WO2000039275A2 - Multiple shear stress responsive elements (ssre) and methods of use thereof - Google Patents

Multiple shear stress responsive elements (ssre) and methods of use thereof Download PDF

Info

Publication number
WO2000039275A2
WO2000039275A2 PCT/IL1999/000702 IL9900702W WO0039275A2 WO 2000039275 A2 WO2000039275 A2 WO 2000039275A2 IL 9900702 W IL9900702 W IL 9900702W WO 0039275 A2 WO0039275 A2 WO 0039275A2
Authority
WO
WIPO (PCT)
Prior art keywords
shear stress
vector
stress response
response element
pdgf
Prior art date
Application number
PCT/IL1999/000702
Other languages
French (fr)
Other versions
WO2000039275A3 (en
Inventor
Nitzan Resnick
Original Assignee
Florence Medical Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/220,510 external-priority patent/US6440726B1/en
Application filed by Florence Medical Ltd. filed Critical Florence Medical Ltd.
Priority to EP99961261A priority Critical patent/EP1141266A4/en
Priority to JP2000591168A priority patent/JP2002533113A/en
Priority to AU17954/00A priority patent/AU1795400A/en
Publication of WO2000039275A2 publication Critical patent/WO2000039275A2/en
Publication of WO2000039275A3 publication Critical patent/WO2000039275A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/02Non-specific cardiovascular stimulants, e.g. drugs for syncope, antihypotensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/001Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination

Definitions

  • This invention provides expression vectors comprising multiple shear stress responsive elements and a gene of interest or nucleic acid encoding the protein or peptide of interest. Further, this invention provides methods to monitor shear stress activities, to screen and select for target genes and methods of identifying and describing genes which are differentially expressed in disease states. Lastly, this invention provides methods for methods for treating disorders by introducing the vector into the vasculature which has hemodynamic forces such as fluid shear stress forces; diagnostic methods for monitoring of patients undergoing clinical evaluation for the treatment of disease and for the identification, monitoring and therapeutic use of compounds as treatments of disease.
  • vasculogenesis the establishment of vascular network during embryogenesis from multipotential mesanchymal progenitors
  • angiogenesis the sprouting of existing blood vessels which occurs both in the embryo and in the adult (1-5).
  • Endothelial cells are the major players in both processes, they migrate and proliferate and then assemble into tubes with tight cell-cell connections. Peri-endothelial cells are recruited to support the endothelial tube, providing maintenance and modulatory functions to the vessel. These cells are perycytes in the capillaries, smooth muscle cells in larger vessels and cardiac mycocytes in the heart.
  • VEGF Vascular Endothelial Growth factor
  • Angiopeitin 1 and 2 and their receptor Tiel and 2
  • bFGF Basic Fibroblast Growth Factor
  • PDGF Platelet derived Growth factor
  • TGF Transforming Growth Factor
  • angiopoietin 1 and 2 were disrupted (10-14), endothelial cells organized into a tube shape, but failed to recruit the periendothelial cells.
  • endothelial cells In mature blood vessels, endothelial cells, by virtue of their unique anatomical position, are constantly exposed to the fluid mechanical forces generated by the flowing blood (See, William R. Milnor in Chapter 6 entitled “The Normal Hemodynamic State” of the book entitled “Hemodynamics”, published by Williams & Wilkins, Maryland (1989) and US Patent Nos. 5199298, 5052228 and 4926696 for measuring shear stress.
  • hemodynamic forces which include hydrostatic pressure, cyclic strain and frictional wall shear stress, constitute a special category of physical stimuli that, in addition to better characterized biochemical stimuli, can elicit important biological responses in the cells that compose the blood vessel wall (23).
  • ischemic foot (as a result of femoral artery occlusion) where collaterals develop in both ischemic and more distant non-ischemic regions (34).
  • ischemic foot (as a result of femoral artery occlusion) where collaterals develop in both ischemic and more distant non-ischemic regions (34).
  • angiogenesis often involves massive sprouting of the already existing vessels, which is accompanied by the regression of some of the newly formed tubes (21,22). Is this balance (formation versus regression) affected by changes in the rate and pattern of blood flow through these newly formed tubes?
  • This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide.
  • the genes code for transcription factors, cell cycle proteins, signaling molecules, degrading proteins, transmembrane protein, enzyme, secreted factors, growth factor, angiogenic factor, or thrombogenic factor. It is contemplated herein, that the vector comprises one or a multiple number of genes.
  • This invention provides a method for detecting shear stress or a shear stress related condition in a subject, comprising administering to the subject an amount of the vector which comprises one or more Shear Stress Response Element (SSRE) and a gene of interest coupled to the SSRE, wherein the gene is activated in a shear stress environment, thereby detecting shear stress or a shear stress related condition in the subject.
  • SSRE Shear Stress Response Element
  • This invention provides methods to monitor shear stress activities, to screen and select for target genes and methods of identifying and describing genes which are differentially expressed in disease states, relative to their expression in normal, or non disease states and a method for the identification and therapeutic use of compounds as treatments of the disease.
  • this invention provides methods for the diagnostic monitoring of patients undergoing clinical evaluation for the treatment of diseases, such as cardiovascular, neoplastic, vascular associated_ diseases, and for monitoring the efficacy of compounds in clinical trials.
  • This invention provides gene therapy methods for treating disorders related to or associated with vasculogenesis and/or angiogenesis by introducing the vectors described herein in the vasculature having hemodynamic forces such as fluid shear stress forces.
  • Hemodynamic forces which include hydrostatic pressure, cyclic strain, and frictional wall shear stress, play an important role in the formation and maturation of blood vessels by regulating endothelial genes through Shear Stress Responsive Elements (SSRE) in promoters of endothelial shear stress responsive genes.
  • SSRE Shear Stress Responsive Elements
  • the vectors provided herein are useful as acting as agents or in combination with other therapeutic agents for inhibiting, stimulating, regulating and/or modulating a variety of cellular processes (e.g., vasculogenic, angiogenic -related and/or metabolic-related processes).
  • This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide.
  • SSRE Shear Stress Response Elements
  • the promoter Shear Stress Response Elements are nucleic acid sequences from regulatory elements of growth factors, thrombogenic factors or angiogenic genes.
  • This invention provides for a vector which comprises a multiple number of Shear Stress Response Elements which binds to NFKB, NFAT, SP1, or Egrl and/or Shear Stress Response Element which comprises a binding site for fos, jun, or SP1.
  • the vector comprises a gene of interest or a nucleic acid encoding one or more transmembrane proteins, enzymes, secreted factors, or a gene coding for any protein. Further, the vector may comprises a reporter gene, or a selection marker.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier.
  • SSRE Shear Stress Response Elements
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Sheaf Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier.
  • SSRE Sheaf Stress Response Elements
  • This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the Shear Stress Response Element
  • This invention provides a method of modulating vascular permeability in a mammal, comprising administering to said mammal an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier; or a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Element
  • This invention provides a method of stimulating the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby stimulating the formation, maturation or regression of blood vessels.
  • SSRE Shear Stress Response Elements
  • This invention provides a method of inhibiting the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the
  • This invention provides a method of modulating genes or proteins involved in a diseases which comprises administering to a subject with the disease an effective amount of the pharmaceutical compositions and/or vectors described, above, wherein the pharmaceutical composition or vector is administered to the subject in the vasculature with the proviso that the vasculature has shear stress, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby modulating genes or proteins involved in the vascular diseases.
  • a method of down regulating angiogenesis comprising administering to the subject an amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature with the proviso that the
  • the present invention relates to a method for revascularization of ischemic tissues, development of collateral vessels and improvement of function in peripheral and myocardial ischemic tissue and enhancing the level of perfusion of blood to a target tissue. Also, the present invention relates to a method for treating a target tissue suffering from or at risk of suffering from ischemic damage, and a method of inducing angiogenesis in a target tissue.
  • This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein SSRE is two or more or a combination of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear " Stress Response Element TRE and Shear Stress Response Element SP1 , such that the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby
  • This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide, wherein the SSRE is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SP1, and Shear Stress Response Element TRE, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
  • SSRE Shear Stress Response Element
  • PDGF-B Shear Stress Response Element PDGF-B
  • Shear Stress Response Element SP1 Shear Stress Response Element SP1
  • Shear Stress Response Element TRE Shear Stress Response Element transcriptionally regulate endothelial cell gene expression
  • This invention provides a method of stimulating angiogenesis comprising contacting the cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide, wherein the SSRE is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SP1, and Shear Stress Response Element TRE, thereby stimulating angiogenesis.
  • SSRE Shear Stress Response Element
  • PDGF-B Shear Stress Response Element PDGF-B
  • Shear Stress Response Element SP1 Shear Stress Response Element SP1
  • Shear Stress Response Element TRE Shear Stress Response Element TRE
  • This invention provides a method for screening test compounds for the ability to regulate endothelial cell expression or angiogenesis and/or vasculogenesis comprising: (a) contacting a endothelial cells with the compound to be tested; (b) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the test compound; (c) stimulating endothelial cells by introduction of the vector provided herein; (d) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the vector; (e) comparing the amount of angiogenesis and/or vasculogenesis produced as a result step (b) to that of step (d), wherein an increased amount of expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis of the test compound means that the test compound regulates endothelial cell expression angiogenesis and/or vasculogenesis.
  • Figure 1 Schematic of a SSRE hybrid promoter vector named pGL2 -promoter vector (5789 bases) comprising one of the following: NR1/2+NR3/4; NR1/2; or
  • NR3/4 promoter, poly(A) signal and a reporter gene.
  • NR1/2 comprises nucleic acid sequences of two (2) PDGF-B SSRE, a Sp-1, and TRE, while
  • NR3/4 comprises nucleic acid sequences of Sp-l/Egr-1 and TRE.
  • Figure 2 Schematic of a SSRE hybrid promoter vector named pGL3-enahncer vector (5255 bases) comprising one of the following: NR3/4 and NR1/2+ NR3/4, poly(A) signal and a reporter gene.
  • shear stress responsive promoter elements Several novel shear stress response elements have been defined herein, that bind endothelial cells transcription factors which are activated by shear stress forces.
  • "synthetic" shear stress responsive elements have been constructed containing SSREs which have been tested under laminar shear stress regimes and patterns.
  • Shear stress includes pulsatile, turbulent, oscillatory, disturbed LSS, shear stress gradients.
  • shear stress is important modulators of cellular functions in many tissues and particular important in the cardiovascular system to maintain homeostasis of blood vessels.
  • shear stress is a laminar steady state force, different than those acting at the branch points of the blood vessels.
  • complex shear stresses are involved in the development of cardiovascular diseases such as atherosclerosis and hypertension. Development of such pathologies are thought to be initiated by function/dysfunction of vascular endothelial cells.
  • the vascular endothelium constitutes the interface between the blood and the vessel wall, as such, it is exposed to mechanical forces produced by the arterial pressure variations during the cardiac cycle, and i.e., the blood flow induced wall shear stress and the circumferential cyclic stretch of the whole vessel wall.
  • Blood flow interaction with the vascular endothelium represent a specialized example of mechanical regulation of cell function that has important physiological and pathological consequences. Blood flow plays an important role in the morphogenesis of blood vessels, for instance increase in blood flow induces dilation of the blood vessels while decrease in blood flow cause reduction in blood vessel diameter.
  • Vessel remodeling occurs in response to both biochemical and biomechanical stimuli, and has been shown to be dependant on the presence of an intact endothelial layer.
  • endothelial cells are constantly exposed to hemodynamic forces generated by the flowing blood, forces that consist of fluid shear stress, cyclic strain and pressure. These forces affect endothelial cells structure and function, changes that are often mediated by the induction or shut-off of endothelial genes.
  • This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide.
  • the genes code for transcription factors, cell cycle proteins, signaling molecules, degrading proteins, transmembrane protein, enzyme, secreted factors, growth factor, angiogenic factor, or thrombogenic factor. It is contemplated herein, that the vector comprises multiple genes.
  • the vector comprising a nucleic acid or gene coupled to the SSRE which encodes a peptide or protein. Any gene or nucleic acid encoding a protein or peptide may be used. In one embodiment the nucleic acid or gene which encodes a peptide or protein which is angiogenic and/or vaculogenic. Angiogenic genes and proteins are known to those skilled in the art.
  • the nucleic acids encodes the following proteins or growth factors: NFkB, MCP-1, NFAT, spl/Egr 1, c-fos, c-jun, c-myc, PDGF A, PDGF B, TM, b-FGF, TGF, eNOS, HO-1, cu/Zn SOD, VCAM-1, I-CAM, Connecxin 43, FLT-1 , FLK-1, VCAM, PGI synthase, smad 6, smad 7, TGF.
  • proteins or growth factors include NFkB, MCP-1, NFAT, spl/Egr 1, c-fos, c-jun, c-myc, PDGF A, PDGF B, TM, b-FGF, TGF, eNOS, HO-1, cu/Zn SOD, VCAM-1, I-CAM, Connecxin 43, FLT-1 , FLK-1, VCAM, PGI synthas
  • HB-EG CNP COX-2, thrombospondin, ICAM, ELAM-1, cyclooxygenase, angiopeitin 1, tenscin, angiopeitin 2, laminin Bl, IL-1, 11-2, 11-3, 11-4, 11-4, IL-6, 11-7, 11-8, 11-9. 11-10, 11-1 1 , 11-12, ACE , ICE, Vascular Endothelial Growth Factor (VEGF) Genbank Accession Nos: 2851617, 1718152, 137821. 3402014, 3402011, 3402013, 3402010.
  • VEGF Vascular Endothelial Growth Factor
  • PLGF-l/PLGF-2 Placenta Growth Factor 1 and 2 Genbank Accession No: 1709656, EPAS-1 Genbank Accession No:391429, EEGIR-3 Genbank Accession No. 1718189, FLT-1 Genbank Accession No.
  • EDRF Endothelin-Derived Relaxin Factor
  • HGF/SF hepatocyte growth factor/Scatter factor
  • PD-ECGF Platelet Derived Endothelial Cell Growth Factor
  • uPA Urokinase Plasminogen Activator
  • Cartillage Type II Collagen a tumor suppressor gene, tyrosine kinases, or serine kinases.
  • the vector comprises alleles, alternative-splicing products, analogs, fragments, isoenzymes, mimetics, mutants, synthetic forms or variants of the nucleic acid. Additional genes, proteins are described in U.S.
  • the angiogenic genes or proteins include natural and recombinant forms of a variety of peptides, e.g. growth factors and related molecules which are able to promote endothelial and smooth muscle cell proliferation leading to the formation of new blood vessels (angiogenesis).
  • This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of. or activity of the protein or peptide,.
