WO2000049147A1 - Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy - Google Patents
Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy Download PDFInfo
- Publication number
- WO2000049147A1 WO2000049147A1 PCT/EP2000/001368 EP0001368W WO0049147A1 WO 2000049147 A1 WO2000049147 A1 WO 2000049147A1 EP 0001368 W EP0001368 W EP 0001368W WO 0049147 A1 WO0049147 A1 WO 0049147A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hormone
- nucleic acid
- factor
- transgene
- composition
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/644—Coagulation factor IXa (3.4.21.22)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21022—Coagulation factor IXa (3.4.21.22)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/30—Vector systems having a special element relevant for transcription being an enhancer not forming part of the promoter region
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
Definitions
- the invention relates to the use of a nucleic acid construct comprising at least one hormone responsive element and a transgene for preparing an agent for gene transfer. It further relates to particular nucleic acid constructs comprising at least one hormone responsive element and a transgene, wherein one of said at least one hormone responsive elements is not functionally linked to the transgene, vectors comprising such nucleic acid constructs and compositions of matter comprising such nucleic acid constructs wherein the hormone responsive elements of the constructs are coupled to a hormone-hormone receptor complex.
- the nucleic acid constructs, plasmids, and compositions of matter of the invention have applications in gene therapy, particularly in the treatment of human blood clotting disorders, such as hemophilia. They may also be used to up- or down-regulate target genes and for the delivery of vaccines.
- Gene therapy is a method that holds great promise for many diseases and disorders. In general, it involves the transfer of recombinant genes or transgenes into somatic cells to replace proteins with a genetic defect or to interfere with the pathological process of an illness. In principle, gene therapy is a simple method. In practice, many disadvantages must still be overcome.
- Viral vectors are currently the widely used vehicles in clinical gene therapy approaches. In terms of efficacy in gene expression, the viral delivery systems have major advantages over techniques using DNA-lipid formulations as delivery vehicles or over mechanical methods, such as the gene gun. Although there are a variety of viral systems tested for gene therapeutical strategies, retroviral vectors and adenoviral vectors are presently the most widely used vehicles (Salmons, B. and Gunzburg, W. H., Hum. Gene Ther., Vol. 4, 129, 1993; Kasahara, N. A., et al., Science, Vol. 266, 1373, 1994; Ali, M., et al., Get7e Ther., Vol.
- AAV adenoassociated virus
- hemophilia A and B are X-linked, recessive bleeding disorders caused by deficiencies of clotting factors VIII and IX, respectively (Sadler, J. E. et al., in : The Molecular Basis of Blood Diseases, 575, 1987).
- the incidence of hemophilia is about 1 in 5,000 male births.
- Hemophiliacs suffer from excessive bleeding due to the lack of clotting at the site of wounds. The inability to clot properly causes damage to joints and internal tissues as well as posing risks to the proper treatment of cuts.
- hemophilia A Treatment of hemophilia A is possible by the administration of the blood clotting factor VIII.
- factor VIII preparations had to be prepared by concentrating blood from donors, posing the risk of contamination by infectious agents, such as HIV and hepatitis.
- the gene for factor VIII has been cloned (e.g., Vehar et al., Nature Vol. 312, 337 1984) allowing for the production of a recombinant product.
- recombinant methods provide factor VIII of higher purity than blood concentrates, the exogenous supply of factor VIII to a patient still requires repeated doses throughout the lifetime of the patient, an inconvenient and expensive solution.
- hemophilia Other forms include hemophilia B, caused by a defect in the gene coding for Factor IX.
- the gene therapy systems described above have been attempted for the treatment of hemophilia A and B with factors VIII and IX, respectively. (See e.g., WO 94/29471). However, these systems have the disadvantages already discussed above.
- the classical model of the action of hormones is based on the concept of binding interaction of the hormone to an intracellular receptor, located in the cytoplasm or the nucleus (Evans, R., Science, Vol. 240, 889, 1988). These intracellular receptors remain latent until exposed to their target hormone. When so exposed, the hormone receptor changes its conformation after the hormone is bound and translocates in the activated form into the cell nucleus where it binds as a dimer to hormone responsive elements in the promoter region of hormone-regulated genes (Beato, M., Cell, Vol. 56, 335, 1989; O ' Malley, B., et al., Biol. Reprod., Vol. 46, 163, 1992).
- the hormone responsive elements are enhancer elements usually located in the 5 ' flanking region of the specific hormone- induced gene, i.e., are functionally linked to the specific hormone induced gene.
- DNA constructs comprising a hormone responsive element and a nucleic acid sequence encoding a protein of interest are disclosed in U.S. Pat. Nos. 5,688,677 and 5,580,722 and are taught to be suitable for expression of the protein of interest.
- Steroid receptors belong to a superfamily of ligand- dependent transcription factors characterized by a unique molecular structure. The centrally located highly conserved DNA-binding domain defines this superfamily. The second important and relatively invariant region is the COOH-terminal ligand-binding domain.
- An example of such a receptor is the progesterone receptor mediated by the steroid progesterone. At the progesterone receptor, progesterone acts as a natural agonist whereas it displays potent antimineralocorticoid properties both at the molecular and the systemic level. Besides classical effects on the uterus, antiepileptic, anxiolytic, hypnotic and anesthetic properties have been attributed to progesterone according to numerous studies.
- mutant hormone receptors including mutant steroid receptors for gene therapy.
- methods are disclosed in WO 93/23431, WO 98/18925, WO 96/40911.
- WO 98/33903 discloses a genetic construct comprising a steroid responsive element from a tissue specific gene, a coding sequence, and an SV40 enhancer.
- the object of the present invention is to overcome the disadvantages of the previous gene therapy delivery systems. It was found that a hormone-hormone receptor complex possesses the ability to drag a nucleic acid construct having one or more hormone responsive element(s) through the cell membrane into a cell. It was also found that if the construct comprises further functional sequences besides the hormone responsive elements (hereinafter "transgenes"), the functional sequences exert their function. The hormone responsive element may also enhance the expression of the transgene. Moreover, it was found that steroid hormones are very effective mediators for the transfer of nucleic acid constructs through the cell membranes into a cell. The present invention thus provides
- HRE hormone responsive element
- the agent further comprises a hormone-hormone receptor complex; (3) a nucleic acid construct comprising at least one HRE and a transgene, wherein one of said at least one HREs is not functionally linked to the transgene;
- composition of matter comprising a nucleic acid construct comprising at least one HRE and a transgene as defined in (3) above and/or a vector as defined in (4) above, said at least one HRE being coupled to a hormone-hormone receptor complex;
- transgene is a gene encoding a blood clotting factor
- the blood clotting factor is factor IX
- (11) a method for preparing the composition of matter as defined in (6) above, which method comprises admixing the nucleic acid construct with the hormone receptor and the hormone; (12) a method for gene transfer which comprises administering the agent as defined in (1) and (2) or the composition of matter as defined in (6) to (9) above to an organism or to a cellular system;
- (13) a method for delivering into an organism or into a cellular system a nucleic acid encoding a transgene to be expressed in the cells of the organism or the cells of the cellular system, which method comprises administering an agent as defined in (1) above or composition of matter as defined in (6) to (9) above to the organism or to the cellular system so that the hormone in the composition interacts with the cell membrane and therewith enhances diffusion and transport of the nucleic acid that is coupled to the hormone- hormone receptor complex across the membrane and into the cell;
- a method of treating hemophilia B comprising administering a therapeutically effective amount of the composition of matter as defined in (8) above to an organism or to a cellular system;
- a method for gene transfer which comprises administering a nucleic acid construct to an organism or to a cellular system, wherein the nucleic acid construct contains a transgene and is encapsulated in a steroid hormone.
- the hormone responsive element is a steroid responsive element (SRE), most preferably a progesterone responsive element (PRE).
- SRE steroid responsive element
- PRE progesterone responsive element
- the receptor preferably is a steroid receptor, most preferably, a progesterone receptor.
- the hormone is preferably a steroid, most preferably, progesterone.
- the present invention thus provides a delivery system for gene therapy that should overcome the prior art disadvantages.
- the presence of the hormone responsive element on the nucleic acid carrying a transgene encourages the binding of a hormone-hormone receptor complex.
- the present invention uses the activated hormone receptor as a link (or binding compound) between the nucleic acid carrying the transgene and the hormone known to interact with the cell membrane.
- the general known biological activity mediated by the HREs is not the primary effect utilized in the present invention, but might be an additional effect when regulation of the transgene is desired.
