuticals, including AZT, ddl, and ddC. The triphosphates of these drugs may prove to be more potent than the currently available nucleoside drugs. Thus, the nucleotide produced by the present invention may be used in pharmaceuticals and therefore mayt be formulated in a composition comprising one or more nucleotides and a pharmaceutical carrier.

Within the context of the present invention, the term phosphate donor refers to one or more substrates capable of donating one or more phosphates. Such phosphate donors include but are limited to PEP, a nucleotide (e.g., xNMP, xNDP, xNTP), and 1 ,3-diphosphoglycerate.

As used herein substantially pure means that the desired purified enzyme or nucleotide is essentially free from contaminants. In the case of a substantially pure enzyme, the contaminant amount does not substantially affect or does not substantially adversely affect the activity of the enzyme in the desired reaction. For a substantially pure nucleotide, the contaminant amount does not substantially affect or does not substantially adversely affect a reaction in which the nucleotide is used. In a preferred aspect, the amount of contaminating nucleotides (e.g., nucleosides, xNMP and xNDP) in the synthesis of a product (e.g., xNTP) is below 20%, preferably below 15%, more preferably below 10%, more preferably below 5%, still more preferably below

2% and most preferably below 1%. According to the present invention, host cell refers to any prokaryotic or eukaryotic cell that can serve as a source of an enzyme used in the invention and may include recombinant host cells if it is the recipient of a replicable expression vector or cloning vector or desired gene to express the desired enzyme(s). Recombinant host cells preferably contain the gene(s) expressing the desired enzyme on a vector but may contain such gene(s) in its chromosome or genome. The terms "host" or "host cell" may be used interchangeably herein. For examples of such hosts, see Maniatis et al., "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1982). Preferred prokaryotic hosts include, but are not limited to, bacteria of the genus Escherichia (e.g., E. coli), Bacillus, Staphylococcus, Agrobacter (e.g., A. tumefaciens), Streptomyces, Pseudomonas, Salmonella, Serratia, Caryophanon, etc. The most preferred prokaryotic host is E. coli. Bacterial hosts of particular interest in the present invention include E. coli strains K12, DH10B, DH5α and HB101. Preferred eukaryotic hosts include, but are not limited to, fungi, fish cells, yeast cells, plant cells and animal cells. Particularly preferred animal cells are insect cells such as Drosophila cells, Spodoptera Sf9, Sf21 cells and Trichoplusa High- Five cells; nematode cells such as C. elegans cells; and mammalian cells such as COS cells, CHO cells, VERO cells, 293 cells, PERC6 cells, BHK cells and human cells.

Within the context of the present invention, a vector is a nucleic acid molecule (preferably DNA) capable of replicating autonomously in a host cell. Such vectors may also be characterized by having a small number of endonuclease restriction sites at which such sequences may be cut without loss of an essential biological function and into which nucleic acid molecules may be spliced to bring about its replication and expressing. Examples include plasmids, autonomously replicating sequences (ARS), centromeres, cosmids and phagemids. Vectors can further provide primer sites, e.g., for PCR, transcriptional and/or translational initiation and/or regulation sites, recombinational signals, replicons, etc. The vector can further contain one or more selectable markers suitable for use in the identification of cells transformed or transfected with the vector, such as kanamycin, tetracycline, amplicillin, etc.

In accordance with the invention, any vector may be used. In particular, vectors known in the art and those commercially available (and variants or derivatives thereof) may be used in accordance with the invention.

Such vectors may be obtained from, for example, Vector Laboratories Inc., InVitrogen, Promega, Novagen, NEB, Clontech, Boehringer Mannheim, Pharmacia, EpiCenter, OriGenes Technologies Inc., Stratagene, Perkin Elmer, Pharmingen, Life Technologies, Inc., and Research Genetics. Such vectors may be used for cloning or subcloning nucleic acid molecules of interest and therefore recombinant vectors containing inserts, nucleic acid fragments or genes (or portions of genes) may also be used in accordance with the invention. General classes of vectors of particular interest include prokaryotic and/or eukaryotic cloning vectors, expression vectors, fusion vectors, two- hybrid or reverse two-hybrid vectors, shuttle vectors for use in different hosts, mutagenesis vectors, transcription vectors, vectors for receiving large inserts (yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs) and PI artificial chromosomes (PACs)) and the like. Other vectors of interest include viral origin vectors (Ml 3 vectors, bacterial phage λ vectors, baculovirus vectors, adenovirus vectors, and retrovirus vectors), high, low and adjustable copy number vectors, vectors which have compatible replicons for use in combination in a single host (e.g., pACYC184 and pBR322) and eukaryotic episomal replication vectors (e.g., pCDM8). The vectors contemplated by the invention include vectors containing inserted or additional nucleic acid fragments or sequences (e.g., recombinant vectors) as well as derivatives or variants of any of the vectors described herein.

Expression vectors useful in accordance with the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids or bacteriophages, and vectors derived from combinations thereof, such as cosmids and phagemids, and will preferably include at least one selectable marker (such as a tetracycline or ampicillin resistance genes) and one or more promoters such as the phage lambda PL _ΛΛ,._Λ^ PCT/US00/04643 00/50625

-13-

promoter, and/or the E. coli lac, trp and tac promoters. Other suitable promoters will be known to the skilled artisan. Such promoters may be operably linked to the gene(s) of interest to bring about expression of such gene(s). The preferred enzymatic method for making xNTPs from nucleotide monophosphates according to the present invention is represented schematically in Figure 1. As seen in Figure 1 , the first step of the nucleotide synthesis involves converting the appropriate nucleotide monophosphate, xNMP, into the appropriate nucleotide diphosphate, xNDP, in the presence of one or more enzymes capable of converting the monophosphate into the diphosphate. The second step of the synthesis involves converting the nucleotide diphosphate, xNDP, into the desired nucleotide triphosphate, xNTP, in the presence of one or more enzymes capable of converting the diphosphate into a triphosphate. The first and second steps are accomplished in the presence of one or more phosphate donors which may be added to the reaction or prepared enzymatically during the reaction. In a preferred aspect, the phosphate donors are different for the first and second steps of the reaction, although the same phosphate donor may be used.

Phosphate donors used according to the present invention include any compound capable of donating one or more phosphates. According to a preferred embodiment, the phosphate donor is PEP and xNTP. In a preferred aspect, xNTP is the phosphate donor for the conversion of xNMP to xNDP and PEP is the phosphate donor for conversion of xNDP to xNTP. In a more preferred embodiment, PEP is obtained enzymatically from the reaction of 3- PGA in the presence of the enzymes PGM and ENO and xNTP is obtained enzymatically from the reaction of xNDP in the presence of PYK and PEP. In this method of the invention, when a nucleotide is used as a phosphate donor, the nucleotide used preferably is the desired nucleotide to be produced. For example, to produce xNTP or xNDP using a nucleotide as the phosphate donor, it is preferable to use xNTP and xNDP, respectively, as the phosphate donor. This reduces the likelihood that contaminating nucleotides will be present in the final reaction product. In accordance with the invention, other high-energy phosphate donors can be used, including creatine phosphate, acetyl phosphate, arginine phosphate, and/or 1,3-dihosphoglycerate. These high-energy phosphate donors can be made in a coupled enzyme reaction from inexpensive components. For example, 1,3-diphosphoglycerate can be synthesized enzymatically from gly cerol-3 -phosphate, phosphoric acid, and nicotinamide adenine dinucleotide (NAD), using the commercially available enzymes glycerol-3 -phosphate dehydrogenase, triosephosphate isomerase, and glyceraldehyde-3-phosphate dehydrogenase. If desired, NAD can be regenerated enzymatically using standard methods (for example, coupling the reaction with inexpensive pyruvate and lactate dehydrogenase). Thus, the reaction mix for xNTP synthesis using the 1,3-diphosphoglycerate method may include: xNMP, small amounts of xNTP and NAD, glycerol-3- phosphate, phosphoric acid, pyruvate, and one or more kinases, glycerol-3- phosphate dehydrogenase, triosephosphate isomerase, glyceraldehyde-3- phosphate dehydrogenase, and lactate dehydrogenase. However, the phosphate donor may be provided by starting at any point within the 1,3- diphosphoglycerate pathway by adjusting the starting substrates and enzymes accordingly (see Figure 2). As another example, succinyl CoA can be used as a phosphate donor co-substrate. Succinyl CoA can be made enzymatically from inexpensive citrate, using commercially available enzymes and NAD regeneration. The reaction mix using the succinyl CoA method may thus include: xNMP, small amounts of xNTP and NAD, Coenzyme A, citrate, pyruvate, and one or more kinases, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinyl

CoA synthetase, and lactate dehydrogenase. However, it is possible to start anywhere within the citric acid (Krebs) cycle to provide the phosphate donor by adjusting the starting substrates and enzymes accordingly (see Figure 3).

As a third example, PEP could be synthesized enzymatically from ribulose- 1,5-bisphosphate in bicarbonate buffer using one or more kinases, ribulose- 1,5-bisphosphate carboxylase, PGM, and ENO. Two equivalents of PEP may be generated from each equivalent of ribulose- 1,5-bisphosphate. However, phosphate donor may be provided by starting at any point within this pathway by adjusting the starting substrates and enzymes accordingly (see Figure 4).

Generally, PEP can be synthesized from anywhere in the glycolytic pathway or any other pathway that yields PEP such as the Calvin cycle (i.e. ribulose), the aromatic amino acid biosynthesis of PEP, or any enzyme cascade leading to a generation of PEP (see Figure 5).

Preferably, at least one of the phosphate donors should be higher energy than ATP in order to drive the reaction. If the phosphate donor has less energy than ATP, the reaction may reached equilibrium with the reactants, which may result in lower yield.

In accordance with the invention, any enzyme may be used. Such enzymes may be obtained commercially or may be isolated or purified from any source. If unavailable commercially, such enzymes may be isolated or purified from one or more host cells. In a preferred aspect, recombinant host cells containing and expressing one or more genes encoding the desired enzyme is used as a source to isolate the desired enzymes. Recombinant techniques well known in the art may be used to clone and express the desired gene or genes into one or more vectors. The vectors may then be introduced into one or more host cells by standard transformation or transfection techniques well known in the art.

The host cell producing the desired enzymes can be grown and harvested according to techniques well known in the art. Any culture medium containing nutrients that can be assimilated by the host cell can be used for growing the host cells. Optimal culture conditions can be selected according to the strain used in the composition of the culture medium. After harvesting the host cells, the desired enzymes can be purified by well known protein purification techniques. Such techniques may include extraction, precipition, chromatography, affinity chromatography, electrophoresis and the like. Assays to detect the presence of the desired enzymes during purification can be used to facilitate purification of these enzymes. In a preferred aspect, the desired enzymes are prepared as fusion proteins which may facilitate purification. For example, when cloning the gene encoding the desired enzyme, it is preferable to clone the gene in a vector which provides a carboxy and/or amino terminal tag. Such tags may include His-tags, GST tags, Trx-tags, epitope-tags (myc and HA), etc.

According to the present invention, Escherichia (preferably E. coli) enzymes are preferably used because they are generally well characterized. However, other sources of enzymes and the genes that code for them could be used. For example, thermostable enzymes could be purified from a thermophilic bacterium, or the gene that codes for the enzyme could be cloned and expressed by standard recombinant techniques. For example, sequences of the genes described herein could serve as hybridization probes to isolate a desired gene from a different host cell. The desired enzyme may then be purified by methods well known in the art as described above. Enzymes used in the invention may also be engineered, modified or mutated by standard techniques to improve their activity or to broaden their specificity for other substrates phosphate donors. For example, an enzyme can be engineered to phosphorylate both xNMPs and/or xNDPs, using PEP as a phosphate donor or another phosphate donor (Figure 6). Alternatively, an enzyme may also be designed to phosphorylate nucleosides as well, allowing the use of a less expensive starting material (Figure 7). Finally, an enzyme can be engineered to recognize only the xNMP (Figure 8) and utilize PEP so that no catalytic xNTP would need to be added to the reaction.

According to a preferred aspect of the invention, base specific enzymes and more preferably base specific kinases convert xNMPs into diphosphates.

For example, deoxyadenine monophosphate (dAMP) is converted to deoxyadenine diphosphate (dADP) by adenylate monophosphate kinase (AMK), deoxycytidine monophosphate (dCMP) is converted to deoxycytidine diphosphate (dCDP) by cytidine monophosphate kinase (CMK), deoxyguanosine monophosphate (dGMP) is converted to deoxyguanosine diphosphate (dGDP) by guanosine monophosphate kinase (GMK), deoxythymidine monophosphate (dTMP) is converted to deoxythymidine diphosphate (dTDP) by thymidine monophosphate kinase (TMK), guanosine monophosphate (GMP) is converted to guanosine diphosphate (GDP) by guanosine monophosphate kinase (GMK), etc. In a preferred aspect, conversion of the monophosphate to the diphosphate uses a nucleotide triphosphate as the phosphate donor.

According to the present invention, any enzyme capable of converting the diphosphate into the triphosphate may be used. Preferably, a kinase is used and most preferably PYK is used to convert the diphosphates (e.g., xNDPs) into the desired triphosphate, (e.g., xNTPs). In a preferred aspect, the phosphate donor for conversion of the diphosphate to the triphosphate is phosphoenolpyruvate (PEP). Since PEP is expensive, it is preferably synthesized enzymatically in a coupled reaction from D(-)3-phosphoglyceric acid (3-PGA) in the presence of the enzymes PGM and ENO.

The complete reaction proceeds most efficiently as a coupled reaction with all enzymes present wherein the end product of the reaction is used as a catalyst in the first step of the reaction as shown in Figure 1. Once the reaction is "primed" with a small amount (catalytic amount) of product, in this case, xNTP, the reaction will accelerate as more catalyst, i.e. the end product, is made. The result is that the final reaction product is substantially pure and preferably is not contaminated with any undesired nucleotide such as ATP.

Generally, the present invention relates to a method of making one or more xNMPs comprising (a) mixing one or more nucleosides or derivatives thereof, one or more enzymes capable of converting said nucleosides into xNMPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNMPs, wherein the nucleosides are preferably selected from the group consisting of adenine, cytidine, guanosine, thymidine and uridine or derivatives thereof. Any phosphate donor may be used. The enzyme used is preferably a kinase to allow phosphorylation of the nucleoside. The present invention also relates to a method of making one or more xNDPs comprising (a) mixing one or more xNMPs, one or more enzymes capable of converting said xNMPs into xNDPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNDPs. According to a preferred embodiment, said xNMPs are preferably AMP, CMP, GMP, UMP, dAMP, dCMP, dGMP or dTMP, and derivatives thereof. According to this embodiment, the enzyme is preferably a kinase, most preferably a nucleotide monophosphate kinase (NMK), however, any kinase capable of phosphorylating a xNMP is suitable. According to this embodiment, the phosphate donor is preferably xNTP, but the invention also relates to the use of any phosphate donor that is capable of donating a phopsphate to an xNMP in order to convert it into a xNDP. The phosphate donor may be obtained separately and added to the reaction or may be produced enzymatically during the reaction.