  • This invention contemplates molecules which inhibit trans acting factors from combining with the promoter of endogenic gene. For example, by creating a promoter which contains target elements for binding trans acting factors which will then compete for these trans acting factors.
  • the Shear Stress Response Elements (SSRE) of the vectors described herein are from regulatory elements of growth factors, thrombogenic factors or angiogenic genes.
  • the vector may comprises a reporter gene, or a selection marker.
  • the nucleic acids are in a sense orientation. In another embodiment the nucleic acids are in a sense or an anti-sense orientation. Each of the nucleic acids may be in a 5' to 3' direction in the vector or may be in a 3' to 5' direction in the vector.
  • Shear Stress Response Element or “SSRE” means a nucleic acid from the regulatory elements of genes which regulates endothelial genes through shear stress forces.
  • the gene may encode for growth factors, thrombogenic factors or angiogenic genes.
  • a SSRE is an element necessary and/or sufficient to induce (or suppress) gene expression in endothelial cells exposed to shear stress.
  • the vector comprises a single nucleic acid of the SSRE or multiple SSREs.
  • the vector comprises the Shear Stress Response Element PDGF-A.
  • the vector comprises the Shear Stress Response Element PDGF-B.
  • the vector comprises the Shear Stress Response Element TRE.
  • the vector comprises the Shear Stress Response Element SPl. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element PDGF-B. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element TRE. In another embodiment the vector comprises the Shear Stress Response Element PDGF-B and the Shear Stress Response Element TRE. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element SPl. In another embodiment the vector comprises the Shear Stress Response Element PDGF-B and the Shear Stress Response Element SP 1.
  • the vector comprises multiple number of SSREs.
  • the vector comprises the Shear Stress Response Element are Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE.
  • the Shear Stress Response Elements are Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE
  • the Shear Stress Response Elements are Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl .
  • this invention provides for a vector which comprises a mutiple number of different combinations of the Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE including but not limited to multiple combinations of each SSRE.
  • this invention provides for a SSRE which binds to NFKB, NFAT, SPl, or Egrl. Further, this invention provides for a nucleic acid of a regulatory element or region which contains one or more the SSRE. This invention provides for SSRE which are binding sites for fos, and jun.
  • SSRE PDGF-A means a Platelet Derived Growth Factor- A which comprises the nucleic acid sequence as follows: GGGGGCGGGGGCGGGGG (SEQ ID NO. 1).
  • SSRE PDGF-B means a Platelet Derived Growth Factor- B which comprises the nucleic acid sequence as follows: GAGACC (SEQ ID NO. 2).
  • SSRE TRE means a nucleic acid which has the following sequence TGACTCC (SEQ ID NO. 3).
  • SSRE SPl means a nucleic acid which has the following sequence GGGGCGGGCGG (SEQ ID NO. 4).
  • the vector comprises the following nucleic acid sequence CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCT (SEQ ID NO 5).
  • the vector comprises the following nucleic acid sequenceTCGAGGGGGGCGGGGGCGGGGGGGTGACTCCGAGACCCCCACCCCCCG CCCCCGCCCCCACTGTGGCTCTGGGGGTCTAG (SEQ ID NO 6).
  • the vector comprises the following nucleic acid sequence CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCTTCGAGGGGGGCGGGGGC GGGGGTGACTCCGAGACCCCCACCCCCCGCCCCCCCCCCCACTGTGGCTCTG GGGGTCTAG (SEQ ID NO 7).
  • SSREs of the promoter elements from genes that are regulated by shear stress include but are not limited to: Human 15-lipoxygenase gene, Genebank Accession No. U88317 at position 3350..3355, Kritzik,M.R., Ziober.A.F., Sigal,E. and Conrad.D.J., Biochim. Biophys. Acta (1997); Protein Kinase, Genbank Accession No. 2992634, Donadelli,R., Benatti,L., Remuzzi ., Morigi M., Gullans,S.R., Benigni,A., Remuzzi,G. and Noris,M. Biochem. Biophys. Res. Commun.
  • FEG-1 gene which is expressed by vascular endothelial cells under shear stress., Genbank Accession No. El 3350 and 3023539; Endothelin-converting enzyme (ECE-1) gene, Genbank Accession No. X91923 at position 233..238, Valdenaire,O, J. Biol. Chem. 270 (50), 29794-29798 (1995); and Beta-tubulin folding cofactor D, Genbank Accession No.
  • AJ006417 PGI synthetase; conexin 43; c-myc; c-fos; c-jun; TGF; FGF; FGF; HO-1 ; Thrombomodulin; Tl rombospondin; Laminin Bl ; Mn/Cu/Zn SOD; ICAM-1 ; Endothlin-1 ; plasminogen activator 1 ; MADH dehydrogenase; acidic and basic fibroblast growth factors; vascular endothelial growth factors 1, 2, 3, A, B, C, and D; epidermal growth factor; transforming growth factors alpha and beta; tumor necrosis factor alpha; hepatocyte growth factor; vascular endothelium growth factor, EEGIR-3, FLT-1.
  • VEGF vascular endothelial growth factor
  • ESA computer analysis and electromobility shift assays
  • the vector further comprising a reporter gene.
  • Reporter genes are known to those skilled in the art.
  • the vector may comprise the reporter gene with an SSRE without any additional nucleic acid which encodes a gene of interest or may include the nucleic acid which encodes a gene of interest.
  • reporter genes include but are not limited to: ⁇ -lactamase and other antibiotic resistant gene, a cell surface marker as HC I or II sub-types, a receptor for growth factor or cell adhesion and any gene of interest for therapeutic reasons.
  • the vector may comprise a marker inserted may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like.
  • the selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal . These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include those described by Okayama, Molec. CelZ. Biol. 3:280(1983).
  • the transcribed gene under the SSRE can be also a gene that confirm resistant to a specific antibiotic as a selection marker in prokaryotes and eukaryotes cells (neomycin, tetracycline. kanamycine and other).
  • the gene can be also a membrane protein as a screening marker (MHC I or II sub-type or other transmembrane protein as a receptor);
  • the gene can be also encoding for a protein in an individual carrying a genetic defective gene product to be complement for therapeutic reasons.
  • the gene can be also a secreted protein (enzymes or growth factors) that can be monitored by an external or internal biosensor.
  • One attractive gene to be driven by SSRE is a gene encoding a secreted protein with an enzyme activity that can be monitored with a biosensor.
  • This protein can be driven by the second unit of a bicistronic massage driven by SSRE to give low amount of gene products, however indicative of the SSRE activity.
  • For in-vivo gene delivery one can follow the activity of the second cistron to monitor on site (in-vivo) the first cistron.
  • the second cistron include but not limited to lactate dehydrogenase, creatinase, esterase, alcohol dehydrogenase, all of which have characterized substrates and chemical reactions, and also enzymatic biosensor for such enzyme activities have been demonstrated in the art.
  • a biosensor can be introduced in vivo to monitor SSRE activities for drug delivery or to be an indicative parameter of fluid shear stress.
  • the SSRE vector could have one or more transcriptional units. For example, it can have an antibiotic selection marker and a Luciferase gene to monitor SSRE activity.
  • the SSRE transcription unit can be monocistronic or bicistronic transcription unit, having IRES elements between the two genes.
  • the SSRE vector can be used for selection of agonists and antagonists ligands, to shear stress signaling, from combinatorial peptide or antibody phage display libraries, for therapeutic means.
  • natural inhibitors or stimulators from body fluids or other natural extracts
  • this system can be used as an inducible system, to induce gene only when shear stress is applied. The methods described herein, provide functional screening (SSRE activity monitoring) and screening for target drug or target gene.
  • Shear Stress Response Elements include but are not limited to, cDNA, DNA, fragments, variants, mutants, alleles, synthetic forms, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art so long as the SSRE retains its function, i.e. regulation of endothelial genes by shear stresses.
  • Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties, intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
  • the nucleic acid may be modified.
  • Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art.
  • a variety of methods for labeling and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as sup 32 P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand.
  • the choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation.
  • This invention provides screening for mutation within the gene of interest coupled to the SSRE sequences so as to identify sequences with stronger SSRE- activity as shear stress dependent transcription sequences.
  • the SSRE sequences may be screened for more potent binding proteins, as well for compounds that enhance or inhibit protein binding to SSRE for therapeutic means.
  • nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”) and antisense, ribozyme, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA, RNA, and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • a "recombinant DNA” is a DNA that has undergone a molecular biological manipulation.
  • nucleic acid encoding refers to a nucleic acid molecule or gene which directs the expression of a specific protein or peptide.
  • the nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein.
  • the nucleic acid molecule include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
  • Substantial identity or “substantial sequence identity” mean that two sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap which share at least 65-99 percent sequence identity, share at least 75 percent sequence identity, share at least 80 percent sequence identity, share at least 90 percent sequence identity, preferably at least 95 percent sequence identity, more preferably at least 99 percent sequence identity or more.
  • This invention provides for a replicable vector comprising the isolated nucleic acid molecule.
  • the vector includes, but is not limited to: a plasmid, cosmid, phage or yeast artificial chromosome (YAC) which contains at least a portion of the isolated nucleic acid molecule.
  • insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then ligated together with DNA ligase.
  • linkers can be ligated to the insert DNA which correspond to a restriction site in the vector DNA, which is then digested with the restriction enzyme which cuts at that site.
  • Other means are also available and known to an ordinary skilled practitioner.
  • vector refers to viral expression systems, autonomous self-replicating circular DNA (plasmids), and includes both expression and nonexpression plasmids. Where a recombinant microorganism or cell culture is described as hosting an "expression vector,” this includes both extrachromosomal circular DNA and DNA that has been incorporated into the host chromosome(s). Where a vector is being maintained by a host cell, the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is incorporated within the host's genome.
  • Expression vectors which can be used other than adenovirus include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus, swinepox virus, pox virus, rhabdovirus, herpes simplex virus, baculovirus, herpes simplex virus, adeno-associated virus, retrovirus, cytomegalovirus, human cytomegalovirus, papillomavirus, Epstein Barr virus (EBV), mouse mammary tumor virus (MMTV), Moloney murine leukemia virus and plasmid and cosmid DNA vectors, to name but a few.
  • human or animal viruses such as vaccinia virus, swinepox virus, pox virus, rhabdovirus, herpes simplex virus, baculovirus, herpes simplex virus, adeno-associated virus, retrovirus, cytomegalovirus, human cytomegalovirus, papillomavirus, Epstein
  • the adenoviral vector is deficient in at least one essential gene function of the El region of the adenoviral genome, particularly the Ela region, more preferably, the vector is deficient in at least one essential gene function of the El region and part of the E3 region (e.g., an Xbal deletion of the E3 region) or, alternatively, the vector is deficient in at least one essential gene function of the El region and at least one essential gene function of the E4 region.
  • Aadenoviral vectors deficient in at least one essential gene function of the E2a or E2b region and adenoviral vectors deficient in all of the E3 region also are contemplated here and are well known in the art.
  • the viral vector's coat protein can be modified so as to incorporate a specific protein binding sequence.
  • plasmid refers to an autonomous circular DNA molecule capable of replication in a cell, and includes both the expression and nonexpression types. Where a recombinant microorganism or cell culture is described as hosting an "expression plasmid", this includes latent viral DNA integrated into the host chromosome(s). Where a plasmid is being maintained by a host cell, the plasmid is either being stably replicated by the cells during mitosis as an autonomous structure or is incorporated within the host's genome.
  • a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG.
  • a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome.
  • Such vectors may be obtained commercially or assembled from the sequences described by methods well-known in the art, for example the methods described above for constructing vectors in general.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in • a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5 * direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
  • An "expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence.
  • a coding sequence is "under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • a nucleic acid sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence.
  • the term “operatively linked” includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
  • viral promoters include but are not limited to the following: ventricular myocyte specific promoter, cytomegalovirus, human cytomegalovirus, inflammatory promoters, TNF promoter, Rous Sarcoma Virus, Prostate Specific Antigen, Probasin, Immunoglobulin Heavy Chain, Immunoglobulin Light Chain, T-Cell Receptor, HLA, Interferon, Interleukin-2, Interleukin-2 Receptor, MHC Class II, Actin, Muscle Creatine Kinase, Proalbumin (Transthyretin), Elastase I, Metallothionein, Collagenase, Albumin Gene, Fetoprotein, Globin, c-fos, c-Ha-ras, Insulin, Neural Cell Adhesion Molecule (NCAM), antirypole, 2B (TH2B) Histone, Muse or Type I Collagen, Glucose
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier.
  • SSRE Shear Stress Response Elements
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier.
  • SSRE Shear Stress Response Elements
  • Shear Stress Response Elements are from promoters of growth factors, thrombogenic factors or angiogenic genes.
  • the pharmaceutical composition comprises any of the molecules described above.
  • the vector of the pharmaceutical composition comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl.
  • the vector of the pharmaceutical composition comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE.
  • the present invention provides a method of regulating endothelial cell proliferation or anti-proliferation using the vector comprising the SSRE and the gene of interest coupled to the SSRE.
  • This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide wherein the Shear Stress Response Elements transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
  • SSRE Shear Stress Response Elements
  • endothelial cells are vascular endothelial cells or capillary endothelial cells.
  • This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the Shear Stress Response Element
  • the SSRE of the vector comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl , or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation.
  • This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and one or more genes which code for a protein or peptide, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
  • the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and one or more genes which code for a protein or peptide, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
  • This invention provides a method of modulating vascular permeability in a mammal, comprising administering to said mammal an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier; or a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Element
  • This invention provides a method of stimulating the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby stimulating the formation, maturation or regression of blood vessels.
  • SSRE Shear Stress Response Elements
  • This invention provides a method of inhibiting the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition
  • a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the
  • This invention provides a method of modulating genes or proteins involved in a diseases which comprises administering to a subject with the disease an effective amount of the pharmaceutical compositions and/or vectors described, above, wherein the pharmaceutical composition or vector is administered to the subject in the vasculature with the proviso that the vasculature has shear stress, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby modulating genes or proteins involved in the vascular diseases.
  • a method of down regulating angiogenesis comprising administering to the subject an amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature with the proviso that the
  • This invention provides a method of stimulating vasculogenesis and/or angiogenesis comprising contacting the cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and a gene of interest which codes for a protein or peptide, thereby stimulating angiogenesis.
  • the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and a gene of interest which codes for a protein or peptide, thereby stimulating angiogenesis.
  • This invention provides a method of inhibiting ' vasculogenesis and/or angiogenesis comprising contacting the cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response
  • Element SPl or a vector which comprises nucleic acids of Shear Stress Response
  • PDGF-A Shear Stress Response Element
  • PDGF-B Shear Stress Response Element
  • TRE and Shear Stress Response Element SPl and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, thereby inhibiting angiogenesis.