- the hormone responsive element is preferably present as a nucleic acid dimer sequence or nucleic acid multimer sequence. Even in an inverse orientation, the hormone responsive element will exert its proper function.
- the hormone-hormone receptor complex contains a hormone receptor that becomes activated after binding of its specific hormone.
- the hormone receptor in the activated state is able to recognize and bind to its specific hormone responsive element, which in the present invention is present within the nucleic acid comprising the desired transgene, e.g., a human blood-clotting factor.
- Vaccination is another aspect of the embodiment (12) defined above. Introducing a nucleic acid construct or composition of matter of the invention comprising a gene for an antigen or containing a viral sequence into a cell (DNA vaccines) using the method mentioned above may also provide a way to stimulate the cellular immune response.
- Figure 2 is a diagram of the vector pTGFGl.
- Figure 3 is a diagram of the vector pTGFG5.
- Figure 4 is a diagram of the vector pTGFG20.
- Figure 5 is a diagram of the vector pTGFG33.
- Figure 6 is a diagram of the vector pTGFG36.
- Figure 7 is a diagram of the vector pTGFG53.
- Figure 8 is a diagram of the vector pTGFG64.
- Figure 9 is the DNA sequence of vector pTGFG36 (SEQ ID NO: 1).
- Figure 10 shows the protein sequence of factor IX encoded by vector pTGFG36 (SEQ ID NO: 2).
- Figure 11 shows a GFP concentration curve for cell homogenates after transfection with pTGFG5 and pTGFG20, respectively.
- Figure 12 shows corresponding light (a and c) and fluorescent (b and d) micrographs of HeLa cells transfected with pTGFG5 (a and b) and pTGFG20 (c and d), respectively.
- Figure 13 shows the amount of GFP expressed by utilizing the favoured vectors of the invention in a transfection experiment.
- Figure 14 shows the additive effect of human clotting factor IX on clotting activity of mouse blood.
- Figure 15 hPR (A-form) was expressed in insect cells and purified by cobalt 2 * affinity chromatography as described in Example 5. The final preparation (85 ⁇ g protein) was separated on a denaturing 7,5% SDS- polyacrylamid gel, followed by staining with coomassie ® R250 (lane A) or western blotting with hPR-specific staining (lane C).
- Lane B Molecular mass standard. Arrows indicate the two highly enriched protein species (94 and 74 kDa) accessible to immunodetection.
- Figure 16 Domain structure of hPR-B (numbers on the top of the bar represent amino acid positions within the polypeptide sequence).
- Figure 17 shows the mean values of the difference in the clotting time of Example 9.
- Figure 18 shows the clotting time detected in Example 9.
- Figure 19 shows the activity of human progesterone receptor as determined in Example 8.
- Figure 20 shows the amino acid sequence of the hPR B-Form.
- the start methionine 165 of the hPR A-Form is underlined (SEQ ID NO: 18) .
- Figure 21 shows the nucleic acid sequence of the mRNA coding for hPR.
- the reading frame for the hPR B-form starts at position 176, the reading frame for the hPR A-Form at position 668.
- the respective start codons ATG are underlined (SEQ ID NO: 19).
- the sequences of Figures 20 and 21 are taken from Genbank, accession number AF016381.
- Nucleic acid means DNA, cDNA, mRNA, tRNA, rRNA.
- the nucleic acid may be linear or circular, double-stranded or single- stranded.
- Nucleic acid construct refers to a composite of nucleic acid elements in relation to one another.
- the nucleic acid elements of the construct may be incorporated into a vector in such an orientation that a desired gene may be transcribed, and if desired, a desired protein may be expressed.
- Transgene refers to a functional nucleic acid sequence which is transcriptionally active (with or without regulatory sequences).
- Gene transfer includes “gene therapy”.
- HRE Hetermone responsive element
- DNA DNA
- HREs are typically about 10- 40 nucleotides in length, and more usually, about 13-20 nucleotides in length.
- HREs become activated when a hormone binds to its corresponding intracellular receptor causing a conformational change, so that the receptor has increased affinity for the HRE and binds to it. The HRE, in turn, stimulates transcription.
- SRE steroid responsive element
- SRE is an HRE that regulates transcription of genes in response to steroid activation.
- a “progesterone responsive element” is an HRE/SRE that regulates transcription of genes in response to progesterone activation.
- a “hormone receptor” refers to a receptor which binds to and is activated by a hormone.
- a “steroid receptor” refers to a receptor which binds to and is activated by a steroid hormone.
- a “progesterone receptor” is a receptor which binds to or is activated by the steroid hormone progesterone.
- “Functionally linked” refers to configurations of the nucleic acid construct, where the HRE (or SRE/or PRE) is located within the construct so that it can stimulate transcription of the transgene.
- “Not functionally linked” refers to configurations where the HRE is so remotely located from the transgene that it cannot stimulate its transcription.
- Gene refers to DNA sequence encoding a polypeptide, optionally including leader and trailer sequences and introns and exons.
- Vector refers to any genetic construct, such as a plasmid, phage, cosmid, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells.
- the term includes cloning and expression vehicles.
- Promoter refers to a region of regulatory DNA sequences for the control of transcription of a gene to which RNA polymerase binds. The promoter forms an initiation complex with RNA polymerase to initiate and drive transcription activity. “Enhancers” may activate the complex or “silencers” may inhibit the complex.
- tissue-specific promoter is a promoter found in the DNA of tissue for transcription of genes expressed in this specific tissue.
- Organism refers to a multicellular living entity including vertebrates such as mammals (especially humans, cattle, rodents, dogs) and invertebrates.
- Cellular system includes cell cultures, e.g., primary cell cultures (especially those suitable for reimplantation), stem cells, blood cells, tissue samples and whole organs and immortalized cell cultures.
- “Therapeutically effective dose” of the products of the invention refers to a dose effective for treatment or prophylaxis, for example, a dose that yields effective treatment or reduction of the symptoms of hemophilia. It is also a dose that measurably activates expression of a target gene as determined by measurements of target protein levels, or a dose that is predictable to be effective for treatment or prophylaxis by extrapolating from in vitro or in vivo data. The determination of a therapeutically effective dose is within the purview of one skilled in the art.
- Encodes or “encoding” refers to a property of the nucleic acid sequence of being transcribed (in case of DNA) or translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
- express shall refer to transcription and translation of a gene encoding a protein.
- an object of the present invention is to provide a new and improved delivery system for gene therapy.
- the invention thus provides nucleic acid constructs comprising at least one HRE and a transgene wherein one of said at least one HREs is not functionally linked to the transgene, and compositions of matter comprising such nucleic acid construct wherein said at least one HRE is coupled to a hormone-hormone receptor complex (embodiments (3) and (6) defined above).
- a preferred embodiment of the nucleic acid construct and of the composition of matter of the invention is one where the hormone responsive element is a steroid responsive element (SRE), and the receptor is a steroid receptor.
- SRE steroid responsive element
- the hormone responsive element is a progesterone responsive element (PRE)
- the receptor is a progesterone receptor.
- PRE progesterone responsive element
- the most preferred HRE for the invention is a PRE.
- the preferred PRE is described in Example 1, i.e., is the double stranded DNA sequence comprised of SEQ ID NOs: 3 and 4.
- the nucleic acid for use in the invention comprises at least one hormone responsive element.
- Preferred is a nucleic acid comprising more than one HRE.
- the nucleic acid may comprise three to ten, preferably three to five HREs.
- the most preferred embodiment is a nucleic acid comprising three to five PREs.
- Potential hormone receptors for use in the present invention are, for example, estrogen receptors, mineralocorticoid receptors, glucocorticoid receptors, retinoic acid receptors, androgen, calcitriol, thyroid hormone or progesterone receptors and orphan receptors.
- Such receptors have been previously described. (Green, S., et al., Nature, Vol. 320, 134, 1986; Green, G. L.,et al., Science, Vol. 231, 1150, 1986; Arriza, J. L., et al., Science, Vol. 237, 268, 1987; Hollenberg, S. M., et al., Nature, Vol.
- receptors may be from human or other mammalian sources, although human is preferred.