The present invention also relates to a method of making one or more xNTPs comprising (a) mixing one or more xNDPs, one or more enzymes capable of converting said xNDPs into xNTPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNTPs. According to this embodiment, the xNDP is preferably ADP, CDP, GDP, UDP, dADP, dCDP, dGDP or dTDP, and derivatives thereof. According to this embodiment, the enzyme is preferably a kinase, most preferably PYK, however any enzyme capable of phosphorylating xNDP is contemplated. The phosphate donor according to this embodiment is preferably PEP, but any phosphate donor capable of donating a phosphate to xNDP to permit the conversion to xNTP is suitable. The phosphate donor may be obtained separately and added to the reaction or may be made during the reaction by enzymatic synthesis. Enzymatic synthesis includes synthesis by mixing 3-PGA with PGM and ENO or by mixing 2-PGA with ENO.

However, any synthesis reaction which produces a phosphate donor may be used according to the present invention.

The present invention also includes a method of making one or more xNDPs comprising (a) mixing one or more nucleosides or derivatives thereof, one or more enzymes capable of converting said nucleosides into xNMPs and converting said xNMPs into xNDPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNDPs. Another preferred embodiment includes a method of making one or more xNTPs comprising (a) mixing one or more xNMPs, one or more enzymes capable of converting said xNMPs into xNDPs and converting said xNDPs into xNTPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make the desired xNTPs.

Yet another preferred embodiment concerns a method of making one or more xNTPs comprising: (a) mixing one or more nucleosides or derivatives thereof, one or more enzymes capable of converting said nucleosides into xNMP, converting said xNMPs into xNDPs, and converting said xNDPs into xNTPs, and one or more phosphate donors; and (b) incubating said mixture under conditions sufficient to make said xNTPs.

The nucleotides produced by the methods of the invention (e.g., xNMP, xNDP, and xNTP) may be purified and isolated by techniques well known in the art. Purification techniques include chromotography, preferably by high pressure liquid chromatography (HPLC) and/or ion exchange chromotography. Purification or isolation of such nucleotides may provide for substantially pure nucleotides in accordance with the invention.

The present invention permits the synthesis of high quality nucleotides which may be used in amplification (PCR), sequencing, labeling, nucleic acid synthesis, and cDNA synthesis. Thus, the nucleotides of the invention may be included in kits to perform such molecular biology techniques.

Preferred conditions for carrying out the methods of the invention include incubation at a temperature of about 10 to about 60°C, preferably from about 20 to about 45 °C and most preferably at about 37°C. Further preferred reaction conditions include incubating the reaction at a pH of about 5.0 to about 9.0, preferably from about 6.0 to about 8.5, preferably from about 7.0 to about 8.0, and most preferably from about 7.2 to about 7.8. It will be understood that one skilled in the art can optimize the conditions to accomplish the desired enzymatic reaction and obtain the desired product. Such conditions may vary depending on the substrates, the enzymes and the desired reaction. The present invention also relates to a composition comprising (a) one or more nucleosides or derivatives thereof; (b) one or more enzymes capable of converting said nucleosides into xNMPs; and (c) one or more phosphate donors. According to a preferred embodiment, the nucleosides are adenine, cytidine, guanosine, thymidine or uridine or derivatives thereof. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

The present invention further relates to a composition comprising (a) one or more xNMPs; (b) one or more enzymes capable of converting said xNMPs into xNDPs; and (c) one or more phosphate donors. According to a preferred embodiment, the xNMPs are AMP, CMP, GMP, UMP, dAMP, dCMP, dGMP or dTMP or derivatives thereof. Furthermore, the enzyme is preferably a kinase, more preferably NMK, and the phosphate donor is preferably xNTP. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

The present invention further relates to a composition comprising (a) one or more xNDPs; (b) one or more enzymes capable of converting said xNDPs into xNTPs; and (c) one or more phosphate donors, said xNDPs are preferably ADP, CDP, GDP, UDP, dADP, dCDP, dGDP or dTDP or derivatives thereof. According to a preferred embodiment, the enzyme is a kinase, more preferably PYK, and the phosphate donor is preferably PEP. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors. The composition preferably comprises 3-PGA in the presence of PGM and ENO or 2-PGA in the presence of ENO in place of or in addition to PEP. The present invention further relates to a composition comprising (a) one or more nucleosides or derivatives thereof; (b) one or more enzymes capable of converting said nucleosides into xNMPs and converting said xNMPs into xNDPs; and (c) one or more phosphate donors. According to another embodiment, the present invention relates to a composition comprising (a) one or more xNMPs; (b) one or more enzymes capable of converting said xNMPs into xNDPs and converting said xNDPs into xNTPs; and (c) one or more phosphate donors. The invention further relates to a composition comprising (a) one or more nucleosides or derivatives thereof; (b) one or more enzymes capable of converting said nucleosides into xNMPs, converting said xNMPs into xNDPs, and converting said xNDPs into xNTPs; and (c) one or more phosphate donors. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors.

The present invention also relates to compositions comprising one or more enzyme capable carrying out the methods of the invention. Such composition may comprise at least one enzyme capable of converting one or more nucleosides or derivatives thereof into xNMPs and at least one enzyme capable of converting xNMPs into xNDPs. Such composition may also comprise at least one enzyme capable of converting xNMPs into xNDPs and at least one enzyme capable of converting xNDPs into xNTPs. Preferred enzymes in such compositions include any kinase and preferably include

NMK and PYK. Such composition may further comprise one or more phosphate donors and/or one or more enzymes capable of converting a phosphate donor substrate into a phosphate donor. Such enzymes for synthesizing phosphate donors include PGM and/or ENO. The present invention further relates to a composition comprising one or more nucleosides or derivatives thereof and/or one or more nucleotides, and at least one phosphate donor, wherein the nucleotides are preferably xNMP or xNDP and the phosphate donor is preferably xNTP or PEP. Such compositions may further comprise in place of or in addition to the phosphate donors, one or more phosphate donor substrates and one or more enzymes capable of converting such substrates into phosphate donors. The present invention also relates to kits. Such kits comprising one or more components for making nucleotides in accordance with the invention. Such kits may comprise a carrying means being compartmentalized to receive in close confinement one or more container means such as vials, test tubes and the like. Each of such container means comprises components or a mixture of components needed to perform nucleotide synthesis. Such kits for the enzymatic preparation of nucleotides may comprise at least one component selected from the group consisting of at least one enzyme for nucleotide synthesis, preferably a kinase such as NMK and/or PYK, at least one enzyme for phosphate donor synthesis, at least one phosphate donor such as PEP, at least one phosphate donor substrate, at least one substrate for nucleotide synthesis (e.g., nucleosides, xNMP or xNDP), reaction buffers, instructions, etc.

Having now generally described the invention, the same will be more readily understood through reference to the following Examples which are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.

Synthesis of dATP using dATP as a catalyst: A 5-ml aqueous reaction was prepared containing 33 mM Tris-Cl pH 7.5, 30 mM KC1, 30 mM MgCl₂, 4 mM DTT, 60 mM 3-phosphoglyceric acid (3-PGA), 30 mM dAMP and 1 mM ATP or dATP. The following enzymes were added: 89 units phosphogly cerate mutase (PGM), 52 units enolase (ENO), 14 units adenosine monophosphate kinase (AMK) and 54 units pyruvate kinase (PYK). The enzymes were assayed using a modified method further described below. The reaction was incubated at room temperature for 3 days. The synthesis of dATP was confirmed using thin layer chromatography (TLC) on poly(ethyleneimine) plates in 10 mM Tris at a pH 7.5 and 1M LiCl.