  • a method of treating a subject having a vasculogenic and/or angiogenic disorder comprising administering to the subject an amount of the pharmaceutical composition comprises a vector which comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl or the pharmaceutical composition comprises a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TR and a gene of interest which codes for a protein or peptide
  • this invention provides further comprising administering to the subject an agent which acts as a vasoconstrictor, inflammatory agent, vasolidator, fibrinolytic activators, Tumor Necrosis Factor (TNF), or thrombotic factors.
  • an agent which acts as a vasoconstrictor, inflammatory agent, vasolidator, fibrinolytic activators, Tumor Necrosis Factor (TNF), or thrombotic factors.
  • Vasolidators are known to those skilled in the art.
  • the subject invention contemplates but are not limited to the following: prostacyclin, nitric oxide, natriuretic peptide or calcium antagonists.
  • Vasoconstrictors are known to those skilled in the art.
  • the subject invention contemplates but are not limited to the following endothelin, thromboxan A2, angiotensin, kinins, kallikrein, and kininogen.
  • subject application incorporates in its entirety by reference the following: U.S. Pat. No. 5,594,021, Thienyl-, furyl- and pyrrolyl sulfonamides and derivatives thereof that modulate the activity of endothelin; U.S. Pat.
  • Fibrinolytic activators are known to those skilled in the art.
  • subject application incorporates in its entirety by reference the following: U.S. Pat. No.4, 873,083, Fibrinolytic composition; U.S. Pat. No. 5,316,766, Thrombosis treatment with fibrinolytics and prostacyclins; U.S. Pat. No. 4,996,050, Fibrinolytic activity enhancer; U.S. Pat. No. 4,600,580, Novel enzyme derivatives; U.S. Pat. No. 5,302,390, Hybrid proteins of human plasminogen and human t-PA, pharmaceutical compositions and methods of treatment; and U.S. Pat. No. 4,568,545, Thrombolytic agent; U.S.
  • Pat. No. 5,106,741 Tissue plasminogen activator (TPA) analogs.
  • TPA Tissue plasminogen activator
  • Thrombotic factors are known to those skilled in the art.
  • subject invention application in its entirety by reference the following: U.S. Pat. No. 5,837,688, Use of thrombolytic reagents for prevention of vascular disease; U.S. Pat. No.5, 084,274, Inhibition of arterial thrombotic occlusion or thromboembolism; U.S. Pat. No.5, 509, 896, Enhancement of thrombolysis with external ultrasound; U.S. Pat. No. 5,380,299, Thrombolytic treated intravascular medical device; U.S. Pat.
  • Arteriogenic, neoplastic, cardiovascular, vasculogenic and/or angiogenic disorders are known to those skilled in the art.
  • the disorders include but are not limited to: cardiovascular disorders, arteriosclerosis, Monckeebrg's arteriosclerosis, atherosclerosis, diabetic arteriosclerotic disease, hypertension, arterial hypertension, renovascular hypertension, myocardial ischemic disorders, coronary artery disease, angina pectoris, myocardial infarction, occlusive arterial disorders, peripheral atherosclerotic disease, thromboangitis obliterans, functional peripheral arterial disorders, cardiac arrythmias, bundle branch block, sick sinus syndrome, cardiomyopathy, hyperlipidemia, congestive heart failure, mitral stenosis, ischemi, reperfusion, shock, restenosis, arterial inflammation, retinovasculative disorders, mascular degeneration, diabetes, hypercholesterolemia. plaque formation, osteoarthritis, method for promoting tissue repair and regeneration, wound healing,
  • vasculogenic and/or angiogenic disorders include but are not limited to cancer.
  • cancers included but not limited to are as follows: cancers of the epithelia (e.g., carcinomas of the pancreas, stomach, liver, secretory glands (e.g., adenocarcinoma), bladder, lung, breast, skin (e.g., fibromatosis or malignant melanoma), reproductive tract including prostate gland, ovary, cervix and uterus); cancers of the hematopoietic and immune system (e.g., leukemias and lymphomas); cancers of the central nervous, brain system and eye (e. g., gliomas, neuroblastoma and retinoblastoma); and cancers of connective tissues, bone, muscles and vasculature (e.g., hemangiomas and sarcomas)).
  • epithelia e.g., carcinomas of the pancreas, stomach, liver, secretor
  • this invention provides for administration of vascularizing agents when treating a subject with an angiogenic and/or vasculogenic disorder.
  • Vascularization agents are known to those skilled in the art.
  • such agents include but are not limited to the following:granulocyte macrophage-colony stimulating factor (GM-CSF), VEGF.
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • VEGF vascular endothelial growth factor
  • SCF Stem cell factor
  • SDF- 1 stromal cell-derived factor
  • G-CSF granulocyte-colony stimulating factor
  • HGF Angiopoietin- 1
  • MCP stromal cell-derived factor
  • MMP's integrinscadherins
  • Angiopoietin-2 M-CSF
  • b-FGF b-FGF
  • FLT-3 lignand FLT-3 lignand
  • the amount of vascularization is sufficient to increase blood vessel size in the mammal.
  • Methods for determining parameters of blood vessel size, e.g., length and circumference, are known in the field.
  • the amount of administered modulating agent is sufficient to increase blood vessel length between from about 10% to 50%, even more preferably about 20%, as determined by standard blood vessel assay.
  • the arterial tree which consists of large elastic and muscular vessels as well as arterioles and precapillaries vessels, is constantly exposed to hemodynamic forces varying widely in magnitude, frequency and direction. These forces consist of pressure acting perpendicular to the vessel wall, cyclic strain, and shear stress acting parallel to the wall, creating a frictional shear force on the surface of the endothelium.
  • the magnitude of shear stress is in the range of 10-40 dynes/cm 2 , and it is over imposed with the pulsatile characteristic of the flow producing a range of shear stresses and shear stress gradients.
  • the magnitude of shear stress is 1-50 dynes/cm 2 . In another embodiment the magnitude of shear stress is 2-25 dynes/cm 2 . In another embodiment the magnitude of shear stress is 10-25 dynes/cm 2 . In another embodiment the magnitude of shear stress is 2-15 dynes/cm . In another embodiment of the method the magnitude of shear stress is 5-10 dynes/cm . In another embodiment of the method the magnitude of shear stress is 2-5 dynes/cm .
  • the vectors may be introduced into the desired host cells by methods known in the art, e.g., ex vivo viral vectors, particularly retroviral vectors, in vivo viral vectors, particularly defective viral vectors or adeno-associated virus vectors, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., U.S. Patent No. 5,580,859, which is incorporated by reference and Wu et al, 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,31 1, filed March 15, 1990).
  • ex vivo viral vectors particularly retroviral vectors
  • in vivo viral vectors particularly defective viral vectors or aden
  • the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33:153 Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289 Markowitz et al., 1988, J. Virol. 62:1120; Temin et al., U.S. Patent No. 5,124,263 International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al.; and Kuo et al., 1993, Blood 82:845.
  • a retroviral vector e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33:153 Temin et al., U.S. Patent No. 4,650
  • Retroviral vectors are especially attractive for transfecting solid tumors, since the cells of the tumor are replicating.
  • Cell fusion line 18 any cell fusion combination including but not limited to cell fusion between different cell type of different tissues origin, cell fusion between different species origin, cell fusion between mammalian and yeast or mammalian and prokaryote cell type. All these methods are known in the art as methods to transfer genetic materials.
  • the vector may be introduced as a single vector or with a combination of other vectors, supplementing trans activity for the SSRE vector for enhances SSRE vector activities. For example.
  • SSRE containing vector can be co-introduced with another vector that will introduce another genetic material to facilitate SSRE activities, to monitor transfection efficiency, to supply a missing component to the transfected cells (supplying helper function).
  • the vector can be introduced in vitro or in vivo by lipofection (lysosome fusion, including but not limited to cationic liposome, synthetic or natural lyposomes and neutral lyposomes).
  • lipofection lysosome fusion, including but not limited to cationic liposome, synthetic or natural lyposomes and neutral lyposomes.
  • Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417; see Mackey, et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031)).
  • the use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, 1989, Science 337:387-388).
  • lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages.
  • Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al., 1988, supra).
  • Targeted peptides e.g., hormones or neuro transmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.
  • DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, U.S. Patent No. 5,580,859, the contents of which are hereby incorporated by reference and e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,31 1, filed March 15, 1990).
  • the present invention provides a method for the delivery of the vector to an arterial cell, blood vessel or vasculature by being carried by a microdelivery vehicle such as cationic liposomes and adenoviral vectors.
  • DNA encoding different proteins may be used separately or simultaneously.
  • the arterial cell in an artery or blood vessel may be contacted via a balloon catheter coated with a hydrogel polymer.
  • Other treatment methods include percutaneous transluminal angioplasty (PTCA), "Cutting balloon” angioplasty, directional coronary atherectomy (DCA), rotational coronary atherectomy (RCA), Ultrasonic breaking catheter angioplasty, transluminal extraction catheter (TEC) atherectomy, Rotablator atherectomy, and excimer laser angioplasty (ELC A ).
  • the vector described herein may be inserted by a single intra-femoral artery or intracoronary injection directly conducted deeply in the lumen of the one or both femoral or coronary arteries (or graft vessels) in an amount.
  • U.S. Pat. No. 5792453 is hereby inco ⁇ orated in its entirety.
  • plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus. vector.
  • the trimolecular complex is then used to infect cells.
  • the adenovirus vector permits efficient binding, internalization, and degradation of the endosome before the coupled DNA is damaged.
  • Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration (Nabel, 1992).
  • Receptor-mediated gene transfer is accomplished by the conjugation of DNA (usually in the form of covalently closed supercoiled plasmid) to a protein ligand via polylysine.
  • Ligands are chosen on the basis of the presence of the corresponding ligand receptors on the cell surface of the target cell/tissue type.
  • the vector may be inserted/introduced by direct gene transfer of an expression vector.
  • the vector by may implanted between the aorta and left ventricular myocardium, for induced site-directed neovascular development or administrating to the subject intrapericardial infusions. This provides exciting prospects for intervention in cardiac diseases in which myocardial oxygen supply is compromised and/or demand is increased.
  • the induction of new collateral vessel formation should delay or halt the progression of coronary artery disease to myocardial infarction, as well as the advancement of ventricular hypertrophy to heart failure.
  • the therapeutic compound can be delivered in a controlled release system into the vasculature.
  • the vector may be administered using intravenous injections, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321 :574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71 :105 (1989)).
  • a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 1 15-138 (1984)).
  • a controlled release device is introduced into a subject in proximity of the site of inappropriate immune activation or a tumor.
  • Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
  • Localized administration to the target tissue is accomplished by directly injecting the vector into the target tissue or by topically applying the vector to the target tissue.
  • injecting it is meant that the vector is forcefully introduced into the target tissue.
  • Any suitable injection device can be used within the context of the present invention.
  • Another example of an injection device which can be used within the context of the present invention includes minimally invasive injection devices. Such devices are capable of accessing the heart, for example, through small incisions of less than 5 inches and are designed to provide injections through a single lumen, in contrast to the multiple injection device described above. To allow for the need for multiple injections with a specific geometry, a marking system can be employed so that the sites of previous injections are well delineated.
  • Minimally invasive injection devices can comprise injector tips which are flexible and steerable to allow access via small incisions to the curved outer surface of the heart, for example, which exists at varying angles with respect to the limited aperture window required with minimally invasive surgeries.
  • Such an injection can be administered from any suitable surface of the heart (i.e., endocardially and/or epicardially).
  • administration of a dose of the vector can be accomplished through a single application (e.g., a single injection or a single topical application) to the target tissue
  • administration of the dose is via multiple applications of the angiogenic vector.
  • the multiple applications can be 2, 3, 4, 5, or more applications, preferably 5 or more applications, more preferably 8 or more applications, and most preferably at least 10 applications.
  • Multiple applications provide an advantage over single applications in that they can be manipulated by such parameters as a specific geometry defined by the location on the target tissue where each application is administered.
  • the specific geometry of the multiple applications is defined by the location on the target tissue, either in two- or three-dimensional space, where each application of the ector is administered.
  • the multiple applications preferably are spaced such that the points of application are separated by up to about 4 cm (e.g., about 0.5-4 cm), more preferably up to about 3 cm (e.g., about 1-3 cm), and most preferably up to about 2 cm (e.g., about 1-2 cm).
  • a single application will be administered for about every 0.5-15 cm2 of the plane, more preferably for 15 about every 1-12 cm2 of the plane, and most preferably for about every 1.5-7 cm2 of the plane.
  • the depth of the plane is preferably about 1-10 mm, more preferably about 2-7 mm, and most preferably about 3-5 mm.
  • a single application preferably is administered for up to about 50 cm (e.g., about 0.5-50 cm of target tissue, more preferably for up to about 35 cm (e.g., about 1-35 cm of target tissue, and most preferably for up to about 15 cm (e.g., about 3-15 cm) of target tissue.
  • the multiple applications can define any suitable pattern or specific geometry.
  • the vector or naked SSRE nucleic acid may be administered within a biocompatible polymer.Biocompatible polymers are known to those skilled in the art, see WO 97/16176, PCT/CA96/00725 which is incorporated by reference.
  • the vector or naked SSRE nucleic acid may preferably be implanted in the form of a disk, fibre or microsphere, with microsphere being the most preferred form.
  • the microsphere has a diameter no greater than about 500 m, more preferably no greater than about 200 pm, and most preferably from less than about 10 ,UII to about 50 m.
  • the vector or naked SSRE nucleic acid is implanted into the peripheral ischemic tissue or in blood vessels close to the ischemic tissue to stimulate the growth of blood vessels or collaterals.
  • the vector or naked SSRE nucleic acid is incorporated into a wound care product applied to the surface of a wound such as a chronic wound or burn. Wound care products may be wet dressings, dry dressings, occlusive dressings, non-occlusivedressings, wound pastes, or any other product applied to a wound.
  • microcapsules or microspheres which are any polymeric membrane that encloses an interior core of a different material, can be administered to a subject by various means, including implantation, injection, and infusion, via cannulas, catheters, pipette or directly through a needle from a syringe or using forceps or a trocar.
  • implantation, injection, and infusion via cannulas, catheters, pipette or directly through a needle from a syringe or using forceps or a trocar.
  • Preferred biocompatible polymers for use in the present invention include polyacrylates, polyphosphazenes, various vinyl polymers including polyvinyl chloride,polyacrylonitrile, polyvinyl acetate, ethylene vinyl acetate, polyvinyl alcohol copolymers, polyvinyl amine copolymers, polyimides, polyether ketones, polysulphones, siloxanes, polyurethanes and polyamides, polycarbonates, polyesters and bioresorbables such as polyanhydrides, polyorthoesters, polycaprolactones, polyamino acids, polylactic/glycolic acid copolymers and polyhydroxybutyrates.