- Nucleotide and/or amino acid sequences of human steroid receptors are available in the GenBank: mineralocorticoid receptor: M 16801 ; glucocorticoid receptor ⁇ : M10901; glucocorticoid receptor ⁇ 2 : U01351 ; glucocorticoid receptor ⁇ : M 11050; retinoic acid receptor ⁇ : AF088888 (exon 1), AF088889 (exon 2), AF088890 (exon 3), AF088891 (exon 4), AF088892 (exon 5 and 6), AF088893 (exon 7), AF088894 (exon 8), AF088895 (exon 9 and complete cDNA); retinoic acid receptor ⁇ : M24857; androgen receptor: M27423 (exon 1), M27424 (exon 2), M27425 (exon 3), M27436 (exon 4), M27427 (exon 5), M
- telomeres can be achieved by standard methods, e.g. via PCR- cloning of the known cDNAs from cDNA libraries and overexpression of the corresponding proteins in suitable expression vectors, such as, for example, the vectors of the present invention, in suitable host cells, e.g., COS cells.
- suitable host cells e.g., COS cells.
- subsequent purification of the cytosolic fraction can be achieved by routine methods such as affinity chromatography purification.
- various suitable antibodies against the desired receptor are commercially available.
- polyclonal antibodies against the mouse progesterone receptor that have a sufficiently high cross- reactivity for the human protein are available from Dianova (Hamburg, Germany).
- further purification can be achieved by standard methods, e.g., chromatographical methods such as ion-exchange chromatography and/or FPLC.
- the most preferred receptor is the progesterone receptor.
- the receptor is a human progesterone receptor.
- Such a human progesterone receptor (from T47D human breast cancer cells) is disclosed in US Patent No. 4,742,000, and cells expressing this receptor have been deposited (ATCC deposit number HTB, 133). As already described above, it would be routine to purify such a receptor from the cytosol using receptor specific antibodies.
- US Patent No. 4,742,000 discloses a method for purification of the human progesterone receptor using a specific steroid affinity resin (cf. Grandics et al., Endocrinology, Vol. 110, 1088, 1982).
- the cytosolic fraction of the T47D cells is passed over Sterogel, a commercial preparation of deoxycorticosterone coupled to Sepharose ® 2B that selectively binds the progesterone receptor.
- Sterogel a commercial preparation of deoxycorticosterone coupled to Sepharose ® 2B that selectively binds the progesterone receptor.
- the bound receptor is eluted with a buffer containing progesterone.
- the eluted steroid-receptor complex is then chromatographed on DEAE-Biogel and eluted stepwise with a buffer containing 0.2M NaCI.
- the bound progesterone can be readily exchanged.
- further purification can be achieved by routine methods well-known to the skilled person.
- Example 5 The structure of the hPR polypeptide is depicted in Fig. 16.
- the hPR polypeptide is composed of distinct structural domains.
- Naturally the human progesterone receptor (hPR) is expressed as two different sized proteins termed hPR-B (120 kDa) and hPR-A (94 kDa).
- HPR-A is a truncated but otherwise identical form of hPR-B, that is missing 165 the N-terminal amino acids (see Fig. 20, SEQ ID NO: 18). Both forms seems to be indistinguishable regarding their progesterone or DNA binding properties.
- hPR-A and B In human cells the A and B forms of hPR are produced from the same gene by alternate initiation of translation at two different AUG start sites within the same RNA transcript. As it was reported earlier hPR-A and B can be expressed in Spodoptera frugiperda (Sf9) cells as biological fully active polypeptides (Christensen et al., Mol. Endocrinol. 5, 1755ff (1991); Elliston et al., JBC 267, 5193-5198 (1992)).
- the carboxyl terminus of the hPR polypeptide as shown in Fig. 16 comprises a progesterone binding domain (PBD) but also contains sequences responsible for the association with heat shock proteins and receptor dimerization.
- the hinge region provides a flexible link between the DNA-binding domain (DBD) and the PBD but is also thought to contain elements for receptor dimerization as well as nuclear localization. Binding of the hPR to its corresponding target sites at the chromosomal DNA (PREs, Progesterone Responsive Elements) is known to be mediated by the DBD.
- the remaining N- terminal trans-activation domain (TAD) consists of regions specific for the in vivo function of the hPR as a transcriptional gene activator.
- the hPR in embodiments (2) and (6) to (16) of the invention preferably is a PR comprising nucleic acids 557 to 933 of natural hPR shown in SEQ ID NO : 18.
- the third component of the gene transfer system of the invention is the hormone.
- the hormone in the agent of embodiment 2 and in the composition of matter of embodiment (6) include synthetic and natural hormones, preferably steroid hormones, such as estrogen, testosterone, glucocorticoid, androgen, thyroid hormone, and progesterone or derivatives thereof. These are widely available. Progesterone is most preferred.
- natural micronized progesterone is the preferred progesterone from which has been marketed in France since 1980 under the trademark of UTROGESTAN ® and is still available in Germany under the trademark UTROGEST ® . Its properties are similar to the endogenous progesterone, in particular, it has antiestrogen, gestagen, slightly antiandrogen and antimineralocorticoid properties.
- the natural micronized progesterone in said marketed products is dispersed in a matrix as described hereinbelow.
- micronized progesterone has advantages that make it a suitable carrier for genes or nucleic acid constructs to target cells. Specifically, the synergistic effect of the double process of micronization and suspension in long-chain fatty acids residues of an oil results in increasing progesterone absorption. It has been demonstrated that after oral administration of 100 mg of UTROGESTAN ® , peak plasma progesterone levels were obtained after 1-4 hours in most cases (Padwick, M. L., et al., Fertil. Steril., Vol. 46, 402, 1986). Later on, the levels declined substantially, although they were still elevated at 12 hours. Even at 84 hours the levels were slightly higher than baseline. A U.S.
- progesterone As a carrier is the low level of disadvantageous side effects. Orally administered progesterone adversely affects neither plasma lipids (Jensen, J. et al., Am. J. Obstet. Gynecol., Vol. 156, 66, 1987) nor carbohydrate metabolism (Mosnier-Pudar, H. et al., Arch. Mai.
- progesterone does not affect liver enzymes (ASAT, ALAT, AFOS), sex-hormone binding-globulin (SHBG) synthesis or HDL- cholesterol levels at daily doses of 200 mg and 300 mg.
- ASAT liver enzymes
- ALAT ALAT
- AFOS sex-hormone binding-globulin
- HDL- cholesterol levels at daily doses of 200 mg and 300 mg.
- the plasma levels of deoxycorticosterone may increase substantially during UTROGESTAN ® treatment, there are strong indications that the mineralocorticoid effects of this progesterone metabolite are completely counteracted by the anti-mineralocorticoid effects of progesterone itself. This is apparent from a comparative study (Corvol, P., et al., In: Progesterone and progestins. Raven Press, New York, 179, 1983) in which oral UTROGESTAN ® was capable of antagonizing the mineralocorticoid effects of 9- ⁇ -fluor
- SRE/or PRE within the nucleic acid construct to hormone receptor is preferably from 1 : 1 to 1 : 10, more preferably from 1 :2 to 1 :5.
- the molar ratio of hormone to hormone receptor is preferably at least 1000: 1, more preferably at least 10000: 1.
- the hormone is present in a large excess relative to the hormone receptor and the HRE, which is desirable in view of the ability of the hormones to transfer nucleic acid constructs through cell membranes.
- the agent and the composition, especially the hormone component thereof may contain other components capable of assisting in introducing the nucleic acid into a cell for the purpose of gene therapy (matrix compounds).
- the agent and the composition, especially the hormone component thereof may contain the following matrix compounds: glucose and related compounds (such as D-sorbitol, D- mannitol); solubilizing adjuvants (such as alcohols, e.g., ethanol); polyhydric compounds such as glycerine, polyethylene glycol and polypropylene glycol; nonionic surface active compounds, ionic surface active compounds such as lecithin; oily compounds such as sesame oil, peanut oil soybean oil, corn oil, etc.; starches and their derivatives such as cyclodextrines and hydroxyalkylated starches; stabilizers such as human serum albumin, preservatives such as benzyl alcohol and phenol; and the like.
- matrix compounds glucose and related compounds (such as D-sorbitol, D- mannitol); so
- the preferred matrix contains ⁇ -cyclodextrine, glycerine, lecithin and/or corn oil.
- the pharmaceutical composition of hormone-hormone receptor nucleic acid complex of the invention may be provided orally to humans or animals as a gelatin capsule.
- Progesterone therein preferably in micronized form
- the pharmaceutical composition when - due to the selection of appropriate matrix components - the pharmaceutical composition is in a pasty, gel-like form, it may be provided topically.
- the nucleic acid construct of embodiments (1) to (16) of the present invention may - aside from the transgene and the HREs, SREs, or PREs already disclosed above - further contain promoter, enhancer, and/or silencer sequences.
- the promoter may be ubiquitous or tissue-specific. Of the ubiquitous promoters, the CMV promoter is most preferred. However, a tissue-specific promoter is preferred over a ubiquitous promoter.