Synthesis of dATP at 17 mmol scale: A 500-ml aqueous reaction was prepared containing 50 mM Tris-Cl pH 7.5, 33mM KC1, 33 mM MgCl₂, 4 mM DTT, 66 mM 3-PGA, 33 mM dAMP and 0.1 mM dATP. The following enzymes were added: 350 units PYK, 1950 units PGM, 380 units ENO, and 310 units AMK. The reaction was incubated at 37°C and a pH controller was used to maintain the pH between 7.5 and 7.8. After 2.5 h of incubation, a further 17 mmol of 3-PGA was added and incubation was continued for a further hour. Reaction products were analyzed by capillary electrophoresis (CE) (uSIL-WAX capillary, J&W Scientific, 37 cm x 50 μ; 50 mM triethylammonium acetate pH 5.2; 11 kV; reverse polarity; 2 sec pressure injection; analysis at 254 nm) and by HPLC (using standard ion-pair chromatographic methods). Purity of crude dATP synthesized by this method was found to be >88%.

Synthesis of dATP at 100 mmol scale: A 3L reaction was prepared in a 5L three-necked flask containing 50 mM Tris-Cl pH 7.5, 33 mM KC1, 33 mM MgCl₂, 4 mM DTT, 33 mM dAMP, 66 mM 3-PGA and 0.075 M dATP. The following amounts of enzymes were added: 14300 units PYK, 11200 units PGM, 2300 units ENO, 1850 units AMK. The reaction was incubated at 37°C and the pH was maintained between 7.5 and 8.0 with IN HCl. After 3h of incubation, 100 mmol of 3-PGA was added and incubation was continued for another hour. Reaction products were analyzed by CE and HPLC. Final yield of dATP was 98% by CE and 94% by HPLC.

Synthesis of dATP at 200 mmol scale in a fermenter: A 6 L reaction was prepared in a temperature-controlled 10 L fermentation tank. The reaction contained 50 mM Tris-Cl at a pH of 7.5, 33 mM KC1, 33 mM MgCl₂,

4 mM DTT, 33 mM dAMP, 66 mM 3-PGA, and 0.1 mM dATP. The following amounts of enzyme were added: 28600 units PYK, 22400 units PGM, 4600 units ENO, and 3700 units AMK. The temperature was maintained at 37°C and the pH at or below 7.8 with 1 N HCl. After 3h of incubation, an additional 200 mmol of 3-PGA were added and incubation continued for another 3h. Reaction products were analyzed by HPLC. Final yield of dATP was 96%.

The pH of the reaction was monitored during the reaction. Figure 9 shows the pH profile of the first 30 minutes of reaction. The pH rise is due to H⁺ consumption during the PYK reaction. As seen in Figure 9, there is a lag in the pH increase. This is due to the autocatalytic nature of the reaction. Initially, the AMK reaction is limiting, as very little dATP is present. As dATP begins to build up in the reaction, the overall reaction accelerates as the AMK reaction becomes more efficient. After the reaction pH reaches 7.8, the pH controller begins to deliver HCl to the reaction and the pH is maintained at 7.8. Small scale synthesis of dCTP using dCTP as a catalyst: A 30 ml reaction was prepared containing 50 mM Tris-Cl pH 7.5, 50 mM KC1, 33 mM MgCl₂, 2 mM DTT, 66 mM 3-PGA, 33 mM dCMP, and 0.1 mM dCTP. The following enzymes were added: 600 units PYK, 210 units PGM, 45 units ENO, and 45 units cytidine monophosphate kinase (CMK). The reaction was incubated at 37°C and the pH was maintained below 7.8 with 0.1 M HCl. 1.5 mmol additional 3-PGA was added after 2.5h of incubation. Results were analyzed by HPLC and dCTP synthesized by this method was obtained in 90% yield in 5h.

Large scale synthesis of dCTP using dCTP as a catalyst: A 1.5L reaction was prepared containing 50 mM Tris-Cl at a pH of 7.5, 50 mM KC1,

33 mM MgCl₂, 2 mM DTT, 66 mM 3-PGA, 33 mM dCMP and 0.1 mM dCTP. The following enzymes were added: 30,000 units PYK, 10,500 units PGM, 2250 units ENO and 2250 units cytidine monophosphate kinase (CMK). The reaction was incubated at 37°C with pH controlled below 7.8 with 1M acetic acid. An additional 74 mmol 3-PGA were added after 2.5 h of incubation. Results were analyzed by HPLC as described herein and crude dCTP synthesized by this method was obtained in 94% yield after 5 h of reaction.

Synthesis of dGTP using ATP as a catalyst: A 2.0L reaction was prepared containing 50 mM Tris-Cl at a pH of 7.5, 50 mM KC1, 10 mM

MgCl₂, 1.0 mM DTT, 20 mM 3-PGA, 10 mM dGMP and 0.025 mM ATP. The following enzymes were added: 30,000 units PYK, 4000 units PGM, 900 units ENO and 6000 units guanosine monophosphate kinase (GMK). The reaction was incubated at 37°C with pH controlled below 7.8 with 1M acetic acid. An additional 30 mmol 3-PGA were added after 2.5 h of incubation.

Results were analyzed by HPLC as described herein and crude dGTP synthesized by this method was obtained in 92% yield after 5 h of reaction. dGTP was found to separate well from ATP by standard anion exchange chromatography processing methods.

Synthesis of dGTP using dGTP as a catalyst: A 100 1 reaction was prepared containing 50 mM Tris-Cl at a pH of 7.5, 50 mM KCl, 10 mM MgCl₂, 0.1 mM DTT, 10 mM dGMP, 10 mM 3-PGA, and 1 mM dGTP. The following amounts of enzyme were added: 1.5 units PYK, 0.2 units PGM, 0.045 units ENO, and 0.3 units GMK. The reaction was incubated at 37°C overnight. dGTP was synthesized in 41% yield (see Figure 10).

For comparison, GMK was replaced by AMK using the same reaction conditions, but the yield was significantly lower. Furthermore, dGTP was replaced with ATP as a catalyst using the same reaction conditions. Although the yield was not as good as the results obtained using dGTP as a catalyst, the results were significant. See Figure 10.

Small scale synthesis of dTTP using dTTP as a catalyst: A 91 ml reaction was prepared containing 50 mM Tris-Cl pH 7.5, 50 mM KCl, 33 mM

MgCl₂, 2 mM DTT, 66 mM 3-PGA, 33 mM dTMP, and 0.1 mM dTTP. The following enzymes were added: 460 units PYK, 640 units PGM, 140 units ENO, and 270 units thymidine monophosphate kinase (TMK). The reaction was incubated at 37°C and the pH was maintained below 7.8 with 1 M acetic acid. 4.5 mmol additional 3-PGA were added after 3 hours of incubation.

Results were analyzed by HPLC and dTTP synthesized by this method was obtained in 95% yield in 5 hours. Figure 11 shows the progression of the dTTP synthesis reaction as a function of time.