  • various vinyl polymers including polyvinyl chloride,polyacrylonitrile, polyvinyl acetate, ethylene vinyl acetate, polyvinyl alcohol copolymers, polyvinyl amine copolymers, polyimides, polyether ketones, polysulphones, siloxanes, polyurethanes and polyamide
  • More preferred biocompatible polymers are polyacrylates, with hydroxyethyl methacrylate-methyl methacrylate (HEMA-MMA) and hydroxyethyl methacrylate-methyl methacrylate-methacrylic acid (HEMA-MMA-MAA).
  • HEMA-MMA hydroxyethyl methacrylate-methyl methacrylate
  • HEMA-MMA-MAA hydroxyethyl methacrylate-methyl methacrylate-methacrylic acid
  • This invention provides administrating the vector or naked SSRE nucleic acid via intravascular catheters.
  • Intravascular catheters and stents for delivery of drugs are known to those skilled in the art.
  • Patent Nos. 5,180,366; 5,171,217; 5,049,132; and 5,021,044;and PCT Publications WO 93/08866, WO 92/1 1895 and WO 97/123256 which are hereby inco ⁇ orated by reference.
  • Tissues to be treated by the present invention will typically be adjacent to blood vessels, within the blood vessel, or more typically being adjacent to coronary and peripheral arteries, where the vector or naked SSRE nucleic acid is delivered transmurally within the adjacent blood vessel to promote angiogenesis from the delivery site within the blood vessel into the surrounding tissue.
  • the target tissue will usually be ischemic, i.e., deprived of blood flow, but the present invention might also find use with promoting angiogenesis in non-ischemic tissues.
  • body lumen will generally refer to blood vessels, including portions of the arterial vasculature and venous vasculature. Body lumen wall includes the neointimal, intimal, medial, adventitial and perivascular spaces, adjacent to the target site.
  • delivery of the vector according to the methods of the present invention could be performed after balloon angioplasty to enhance blood perfusion into ischemic tissue surrounding the treated stenotic region.
  • Delivery of vector or naked SSRE nucleic acid could also be combined with delivery of other therapeutic agents intended for treating coronary artery disease, such as anti-5 thrombotic and fibrinolytic agents.
  • balloon catheters having expandable distal ends capable of engaging the inner wall of a blood vessel and infusing an angiogenic factor directly therein are well-described in the patent literature. See, for example, U.S.Patent Nos.
  • Ultrasonically assisted drug delivery catheters (phonophoresis devices) are described in U.S. Patent Nos. 15 5,362,309; 5,318,014; and 5,315,998.
  • Other iontophoresis and phonophoresis drug delivery catheters are described in U.S. Patent Nos. 5,304,120; 5,282,785; and 5,267,985.
  • sleeve catheters having drug delivery lumens intended for use in combination with conventional angioplasty balloon catheters are described in U.S. Patent Nos. 5,364,356 and 5,336,178.
  • the vector or naked SSRE nucleic acid could be delivered by applying a thin layer of a hydrogel,glycosaminoglycans, or other polymeric carrier matrix to the endoluminal wall at the target location.
  • the polymeric carrier will be biodegradable or bioeluting and serve as a temporary wall support while the vector or naked SSRE nucleic acid are released over time.
  • compositions of the present invention are particularly suited to administration to a mammal, preferable a human subject.
  • pharmaceutical composition could mean therapeutically effective amounts of the vector of the invention together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvant and/or carriers.
  • a “therapeutically effective amount” as used herein refers to that amount which provides a therapeutic effect for a given condition and administration regimen.
  • compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g., Tris-HCL, acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent abso ⁇ tion to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or inco ⁇ oration of the material into or onto particulate preparations of polymeric compounds such as polylactic acid, pol
  • compositions of the invention inco ⁇ orate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.
  • pharmaceutical composition is administered parenterally, intratumorally, paracancerally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, intravascularly, subcutaneously, intraperitonealy, intraventricularly, intracranially.
  • pharmaceutically acceptable carrier include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobial, antioxidants, collating agents, inert gases and the like.
  • adjuvant refers to a compound or mixture that enhances the immune response to an antigen.
  • An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., Immunology, Second Ed., 1984, Benjamin/Cummings: Menlo Park, California, p. 384).
  • a primary challenge with an antigen alone, in the absence of an adjuvant will fail to elicit a humoral or cellular immune response.
  • Adjuvant include, but are not limited to, complete Freud's adjuvant, incomplete Freud's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol.
  • the adjuvant is pharmaceutically acceptable.
  • Controlled or sustained release compositions include formulation in lipophilic depots (e.g. fatty acids, waxes, oils). Also comprehended by the invention are particulate compositions coated with polymers (e.g. poloxamers or poloxamines) and the compound coupled to antibodies directed against tissue-specific receptors, ligands or antigens or coupled to ligands of tissue-specific receptors. Other embodiments of the compositions of the invention inco ⁇ orate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral. Suitable excipients are, for example,. water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering
  • An active component can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms.
  • Pharmaceutically acceptable salts include the acid addition salts and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
  • the pharmaceutically acceptable form of the composition includes a pharmaceutically acceptable carrier.
  • a therapeutically effective dosage of the active component is provided.
  • a therapeutically effective dosage can be determined by the ordinary skilled medical worker based on patient characteristics (age, weight, sex, condition, complications, other diseases, etc.), as is well known in the art. Furthermore, as further routine studies are conducted, more specific information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients, and the ordinary skilled worker, considering the therapeutic context, age and general health of the recipient, is able to ascertain proper dosing. Generally, for intravenous injection or infusion, dosage may be lower than for intraperitoneal, intramuscular, or other route of administration.
  • the dosing schedule may vary, depending on the circulation half-life, and the formulation used.
  • the compositions are administered in a manner compatible with the dosage formulation in the therapeutically effective amount. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration. Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Alternatively, continuous intravenous, infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.
  • This invention provides a method for detecting shear stress or a shear stress related condition in a subject, comprising administering to the subject an amount of the vector which comprises one or more Shear Stress Response Element and a reporter gene, wherein the gene is activated in a shear stress environment, thereby detecting shear stress or a shear stress related condition in the subject.
  • This invention provides a method for screening test compounds for the ability to regulate endothelial cell expression or angiogenesis and/or vasculogenesis comprising: (a) contacting a endothelial cells with the compound to be tested; (b) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the test compound; (c) stimulating endothelial cells by introduction of the vector provided herein; (d) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the vector; (e) comparing the amount of angiogenesis and/or vasculogenesis produced as a result step (b) to that of step (d), wherein an increased amount of expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis of the test compound means that the test compound regulates endothelial cell expression angiogenesis and/or vasculogenesis.
  • test composition is any composition such as a gene, SSRE, a nucleic acid sequence, a polypeptide, peptide fragment or composition created through the use of a combinatorial library or other combinatorial process that can be assayed for its ability to function in given capacity or compound which mimics the activity of the complex. Often such a test composition, nucleic acid sequence or polypeptide is, because of its sequence or structure, suspected of being able to function in a given capacity.
  • Any screening technique known in the art can be used to screen for regulators or modulators of angiogenesis and/or vasculogenesis. Identification and screening of antagonists or agonist is further facilitated by comparing the result of the test composition with the result of the vector described hereinabove These techniques provide for the rational design or identification of agonists and antagonists.
  • U.S. Pat. No. 5,165,938, Screening assays for compounds is incorporated in its entirety.
  • This invention provides methods to monitor shear stress activities, to screen and select for target genes, for gene therapy in other organs and methods of identifying and describing genes which are differentially expressed in vascular disease states, relative to their expression in normal, or non-cardiovascular disease states and a method for the identification and therapeutic use of compounds as treatments of vascular disease.
  • This invention provides methods for the diagnostic monitoring of patients undergoing clinical evaluation for the treatment of vascular diseases, and for monitoring the efficacy of compounds in clinical trials. Because the SSRE of this invention are modulated, i.e up-regulated or down-regulating, treatment methods can be designed to enhance or increase the expression of these genes which are coupled to the SSREs, particularly in endothelial cells. In addition, detecting expression of these genes in low amounts of normal expression provides for the diagnosis of disease.
  • genes which are involved in vascular disease may represent genes which are differentially expressed in vascular disease conditions relative to their expression in normal, or non-cardiovascular disease conditions.
  • differentially expressed genes may represent "target” and/or “fingerprint” genes.
  • “Differential expression” as used herein refers to both quantitative as well as qualitative differences in the genes' temporal and/or tissue expression patterns.
  • a differentially expressed gene may have its expression activated or completely inactivated in normal versus vascular disease conditions, or under control versus experimental conditions.
  • Such a qualitatively regulated gene will exhibit an expression pattern within a given tissue or cell type which is detectable in either control or cardiovascular disease subjects, but is not detectable in both.
  • Detectable refers to an RNA expression pattern which is detectable via the standard techniques of differential display, reverse transcriptase- (RT-) PCR and/or Northern analyses, which are well known to those of skill in the art.
  • a differentially expressed gene may have its expression modulated, i.e., quantitatively increased or decreased, in normal versus cardiovascular disease states, or under control versus experimental conditions.
  • the degree to which expression differs in normal versus cardiovascular disease or control versus experimental states need only be large enough to be visualized via standard characterization techniques, such as, for example, the differential display technique described below.
  • standard characterization techniques such as, for example, the differential display technique described below.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to quantitative RT-PCR and Northern analyses.
  • Differentially expressed genes may be further described as target genes and/or finge ⁇ rint genes.
  • “Finge ⁇ rint gene,” as used herein, refers to a differentially expressed gene whose expression pattern may be utilized as part of a prognostic or diagnostic cardiovascular disease evaluation, or which, alternatively, may be used in methods for identifying compounds useful for the treatment of cardiovascular disease.
  • a finge ⁇ rint gene may also have the characteristics of a target gene.
  • a target gene may also have the characteristics of a fingerprint gene.
  • a variety of methods may be utilized for the identification of genes which are involved in cardiovascular disease which are known to those skilled in the art.
  • test cells Cultured HUVEC monolayers are exposed to laminar sheer stress by in a specialized apparatus containing liquid culture medium, may also be compared to unrelated cells (e.g., fibrobiasts) that are also treated with the compound, in order to screen out generic effects on gene expression that might not be related to the disease.
  • unrelated cells e.g., fibrobiasts
  • Such generic effects might be manifest by changes in gene expression that are common to the test cells and the unrelated cells upon treatment with the compound.
  • RNA may be isolated from one or more tissues of the subjects utilized in paradigms such as those described earlier in this Section. RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel, F. M. et al., eds., 1987-1993, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. New York, both of which are inco ⁇ orated herein by reference in their entirety.
  • tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, P. (1989, U.S. Pat. No. 4,843,155), which is incorporated herein by reference in its entirety.
  • Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes may be identified by utilizing a variety of methods which are well known to those of skill in the art. For example, differential screening (Tedder, T. F. et al., 1988, Proc. Natl. Acad. Sci. USA 85:208-212), subtractive hybridization (Hedrick, S. M. et al., 1984, Nature 308: 149-153; Lee, S. W. et al., 1984, Proc. Natl. Acad. Sci. USA 88:2825), and, preferably, differential display (Liang, P., and Pardee, A. B., 1993, U.S. Pat. No. 5,262,311, which is inco ⁇ orated herein by reference in its entirety), may be utilized to identify nucleic acid sequences derived from genes that are differentially expressed.
  • Subtractive hybridization techniques generally involve the isolation of mRNA taken from two different sources, e.g., control and experimental tissue, the hybridization of the mRNA or single-stranded cDNA reverse-transcribed from the isolated mRNA, and the removal of all hybridized, and therefore double-stranded, sequences.
  • the remaining non-hybridized, single-stranded cDNAs potentially represent clones derived from genes that are differentially expressed in the two mRNA sources.
  • Such single-stranded cDNAs are then used as the starting material for the construction of a library comprising clones derived from differentially expressed genes.
  • the differential display technique describes a procedure, utilizing the well known polymerase chain reaction (PCR; the experimental embodiment set forth in Mullis, K. B., 1987, U.S. Pat. No. 4,683,202) which allows for the identification of sequences derived from genes which are differentially expressed.
  • PCR polymerase chain reaction
  • isolated RNA is reverse-transcribed into single-stranded cDNA, utilizing standard techniques which are well known to those of skill in the art.
  • Primers for the reverse transcriptase reaction may include, but are not limited to, oligo dT-containing primers, preferably of the reverse primer type of oligonucleotide described below.
  • this technique uses pairs of PCR primers, as described below, which allow for the amplification of clones representing a random subset of the RNA transcripts present within any given cell. Utilizing different pairs of primers allows each of the mRNA transcripts present in a cell to be amplified. Among such amplified transcripts may be identified those which have been produced from differentially expressed genes.
  • PCR reaction conditions should be chosen which optimize amplified product yield and specificity, and, additionally, produce amplified products of lengths which may be resolved utilizing standard gel electrophoresis techniques.
  • reaction conditions are well known to those of skill in the art, and important reaction parameters include, for example, length and nucleotide sequence of oligonucleotide primers as discussed above, and annealing and elongation step temperatures and reaction times.
  • the pattern of clones resulting from the reverse transcription and amplification of the mRNA of two different cell types is displayed via sequencing gel electrophoresis and compared. Differences in the two banding patterns indicate potentially differentially expressed genes.
  • differential expression of such putatively differentially expressed genes should be corroborated. Corroboration may be accomplished via, for example, such well known techniques as Northern analysis and/or RT-PCR.
  • methods may be employed which result in the simultaneous identification of pathway genes which encode the protein interacting with a protein involved in cardiovascular disease.
  • These methods include, for example, probing expression libraries with labeled protein known or suggested to be involved in cardiovascular disease, using this protein in a manner similar to the well known technique of antibody probing of lambda gt 1 1 libraries.
  • Compounds identified via assays such as those described herein may be useful, for example, in elaborating the biological function of the target gene product, and for ameliorating diseases discussed above.
  • compounds that interact with the target gene product may include compounds which accentuate or amplify the activity of the bound target gene protein.
  • animal-based cardiovascular disease systems such as those described, may be used to identify compounds capable of ameliorating cardiovascular disease symptoms.
  • Such animal models may be used as test substrates for the identification of drugs, pharmaceuticals, therapies, and interventions which may be effective in treating cardiovascular disease.
  • animal models may be exposed to a compound, suspected of exhibiting an ability to ameliorate cardiovascular disease symptoms, at a sufficient concentration and for a time sufficient to elicit such an amelioration of cardiovascular disease symptoms in the exposed animals.
  • the response of the animals to the exposure may be monitored by assessing the reversal of disorders associated with cardiovascular disease, for example, by counting the number of atherosclerotic plaques and/or measuring their size before and after treatment.