- the tissue-specific promoters envisioned for the instant invention include ⁇ i-antitrypsin (further promoters).
- the nucleic acid construct may further comprise additional sequences such as the ampicillin resistance gene.
- the nucleic acid construct may further contain inducible promoters such as, for example, a MMTV (Mouse Mammary Tumor Virus) promoters inducible via glucocorticoides and Ecdyson-inducible insect promoters.
- GFP green fluorescent protein
- CAT chloramphenicolacetyltransferase
- a preferred nucleic acid construct contains sequentially from the 5' to the 3' end: a PRE, a CMV promoter, a gene of interest, SV40 Intron and SV40 poly A enhancer sequence, and an ampicillin resistant gene. Further PREs are evenly distributed on the vector backbone.
- the nucleic acid construct may further contain origin of replication sequences (especially eukariotic origin of replication sequences), elements for gene targeting, integrational sequences (e.g., AAV-ITR, transposon IS), 3'-UTR, "switch” systems (e.g., TET system, Cre/loxP or Flp/ftr system).
- origin of replication sequences especially eukariotic origin of replication sequences
- elements for gene targeting e.g., AAV-ITR, transposon IS
- 3'-UTR e.g., "switch” systems (e.g., TET system, Cre/loxP or Flp/ftr system).
- the transgene may be chosen from those encoding proteins lacking in a variety of genetic disorders or involved in conditions related to inappropriate responses to hormones, for example, hormone-dependent cancers such as breast, ovarian, and endometrial cancers and prostate cancer.
- the transgene may also be used to replace a defective gene resulting in such genetic disorders as hemophilia, von Willebrand disease, and cystic fibrosis.
- the transgene includes mutations of such gene or a gene encoding a fusion product.
- the nucleic acid construct of the present invention may comprise more than one transgene.
- the transgene may replace genes for a blood clotting factor, and preferably a human blood-clotting factor.
- the genes encoding factor VIII and factor IX (sown in Fig. 2, SEQ ID NO: 2), involved in hemophilia A and B, respectively, are good candidates for the invention.
- Other candidates include the gene encoding von Willebrand factor, factor IV, factor X, or protein C.
- hormone genes such as the genes encoding for insulin, parathyroid hormone, luteinizing hormone releasing factor (LHRH), ⁇ and ⁇ seminal inhibins and human growth hormone
- hormone receptor genes such as the glucocorticoid receptor, the estrogen receptor, the progesterone receptor, the retinoic acid receptor
- growth factors such as vascular endothelial growth factor (VEGF), nerve growth factor, epidermal growth factor
- enzyme genes genes encoding cytokines or lymphokines such as interferons, granulocytic macrophage colony stimulating factor (GM-CSF), colony stimulating factor-1 (CSF-1), tumor necrosis factor (TNF), and erythropoietin (EPO); genes encoding inhibitor substances such as ⁇ i-antitrypsin, and genes encoding substances that function as drugs, e. g., genes encoding the diphteria and cholera toxins, ricin or cobra
- nucleic acid constructs of embodiment (3) of the present invention are vectors comprising the nucleic acid constructs of embodiment (3) of the present invention.
- These vectors may be used in the composition matter of embodiment (6) of the present invention.
- the nucleic acid sequence for use in the invention is circular rather than linear.
- the vectors may be capable of expressing the nucleic acid in the nucleic acid construct transiently or permanently (including episomally).
- the nucleic acid construct therein may further contain additional elements.
- the composition of matter of embodiment (6) of the invention can be prepared by admixing the nucleic acid construct with the hormone receptor and the hormone.
- an aqueous solution of nucleic acid construct was added to the oily suspension containing the hormone at ambient temperature under stirring.
- Embodiment(s) of the invention relates to transfected and transformed cells or transgenic organism comprising these vectors and/or nucleic acid constructs.
- a transfected cell is one in which foreign DNA has been incorporated.
- Methods of transfection may include microinjection, CaPO 4 precipitation, electroporation, liposome fusion, or gene gun.
- Transformation refers to introducing genetic material into a cell, such as the vectors or nucleic acid constructs of the invention, rendering the cell transiently or permanently altered so that the cell expresses a specific gene product or is otherwise altered in its expression. Transformation may be achieved by in vivo or in vitro techniques, although in vivo transformation is preferred.
- a further embodiment of the present invention is pharmaceutical compositions comprising a therapeutically effective dose of the nucleic acid constructs of the invention and a hormone.
- the hormone is preferably a steroid, and most preferably, progesterone, as described above.
- the dose is dependent on the condition to be treated, the characteristics of the patient, and the result sought to be achieved. Determining dosage is within the realm of the skilled artisan.
- the pharmaceutical composition (or, alternatively, the composition of matter, the nucleic acid construct, or the vector) of the present invention may be administered orally, intravenously, intramuscularly, subcutaneously, topically, through mucosa (including buccal, nasal spray) or by gene gun. Oral administration (of a micronized hormone dispersion) is preferred. Delivery may be systemic or directed at certain tissue.
- the invention further includes a method of introducing into a cell a nucleic acid construct encoding a gene of interest, e.g., a human blood-clotting factor, to express the blood-clotting factor in the cell.
- a nucleic acid construct comprising at least one hormone responsive element (HRE), preferably a progesterone responsive element.
- HRE hormone responsive element
- the mixture of nucleic acid bound to the hormone-hormone receptor complex together with an excess of hormone, preferably progesterone, will be used to introduce the nucleic acid into a cell by various methods known to the skilled artisan and outlined above.
- the cell-uptake will be stimulated by the interaction of the hormone with the cell membrane.
- the hormone or steroid interacts with the ITpid bilayer of the cell membrane not only through membrane perturbation but also through activation of certain hormone- or steroid-sensitive membrane receptors. This has been demonstrated for progesterone and other steroids. Last but not least, it is known that hormones are able to cross the cell membrane by diffusion. In the present invention, the nucleic acid bound to the hormone-hormone receptor complex should be transported through the membrane during the process of diffusion or uptake.
- Another aspect of the invention is a method of treating a blood clotting disorder by administering a therapeutically effective amount of the composition of matter of the invention to an organism. This method involves the administration and dosage considerations already discussed.
- Embodiments (17) and (18) of the invention pertain to the use of a steroid hormone for preparing an agent for gene therapy and/or gene transfer and to method for gene therapy and/or gene transfer which comprises administering a nucleic acid construct to an organism or to a cellular system, wherein the nucleic acid construct contains a transgene and is encapsulated in a steroid hormone.
- Suitable steroid hormones are enumerated hereinafter.
- the preferred steroid hormone in said embodiments of the invention is a natural micronized steroid hormone, in particular a natural micronized progesterone.
- the micronized hormone is solubilized/dispersed in a lipophilic matrix as described hereinafter.
- the vector pUC19 (MBI Fermentas) was digested with Xbal, treated with Klenow enzyme and religated.
- This Xbal deleted vector was then digested with EcoRI, treated with
- Another Xbal-site was inserted by digesting the newly produced vector with Hindlll, treating it with Klenow, dephosphorylating it with alkaline phosphatase and ligating it with the
- Xbal-linker CTCTAGAG Biolabs #10312. This vector was named pUC19/X.
- this vector was digested with Xbal, treated with Klenow enzyme and religated resulting in the vector pGFP/0.
- a 2.3 kb fragment containing the GFP-Gene was isolated after digesting pGFP/0 with Mlul, treating it with Klenow enzyme and digesting it with BamHI. This fragment was inserted into the multiple cloning site of the vector pUC19/X which was digested with Sail, treated with Klenow enzyme and digested with BamHI.
- the resulting vector was named pTGFGl ( Figure 2). Starting with this vector all the vectors described in Table 1 were obtained. At the restriction sites for Pstl, Kpnl, Ehel, EcoO109 and/or Sapl a PRE(ds) was inserted giving rise to plasmids carrying the GFP gene and up to five PREs. By exchanging the GFP gene with a FIX gene a set of FIX expression plasmids were obtained. By excising the GFP gene the cloning vectors without a transgene were obtained.
- PRE-AS (5'-GGG GTA CCA GAA CAT GAT GTT CTA GCT ACG AAG CTG ATA TCC CAG AAC ATG ATG TTC TAG CTA CGA AGC TGG TAC CCC-3'; SEQ ID NO: 4) were hybridized and phosphorylated by kinase reaction, resulting in the insert PRE(ds).