Large scale synthesis of dTTP using dTTP as a catalyst: A 1.9L reaction was prepared containing 50 mM Tris-Cl at a pH of 7.5, 50 mM KCl,

10 mM MgCl₂, 0.1 mM DTT, 20 mM 3-PGA, 10 mM dTMP and 0.04 mM dTTP. The following enzymes were added: 37,500 units PYK, 5000 units PGM, 1125 units ENO and 3750 units thymidine monophosphate kinase (TMK). The reaction was incubated at 37°C with pH controlled below 7.8 with IM acetic acid. An additional 30 mmol 3-PGA were added after 2.5 h of incubation. Results were analyzed by HPLC as described herein and crude dCTP synthesized by this method was obtained in 94% yield after 6 h of 0625

-26-

reaction. Figure 12 shows the effect of the 3-PGA/dTMP ratio on the dTTP synthesis reaction. In order to achieve a >90% yield, >3 equivalents of 3-PGA are required.

Table 1 below summarizes the results of dNTP synthesis reactions using the methods of the present invention as described above.

Examples:

Table 1: dNTP Reaction Summary

synt es ze us ng as a cata yst.

625

-27-

Table 2 below summarizes the enzymatic requirements for dNTP synthesis according to the present invention.

synthesized using ATP as a catalyst.

Synthesis of dTDP. A 91 ml reaction was prepared containing 50 mM Tris-Cl pH 7.5, 50 mM KCl, 33 mM MgCl₂, 2 mM DTT, 66 mM 3-PGA, 33 mM dTMP, and 0.1 mM dTTP. The following enzymes were added: 460 units PYK, 640 units PGM, 140 units ENO, and 270 units thymidine monophosphate kinase (TMK). The reaction was incubated at 37°C and the pH was maintained below 7.8 with 1 M acetic acid. Results were analyzed by HPLC and dTDP synthesized by this method was obtained in 30% yield.

Synthesis of GTP using GTP as a catalyst: A 100 1 reaction was prepared containing 50 mM Tris-Cl at a pH of 7.5, 50 mM KCl, 10 mM MgCl₂, 0.1 mM DTT, 10 mM GMP, 10 mM 3-PGA, and 1 mM GTP. The following amounts of enzyme were added: 1.5 units PYK, 0.2 units PGM, 0.045 units ENO, and 0.3 units GMK. The reaction was incubated at 37°C overnight. GTP was synthesized in 28% yield (see Figure 10).

For comparison, GMK was replaced by AMK using the same reaction conditions, but the yield was significantly lower. Furthermore, GTP was replaced with ATP as a catalyst using the same reaction conditions. The yield was comparable to the results obtained using GTP as a catalyst. See Figure 10. Synthesis of UTP using UTP as a catalyst: A reaction mix containing 50 mM Tris-Cl at a pH of 7.5, 50 M KCl, 10 mM MgCl₂, 0.1 mM DTT, 20 mM 3-PGA, 10 mM UMP and 0.1 mM UTP is prepared. The following enzymes are added: 1500 units/ml PYK, 200 units/ml PGM, 45 units/ml ENO and 300 units/ml adenosine monophosphate kinase (AMK). The reaction is incubated at 37°C with pH controlled below 7.8 with IM acetic acid. Add 3- PGA to a final concentration of 35 mM after 2.5 h of incubation. The total reaction time is 5 h.

The following experiments compare the purification products of synthesis of dATP using ATP as a catalyst with the purification products of synthesis of dATP using dATP as a catalyst as described above.

Purification of dATP from material generated by the enzymatic synthesis of dATP using ATP as a catalyst: Several different buffers and ion- exchange chromatography resins were tested in an attempt to separate dATP from other synthesis components. No buffer, ion-exchange chromatography resin or combination thereof was found to give good resolution of dATP from ATP components. Figure 13 represents an analysis of the reaction product of the enzymatic synthesis of dATP product using ATP as a catalyst. Table 3 a presents the peak number, retention time (in minutes), and area (expressed as a percentage) for each peak present in the HPLC chromatogram depicted in Figure 13: Table 3a

Figure 14 represents an analysis of the purified product of the enzymatic synthesis of dATP product using ATP as a catalyst. Table 3b presents the peak number, retention time (in minutes), and area (expressed as a percentage) for each peak present in the HPLC chromatogram depicted in Figure 14:

Table 3b

The purity of the dATP by HPLC was 92.9%. The HPLC analysis of the purified dATP showed a contaminant of >2% (3.1%) that eluted as ATP.

For this experiment, the following methods were used. The column was a TosoHaas Super Q-650(s) with a 5.0 ml packed bed of resin, equilibrated to Buffer A, 200 mM Triethylamine Formate (pH 5.10) in H₂O.

4.0 ml of centrifuge supernatant was diluted with 10 ml of H₂O and 10 ml Buffer A. Titration was performed to pH 5 with 5 M Formic Acid. Filtration was to 0.2 μ. 17 ml of diluted sample was loaded at the rate of 100 cm/hr (3.3 ml/min) and 3.8 mg dATP per ml resin was loaded. 625

-31-

The column was washed using 50 ml Buffer A at a flow of 100 cm/hr (3.3 ml/min). The gradient was a linear 100 ml gradient from Buffer A to Buffer B, 1.0 M Triethylamine Formate (pH 5.12), in 1.5 ml fractions at a flow of 30 cm/hr (1 ml/min). All gradient peak fractions showing > ^lA peak height were pooled.

Table 3c below summarizes the major peaks seen in Figures 13 and 14. As seen in Figure 13, the purified dATP synthesized using ATP as a catalyst showed a contamination that eluted as ATP.

Table 3c

Purification of dATP from material generated by enzymatic synthesis of dATP using dATP as a catalyst: The purification of dATP from the synthesis of dATP using dATP as a catalyst was demonstrated. Figure 15 represents an analysis of the reaction product. Table 4a presents the peak number, retention time (in minutes), and area (expressed as a percentage) for each peak present in the HPLC chromatogram depicted in Figure 15: 625

-32-

Table 4a

Figure 16 represents an analysis of the purified reaction product. Table 4b presents the peak number, retention time (in minutes), and area (expressed as a percentage) for each peak present in the HPLC chromatogram depicted in Figure 16: Table 4b

The purity of the dATP by HPLC was 94.2%. The HPLC analysis of the purified dATP did not show any prominent contamination that eluted as ATP.

For this experiment, the following methods were used: The column was a TosoHaas Super Q-650(s), with a 5.0 ml packed bed of resin and equilibrated to Buffer A.

4.0 ml of centrifuge supernatant was diluted with 6 ml of H₂O and 10 ml Buffer A. Titration was performed to pH 5 with 5 M Formic Acid. Filtration was to 0.2 μ. 17.9 ml of diluted sample was loaded at the rate of 100 cm/hr (3.3 ml/min) and 3.9 mg dATP per ml resin was loaded. 625

-34-

The column was washed using 50 ml Buffer A at a flow of 100 cm/hr (3.3 ml/min). The gradient was a linear 100 ml gradient from Buffer A to Buffer B in 1.5 ml fractions at a flow of 30 cm/hr (1 ml/min). All gradient peak fractions showing > ^XA peak height were pooled.

Table 4c below summarizes the peaks seen in Figures 15 and 16. As seen in Figure 16, the purified dATP synthesized using dATP as a catalyst showed no contamination that eluted as ATP.

Table 4c

The use of dNTP as a catalyst for the synthesis of dNTP according to the present invention clearly eliminates the problems associated with ATP contamination.