  • Antisense and ribozyme molecules which inhibit expression of the target gene may also be used in accordance with the invention to inhibit the aberrant target gene activity.
  • the compounds which may exhibit the ability to ameliorate cardiovascular disease symptoms are antisense, ribozyme, and triple helix molecules.
  • the present invention provides a kit comprising the all the essential materials and reagents required.
  • This generally will comprise selected expression constructs.
  • kits will comprise distinct containers for each individual reagent.
  • the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the expression construct may be formulated into a pharmaceutically acceptable syringeable composition.
  • the container means may itself be an inhalent, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the body, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit.
  • the components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
  • kits of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
  • a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained.
  • the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal.
  • an instrument may be an inhalent, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
  • EXAMPLE 1 Construction of "synthetic" shear stress responsive hybrid promoter constructs based on known SSREs.
  • Cone - Plate shear stress apparatus A cone-plate viscometer was used, the design of which and the operating parameters have been described in details (26, 36). Shear stress is produced in the fluid contained between a stationary base plate and a rotating cone. By adjusting the cone angle, the viscosity of the medium and the cone rotational speed a wide broad of shear stress magnitudes (1-50 dynes/cm) and patterns (laminare, turbulent, disturbed-laminar and oscillatory) can be achieved. Confluent endothelial monolayers can be grown either on 11 mm in diameter twelve tissue culture coated coverslips to achieve multiple sampling under the same flow and medium conditions, or alternatively, on a 17 cm in diameter tissue culture coated coverslip for molecular biology procedures requiring high cell quantities.
  • SSREs Four positive SSREs were defined and tested, which include the PDGF/B SSRE which binds NFkB and NFAT, the PDGF/A SSRE which binds Spl and Egrl, the MCP-1 TRE which is binding site for fos and jun and the tissue factor SSRE, which is a binding site for Spl. Interestingly, most of these promoters contain more than one of the described SSREs. PDGF-B promoter contains a binding site for fos and jun and an spl binding site in addition to the PDGF/B-SSRE. MCP-1 encodes for the PDGF/B-SSRE in addition to its TRE site.
  • Tissue factor promoter contains NFkB, fos and jun binding sites, in addition to its spl/SSRE site. Shear stress responsiveness in vivo, is the result of the cooperative action of several SSREs in each promoter.
  • the vector pGL2-promoter as shown in Figure 1 , containing the luciferase gene and the SV40 promoter (Promega, Madison, WI, U.S.A) was used as a backbone to all of the described constructs.
  • This oligonucleotide contains the PDGF-B/SSRE sequence (GAGACCCCC) twice, the Sp-1 binding site (GGGGCGGGGCG) twice, the TRE site (TGACTCC) twice and polylinkers to the restrictions enzymes Miul and Xhol.
  • This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bglll.
  • These constructs were ligated 5 'to the SV40 promoter (both NR1/NR2 and NR3/NR4) to create the vectors 5' NR1/NR2-Luc and 5' NR3 NR4-Luc and also 3' to the luciferase gene (3' NR3/NR4-Luc) to test the positional effect of the SSREs.
  • These constructs were used to transfect endothelial cells, and their expression was compared to already existing hybrid promoters containing each of the SSREs alone.
  • several commercially available transfection kits as well as a modified calcium phosphate method adapted by to suit endothelial cells were used. In these experiments three kits were used: The Tfx 20 and 50 (Promega, U.S.A). Fugene (Gibco-BRL, U.S.A) and Effectine (Qiagene, U.S.A).
  • Endothelial cells from arterial and capillary origin Bovine Aortic Endothelial cells -BAEC, and Bovine brain Capillary Edothelial cells - BBC were used for transfecion.
  • the efficiencies of transfection of BAEC with the various techniques were: Modified calcium phosphate (concentration of sodium hydrogen phosphate 1.4 mM),22%, Effectine - 19%, Fugene - 15%, Tfx 20 - 16%, and Tfx 50-20%.
  • the efficiencies of transfection of BBC with the various methods were: Modified Calcium phosphatase: 8%, Effectine - 15%, Fugene - 15%, and Tfx 20 - 13% Tfx 50 - 7%.
  • Endothelial cells were transfected in triplicate with three constructs: NR1/2 which contains the combination of all four SSREs, SSRE-Luc which contains a single copy of the PDGF-B/SSRE and the core plasmid PGL, and co-transfected with the Renilla luciferase vector.
  • Two days after transfection the cells were transferred to a medium containing 5% calf serum and either incubated under static conditions or exposed to shear stress (10 dynes/cm , 2 hrs). The cells were extracted and the ratio luciferase/renilla luciferase was calculated. The induction of expression was calculated for the average ratio of the triplicates in shear stress versus, static experiments.
  • Table 1 The induction of SSRE-hybrid promoter vectors by shear stress.
  • the vector pGL3 -enhancer as shown in Figure 2, containing the luciferase gene and the SV40 promoter (Promega, Madison, WI, U.S.A) was used as a backbone to all of the described constructs.
  • This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A and from the TF promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bgll.
  • -These constructs were ligated 5'to the SV40 promoter (both NR1/NR2 and NR3/NR4) to create the vectors 5' NR1/NR2-Luc and 5' NR3/NR4-Luc and also 3' to the luciferase gene (3' NR3/NR4-Luc) to test the positional effect of the SSREs.
  • These constructs were used to transfect endothelial cells, and their expression was compared to already existing hybrid promoters containing each of the SSREs alone.
  • This oligonucleotide contains the PDGF-B/SSRE sequence (GAGACCCCC) three times, the Sp-1 binding site (GGGGCGGGGCG) twice, the TRE site (TGACTCC) twice and polylinkers to the restrictions enzymes Miul and Xhol and
  • This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bgll.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Diabetes (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Obesity (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Plant Pathology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Dermatology (AREA)
  • Hospice & Palliative Care (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • Molecular Biology (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)

Abstract

This invention provides expression vectors comprising multiple shear stress responsive elements and one or more genes of interest and methods of treating disorders related to or associated with vasculogenesis and/or angiogenesis conditions.

Description

EXPRESSION VECTORS COMPRISING MULTIPLE SHEAR STRESS
RESPONSIVE ELEMENTS (SSRE) AND A GENE OF INTEREST
AND METHODS OF USE THEREOF
FIELD OF INVENTION
This invention provides expression vectors comprising multiple shear stress responsive elements and a gene of interest or nucleic acid encoding the protein or peptide of interest. Further, this invention provides methods to monitor shear stress activities, to screen and select for target genes and methods of identifying and describing genes which are differentially expressed in disease states. Lastly, this invention provides methods for methods for treating disorders by introducing the vector into the vasculature which has hemodynamic forces such as fluid shear stress forces; diagnostic methods for monitoring of patients undergoing clinical evaluation for the treatment of disease and for the identification, monitoring and therapeutic use of compounds as treatments of disease.
BACKGROUND OF THE INVENTION The construction of blood vessels consists of two processes: vasculogenesis, the establishment of vascular network during embryogenesis from multipotential mesanchymal progenitors, and angiogenesis, the sprouting of existing blood vessels which occurs both in the embryo and in the adult (1-5). Endothelial cells are the major players in both processes, they migrate and proliferate and then assemble into tubes with tight cell-cell connections. Peri-endothelial cells are recruited to support the endothelial tube, providing maintenance and modulatory functions to the vessel. These cells are perycytes in the capillaries, smooth muscle cells in larger vessels and cardiac mycocytes in the heart.
The establishment and remodeling of blood vessels is controlled by paracrine signals, many of which are protein ligands that bind to modulate the activity of transmembrane tyrosine kinase receptors (1,3,6). Among these molecules are Vascular Endothelial Growth factor (VEGF) and its receptors, Angiopeitin 1 and 2 and their receptor (Tiel and 2), Basic Fibroblast Growth Factor (bFGF), Platelet derived Growth factor (PDGF),and Transforming Growth Factor (TGF). Recently, some of these molecules have been disrupted in the embryo (null-mice), or mutated in the adult. The animal models pointed to a certain order in the formation of the blood vessel, and further stressed the role of the endothelium in all stages of vessel formation. The dominant role of VEGF and its receptors in preliminary stages of angiogenesis and vasculogenesis has been demonstrated in null animals which die in early stages of embryogenesis even in heterozygous animals (7-9). Null animals lacking the Flkl receptor had no endothelial cells, while null animals lacking the Fltl receptor failed to form tubes. When the Tie2 receptor or its ligands angiopoietin 1 and 2 were disrupted (10-14), endothelial cells organized into a tube shape, but failed to recruit the periendothelial cells. Interestingly, similar phenotypes were observed in animals null in PDGF-B, TGF- and tissue factor (15-18) suggesting that the binding of angiopoietin to its receptor may lead to the secretion of these molecules from the endothelium, pointing again for the role of these cells in the various steps of vessel formation.
The scheme evolving suggests that the binding of VEGF to its receptors, plays an important role in the primary steps of vessel formation, differentiation, migration and proliferation of endothelial cells and the formation pf the primary tube, while the binding of Angiopoietinl to its Tie2 receptor mediate the maturation of the vessel, recruitment of peri-endothelial supporting cells and maintenance of vessel integrity and quiescence. These same molecules play an additional role in loosening the interaction of the endothelium with its matrix and support cells, enabling the sprouting of new vessels (6). Recently it was suggested that the binding of Angiopoietin 2 to Tie2 plays a role in regression of already existing vessels (6, 13).
In mature blood vessels, endothelial cells, by virtue of their unique anatomical position, are constantly exposed to the fluid mechanical forces generated by the flowing blood (See, William R. Milnor in Chapter 6 entitled "The Normal Hemodynamic State" of the book entitled "Hemodynamics", published by Williams & Wilkins, Maryland (1989) and US Patent Nos. 5199298, 5052228 and 4926696 for measuring shear stress. These hemodynamic forces, which include hydrostatic pressure, cyclic strain and frictional wall shear stress, constitute a special category of physical stimuli that, in addition to better characterized biochemical stimuli, can elicit important biological responses in the cells that compose the blood vessel wall (23). The non-random distribution of early atherosclerotic lesions observed both in natural disease processes in human and in experimental animal model has long been cited as suggestive evidence for the role these forces play in the pathogenesis of cardiovascular diseases (24,25). Both in -vivo studies and in-vitro experiments, using well defined model flow systems, have demonstrated that wall shear stresses can modulate various aspects of endothelial structure and function, changes that are mediated via up or down regulation of endothelial gene expression at the transcription level (26,27). Hemodynamic forces and more specifically, fluid shear stress, regulate the expression of PDGF and TGF( (26,27). The activity of extracellular degrading enzymes and the levels of their transcripts are all induced in endothelial cells exposed to flow (23,27). Recently, it was demonstrated that NO is a down stream signaling molecule in angiogenesis induced by VEGF, but not FGF (35). Endothelial NO synthase is highly regulated in cells exposed to shear stress.
One of the intriguing and unanswered questions is the role that hemodynamic forces play in the formation and maturation of blood vessels in both vasculogenesis and angiogenesis. The role of these forces in vessel formation has been so far only suggestive (4,5). The formation of coronary collaterals was suggested to be affected by hypoxia. Although VEGF and its receptors , as well as PDGF -B, are all induced in hypoxic endothelial cells and myocytes in-vitro (29-32), several in-vivo models demonstrated that collateral growth occurs outside the hypoxic area. In the canine model collateral growth occurs in the epicardium (which is not hypoxic) and proceeds at the time when even the endocardium is not hypoxic anymore (33). Another example from the peripheral circulation, is the ischemic foot (as a result of femoral artery occlusion) where collaterals develop in both ischemic and more distant non-ischemic regions (34). During maturation of the vessel changes in the composition of the extracellular matrix occur, and tight junctions are formed (19,20). Are these changes stimulated by the flow of blood in the newly formed vessel? Furthermore, angiogenesis often involves massive sprouting of the already existing vessels, which is accompanied by the regression of some of the newly formed tubes (21,22). Is this balance (formation versus regression) affected by changes in the rate and pattern of blood flow through these newly formed tubes? Do changes in the pattern and magnitude of hemodynamic forces in big vessels affect the formation of smaller vessels (vasa vasorum) in the adventitia (37)?
SUMMARY OF THE INVENTION This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide. In one embodiment, the genes code for transcription factors, cell cycle proteins, signaling molecules, degrading proteins, transmembrane protein, enzyme, secreted factors, growth factor, angiogenic factor, or thrombogenic factor. It is contemplated herein, that the vector comprises one or a multiple number of genes. This invention provides a method for detecting shear stress or a shear stress related condition in a subject, comprising administering to the subject an amount of the vector which comprises one or more Shear Stress Response Element (SSRE) and a gene of interest coupled to the SSRE, wherein the gene is activated in a shear stress environment, thereby detecting shear stress or a shear stress related condition in the subject.
This invention provides methods to monitor shear stress activities, to screen and select for target genes and methods of identifying and describing genes which are differentially expressed in disease states, relative to their expression in normal, or non disease states and a method for the identification and therapeutic use of compounds as treatments of the disease. Lastly, this invention provides methods for the diagnostic monitoring of patients undergoing clinical evaluation for the treatment of diseases, such as cardiovascular, neoplastic, vascular associated_ diseases, and for monitoring the efficacy of compounds in clinical trials.
This invention provides gene therapy methods for treating disorders related to or associated with vasculogenesis and/or angiogenesis by introducing the vectors described herein in the vasculature having hemodynamic forces such as fluid shear stress forces. Hemodynamic forces, which include hydrostatic pressure, cyclic strain, and frictional wall shear stress, play an important role in the formation and maturation of blood vessels by regulating endothelial genes through Shear Stress Responsive Elements (SSRE) in promoters of endothelial shear stress responsive genes. The vectors provided herein are useful as acting as agents or in combination with other therapeutic agents for inhibiting, stimulating, regulating and/or modulating a variety of cellular processes (e.g., vasculogenic, angiogenic -related and/or metabolic-related processes).
This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide.
The promoter Shear Stress Response Elements are nucleic acid sequences from regulatory elements of growth factors, thrombogenic factors or angiogenic genes. This invention provides for a vector which comprises a multiple number of Shear Stress Response Elements which binds to NFKB, NFAT, SP1, or Egrl and/or Shear Stress Response Element which comprises a binding site for fos, jun, or SP1. The vector comprises a gene of interest or a nucleic acid encoding one or more transmembrane proteins, enzymes, secreted factors, or a gene coding for any protein. Further, the vector may comprises a reporter gene, or a selection marker.
This invention provides a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier.
This invention provides a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Sheaf Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier.
This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation.