- the vector pTGFGl was digested with EcoO109I, treated with Klenow enzyme and dephosphorylated with alkaline phosphatase. It was then ligated with the PRE(ds) insert, resulting in the vector pTGFG5 ( Figure 3), i.e., a vector which carries a PRE at position C of Fig. 2.
- the vector pTGFGl was digested with Kpnl, treated with T4-polymerase and dephosphorylated with alkaline phosphatase. It was then ligated with the PRE(ds) insert, resulting in the vector pTGFG7.
- This vector pTGFG7 was digested with Pstl, treated with T4-polymerase and dephosphorylated with alkaline phosphatase. It was then ligated with the PRE(ds) insert, resulting in the vector pTGFGll.
- pTGFGl l was digested with EcoO109I, treated with Klenow enzyme and dephosphorylated with alkaline phosphatase. It was then ligated with the PRE(ds) insert, resulting in the vector pTGFG20 ( Figure 4).
- This vector carries a PRE at positions A, B and D of Fig. 2.
- the vector pUC19 (MBI Fermentas) was digested with Sail, treated with Klenow enzyme and dephosphorylated with alkaline phosphatase. It was ligated to the Notl-linker GCGGCCGC (Biolabs # 1045), resulting in the vector pUC19/N.
- This fragment was ligated to the 4.3 kb fragment of the Hindlll and Notl double-digested vector pTGFG5 resulting in the vector pTGFG36 shown in Figure 6.
- This vector is a preferred one for delivery of Factor IX into the cell, and its DNA sequence is provided in Figure 9 (SEQ ID NO: 1).
- plasmids pTGFG53 and pTGFG64 were obtained by exchanging the GFP gene in plasmids pTGFG20 and pTGFG33 by the FIX gene.
- Production of the insert ALLGfds The oligonucleotides (Metabion) ALLG1/1 (5'-AGC TTG ACC TCG AGC AAG C-3') (SEQ. ID NO: 5) and ALLG2 (5'-GGC CGC TTG CTC GAG GTC A-3') (SEQ. ID NO: 6) were hybridized and phosphorylated by kinase reaction, resulting in the inserts ALLG(ds).
- the insert ALLG (ds) was constructed to introduce into the vector of choice a sequence with a multiple cloning site for the possible introduction of other transgenes.
- Table 1 gives an overview of the available vectors with different transgenes and a different number of PREs in various positions. The positions of the PREs are given according to Figure 2. For the underlined vectors a map is provided ( Figures 3 to 8).
- Factor IX cDNA was amplified from human liver cDNA (Clontech) using two primers overlapping the start and termination codon of the factor IX open reading frame resulting in a 1387 bp fragment containing the entire open reading frame. Restriction sites for EcoRI (upstream) and BamHI (downstream) were included at the end of each primer to facilitate cloning.
- Amplification was performed with Pwo polymerase (Boehringer Mannheim) in 50 ml reaction volume [10 mM Tris HCI pH 8.85, 25 mM KCI, 5 mM (NH 4 ) 2 SO 4 , 2 mM MgSO 4 ] with 30 incubation cycles at 96°C for 1 min, 60°C for 1 min, 72°C for 2 min, followed by a final extension step at 72°C for 10 min.
- Pwo polymerase Boehringer Mannheim
- Reaction products were ligated into the EcoRI- and BamHI-sites of pUC19 and transformed into E. coli DH5-a. Positive clones were selected. Sequences were confirmed by cycle sequencing (Amersham) from both ends with labeled primers (IR-700) and automated analysis on the LiCor sequencing system (MWG, Biotech). The following primers were used : GGAATTCCGCAAAGGTTATGCAGCGCGTGAACATGATCATGGC (upstream; SEQ. ID NO : 7)
- Method 1 HeLa cells were transfected by electroporation with plasmids pTGFG5 or pTGFG20. Transfected cells were harvested and the cell pellets were homogenized and lysed in a buffer containing phosphate buffered saline (pH 7.5) and 10 mM PMSF. The concentration of green fluorescent protein (GFP) in the cell homogenate was determined by competitive ELISA.
- GFP green fluorescent protein
- GFP was coated in a defined concentration on microtiter plates. Then, GFP samples were added in the presence of anti-GFP antibody. After several washing steps a labeled secondary antibody was added in order to trace the first antibody. The colorimetric reaction was measured photometrically (extinction). Generally, the more GFP was added the less antibody was left to bind the coated GFP. Thus, reduction of extinction corresponded to higher GFP concentration in the sample.
- FIG. 12 a-d show micrographs of HeLa cell cultures transfected with pTGFG5 (Fig. 12 a and b) and pTGFG20 (Fig. 12 c and d), respectively.
- Figures 12 a and c represent light microscopic views as controls, and Fig. 12 b and d show the corresponding cell patches in the fluorescent mode. Routinely, more than 50% of the cells expressed GFP, indicating very efficient transfection, the presence of only one PRE showing more efficient expression.
- Method 2 293 T cells were transfected with pTGFG 5, 20 and 33 using calcium phosphate method and fluorescence was detected with a fluorimeter (Labsystems, Extinction : 485 nm Emission: 520 nm). In the case of the mock transfection, non GFP-expressing DNA was used. Background indicates the fluorescence of the empty plate (96-well plate, Dynex, Immulon-4). The results are summarized in Fig. 13. Again the vector with just one PRE (pTGFG5) shows the highest expression.
- HeLa cells were transfected either by electroporation or using liposome reagent DOTAP (Boehringer Mannheim) with plasmids pTGFG36, pTGFG53 and pTGFG64. These plasmids contain the cDNA of human clotting factor IX. Recombinant human factor IX was secreted into the supernatant of the cell culture and quantified using a sandwich ELISA method.
- Cloning of the human progesterone receptor The cloning was performed as follows: Total human RNA was isolated from human white blood cells or liver cells using cell lysis in guanidinium hydrochloride buffer and CsCI-density centrifugation. For cloning of the hPR coding sequence, hPR specific cDNA was prepared and used for amplification of the hPR coding sequence in two fragments by PCR.
- oligonucleotide primers were selected based on the published mRNA sequence (Genbank: NM_000926 and X51730). Oligonucleotides used were obtained from MWG, Ebersberg or Metabion, M ⁇ nchen. All primers used are listed 5' to 3', bases added to introduce restriction sites are in capital letters and restriction sites used for cloning are underlined.
- hPGR-5'-primer CGA GGA tec agt cgt cat gac tga gc (SEQ ID NO: 9); hPGR-3'-primer: GCA GAA TT cat tat aaa aac tea aga cct cat aat cct gac (SEQ ID NO: 10); hPGR-internal primer (Sal I) 1 : etc etc ggg qtc gac cct gg (SEQ ID NO: ii); hPGR-internal primer (Sal I) 2: cca ggg teg ace ccg agg ag (SEQ ID NO: 12).
- Synthesis of cDNA was perfomed using 3 ⁇ g of total RNA and 200 pmol of the 3'-primer with Superscript II reverse transcriptase (Gibco BRL). Reaction volume was 50 ⁇ l and buffer was used as recommended, supplemented with RNase Inhibitor and 10 mM DTT and 1 mM dNTPs. Before adding the enzyme, samples were heated to 80°C for 10 min, followed by 10 min at 72°C and 10 min at 42°C. Superscript II RT was added at 42°C and reaction was continued for 15 min at 42°C, 15 min at 50°C and 1 h at 58°C.
- the cDNA obtained from this synthesis reaction was used to amplify the hPGR coding sequence in two fragments by PCR.
- Reaction setup in 50 ⁇ l was : Pwo polymerase (Roche Diagnostics), buffer as supplied by Roche Diagnostics, supplemented with DMSO, 50 pmol of each primer and 0.2 mM dNTPs. Reaction conditions were: 10 min 96°C followed by 35 cycles of 1 min 96°C, 2 min at 59°C, 2 min 72°C and a final extension step at 72°C for 10 min.
- PCR-products were purified by gel electrophoresis and digested with Sal I.
- the BamHI and Hind III sites introduced in the primer were not used to avoid cutting at two internal restriction sites of the hPR coding sequence. Both fragments were ligated into pBluescript SK+ vector cut with EcoRV through blunt end ligation into the vector and sticky end ligation through the internal Sal I site.
- Vectors containing the appropriate insert were identified by mini-prep, restriction digest and sequencing. The obtained vector was designated pTGhPRl. 2.