Enzyme Assays

Nucleotide monophosphate kinases were assayed as follows: For adenosine monophosphate kinase, the reaction mix (in a 1-ml disposable spectrophotometer cuvette) included 50 M Tris-Cl pH 7.5, 50 mM KCl, 5 mM MgCl₂, 1 mM DTT, 2 mM PEP, 0.2 mM NADH, 0.2 mM dAMP, 0.2 mM ATP, 5 units/ml lactate dehydrogenase and 8 units/ml PYK. Reactions were equilibrated at 37°C and initiated by the addition of enzyme. Enzyme activity was quantified by following the oxidation of NADH at 340 nm in a spectrophotometer. One unit of enzyme is defined as the amount of AMK required to oxidize 1 mmol of NADH in 1 min at 37°C. Cytidine monophosphate kinase and thymidine monophosphate kinase were assayed similarly, except that dCMP and dTMP, respectively, replaced dAMP in the reaction mix. The production of high levels of PYK for dNTP synthesis benefits the NMK assay because it allows high levels of this coupling enzyme to be added to the reaction. Blondin, et al, (1994) Analytical Biochemistry 220; 219-221 have shown that the substrate specificity of PYK for nucleotides such as dCMP requires high levels of PYK (>5 units/ml) to be added to the NMK assay. In Blondin, et al, the addition of another enzyme such as nucleoside diphosphate kinase is recommended. However, the method of the present invention permits the purification of over 1,000,000 units of PYK from cells (final enzyme concentration: 1400 U/ml). As seen in Figure 17, the addition of excess CMK leads to a rapid oxidation of NADH, showing that PYK and

LDH are not limiting in the reaction.

Pyruvate kinase was assayed similarly to AMK except that the reaction mix contained 0.2 mM ADP instead of dAMP and ATP and only LDH was used as a coupling enzyme. PYK enzyme was added to the reaction mix prior to pre-equilibration and the reaction was initiated by the addition of ADP.

Enolase was assayed as follows: the reaction mix (in a 1-ml quartz spectrophotometer cuvette) included 50 mM Tris-Cl pH 8.0, 50 mM KCl, 10 mM MgCl₂, 1 M DTT, 2 mM D-(+)-2-phosphoglyerate. Reactions were equilibrated at 37°C and initiated by the addition of enzyme. Enzyme activity was quantified by following the formation of PEP at 240 nm in a spectrophotometer. The extinction coefficient of PEP is 1510 M 'c ^"1 at pH 8. One unit of enzyme is defined as the amount of enolase required to form 1 mmol of PEP in 1 min at 37°C.

Phospho gly cerate mutase was assayed similarly to enolase except that D-(+)-2-phosphoglycerate was omitted from the reaction mix and was replaced with 2 mM 3-phosphoglycerate, 0.2 mM 2,3-diphosphoglycerate, and 2 units/ml enolase.

Desalting of PGA: Barium PGA was converted to the potassium salt according to Simon, et al, Convenient Syntheses of Cytidine 5 '-Triphosphate, Uridine 5 'Triphosphate and Their Use in the Preparation of UDP-glucose,

UDP-glucuronic Acid, and GDP-mannose (1990) J Org. Chem 55, 1834- 1841, and using KOH as the neutralizing agent. The resulting PGA was assayed by converting PGA to PEP in a 1 ml reaction with 50 mM Tris-Cl pH 8.0, 50 mM KCl, 5 mM MgC12, ~1 mM PGA, 0.4 units ENO and 3.4 units PGM. The reaction was incubated at 37°C for 20 minutes and PEP measured at 240 nm in a spectrophotometer. Results were compared to a standard curve using commercially purchased sodium PGA.

HPLC Methodology: An Alltech Nucleoside/Nucleotide 7 μ column (4.5 mm i.d. x 25 cm length) was used. Buffer C was a 60 mM ammonium phosphate pH 5.0, 5 mM tetrabutylammonium phosphate (TBAP), and Buffer D was a methanol with 5 mM TBAP. The gradient was programmed as follows: 0 to 13 minutes, 5-36% Buffer C; 13 to 16 minutes, 36% Buffer C;

16 to 26 minutes, 36-90% Buffer C. Flow rate was 1.5 ml/min. The first 18 minutes of the chromatogram were analyzed.

According to the present invention, the genes for the 4 E. coli enzymes that convert dNMP to dNDP (AMK, CMK, GMK and TMK) and the genes for the E. coli enzymes PYK, PGM and ENO were cloned from E. coli DNA by

PCR using published sequence data and subcloned into expression vectors with affinity tags for easy purification. Each of the enzymes were expressed in an E. coli host and all of the enzymes were soluble, active and made in large amounts. They were purified from crude cell extracts by binding to a NTA column charged with nickel sulfate, and eluted with an imidazole gradient using standard procedures.

Cloning and expressing the gene for E. coli adenine monophosphate kinase (AMK): The AMK gene was cloned by PCR, and subcloned into an expression vector which added a histidine tag. The E. coli cells with this plasmid were then induced for expression of the histidine-tagged AMK protein, and the protein was purified on a column which binds histidine-tagged proteins.

The DNA sequence of the gene for E. coli adenine monophosphate kinase (AMK) has been published by Brune, et al. (1985) Nucleic Acids Research 13 (19), 7139-7151. According to Brune, et al, the gene is referred to as the adk (adenylate kinase) gene. However, for simplicity, a uniform nomenclature which is consistent for all 4 monophosphate kinase genes and proteins has been chosen. Two oligonucleotides were synthesized to clone the AMK gene by a standard PCR regimen:

Gene: AMK Reference: GENBANK LOCUS: ECADK, ACCESSION: X03038

Sequence 1:

5' CAUCAUCAUCAUATGCGTATCATTCTGCTTGGCGCT 3' (SEQ ID

NO:l)

Sequence 2:

5' CUACUACUACUAGAGCTCEL4GCCGAGGATTTTTTCCA 3' (SEQ ID

NO:2)

Each oligonucleotide has a 12 base 5' extension, containing 4 uracil residues each, which allow for simple cloning of the PCR fragment by the

UDG cloning method (see Buchman, et al. (1992) Focus 14, 41-45). In Sequence 1 , an Ndel endonuclease site (bold) is constructed out of the ATG start codon of the AMK gene. In Sequence 2, which is a "reverse" primer, an Sstl site (bold) is added just after the termination codon (italic). E. coli DNA from strain DH5αFTQ was used as target, and after 8 cycles, the PCR product was precipitated with ethanol, re-suspended in 20 μl TES, and cloned into pAMPl using UDG (see Buchman, et al.) (see Figure 18). Clones were identified by screening plasmid minipreps for the correct size plasmid.

The insert was removed with Ndel-Sstl and subcloned into the Ndel- Sstl sites of pROEXl, forming pROEX-AMK (see Figure 19). This placed the AMK gene downstream from the Trc promoter in pROEXl, and added a histidine tag to the amino end of the coding sequence so that the recombinant AMK protein could be purified by using a nickel column. The His tag is marked on the map but is not labeled because it is so small. Cloning and expressing the genes for E. coli thymidine monophosphate kinase (TMK), cytidine monophosphate kinase (CMK), guanosine monophosphate kinase (GMK), phoshoglycerate mutase (PGM), pyruvate kinase (PYK) and enolase (ENO): The TMK, CMK, GMK, PGM, PYK and ENO genes were cloned by PCR (see Figures 20, 22, 24, 26, 28 and 30 respectively). CMK, GMK, PGM and ENO were subcloned into an expression vector which added a histidine tag in the same way that the AMK gene was cloned and subcloned (see Figures 23, 25, 27 and 31 respectively).

TMK was cloned into pROEXl-HT with Ehel and Sstl instead of Ndel-Sstl (.see Figure 21). In the case of PYK, the histidine tag was added to the carboxy end of the protein (see Figure 29). The E. coli cells with these plasmids were then induced for expression of the histidine-tagged protein, and the proteins were purified on columns which bind histidine-tagged proteins, in the same way that AMK was expressed and purified as described above.