This invention provides a method of modulating vascular permeability in a mammal, comprising administering to said mammal an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier; or a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Element to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby modulating vascular permeability in the mammal. '' ~
This invention provides a method of stimulating the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby stimulating the formation, maturation or regression of blood vessels.
This invention provides a method of inhibiting the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby inhibiting the formation, maturation or regression of blood vessels.
This invention provides a method of modulating genes or proteins involved in a diseases which comprises administering to a subject with the disease an effective amount of the pharmaceutical compositions and/or vectors described, above, wherein the pharmaceutical composition or vector is administered to the subject in the vasculature with the proviso that the vasculature has shear stress, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby modulating genes or proteins involved in the vascular diseases. "
A method of down regulating angiogenesis comprising administering to the subject an amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby down regulating angiogenesis. The present invention relates to a method for revascularization of ischemic tissues, development of collateral vessels and improvement of function in peripheral and myocardial ischemic tissue and enhancing the level of perfusion of blood to a target tissue. Also, the present invention relates to a method for treating a target tissue suffering from or at risk of suffering from ischemic damage, and a method of inducing angiogenesis in a target tissue.
This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein SSRE is two or more or a combination of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear "Stress Response Element TRE and Shear Stress Response Element SP1 , such that the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation.
This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide, wherein the SSRE is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SP1, and Shear Stress Response Element TRE, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
This invention provides a method of stimulating angiogenesis comprising contacting the cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide, wherein the SSRE is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SP1, and Shear Stress Response Element TRE, thereby stimulating angiogenesis.
This invention provides a method for screening test compounds for the ability to regulate endothelial cell expression or angiogenesis and/or vasculogenesis comprising: (a) contacting a endothelial cells with the compound to be tested; (b) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the test compound; (c) stimulating endothelial cells by introduction of the vector provided herein; (d) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the vector; (e) comparing the amount of angiogenesis and/or vasculogenesis produced as a result step (b) to that of step (d), wherein an increased amount of expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis of the test compound means that the test compound regulates endothelial cell expression angiogenesis and/or vasculogenesis.
DETAILED DESCRIPTION OF FIGURES
Figure 1 : Schematic of a SSRE hybrid promoter vector named pGL2 -promoter vector (5789 bases) comprising one of the following: NR1/2+NR3/4; NR1/2; or
NR3/4, promoter, poly(A) signal and a reporter gene. NR1/2 comprises nucleic acid sequences of two (2) PDGF-B SSRE, a Sp-1, and TRE, while
NR3/4 comprises nucleic acid sequences of Sp-l/Egr-1 and TRE.
Figure 2: Schematic of a SSRE hybrid promoter vector named pGL3-enahncer vector (5255 bases) comprising one of the following: NR3/4 and NR1/2+ NR3/4, poly(A) signal and a reporter gene.
DETAILED DESCRIPTION OF THE INVENTION
The formation of blood vessels via vasculogenesis, formation of blood vessels from newly differentiated mesanchymal progenitors, and angiogenesis, the sprouting of already existing blood vessels, accompanies many physiological and pathological processes during embryogenesis and adulthood. The major players in these two processes are endothelial cells, which differentiate, proliferate, migrate and assemble into new tubes. The endothelium also recruit the peri-endothelial cells which support the tube and contribute to its unique remodeling capability. After the assembly of the endothelium into tubes, blood starts to flow through the newly formed vessels, a step which is followed by the maturation of the vessel, formation of tight junctions and changes in the composition of the extracellular matrix, but is also accompanied by the regression of some of these newly formed vessels. The nature of the relationship between hemodynamic forces generated by the flowing blood and vessel maturation has never been tested. Fluid shear stress transcriptionally regulates endothelial gene expression, a process which is mediated by shear stress responsive promoter elements. Several novel shear stress response elements have been defined herein, that bind endothelial cells transcription factors which are activated by shear stress forces.
Fluid shear stress by regulating the expression of endothelial genes, through shear- stress -response promoter elements, plays an important role in the formation, and maturation of blood vessels. As such, "synthetic" shear stress responsive elements have been constructed containing SSREs which have been tested under laminar shear stress regimes and patterns. Shear stress includes pulsatile, turbulent, oscillatory, disturbed LSS, shear stress gradients.
Mechanical forces, as shear stress, are important modulators of cellular functions in many tissues and particular important in the cardiovascular system to maintain homeostasis of blood vessels. During physiological condition shear stress is a laminar steady state force, different than those acting at the branch points of the blood vessels. In pathological events, complex shear stresses are involved in the development of cardiovascular diseases such as atherosclerosis and hypertension. Development of such pathologies are thought to be initiated by function/dysfunction of vascular endothelial cells. The vascular endothelium constitutes the interface between the blood and the vessel wall, as such, it is exposed to mechanical forces produced by the arterial pressure variations during the cardiac cycle, and i.e., the blood flow induced wall shear stress and the circumferential cyclic stretch of the whole vessel wall. Blood flow interaction with the vascular endothelium represent a specialized example of mechanical regulation of cell function that has important physiological and pathological consequences. Blood flow plays an important role in the morphogenesis of blood vessels, for instance increase in blood flow induces dilation of the blood vessels while decrease in blood flow cause reduction in blood vessel diameter.
The remodeling of blood vessels accompanies physiological and pathological processes such as, angiogenesis and vasculogensis, neoplastic growth, atherosclerosis, hypertension and restenosis. Vessel remodeling occurs in response to both biochemical and biomechanical stimuli, and has been shown to be dependant on the presence of an intact endothelial layer. By virtue of their anatomical position, endothelial cells are constantly exposed to hemodynamic forces generated by the flowing blood, forces that consist of fluid shear stress, cyclic strain and pressure. These forces affect endothelial cells structure and function, changes that are often mediated by the induction or shut-off of endothelial genes.
This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide. In one embodiment, the genes code for transcription factors, cell cycle proteins, signaling molecules, degrading proteins, transmembrane protein, enzyme, secreted factors, growth factor, angiogenic factor, or thrombogenic factor. It is contemplated herein, that the vector comprises multiple genes.
As provided herein, the vector comprising a nucleic acid or gene coupled to the SSRE which encodes a peptide or protein. Any gene or nucleic acid encoding a protein or peptide may be used. In one embodiment the nucleic acid or gene which encodes a peptide or protein which is angiogenic and/or vaculogenic. Angiogenic genes and proteins are known to those skilled in the art. In another embodiment the nucleic acids encodes the following proteins or growth factors: NFkB, MCP-1, NFAT, spl/Egr 1, c-fos, c-jun, c-myc, PDGF A, PDGF B, TM, b-FGF, TGF, eNOS, HO-1, cu/Zn SOD, VCAM-1, I-CAM, Connecxin 43, FLT-1 , FLK-1, VCAM, PGI synthase, smad 6, smad 7, TGF. HB-EG CNP, COX-2, thrombospondin, ICAM, ELAM-1, cyclooxygenase, angiopeitin 1, tenscin, angiopeitin 2, laminin Bl, IL-1, 11-2, 11-3, 11-4, 11-4, IL-6, 11-7, 11-8, 11-9. 11-10, 11-1 1 , 11-12, ACE , ICE, Vascular Endothelial Growth Factor (VEGF) Genbank Accession Nos: 2851617, 1718152, 137821. 3402014, 3402011, 3402013, 3402010. 3402008, 3402009, 3056721, 549320, and 451322, Placenta Growth Factor 1 and 2 (PLGF-l/PLGF-2) Genbank Accession No: 1709656, EPAS-1 Genbank Accession No:391429, EEGIR-3 Genbank Accession No. 1718189, FLT-1 Genbank Accession No. 125361, EDRF (Endothelin-Derived Relaxin Factor, hepatocyte growth factor/Scatter factor (HGF/SF), Platelet Derived Endothelial Cell Growth Factor (PD-ECGF), Urokinase Plasminogen Activator (uPA), or Cartillage Type II Collagen, a tumor suppressor gene, tyrosine kinases, or serine kinases. It is contemplated that the vector comprises alleles, alternative-splicing products, analogs, fragments, isoenzymes, mimetics, mutants, synthetic forms or variants of the nucleic acid. Additional genes, proteins are described in U.S. Patents 5,332,671 , 5712380, (Ferrara et al.), 5,240,848 (Keck et) and 5,219,739 (Tischer et al.), 5,338,840 (Bayne et al.) and 5,532,343 (Bayne et al.); International Patent Application WO in 5/24473 (Hu et al.) International Patent Application WO 981 10071 PCT/LJS97/ 15471 , European Patent Documents 476 983 (Bayne et al.), 506 477 (Bayne et al.), and 550 296 (Sudo et al.), and Japanese Patent Documents 1038100, 21 17698, 2279698, and 3178996 which are incorporated by reference.
The angiogenic genes or proteins include natural and recombinant forms of a variety of peptides, e.g. growth factors and related molecules which are able to promote endothelial and smooth muscle cell proliferation leading to the formation of new blood vessels (angiogenesis).
This invention provides a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of. or activity of the protein or peptide,. This invention contemplates molecules which inhibit trans acting factors from combining with the promoter of endogenic gene. For example, by creating a promoter which contains target elements for binding trans acting factors which will then compete for these trans acting factors.
In one embodiment the Shear Stress Response Elements (SSRE) of the vectors described herein are from regulatory elements of growth factors, thrombogenic factors or angiogenic genes. Further, the vector may comprises a reporter gene, or a selection marker. In one embodiment the nucleic acids are in a sense orientation. In another embodiment the nucleic acids are in a sense or an anti-sense orientation. Each of the nucleic acids may be in a 5' to 3' direction in the vector or may be in a 3' to 5' direction in the vector.
As defined herein "Shear Stress Response Element" or "SSRE" means a nucleic acid from the regulatory elements of genes which regulates endothelial genes through shear stress forces. The gene may encode for growth factors, thrombogenic factors or angiogenic genes. A SSRE is an element necessary and/or sufficient to induce (or suppress) gene expression in endothelial cells exposed to shear stress. It is contemplated by this invention that the vector comprises a single nucleic acid of the SSRE or multiple SSREs. For example, in one embodiment the vector comprises the Shear Stress Response Element PDGF-A. In another embodiment the vector comprises the Shear Stress Response Element PDGF-B. In another embodiment the vector comprises the Shear Stress Response Element TRE. In another embodiment the vector comprises the Shear Stress Response Element SPl. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element PDGF-B. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element TRE. In another embodiment the vector comprises the Shear Stress Response Element PDGF-B and the Shear Stress Response Element TRE. In another embodiment the vector comprises the Shear Stress Response Element PDGF-A and the Shear Stress Response Element SPl. In another embodiment the vector comprises the Shear Stress Response Element PDGF-B and the Shear Stress Response Element SP 1.
In the preferred embodiment the vector comprises multiple number of SSREs. In one embodiment the vector comprises the Shear Stress Response Element are Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE. In another embodiment the Shear Stress Response Elements are Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE In another embodiment the Shear Stress Response Elements are Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl . It is contemplated that this invention provides for a vector which comprises a mutiple number of different combinations of the Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE including but not limited to multiple combinations of each SSRE.
Further, this invention provides for a SSRE which binds to NFKB, NFAT, SPl, or Egrl. Further, this invention provides for a nucleic acid of a regulatory element or region which contains one or more the SSRE. This invention provides for SSRE which are binding sites for fos, and jun.
As defined herein a "SSRE PDGF-A" means a Platelet Derived Growth Factor- A which comprises the nucleic acid sequence as follows: GGGGGCGGGGGCGGGGG (SEQ ID NO. 1). As defined herein a "SSRE PDGF-B" means a Platelet Derived Growth Factor- B which comprises the nucleic acid sequence as follows: GAGACC (SEQ ID NO. 2). As defined herein a "SSRE TRE" means a nucleic acid which has the following sequence TGACTCC (SEQ ID NO. 3). As defined herein a "SSRE SPl " means a nucleic acid which has the following sequence GGGGCGGGCGG (SEQ ID NO. 4).
In another embodiment the vector comprises the following nucleic acid sequence CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCT (SEQ ID NO 5). In another embodiment the vector comprises the following nucleic acid sequenceTCGAGGGGGGCGGGGGCGGGGGTGACTCCGAGACCCCCACCCCCCG CCCCCGCCCCCACTGTGGCTCTGGGGGTCTAG (SEQ ID NO 6).In another embodiment the vector comprises the following nucleic acid sequence CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCTTCGAGGGGGGCGGGGGC GGGGGTGACTCCGAGACCCCCACCCCCCGCCCCCGCCCCCACTGTGGCTCTG GGGGTCTAG (SEQ ID NO 7).
As contemplated herein, SSREs of the promoter elements from genes that are regulated by shear stress include but are not limited to: Human 15-lipoxygenase gene, Genebank Accession No. U88317 at position 3350..3355, Kritzik,M.R., Ziober.A.F., Sigal,E. and Conrad.D.J., Biochim. Biophys. Acta (1997); Protein Kinase, Genbank Accession No. 2992634, Donadelli,R., Benatti,L., Remuzzi ., Morigi M., Gullans,S.R., Benigni,A., Remuzzi,G. and Noris,M. Biochem. Biophys. Res. Commun. 246 (3), 881-887 (1998); FEG-1 gene which is expressed by vascular endothelial cells under shear stress., Genbank Accession No. El 3350 and 3023539; Endothelin-converting enzyme (ECE-1) gene, Genbank Accession No. X91923 at position 233..238, Valdenaire,O, J. Biol. Chem. 270 (50), 29794-29798 (1995); and Beta-tubulin folding cofactor D, Genbank Accession No. AJ006417; PGI synthetase; conexin 43; c-myc; c-fos; c-jun; TGF; FGF; FGF; HO-1 ; Thrombomodulin; Tl rombospondin; Laminin Bl ; Mn/Cu/Zn SOD; ICAM-1 ; Endothlin-1 ; plasminogen activator 1 ; MADH dehydrogenase; acidic and basic fibroblast growth factors; vascular endothelial growth factors 1, 2, 3, A, B, C, and D; epidermal growth factor; transforming growth factors alpha and beta; tumor necrosis factor alpha; hepatocyte growth factor; vascular endothelium growth factor, EEGIR-3, FLT-1. VEGF, and isoforms, variants, mimetics, alternate splices, fragments and mutants thereof, placenta growth factor 1 and 2, endothelial pas domain protein-1, and insulin like growth factor. It is known by those skilled in the art how to localize element(s) within the promoter that are shear stress responsive. For example, one may employ 5-nested deletion analysis. Using computer analysis and electromobility shift assays (EMSA) one is able to localize the shear stress responsiveness to an element within the region, and ligating the nucleic acid into a promoter construct and transfected into endothelial cells.