- hPR-B inclusive its 3 ' -UTR was cut out from pTGh PR1 and cloned in frame in the multiple cloning site of the expression plasmid pFASTBAC HTc (BAC- to-BAC Bacuiovirus Expression System, Life Technologies). This resulted in an expression casette of a N-terminally histidine-tagged version of hPR-B under expression control of the viral polyhedrin promotor as shown below.
- a rTEV protease cleavage site is located between the six histidine residues and the initial methionine of the hPR-B reading frame, which allows removal of the histidine residues from the expressed protein.
- the N-terminal region of the expression cassettes is shown below.
- the DNA sequence encoding for the amino acids between Met 1 and Met 165 of the hPR-B form was removed using a PCR-based strategy.
- Two primer pairs were designed which allowed amplification of either a DNA fragment just downstream of the start AUG of the hPR-B gene and a DNA-fragment just upstream of the AUG coding for Met 165, respectively.
- these two DNA fragments were annealed to each other at their homologous 3'-ends, and amplified using the outermost amplification primers.
- the resulting DNA-fragment was digested by EcoRI and Mlu I and the cleavage product was exchanged against the corresponding fragment of the hPR-B expression cassette in the pFASTBAC HTc vector. Thereby the reading frame coding for an N-terminal histidine tagged version of the hPR-A polypeptide (94kDA) was restored.
- This 6xHis-tag was utilised for affinity purification of the protein by immobilized cobalt 2+ affinity chromatography on a TALON ® resin (Clontech).
- the procedure following the method of Boonyaratanakornkit et al. Mol. Cell. Biol.18, 4471 (1998), was as follows (all steps were carried out at 0 to 8°C) : Sf9 cells were cultivated in monolayer culture in serum free SF900 medium. Viral infection of the cells was done at a multiplicity of infection (MOI) of 5-8.
- MOI multiplicity of infection
- the harvesting was done 48 hours after infection with baculovirus containing the hPR expression cassette and lysed mechanically by homogenising in buffer A containing 20 mM Tris-CI pH 8.0, 350 mM NaCI, 10 mM imidazol, 5% glycerol and a cocktail of proteinase inhibitors (CompleteTM EDTA-free, Roche Diagnostics, Penzberg, Germany). After a 10 min centrifugation at 10000 x g, supernatant originating from 10 8 cells was incubated for 1 h with 0,5 ml settled TALON ® resin equilibrated in buffer A. TALON ® was washed with 20 volumes of buffer A.
- hPR-A was eluted with 10 Vol buffer B, containing all ingredients of buffer A, but 100 mM imidazol. The eluate was concentrated 50-fold and dialysed against 100 volumes buffer C (PBS + 100 nM progesteron) by centrifugal ultrafltration at a molecular exclusion size of 10 kDa (Centricon Plus-20 PL-10, Miliipore, Eschborn, Germany).
- hPR-A Determination of identity, purity and yield of hPR-A: Purity and yield of the product were determined by application on denaturing reducing polyacrylamid- gelelectrophoresis according to Laemmli, U. et al., Nature 227, 680-685 (1970) and subsequent staining with coomassie ® blue R250. By this one-step procedure hPR-A was enriched to a final specific hPR content of 0.2 - 0.5 mg hPR/mg protein. As depicted in Figure 15, lane A, the final preparation consisted predominantly of two distinct protein species displaying apparent molecular masses of 94 and 74 kDa (Fig. 15, arrows).
- Yield was estimated by parallel separation of standardised protein preparations. Data taken from a set of three separate experiments hint at a typical yield of 30 ⁇ g enriched hPR A-receptor per 10 8 cells. Identity of hPR was determined by immunodetection of the product transferred to nitrocellulose by western blotting with mouse monoclonal antibodies directed against recombinant hPR (PR Ab-1, Oncogene, Cambridge, MA, USA).
- the final product was transferred to nitrocellulose BA-83 and immunostained as described above. As presented in Figure 15, lane C, three major protein bands were detected, including the two dominant protein species described above. The smaller sized bands may display copurified proteolytic fragments of hPR.
- a concentration range of 55 - 95 ng/ml human clotting factor IX has been reached by transfection of 293 T-cells with plasmids containing human factor IX-cDNA (pTGFG 36, 53, 64 and 2) in 11 different experiments using ELISA (Example 4).
- Clotting activity was deterined with a partial thromboplastin time assay using Cephalin (phosphatidyl ethanolamine) activation with a manual coagulation instrument (ML-2, Instrumentation Laboratories).
- Clotting activity was determined with a partial thromboplastin time assay using Cephalin (phosphatidyl ethanolamine) activation with a manual coagulation instrument (KC 4 A, Amelung).
- mice blood 5 ⁇ l mouse blood, 20 ⁇ l deficiency plasma (Progen) ad 100 ⁇ l physiological NaCI and 100 ⁇ l DaPPTin (Progen) were incubated for 2 minutes at 37°C. Coagulation was started by adding 100 ⁇ l CaCI 2 .
- ELISA The addition of human clotting factor IX to the mouse blood was monitored by ELISA as described in Example 4. Citrate plasma was made out of mouse blood and human clotting factor IX was added in different concentrations.
- Transfections were performed by the calcium phosphate method using 2 ⁇ g of a pSG- hPRl constructt and pMTV-luc (Hollenberg et al., 1985, Cell 55, p899- 906) per well.
- One day after transfection the cells were washed in PBS and the luciferase expression assayed with the Berthold luciferase kit according to the manufacturer's directions in a fluorimeter (Labsystems).
- the controls were as follows: R5020 was omitted (PR+MTV) and both plasmids alone were transfected with (PR+R5020, MTV+R5020) and without R5020 (PR, MTV).
- PR, MTV a plasmid with a CMV-driven luciferase gene was transfected (pCMV- luc).
- the object of this pilot study is to prove oral gene transfer in an in vivo animal experiment.
- Successful gene transfer is established by coagulation measurement: an additive effect of 5 expressed human factor IX on the coagulation time of healthy murine whole blood is expected.
- the presence of expression of human factor IX in mouse blood is quantitated by ELISA.
- mice 35 male C57BL/6J mice from Iffa lo Credo, France, with an initial age of 9 weeks and a weight of 23-33 g.
- the mice are kept in groups of 7 animals each in conventional test animal cages with wooden chips in the Institut f ⁇ r Experimentelle Onkologie und Therapieutz der Technischen Universitat M ⁇ nchen. is The animals are fed ad libitum with "Altrum Ratten und Mause
- Haltung and are given tap water, also ad libitum.
- test animal cages are kept at an ambient temperature of 19- 24°C and a humidity of 55 5%.
- the room is additionally provided with an automatic light supply which maintains a 12 hours rhythm.
- the test animals are supervised by specialized staff.
- Esophageal sound Vein catheter, diam. 0.5 x 0.9 mm,
- mice were divided into 5 groups of 7 mice each.
- One group serves as a control
- the second group was daily administered a total of 100 ⁇ l of hormone and plasmid via the gastrointestinal tract orally with an esophageal sound
- the third group was daily administered a total of 100 ⁇ l of plasmid with aqua dest. orally with an esophageal sound
- the fourth group was administered a total of 50 ⁇ l of plasmid with aqua dest. i.m. into the musculus quadriceps femoris
- the fifth group was daily administered a total of 100 ⁇ l of hormone, hormone receptor and plasmid orally with an esophageal sound.
- mice were prewarmed under a red light. Immediately before, during and after the manipulation, the mice were examined and supervised by a veterinarian. Blood sampling from the mice was performed daily from the caudal artery of animals slightly sedated by inhalation anesthesia. For this purpuse the artery was punctured with a disposable injection cannula (0.90 x 40 mm). Whole blood welling out of the puncture site (5 ⁇ l of blood) was immediately collected with an Eppendorf pipette. Without further delay, the blood coagulation time in seconds was determined using an Amelung-Koagulometer KC 4A by means of an aPTT assay (activated partial thromboplastin time). The blood coagulation analysis was always performed by the same person. Immediately after the blood sampling, the bleeding was stopped by compression.
- mice Sedation of the mice was achieved by inhalation anesthesia (active substance: isoflurane: Forene , Abbott GmbH, 65205 Wiesbaden, Western Germany) in a whole body chamber.
- active substance isoflurane: Forene , Abbott GmbH, 65205 Wiesbaden, Western Germany
- the daily manipulation was performed through an overall period of 7 days. This was followed by a day (day 8 of experiment) without any manipulation, and at day 9 of experiment, again 5 ⁇ l of whole blood was withdrawn from the ventral caudal artery under anesthesia, and the coagulation time established as described above.