The DNA sequences of the E. coli genes for each enzyme have been published and oligonucleotides were designed to clone them by PCR as follows:

Gene: TMK

Reference: GENBANK LOCUS: ECU41456, ACCESSION: U41456 See, Escherichia coli thymidylate kinase: molecular cloning, nucleotide sequence, and genetic organization of the corresponding TMK locus, J.

Bacteriol. 178 (10), 2804-2812 (1996).

Oligonucleotides to clone TMK by PCR (Ehel site in bold):

Sequence 3:

5' CAUCAUCAUCAUGGCGCCATGCGCAGTAAGTATATCGTCATT 3' (SEQ ID NO:3)

Sequence 4: 5' CUACUACUACUAGAGCTCJr TGCGTCCAACTCCTTCACCCA 3'

(SEQ ID NO:4) Gene: CMK

Reference: GENBANK LOCUS: ECCMK X82933, ACCESSION: D90729

AB001340

See, Fricke, et al., The CMK gene encoding cytidine monophosphate kinase is located in the rpsA operon and is required for normal replication rate in Escherichia coli, J. Bacteriol. 177 (3), 517-523 (1995) and Oshima et al., A 718-kb DNA sequence of the Escherichia coli K- 12 genome corresponding to the 12.7-28.0 min region on the linkage map, DNA Res. 3 (3), 137-155 (1996).

Oligonucleotides to clone CMK by PCR:

Sequence 5:

5' CAUCAUCAUCAUATGACGGCAATTGCCCCGGTTATT 3' (SEQ ID NO:5)

Sequence 6:

5' CUACUACUACUAGAGCTCEEΛTGCGAGAGCCAATTTCTGGCG 3'

(SEQ ID NO:6)

Gene: GMK

Reference: GENBANK LOCUS: ECOGMK, ACCESSION: M84400

See, Sarubbi, et al., Characterization of the spoT gene of Escherichia coli, J.

Biol. Chem. 264 (25), 15074-15082 (1989). MEDLINE: 89359321

Reference: bases 1 to 1588

See, Gentry et al., Guanylate kinase of Escherichia coli K-12, J. Biol. Chem.

268 (19), 14316-14321 (1993).

Oligonucleotides to clone GMK by PCR:

Sequence 7: 5'

CAUCAUCAUCAUATGGCTCAAGGCACGCTTTATATTGTTTCTGCCC CCAGTGGC 3' (SEQ ID NO:7)

Sequence 8:

5' CUACUACUACUAGAGCTC7T4GTCTGCCAACAATTTGCTGAT 3' (SEQ ID NO:8)

Gene: PGM Reference: GENBANK LOCUS: AE000178, ACCESSION: AE000178

U00096

See, Blattner et al., The complete genome sequence of Escherichia coli K-12, Science 277 (5331), 1453-1474 (1997).

Oligonucleotides to clone PGM by PCR:

Sequence 9:

5' CAUCAUCAUCAUATGGCTGTAACTAAGCTGGTTCTG 3' (SEQ ID NO:9)

Sequence 10:

5' CUACUACUACUAGAGCTC CTTCGCTTTACCCTGGTTTGC 3'

(SEQ ID NO: 10)

Gene: PYK

Reference: GENBANK LOCUS: ECOPK1, ACCESSION: M24636

See, Ohara et al., Direct genomic sequencing of bacterial DNA: The pyruvate kinase I gene of Escherichia coli, Proc. Natl. Acad. Sci. U.S.A. 86, 6883-6887

(1989).

Oligonucleotides to clone PYK by PCR: Sequence 11 :

5' CAUCAUCAUCAUATGAAAAAGACCAAAATTGTTTGC 3' (SEQ ID

NO: 11)

Sequence 12:

5 ' CUACUACUACUAGAGCTCrR4GTGATGGTGATGGTGATGGCCT CCCAGGACGTGAACAGATGCGGTGTT 3' (SEQ ID NO: 12)

Gene: ENO Reference: GENBANK LOCUS: ECENO, ACCESSION: X82400

See, Klein et al., Cloning, nucleotide sequence, and functional expression of the Escherichia coli enolase (eno) gene in a temperature-sensitive eno mutant strain, DNA Seq. 6, 315-355 (1996).

Oligonucleotides to clone ENO by PCR:

Sequence 13:

5' CAUCAUCAUCAUATGTCCAAAATCGTAAAAATCATC 3' (SEQ ID NO:13)

Sequence 14:

5' CUACUACUACUAGAGCTCTCAGATAAAGTCAGTCTTATG 3' (SEQ

ID NO: 14)

As described for the cloning of the AMK gene, each oligonucleotide has a 12 base 5' extension, containing 4 uracil residues each, which allow for simple cloning of the PCR fragment by the UDG cloning method. As described for AMK, an Ndel endonuclease site (bold) is constructed out of the ATG start codon of each gene (except TMK, which uses an Ehel site). As described for AMK, in the "reverse" primer, an Sstl site (bold) is added just after the termination codon (italic). In the case of PYK, a histidine tag at the amino end was found to be unsuitable, so a histidine coding sequence was -Λ2-

added to the "reverse" primer, thus adding a histidine tag to the carboxy end of the PYK protein. As described for AMK above, E. coli DNA from strain DH5αFTQ was used as target, and after 8 cycles, the PCR product cloned into pAMPl using UDG. As described for AMK, clones were identified by screening plasmid minipreps for the correct size plasmid.

As described for AMK, the insert was subcloned in pROEXl, placing the appropriate gene downstream from the Trc promoter in pROEXl (except for PYK), and adding a histidine coding sequence to the amino end of the coding sequence so that the recombinant protein could be purified by using a nickel column. In the case of PYK, since the histidine sequence was added to the carboxy end of the gene, and the histidine-tagged gene was cloned into the Ndel-Sstl sites of expression vector pTrcN, forming pTrcN-PYK-CHis (Figure 29).

Purification of histidine-tagged E. coli adenine mono-phosphate kinase (AMK): E. coli strain DHlOB/pROΕX-AMK harbors the pROΕX-AMK plasmid, and thus expresses recombinant, histidine-tagged AMK when the Trc promoter is activated with IPTG. DHlOB/pROΕX-AMK cells were grown in 200 ml CG + 0.01% PPG 100 μg ampicillin/ml at 37°C until they reached an OD₅₉₀nm of 1. IPTG was added to a final concentration of 1 mM. After 3 more hours, cells were harvested by centrifugation, and the cell pellet was stored at -20°C until used. The pellet was thawed with 20 ml of cold (4°C) cracking buffer (described below), and 20 mg of lysozyme was added. The following steps were preformed at 4°C. The cells were broken by ultra- sonication, and the lysate was centrifuged for 60 min at 10,000 rpm in a sorvall SS34 rotor. The supernatant was applied to a 15 ml Nickel-NTA column and the column was washed with 150 ml of Buffer Ε (described below). His-tagged AMK was eluted with 150 ml of a linear gradient of imidazole from 20 mM to 400 M, accomplished by appropriate mixing of Buffer Ε and Buffer F (described below). 3 ml fractions were collected. The His-tagged AMK eluted at imidazole concentrations from 125 mM to 175 mM, as detected by protein concentration determination and by polyacrylamide gel electrophoresis. Fractions containing His-tagged AMK were pooled and dialyzed against Buffer G (described below) at 4°C. His- tagged AMK was stored at -20° C in Buffer G.