In another embodiment the vector further comprising a reporter gene. Reporter genes are known to those skilled in the art. The vector may comprise the reporter gene with an SSRE without any additional nucleic acid which encodes a gene of interest or may include the nucleic acid which encodes a gene of interest. For example, one may use, but is not limited to, the following reporter genes: luciferase, β-galactosidase, or β-lacatamase. Other reporter genes include but are not limited to: β -lactamase and other antibiotic resistant gene, a cell surface marker as HC I or II sub-types, a receptor for growth factor or cell adhesion and any gene of interest for therapeutic reasons. Additionally, the vector may comprise a marker inserted may provide for prototrophy to an auxotrophic host, biocide resistance, e.g., antibiotics, or heavy metals, such as copper, or the like. The selectable marker gene sequence can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. Additional elements may also be needed for optimal . These elements may include splice signals, as well as transcription promoters, enhancers, and termination signals. cDNA expression vectors incorporating such elements include those described by Okayama, Molec. CelZ. Biol. 3:280(1983).
The transcribed gene under the SSRE can be also a gene that confirm resistant to a specific antibiotic as a selection marker in prokaryotes and eukaryotes cells (neomycin, tetracycline. kanamycine and other). The gene can be also a membrane protein as a screening marker (MHC I or II sub-type or other transmembrane protein as a receptor); The gene can be also encoding for a protein in an individual carrying a genetic defective gene product to be complement for therapeutic reasons. The gene can be also a secreted protein (enzymes or growth factors) that can be monitored by an external or internal biosensor.One attractive gene to be driven by SSRE is a gene encoding a secreted protein with an enzyme activity that can be monitored with a biosensor. This protein can be driven by the second unit of a bicistronic massage driven by SSRE to give low amount of gene products, however indicative of the SSRE activity. For in-vivo gene delivery, one can follow the activity of the second cistron to monitor on site (in-vivo) the first cistron. The second cistron include but not limited to lactate dehydrogenase, creatinase, esterase, alcohol dehydrogenase, all of which have characterized substrates and chemical reactions, and also enzymatic biosensor for such enzyme activities have been demonstrated in the art. A biosensor can be introduced in vivo to monitor SSRE activities for drug delivery or to be an indicative parameter of fluid shear stress. The SSRE vector could have one or more transcriptional units. For example, it can have an antibiotic selection marker and a Luciferase gene to monitor SSRE activity. The SSRE transcription unit can be monocistronic or bicistronic transcription unit, having IRES elements between the two genes.
Further, the SSRE vector can be used for selection of agonists and antagonists ligands, to shear stress signaling, from combinatorial peptide or antibody phage display libraries, for therapeutic means. Also, natural inhibitors or stimulators (from body fluids or other natural extracts) can be identified. In addition, this system can be used as an inducible system, to induce gene only when shear stress is applied. The methods described herein, provide functional screening (SSRE activity monitoring) and screening for target drug or target gene.
The Shear Stress Response Elements, include but are not limited to, cDNA, DNA, fragments, variants, mutants, alleles, synthetic forms, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art so long as the SSRE retains its function, i.e. regulation of endothelial genes by shear stresses. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties, intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.). The nucleic acid may be modified. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as sup 32P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation.
This invention provides screening for mutation within the gene of interest coupled to the SSRE sequences so as to identify sequences with stronger SSRE- activity as shear stress dependent transcription sequences. The SSRE sequences may be screened for more potent binding proteins, as well for compounds that enhance or inhibit protein binding to SSRE for therapeutic means.
In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R. M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (-1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).
A "nucleic acid" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules") and antisense, ribozyme, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA, RNA, and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA" is a DNA that has undergone a molecular biological manipulation. The phrase "nucleic acid encoding" refers to a nucleic acid molecule or gene which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid molecule include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell. "Substantial identity" or "substantial sequence identity" mean that two sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap which share at least 65-99 percent sequence identity, share at least 75 percent sequence identity, share at least 80 percent sequence identity, share at least 90 percent sequence identity, preferably at least 95 percent sequence identity, more preferably at least 99 percent sequence identity or more.
This invention provides for a replicable vector comprising the isolated nucleic acid molecule. The vector includes, but is not limited to: a plasmid, cosmid, phage or yeast artificial chromosome (YAC) which contains at least a portion of the isolated nucleic acid molecule. As an example to obtain these vectors, insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then ligated together with DNA ligase. Alternatively, linkers can be ligated to the insert DNA which correspond to a restriction site in the vector DNA, which is then digested with the restriction enzyme which cuts at that site. Other means are also available and known to an ordinary skilled practitioner.
The term "vector", refers to viral expression systems, autonomous self-replicating circular DNA (plasmids), and includes both expression and nonexpression plasmids. Where a recombinant microorganism or cell culture is described as hosting an "expression vector," this includes both extrachromosomal circular DNA and DNA that has been incorporated into the host chromosome(s). Where a vector is being maintained by a host cell, the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is incorporated within the host's genome.
Expression vectors which can be used other than adenovirus include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus, swinepox virus, pox virus, rhabdovirus, herpes simplex virus, baculovirus, herpes simplex virus, adeno-associated virus, retrovirus, cytomegalovirus, human cytomegalovirus, papillomavirus, Epstein Barr virus (EBV), mouse mammary tumor virus (MMTV), Moloney murine leukemia virus and plasmid and cosmid DNA vectors, to name but a few.
In one embodiment, the adenoviral vector is deficient in at least one essential gene function of the El region of the adenoviral genome, particularly the Ela region, more preferably, the vector is deficient in at least one essential gene function of the El region and part of the E3 region (e.g., an Xbal deletion of the E3 region) or, alternatively, the vector is deficient in at least one essential gene function of the El region and at least one essential gene function of the E4 region. Aadenoviral vectors deficient in at least one essential gene function of the E2a or E2b region and adenoviral vectors deficient in all of the E3 region also are contemplated here and are well known in the art. Furthermore, the viral vector's coat protein can be modified so as to incorporate a specific protein binding sequence.
The term "plasmid" refers to an autonomous circular DNA molecule capable of replication in a cell, and includes both the expression and nonexpression types. Where a recombinant microorganism or cell culture is described as hosting an "expression plasmid", this includes latent viral DNA integrated into the host chromosome(s). Where a plasmid is being maintained by a host cell, the plasmid is either being stably replicated by the cells during mitosis as an autonomous structure or is incorporated within the host's genome.
Regulatory elements required for expression include promoter or enhancer sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgarno sequence and the start codon AUG. Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or assembled from the sequences described by methods well-known in the art, for example the methods described above for constructing vectors in general. Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5* direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence. A nucleic acid sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g., ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.
Below is a list of viral promoters, cellular enhancers and inducible enhancers that may be used, which include but are not limited to the following: ventricular myocyte specific promoter, cytomegalovirus, human cytomegalovirus, inflammatory promoters, TNF promoter, Rous Sarcoma Virus, Prostate Specific Antigen, Probasin, Immunoglobulin Heavy Chain, Immunoglobulin Light Chain, T-Cell Receptor, HLA, Interferon, Interleukin-2, Interleukin-2 Receptor, MHC Class II, Actin, Muscle Creatine Kinase, Proalbumin (Transthyretin), Elastase I, Metallothionein, Collagenase, Albumin Gene, Fetoprotein, Globin, c-fos, c-Ha-ras, Insulin, Neural Cell Adhesion Molecule (NCAM), antirypole, 2B (TH2B) Histone, Muse or Type I Collagen, Glucose-Regulated Proteins (GRP94 and GRP78), Human Serum Amyloid A (SAA), Troponin I (TN I), Platelet-Derived Growth Factor, Duchenne Muscular Dystrophy, SV40, Polyoma, Retroviruses, Papilloma Virus, Hepatitis B Virus, or Gibbon Ape Leukemia Virus.
This invention provides a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier.
This invention provides a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier.
In one embodiment the Shear Stress Response Elements (SSRE) are from promoters of growth factors, thrombogenic factors or angiogenic genes. The pharmaceutical composition comprises any of the molecules described above.
In one embodiment, the vector of the pharmaceutical composition comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl.
In another embodiment, the vector of the pharmaceutical composition comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE. The present invention provides a method of regulating endothelial cell proliferation or anti-proliferation using the vector comprising the SSRE and the gene of interest coupled to the SSRE.
This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide wherein the Shear Stress Response Elements transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation. As contemplated herein, endothelial cells are vascular endothelial cells or capillary endothelial cells.
This invention provides a method of inhibiting endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation.
The SSRE of the vector comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl , or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation. This invention provides a method of stimulating endothelial cell proliferation comprising transfecting the endothelial cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and one or more genes which code for a protein or peptide, wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
This invention provides a method of modulating vascular permeability in a mammal, comprising administering to said mammal an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier; or a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Element to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby modulating vascular permeability in the mammal.
This invention provides a method of stimulating the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes which code for a protein or peptide and a suitable diluent or carrier, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby stimulating the formation, maturation or regression of blood vessels. This invention provides a method of inhibiting the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature "with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby inhibiting the formation, maturation or regression of blood vessels.
This invention provides a method of modulating genes or proteins involved in a diseases which comprises administering to a subject with the disease an effective amount of the pharmaceutical compositions and/or vectors described, above, wherein the pharmaceutical composition or vector is administered to the subject in the vasculature with the proviso that the vasculature has shear stress, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby modulating genes or proteins involved in the vascular diseases.
A method of down regulating angiogenesis comprising administering to the subject an amount of a pharmaceutical composition comprising a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide and a suitable diluent or carrier; or a vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, wherein the pharmaceutical composition or the vector is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby down regulating angiogenesis.
This invention provides a method of stimulating vasculogenesis and/or angiogenesis comprising contacting the cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TRE and a gene of interest which codes for a protein or peptide, thereby stimulating angiogenesis.
This invention provides a method of inhibiting' vasculogenesis and/or angiogenesis comprising contacting the cells with an effective amount of the vector which comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response
Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response
Element SPl, or a vector which comprises nucleic acids of Shear Stress Response
Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl . Shear Stress Response Element TRE, Shear Stress Response Element
PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element
TRE and Shear Stress Response Element SPl and a nucleic acid of an inhibitor or repressor of the gene of interest, wherein the nucleic acid is an antisense molecule which hybridizes with the sense RNA strand made by the gene and thereby inhibit synthesis of the corresponding gene, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide, thereby inhibiting angiogenesis.
A method of treating a subject having a vasculogenic and/or angiogenic disorder comprising administering to the subject an amount of the pharmaceutical composition comprises a vector which comprises nucleic acids of Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl, or a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl or the pharmaceutical composition comprises a vector which comprises nucleic acids of Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, and Shear Stress Response Element TR and a gene of interest which codes for a protein or peptide, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby treating the subject having the vasculogenesis and/or angiogenesis disorder.
Further, this invention provides further comprising administering to the subject an agent which acts as a vasoconstrictor, inflammatory agent, vasolidator, fibrinolytic activators, Tumor Necrosis Factor (TNF), or thrombotic factors.
Vasolidators are known to those skilled in the art. For example, the subject invention contemplates but are not limited to the following: prostacyclin, nitric oxide, natriuretic peptide or calcium antagonists. Vasoconstrictors are known to those skilled in the art. For example, the subject invention contemplates but are not limited to the following endothelin, thromboxan A2, angiotensin, kinins, kallikrein, and kininogen. Further, subject application incorporates in its entirety by reference the following: U.S. Pat. No. 5,594,021, Thienyl-, furyl- and pyrrolyl sulfonamides and derivatives thereof that modulate the activity of endothelin; U.S. Pat. No. 5,691,344, Vasoconstrictive substituted dihydropyranopyridines; U.S. Pat. No. 5,441,95 1, Lipoxin compounds; U.S. Pat. No. 5,767,160, Method and formulation of stimulating nitric oxide synthesis; U.S. Pat. No.5, 824,682, Vasoconstrictive dihydrobenzopyran derivatives;U.S. Pat. No. 5,468,746, Compounds active on the cardiovascular system; and U.S. Pat. No.5, 733,916, Prevention and treatment of ischemia-reperfusion and endotoxin-related injury using adenosine and purino receptor antagonists.
Fibrinolytic activators are known to those skilled in the art. For example subject application incorporates in its entirety by reference the following: U.S. Pat. No.4, 873,083, Fibrinolytic composition; U.S. Pat. No. 5,316,766, Thrombosis treatment with fibrinolytics and prostacyclins; U.S. Pat. No. 4,996,050, Fibrinolytic activity enhancer; U.S. Pat. No. 4,600,580, Novel enzyme derivatives; U.S. Pat. No. 5,302,390, Hybrid proteins of human plasminogen and human t-PA, pharmaceutical compositions and methods of treatment; and U.S. Pat. No. 4,568,545, Thrombolytic agent; U.S. Pat. No. 5,106,741, Tissue plasminogen activator (TPA) analogs. Thrombotic factors are known to those skilled in the art. For example subject invention application in its entirety by reference the following: U.S. Pat. No. 5,837,688, Use of thrombolytic reagents for prevention of vascular disease; U.S. Pat. No.5, 084,274, Inhibition of arterial thrombotic occlusion or thromboembolism; U.S. Pat. No.5, 509, 896, Enhancement of thrombolysis with external ultrasound; U.S. Pat. No. 5,380,299, Thrombolytic treated intravascular medical device; U.S. Pat. No.5,275,812, Method of treatment for myocardial infarction; U.S. Pat. No. 5,217,705, Method of diagnosing blood clots using fibrin-binding proteins; U.S. Pat. No. 5,637,299, Enhancement of thrombolytic therapy with deglycosylated forms of plasminogen; U.S. Pat. No. 5,643,915, Treatment of ischemia/reperfusion injury with thalidomide alone or in combination with other therapies; U.S. Pat. No. 5,021,044, Catheter for even distribution of therapeutic fluids; U.S. Pat. No. 4,582,854, 7-oxabicycloheptane substituted oxa prostaglandin analogs useful in the .treatment of thrombolytic disease.
Arteriogenic, neoplastic, cardiovascular, vasculogenic and/or angiogenic disorders are known to those skilled in the art. For examples the disorders include but are not limited to: cardiovascular disorders, arteriosclerosis, Monckeebrg's arteriosclerosis, atherosclerosis, diabetic arteriosclerotic disease, hypertension, arterial hypertension, renovascular hypertension, myocardial ischemic disorders, coronary artery disease, angina pectoris, myocardial infarction, occlusive arterial disorders, peripheral atherosclerotic disease, thromboangitis obliterans, functional peripheral arterial disorders, cardiac arrythmias, bundle branch block, sick sinus syndrome, cardiomyopathy, hyperlipidemia, congestive heart failure, mitral stenosis, ischemi, reperfusion, shock, restenosis, arterial inflammation, retinovasculative disorders, mascular degeneration, diabetes, hypercholesterolemia. plaque formation, osteoarthritis, method for promoting tissue repair and regeneration, wound healing, lung or bladder disorders.