- 0.5- 0.75 ml of whole blood was collected intracardially using U-40 insulin syringes (Mikro-Fine 12.4 mm) filled with 50-75 ⁇ l of sodium citrate (3.1%), transferred into Eppendorf cuvettes, and about 100 ⁇ l of whole blood with citrate was reserved for PCR examination and stored in a cool environment.
- the remaining citrate blood was centrifuged for 10 min using a centrifuge 6000 rpm, 4°C, at 5000 rpm, and the plasma was recovered for the ELISA determination of the factor IX concentration.
- mice were sacrificed using 0.5 ml Narkoren i.p. Immediately after the sacrificing, the animal bodies were dissected. The following organs were removed from the mice for an immunohistochemical examination: brain, spleen, liver, kidneys, testes, lungs, m. quadriceps femoris, heart, appendix; and frozen at -80°C.
- Deviation from the scheduled experimental course Due to the poor general condition of the mice in the course of the long-term administration series, the administration had to be interrupted at days 3 (except one mouse) and 5 for test group 2 (hormone and plasmid), at days 3 and 5 for group 5 (hormone, hormone receptor and plasmid), and two mice were additionally spared the administration of the reagents at days 2 and 7 of the experiment.
- the poor general condition is accounted for by the hypnotic effect of the hormone progesterone. It causes the mice to sleep for about 24 hours without eating and drinking. This again has an adverse effect on the water balance of the mice, resulting in exsiccotic phenomena and apathic behavior.
- mice were prophylactically treated with a subcutaneous administration of 1 ml of 5% glucose solution (Delta Pharma GmbH, 72793 Pfullingen) and 1 ml of Ringer solution (Delta Pharma GmbH, 72793 Pfullingen) when the hormone was administered orally.
- a subcutaneous administration of 1 ml of 5% glucose solution (Delta Pharma GmbH, 72793 Pfullingen)
- 1 ml of Ringer solution (Delta Pharma GmbH, 72793 Pfullingen)
- Figure 17 shows the mean values of the calculated differences: In the control, for example, this difference was about 50 seconds.
- the vertical lines show plus and minus one standard deviation from these values.
- the T test is based both on the differences between the mean values and on the degree of overlapping which can be seen from these lines: The larger the overlapping, the less is the significance of the mean value differences.
- the groups "control” and "plasmid and water i.m.” (groups 1 and 5, respectively) are distinguished in a purely numerical way in the mean value, but the degree of overlapping is so high that these groups are not significantly different.
- the human F IX was also detectable in the treated mice of the "hormone-hormone reception and plasmid orally group using an Elisa as described in Example 4.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pulmonology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002362970A CA2362970A1 (en) | 1999-02-19 | 2000-02-18 | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy |
JP2000599872A JP2002537311A (en) | 1999-02-19 | 2000-02-18 | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy |
AU28061/00A AU780854B2 (en) | 1999-02-19 | 2000-02-18 | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy |
EP00906356A EP1151099A1 (en) | 1999-02-19 | 2000-02-18 | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12084899P | 1999-02-19 | 1999-02-19 | |
DE19907099.7 | 1999-02-19 | ||
US60/120,848 | 1999-02-19 | ||
DE1999107099 DE19907099A1 (en) | 1999-02-19 | 1999-02-19 | Novel nucleic acid construct useful in gene therapy comprising an hormone responsive element and transgene in which the hormone responsive element is not functionally linked to the transgene |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000049147A1 true WO2000049147A1 (en) | 2000-08-24 |
Family
ID=26051947
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2000/001368 WO2000049147A1 (en) | 1999-02-19 | 2000-02-18 | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1151099A1 (en) |
JP (1) | JP2002537311A (en) |
AU (2) | AU780854B2 (en) |
CA (1) | CA2362970A1 (en) |
NZ (1) | NZ513595A (en) |
WO (1) | WO2000049147A1 (en) |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1136553A1 (en) * | 2000-03-22 | 2001-09-26 | Octagene GmbH | Production of recombinant blood clotting factors in human cell lines |
WO2001070968A2 (en) * | 2000-03-22 | 2001-09-27 | Octagene Gmbh | Production of recombinant blood clotting factors in human cell lines |
EP1180364A1 (en) * | 2000-08-15 | 2002-02-20 | Octagene GmbH | Steroid hormones as transfer agents |
EP1188770A1 (en) * | 1999-06-14 | 2002-03-20 | Fujimori Kogyo Co., Ltd. | Substance binding to the substrate of activated blood coagulation factor in competition with this factorto thereby regulate the r eaction between the activated blood coagulation factor and the substrate, a process for producing the substance and blood coagulation factor-adsorbent with the use of the |
WO2002028175A2 (en) * | 2000-10-03 | 2002-04-11 | Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) | Transgenic mouse for targeted recombination mediated by modified cre-er |
WO2003000847A2 (en) * | 2001-06-22 | 2003-01-03 | Greenville Hospital System | Membrane associated progesterone receptor |
US7091030B2 (en) | 2001-12-12 | 2006-08-15 | Kerrie Setiawan | Composition for the preservation of viruses |
EP1692936A1 (en) * | 2000-10-03 | 2006-08-23 | GIE-CERBM, Centre Europeen de Recherche en Biologie et en Médecine | Method for targeted conditional DNA recombination in mice using the cre-ert2 fusion protein |
EP2258860A1 (en) | 2005-03-29 | 2010-12-08 | Octapharma AG | Method for isolation of recombinantly produced proteins |
US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
US11344608B2 (en) | 2014-11-12 | 2022-05-31 | Ucl Business Ltd | Factor IX gene therapy |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993020218A1 (en) * | 1992-03-30 | 1993-10-14 | Connaught Laboratories Limited | Synthetic eukaryotic promoters containing two inducible elements |
WO1993023431A1 (en) * | 1992-05-14 | 1993-11-25 | Baylor College Of Medicine | Mutated steroid hormone receptors, methods for their use and molecular switch for gene therapy |
WO1994017182A1 (en) * | 1993-01-26 | 1994-08-04 | The Research Institute Of The Palo Alto Medical Foundation | The l-plastin promoter region and its uses |
WO1994028150A1 (en) * | 1993-05-21 | 1994-12-08 | Mcgill University | Expression vectors responsive to steroid hormones |
WO1994029471A1 (en) * | 1993-06-10 | 1994-12-22 | Genetic Therapy, Inc. | Adenoviral vectors for treatment of hemophilia |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994018172A1 (en) * | 1993-02-01 | 1994-08-18 | Yoshitomi Pharmaceutical Industries, Ltd. | Imidazolylbenzene compound and use thereof as medicine |
-
2000
- 2000-02-18 JP JP2000599872A patent/JP2002537311A/en active Pending
- 2000-02-18 WO PCT/EP2000/001368 patent/WO2000049147A1/en not_active Application Discontinuation
- 2000-02-18 AU AU28061/00A patent/AU780854B2/en not_active Ceased
- 2000-02-18 EP EP00906356A patent/EP1151099A1/en not_active Withdrawn
- 2000-02-18 CA CA002362970A patent/CA2362970A1/en not_active Abandoned
- 2000-02-18 NZ NZ513595A patent/NZ513595A/en unknown
-
2005
- 2005-02-28 AU AU2005200908A patent/AU2005200908A1/en not_active Abandoned
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993020218A1 (en) * | 1992-03-30 | 1993-10-14 | Connaught Laboratories Limited | Synthetic eukaryotic promoters containing two inducible elements |
WO1993023431A1 (en) * | 1992-05-14 | 1993-11-25 | Baylor College Of Medicine | Mutated steroid hormone receptors, methods for their use and molecular switch for gene therapy |
WO1994017182A1 (en) * | 1993-01-26 | 1994-08-04 | The Research Institute Of The Palo Alto Medical Foundation | The l-plastin promoter region and its uses |
WO1994028150A1 (en) * | 1993-05-21 | 1994-12-08 | Mcgill University | Expression vectors responsive to steroid hormones |
WO1994029471A1 (en) * | 1993-06-10 | 1994-12-22 | Genetic Therapy, Inc. | Adenoviral vectors for treatment of hemophilia |
Non-Patent Citations (5)
Title |
---|
BEATO M ET AL: "Transcriptional regulation by steroid hormones", STEROIDS: STRUCTURE, FUNCTION, AND REGULATION,US,ELSEVIER SCIENCE PUBLISHERS, NEW YORK, NY, vol. 61, no. 4, 1 April 1996 (1996-04-01), pages 240 - 251, XP004026583, ISSN: 0039-128X * |