Purification of histidine-tagged E. coli enzymes thymidine monophosphate kinase (TMK), cytidine monophosphate kinase (CMK), guanosine monophosphate kinase (GMK), phosphoglycerate mutase (PGM), pyruvate kinase (PYK) and enolase (ENO): E. coli strains DHlOB/pROEX- TMK harbors the pROEX-TMK plasmid, and thus expresses recombinant, histidine-tagged TMK when the Trc promoter is activated with IPTG. Similarly, DHlOB/pROEX-CMK, DHlOB/pROEX-GMK DHlOB/pROEX- PGM, and DHlOB/pROEX-ENO cause the expression of histidine-tagged

CMK, GMK, PGM, and ENO proteins, respectively. PYK was similarly expressed from DHlOB/pTrcN-PYK-CHis. DH10B cells carrying the appropriate plasmid were grown, induced, further grown, harvested, broken by ultra-sonication, and centrifuged as described above for histidine-tagged AMK. The supernatants were applied to 15 ml Nickel-NTA columns and chromatographed as described above for histidine-tagged AMK. The His- tagged proteins eluted at imidazole concentrations from 125 mM to 175 mM imidazole, (except for GMK, which eluted from about 165 mM to 215 mM imidazole) and were detected by protein concentration determination and by polyacrylamide gel electrophoresis. Fractions containing the appropriate His- tagged enzyme were pooled and dialyzed against Buffer G at 4°C. His-tagged proteins were stored at -20°C in Buffer G.

Methods: The PCR regimen included 100 μl Supermix, 1 μl 100 mM each oligonucleotide, 1 μl 200 ng/μl target DNA and 1 μl (5 U) additional recombinant Taq DNA polymerase:

5 min 94°C once cycle repeated 8 times: 15 sec 94°C, 15 sec 55°C, 1 min 72°C 3 min 72°C, once The following buffers were used: TE: 20 mM Tris-HCl (pH 8.0), 1 mM EDTA; TES: 50 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA; Supermix: 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgC12, 200 μM dATP, 200 μM dCTP, 200 μM dGTP, 200 μM dTTP, 0.02 U/ml recombinant Taq DNA polymerase; Cracking buffer: 20 mM Tris 8.0, lOOmM KCL, 1 mM PMSF; 1 mg/ml lysozyme; Buffer E: 20 mM Tris 8.5 (4°C), 100 mM KCl, 5 mM βME, 10 % glycerol, 20 mM imidazole; Buffer F: 20 mM Tris 8.0, 100 mM KCl, 10 % glycerol, 1 M imidazole; Buffer G: 20 mM Tris pH 8.0, 100 mM KCl, 5 mM βME, 50% glycerol.

The preparation of the Nickel-NTA column included charging a 15 ml bed of NTA-sepharose (Pharmacia) with 75 ml of 200 mM NiSO4, washing with water, washing with Buffer F, and then washing with Buffer E. The media and additives included CG: 1 Circlegrow (BiolOl, LaJolla,

CA) capsule per 25 ml water, autoclaved; IPTG: 200 mM in water, filter sterilized, stored at -20°C until used.

Having now fully described the present invention in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious to one of ordinary skill in the art that the same can be performed by modifying or changing the invention within a wide and equivalent range of conditions, formulations and other parameters without affecting the scope of the invention or any specific embodiment thereof, and that such modifications or changes are intended to be encompassed within the scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference.

Claims

What Is Claimed Is:

1. A method of making one or more xNMPs comprising: mixing at least one nucleoside or derivative thereof, at least one enzyme capable of converting said nucleoside or derivative thereof into xNMP, and at least one phosphate donor; and incubating said mixture under conditions sufficient to make said xNMPs.

2. The method of claim 1, wherein said phosphate donor is provided by enzymatic synthesis.

3. A method of making one or more xNDPs comprising: mixing at least one xNMP, at least one enzyme capable of converting said xNMP into xNDP, and at lest one phosphate donor; and incubating said mixture under conditions sufficient to make said xNDPs.

4. The method of claim 3, wherein said phosphate donor is provided by enzymatic synthesis.

5. The method of claim 3, wherein said enzyme is a kinase.

6. The method of claim 4, wherein said mixture further comprises at least one enzyme capable of converting a phosphate donor substrate into a phosphate donor.

7. The method of claim 3, wherein said phosphate donor is xNTP.

8. A method of making one or more xNTPs comprising: mixing at least one xNDP, at least one enzyme capable of converting said xNDP into xNTP, and at least one phosphate donor; and incubating said mixture under conditions sufficient to make said xNTPs.

9. The method of claim 8, wherein said phosphate donor is provided by enzymatic synthesis.

10. The method of claim 8, wherein said enzyme is a kinase.

11. The method of claim 9, wherein said mixture further comprises at least one enzyme capable of converting a phosphate donor substrate into a phosphate donor.

12. The method of claim 8, wherein said phosphate donor is PEP.

13. The method of claim 8, wherein said phosphate donor is provided by chemical synthesis.

14. The method of claim 5, wherein said kinase is PYK.

15. The method of claim 11, wherein said enzyme is at least one enzyme selected from PGM and ENO.

16. A method of making one or more xNDPs comprising: mixing at least one nucleoside or derivative thereof, one or more enzymes capable of converting said nucleoside into xNMP and converting said xNMP into xNDP, and at least one phosphate donor; and incubating said mixture under conditions sufficient to make said xNDPs.

17. A method of making one or more xNTPs comprising: mixing at least one xNMP, one or more enzymes capable of converting said xNMP into xNDP and converting said xNDP into xNTP, and at least one phosphate donor; and incubating said mixture under conditions sufficient to make said xNTPs.

18. A method of making one or more xNTPs comprising: mixing at least one nucleoside or derivative thereof, one or more enzymes capable of converting said nucleoside into xNMP, converting said xNMP into xNDP, and converting said xNDP into xNTP, and at least one phosphate donor; and incubating said mixture under conditions sufficient to make said xNTPs.

19. The method of claim 18 further comprising isolating said xNTPs.

20. A composition comprising: at least one nucleoside or derivative thereof; at least one enzyme capable of converting said nucleoside or derivative thereof into xNMP; and at least one phosphate donor.

21. A composition comprising : at least one xNMP; at least one enzyme capable of converting said xNMP into xNDP; and at least one phosphate donor.

22. A composition comprising: at least one xNDP; at least one enzyme capable of converting said xNDP into xNTP; and 625

-48-

at least one phosphate donor.

23. A composition comprising: at least one nucleoside or derivative thereof; one or more enzymes capable of converting said nucleoside or derivative thereof into xNMP and converting said xNMP into xNDP; and one or more phosphate donors.

24. A composition comprising: at least one xNMP; one or more enzymes capable of converting said xNMP into a xNDP and converting said xNDP into xNTP; and one or more phosphate donors.

25. A composition comprising: at least one nucleoside or derivative thereof; one or more enzymes capable of converting said nucleoside or derivative thereof into xNMP, converting said xNMP into xNDP, and converting said xNDP into xNTP; and one or more phosphate donors.

26. A composition comprising an enzyme capable of converting xNMP into xNDP and an enzyme capable of converting xNDP into xNTP.

27. A kit for the preparation of xNTP comprising an enzyme capable of converting xNMP into xNDP and an enzyme capable of converting xNDP into xNTP.

28. The kit of claim 27, wherein said enzyme capable of converting xNMP into xNDP is NMK.

29. The kit of claim 27, wherein said enzyme capable of converting xNDP into xNTP is PYK.

30. The kit of claim 27, wherein said kit further comprises at least one phosphate donor.

31. The kit of claim 27, wherein said kit further comprise substrate into a phosphate donor.