BEATO M: "GENE REGULATION BY STEROID HORMONES", CELL,US,CELL PRESS, CAMBRIDGE, NA, vol. 56, no. 3, 10 February 1989 (1989-02-10), pages 335 - 344, XP000051659, ISSN: 0092-8674 * |
CROSSLEY M. ET AL: "Recovery from hemophilia B Leyden: An androgen-responsive element in the factor IX promoter.", SCIENCE, (1992) 257/5068 (377-379)., XP002139582 * |
KURACHI S. ET AL: "Regulatory mechanism of human factor IX gene: Protein binding at the Leyden-specific region.", BIOCHEMISTRY, (1994) 33/6 (1580-1591)., XP002139581 * |
V. BOONYARATANAKORNKIT ET AL.: "High-mobility group chromatin proteins 1 and 2 functionally interact with steroid hormone receptors to enhance their DNA binding in vitro and transcriptional activity in mamalian cells", MOL. CELL. BIOL., vol. 18, no. 8, August 1998 (1998-08-01), ASM WASHINGTON, DC,US, pages 4471 - 4487, XP002139580 * |
Cited By (26)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1188770A1 (en) * | 1999-06-14 | 2002-03-20 | Fujimori Kogyo Co., Ltd. | Substance binding to the substrate of activated blood coagulation factor in competition with this factorto thereby regulate the r eaction between the activated blood coagulation factor and the substrate, a process for producing the substance and blood coagulation factor-adsorbent with the use of the |
EP1188770A4 (en) * | 1999-06-14 | 2004-03-24 | Fujimori Kogyo Co | Substance binding to the substrate of activated blood coagulation factor in competition with this factorto thereby regulate the r eaction between the activated blood coagulation factor and the substrate, a process for producing the substance and blood coagulation factor-adsorbent with the use of the |
EP1460131A2 (en) * | 2000-03-22 | 2004-09-22 | Octagene GmbH | Production of recombinant blood clotting factors in human cell lines |
WO2001070968A2 (en) * | 2000-03-22 | 2001-09-27 | Octagene Gmbh | Production of recombinant blood clotting factors in human cell lines |
WO2001070968A3 (en) * | 2000-03-22 | 2001-12-13 | Octagene Gmbh | Production of recombinant blood clotting factors in human cell lines |
EP1136553A1 (en) * | 2000-03-22 | 2001-09-26 | Octagene GmbH | Production of recombinant blood clotting factors in human cell lines |
HRP20020767B1 (en) * | 2000-03-22 | 2011-09-30 | Octapharma Biopharmaceuticals Gmbh | Production of recombinant blood clotting factors in human cell lines |
US7572619B2 (en) | 2000-03-22 | 2009-08-11 | Octagene Gmbh | Recombinant blood clotting factors |
EP1460131A3 (en) * | 2000-03-22 | 2005-06-01 | Octagene GmbH | Production of recombinant blood clotting factors in human cell lines |
EP1180364A1 (en) * | 2000-08-15 | 2002-02-20 | Octagene GmbH | Steroid hormones as transfer agents |
WO2002013791A2 (en) * | 2000-08-15 | 2002-02-21 | Octagene Gmbh | Steroid hormones as transfer agents |
WO2002013791A3 (en) * | 2000-08-15 | 2003-02-13 | Octagene Gmbh | Steroid hormones as transfer agents |
WO2002028175A2 (en) * | 2000-10-03 | 2002-04-11 | Association Pour Le Developpement De La Recherche En Genetique Moleculaire (Aderegem) | Transgenic mouse for targeted recombination mediated by modified cre-er |
US7112715B2 (en) | 2000-10-03 | 2006-09-26 | Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) | Transgenic mouse for targeted recombination mediated by modified Cre-ER |
WO2002028175A3 (en) * | 2000-10-03 | 2003-01-09 | Ass Pour Le Dev De La Rech | Transgenic mouse for targeted recombination mediated by modified cre-er |
EP1692936A1 (en) * | 2000-10-03 | 2006-08-23 | GIE-CERBM, Centre Europeen de Recherche en Biologie et en Médecine | Method for targeted conditional DNA recombination in mice using the cre-ert2 fusion protein |
WO2003000847A2 (en) * | 2001-06-22 | 2003-01-03 | Greenville Hospital System | Membrane associated progesterone receptor |
WO2003000847A3 (en) * | 2001-06-22 | 2003-03-13 | Greenville Hospital System | Membrane associated progesterone receptor |
US7091030B2 (en) | 2001-12-12 | 2006-08-15 | Kerrie Setiawan | Composition for the preservation of viruses |
EP2258860A1 (en) | 2005-03-29 | 2010-12-08 | Octapharma AG | Method for isolation of recombinantly produced proteins |
US9388402B2 (en) | 2005-03-29 | 2016-07-12 | Octapharma Ag | Method for improved isolation of recombinantly produced proteins |
EP3467116A1 (en) | 2005-03-29 | 2019-04-10 | Octapharma AG | Method for isolation of recombinantly produced proteins |
US10626431B2 (en) | 2005-03-29 | 2020-04-21 | Octapharma Ag | Method for improved isolation of recombinantly produced proteins |
US11344608B2 (en) | 2014-11-12 | 2022-05-31 | Ucl Business Ltd | Factor IX gene therapy |
US10842885B2 (en) | 2018-08-20 | 2020-11-24 | Ucl Business Ltd | Factor IX encoding nucleotides |
US11517631B2 (en) | 2018-08-20 | 2022-12-06 | Ucl Business Ltd | Factor IX encoding nucleotides |
Also Published As
Publication number | Publication date |
---|---|
CA2362970A1 (en) | 2000-08-24 |
JP2002537311A (en) | 2002-11-05 |
AU780854B2 (en) | 2005-04-21 |
NZ513595A (en) | 2001-09-28 |
AU2806100A (en) | 2000-09-04 |
EP1151099A1 (en) | 2001-11-07 |
AU2005200908A1 (en) | 2005-03-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2005200908A1 (en) | Hormone-hormone receptor complexes and nucleic acid constructs and their use in gene therapy | |
US7053062B2 (en) | Compositions and methods for inducing gene expression | |
US5756264A (en) | Expression vector systems and method of use | |
WO2006076288A2 (en) | Dna constructs for long-term expression of intravascularly injected naked dna | |
JPH09509049A (en) | Tissue-specific enhancer active in the prostate | |
CA2297375A1 (en) | Ghrh expression system and methods of use | |
JP2002502608A (en) | Vessel endothelial cell growth factor, a proangiogenic factor: a variant of VEGF | |
KR20210009317A (en) | Gene therapy for diseases caused by unbalanced nucleotide pools, including mitochondrial DNA depletion syndrome | |
US6875569B2 (en) | Modified lepidopteran receptors and hybrid multifunctional proteins for use in transcription and regulation of transgene expression | |
US5439824A (en) | Increased expression of α-1-antitrypsin in expression vectors through the inclusion of intron II | |
US7074399B2 (en) | Treatment of inflammation with p20 | |
KR20020038589A (en) | Nucleotide Sequences for Gene Regulation and Methods of Use Thereof | |
JP2004500884A (en) | Methods and means for regulating gene expression | |
US6110702A (en) | PSA positive regulating (PSAR) sequences and uses thereof | |
EP1594549B1 (en) | Hypoxia inducible vegf plasmid for ischemic disease | |
JP2004500879A (en) | Renal regulatory elements and methods of their use | |
US20240011040A1 (en) | Salicylic acid-inducible gene expression compositions and systems for cells | |
CA2236332A1 (en) | Treatment of diabetes with a glucokinase gene | |
WO2000024759A1 (en) | Systemic delivery of gene products via skin | |
JP2001504683A (en) | Gene expression in monocytes and macrophages | |
US6030638A (en) | Plasmid for in vivo expression of prostaglandin synthase | |
WO2021209941A1 (en) | Use of an orphan motif to increase expression of a heterologous transgene | |
WO2021158982A2 (en) | Targeted translation of rna with crispr-cas13 to enhance protein synthesis | |
AU1737899A (en) | Adenoviral transfer vector for the gene transport of a DNA sequence | |
DE19907099A1 (en) | Novel nucleic acid construct useful in gene therapy comprising an hormone responsive element and transgene in which the hormone responsive element is not functionally linked to the transgene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 28061/00 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2362970 Country of ref document: CA Kind code of ref document: A Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 513595 Country of ref document: NZ Ref document number: 2000906356 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2000 599872 Country of ref document: JP Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2000906356 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWG | Wipo information: grant in national office |
Ref document number: 28061/00 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000906356 Country of ref document: EP |