Further, vasculogenic and/or angiogenic disorders include but are not limited to cancer. For example, cancers included but not limited to are as follows: cancers of the epithelia (e.g., carcinomas of the pancreas, stomach, liver, secretory glands (e.g., adenocarcinoma), bladder, lung, breast, skin (e.g., fibromatosis or malignant melanoma), reproductive tract including prostate gland, ovary, cervix and uterus); cancers of the hematopoietic and immune system (e.g., leukemias and lymphomas); cancers of the central nervous, brain system and eye (e. g., gliomas, neuroblastoma and retinoblastoma); and cancers of connective tissues, bone, muscles and vasculature (e.g., hemangiomas and sarcomas)).
Further, this invention provides for administration of vascularizing agents when treating a subject with an angiogenic and/or vasculogenic disorder. Vascularization agents are known to those skilled in the art. For example, such agents include but are not limited to the following:granulocyte macrophage-colony stimulating factor (GM-CSF), VEGF. Steel factor (SLF, also known as Stem cell factor (SCF)), stromal cell-derived factor (SDF- 1 ), granulocyte-colony stimulating factor (G-CSF), HGF, Angiopoietin- 1 , MCP, MMP's, integrinscadherins, Angiopoietin-2, M-CSF, b-FGF, and FLT-3 lignand, and effective fragment thereof, or a vector containing a DNA coding for such vasculanization modulating agents. Such materials have sometimes previously been described as "hematopoietic factors." and/or "hematopoietic proteins."
In another particular embodiment of the method, the amount of vascularization is sufficient to increase blood vessel size in the mammal. Methods for determining parameters of blood vessel size, e.g., length and circumference, are known in the field. Preferably, the amount of administered modulating agent is sufficient to increase blood vessel length between from about 10% to 50%, even more preferably about 20%, as determined by standard blood vessel assay.
The arterial tree which consists of large elastic and muscular vessels as well as arterioles and precapillaries vessels, is constantly exposed to hemodynamic forces varying widely in magnitude, frequency and direction. These forces consist of pressure acting perpendicular to the vessel wall, cyclic strain, and shear stress acting parallel to the wall, creating a frictional shear force on the surface of the endothelium. In large arteries the magnitude of shear stress is in the range of 10-40 dynes/cm2, and it is over imposed with the pulsatile characteristic of the flow producing a range of shear stresses and shear stress gradients. In area of unique morphologies, such as curvatures and bifurcations, the steady laminar flow is disrupted to create regions of separated flow that include recirculation sites, which themselves may vary with the cardiac cycle. These secondary flows modify the profile of the original laminar flow therefore dictating the shear stress acting on the endothelium in these specific regions. Studies including in-vitro modeling systems, as well as, in-vivo measurements suggest that the values of shear stress in these regions vary from negative, to zero (in areas of flow separation) and up to positive values of 40 dynes/cm . Under non-physiological conditions (hypertension) these values are even higher. Thus, hemodynamic forces are important stimuli effecting the biology of the endothelium, which plays a pivotal role in both physiological processes and pathological conditions (atherosclerosis, hypertension, thrombosis).
In one embodiment the magnitude of shear stress is 1-50 dynes/cm2. In another embodiment the magnitude of shear stress is 2-25 dynes/cm2. In another embodiment the magnitude of shear stress is 10-25 dynes/cm2. In another embodiment the magnitude of shear stress is 2-15 dynes/cm . In another embodiment of the method the magnitude of shear stress is 5-10 dynes/cm . In another embodiment of the method the magnitude of shear stress is 2-5 dynes/cm .
The vectors may be introduced into the desired host cells by methods known in the art, e.g., ex vivo viral vectors, particularly retroviral vectors, in vivo viral vectors, particularly defective viral vectors or adeno-associated virus vectors, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., U.S. Patent No. 5,580,859, which is incorporated by reference and Wu et al, 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,31 1, filed March 15, 1990).
In another embodiment the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33:153 Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289 Markowitz et al., 1988, J. Virol. 62:1120; Temin et al., U.S. Patent No. 5,124,263 International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al.; and Kuo et al., 1993, Blood 82:845. Retroviral vectors are especially attractive for transfecting solid tumors, since the cells of the tumor are replicating. Cell fusion (line 18) any cell fusion combination including but not limited to cell fusion between different cell type of different tissues origin, cell fusion between different species origin, cell fusion between mammalian and yeast or mammalian and prokaryote cell type. All these methods are known in the art as methods to transfer genetic materials. The vector may be introduced as a single vector or with a combination of other vectors, supplementing trans activity for the SSRE vector for enhances SSRE vector activities. For example. SSRE containing vector can be co-introduced with another vector that will introduce another genetic material to facilitate SSRE activities, to monitor transfection efficiency, to supply a missing component to the transfected cells (supplying helper function). Alternatively, the vector can be introduced in vitro or in vivo by lipofection (lysosome fusion, including but not limited to cationic liposome, synthetic or natural lyposomes and neutral lyposomes). For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417; see Mackey, et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031)). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner and Ringold, 1989, Science 337:387-388). The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells, in this instance tumor cells, e.g., via.tumor-specific cell surface receptors, represents one area of benefit. Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al., 1988, supra). Targeted peptides, e.g., hormones or neuro transmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.
It is also possible to introduce the vector ex vivo or in vivo as a DNA plasmid. DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, U.S. Patent No. 5,580,859, the contents of which are hereby incorporated by reference and e.g., Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,31 1, filed March 15, 1990).
The present invention provides a method for the delivery of the vector to an arterial cell, blood vessel or vasculature by being carried by a microdelivery vehicle such as cationic liposomes and adenoviral vectors. DNA encoding different proteins may be used separately or simultaneously. Also, the arterial cell in an artery or blood vessel may be contacted via a balloon catheter coated with a hydrogel polymer. Other treatment methods include percutaneous transluminal angioplasty (PTCA), "Cutting balloon" angioplasty, directional coronary atherectomy (DCA), rotational coronary atherectomy (RCA), Ultrasonic breaking catheter angioplasty, transluminal extraction catheter (TEC) atherectomy, Rotablator atherectomy, and excimer laser angioplasty (ELC A ). The vector described herein may be inserted by a single intra-femoral artery or intracoronary injection directly conducted deeply in the lumen of the one or both femoral or coronary arteries (or graft vessels) in an amount. U.S. Pat. No. 5792453 is hereby incoφorated in its entirety.
In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined with a polylysine-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus. vector. The trimolecular complex is then used to infect cells. The adenovirus vector permits efficient binding, internalization, and degradation of the endosome before the coupled DNA is damaged. Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct in situ administration (Nabel, 1992). Receptor-mediated gene transfer, for example, is accomplished by the conjugation of DNA (usually in the form of covalently closed supercoiled plasmid) to a protein ligand via polylysine. Ligands are chosen on the basis of the presence of the corresponding ligand receptors on the cell surface of the target cell/tissue type.
In another application the vector may be inserted/introduced by direct gene transfer of an expression vector. Alternatively, the vector by may implanted between the aorta and left ventricular myocardium, for induced site-directed neovascular development or administrating to the subject intrapericardial infusions. This provides exciting prospects for intervention in cardiac diseases in which myocardial oxygen supply is compromised and/or demand is increased. The induction of new collateral vessel formation should delay or halt the progression of coronary artery disease to myocardial infarction, as well as the advancement of ventricular hypertrophy to heart failure.
In yet another embodiment, the therapeutic compound can be delivered in a controlled release system into the vasculature. For example, the vector may be administered using intravenous injections, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321 :574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J. Neurosurg. 71 :105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 1 15-138 (1984)). Preferably, a controlled release device is introduced into a subject in proximity of the site of inappropriate immune activation or a tumor. Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).
Localized administration to the target tissue is accomplished by directly injecting the vector into the target tissue or by topically applying the vector to the target tissue. By the term "injecting," it is meant that the vector is forcefully introduced into the target tissue. Any suitable injection device can be used within the context of the present invention. Another example of an injection device which can be used within the context of the present invention includes minimally invasive injection devices. Such devices are capable of accessing the heart, for example, through small incisions of less than 5 inches and are designed to provide injections through a single lumen, in contrast to the multiple injection device described above. To allow for the need for multiple injections with a specific geometry, a marking system can be employed so that the sites of previous injections are well delineated. Minimally invasive injection devices can comprise injector tips which are flexible and steerable to allow access via small incisions to the curved outer surface of the heart, for example, which exists at varying angles with respect to the limited aperture window required with minimally invasive surgeries. Such an injection can be administered from any suitable surface of the heart (i.e., endocardially and/or epicardially).
While administration of a dose of the vector can be accomplished through a single application (e.g., a single injection or a single topical application) to the target tissue, preferably, administration of the dose is via multiple applications of the angiogenic vector. The multiple applications can be 2, 3, 4, 5, or more applications, preferably 5 or more applications, more preferably 8 or more applications, and most preferably at least 10 applications. Multiple applications provide an advantage over single applications in that they can be manipulated by such parameters as a specific geometry defined by the location on the target tissue where each application is administered. The specific geometry of the multiple applications is defined by the location on the target tissue, either in two- or three-dimensional space, where each application of the ector is administered. The multiple applications preferably are spaced such that the points of application are separated by up to about 4 cm (e.g., about 0.5-4 cm), more preferably up to about 3 cm (e.g., about 1-3 cm), and most preferably up to about 2 cm (e.g., about 1-2 cm).
Preferably, a single application will be administered for about every 0.5-15 cm2 of the plane, more preferably for 15 about every 1-12 cm2 of the plane, and most preferably for about every 1.5-7 cm2 of the plane. The depth of the plane is preferably about 1-10 mm, more preferably about 2-7 mm, and most preferably about 3-5 mm. In three-dimensional space, a single application preferably is administered for up to about 50 cm (e.g., about 0.5-50 cm of target tissue, more preferably for up to about 35 cm (e.g., about 1-35 cm of target tissue, and most preferably for up to about 15 cm (e.g., about 3-15 cm) of target tissue. Furthermore, the multiple applications can define any suitable pattern or specific geometry.
In one embodiment, the vector or naked SSRE nucleic acid may be administered within a biocompatible polymer.Biocompatible polymers are known to those skilled in the art, see WO 97/16176, PCT/CA96/00725 which is incorporated by reference. In another embodiment, the vector or naked SSRE nucleic acid may preferably be implanted in the form of a disk, fibre or microsphere, with microsphere being the most preferred form. Preferably, the microsphere has a diameter no greater than about 500 m, more preferably no greater than about 200 pm, and most preferably from less than about 10 ,UII to about 50 m. In another embodiment, the vector or naked SSRE nucleic acid is implanted into the peripheral ischemic tissue or in blood vessels close to the ischemic tissue to stimulate the growth of blood vessels or collaterals. In another embodiment, the vector or naked SSRE nucleic acid is incorporated into a wound care product applied to the surface of a wound such as a chronic wound or burn. Wound care products may be wet dressings, dry dressings, occlusive dressings, non-occlusivedressings, wound pastes, or any other product applied to a wound.
The disclosed microcapsules or microspheres which are any polymeric membrane that encloses an interior core of a different material, can be administered to a subject by various means, including implantation, injection, and infusion, via cannulas, catheters, pipette or directly through a needle from a syringe or using forceps or a trocar. When implanted into the subject the microcapsules and microspheres according to the present invention will become surrounded with well vascularized tissue.
Preferred biocompatible polymers for use in the present invention include polyacrylates, polyphosphazenes, various vinyl polymers including polyvinyl chloride,polyacrylonitrile, polyvinyl acetate, ethylene vinyl acetate, polyvinyl alcohol copolymers, polyvinyl amine copolymers, polyimides, polyether ketones, polysulphones, siloxanes, polyurethanes and polyamides, polycarbonates, polyesters and bioresorbables such as polyanhydrides, polyorthoesters, polycaprolactones, polyamino acids, polylactic/glycolic acid copolymers and polyhydroxybutyrates. More preferred biocompatible polymers are polyacrylates, with hydroxyethyl methacrylate-methyl methacrylate (HEMA-MMA) and hydroxyethyl methacrylate-methyl methacrylate-methacrylic acid (HEMA-MMA-MAA).
This invention provides administrating the vector or naked SSRE nucleic acid via intravascular catheters. Intravascular catheters and stents for delivery of drugs are known to those skilled in the art. For example, Patent Nos. 5,180,366; 5,171,217; 5,049,132; and 5,021,044;and PCT Publications WO 93/08866, WO 92/1 1895 and WO 97/123256 which are hereby incoφorated by reference.
Tissues to be treated by the present invention will typically be adjacent to blood vessels, within the blood vessel, or more typically being adjacent to coronary and peripheral arteries, where the vector or naked SSRE nucleic acid is delivered transmurally within the adjacent blood vessel to promote angiogenesis from the delivery site within the blood vessel into the surrounding tissue. The target tissue will usually be ischemic, i.e., deprived of blood flow, but the present invention might also find use with promoting angiogenesis in non-ischemic tissues. The phrase "body lumen" will generally refer to blood vessels, including portions of the arterial vasculature and venous vasculature. Body lumen wall includes the neointimal, intimal, medial, adventitial and perivascular spaces, adjacent to the target site.
For example, delivery of the vector according to the methods of the present invention could be performed after balloon angioplasty to enhance blood perfusion into ischemic tissue surrounding the treated stenotic region. Delivery of vector or naked SSRE nucleic acid could also be combined with delivery of other therapeutic agents intended for treating coronary artery disease, such as anti-5 thrombotic and fibrinolytic agents. Most commonly, balloon catheters having expandable distal ends capable of engaging the inner wall of a blood vessel and infusing an angiogenic factor directly therein are well-described in the patent literature. See, for example, U.S.Patent Nos. 5,318,531; 5,304,121 ; 5,295,962; 5,286,254; 5,254,089; 5,213,576; 5,197,946; 5,087,244; 5,049,132; 5,021,044; 4,994,033; and 4,824,436 which are incoφorated by reference.
Ultrasonically assisted drug delivery catheters(phonophoresis devices) are described in U.S. Patent Nos. 15 5,362,309; 5,318,014; and 5,315,998. Other iontophoresis and phonophoresis drug delivery catheters are described in U.S. Patent Nos. 5,304,120; 5,282,785; and 5,267,985. Finally, sleeve catheters having drug delivery lumens intended for use in combination with conventional angioplasty balloon catheters are described in U.S. Patent Nos. 5,364,356 and 5,336,178.
It would also be possible to deliver the vector or naked SSRE nucleic acid by applying a thin layer of a hydrogel,glycosaminoglycans, or other polymeric carrier matrix to the endoluminal wall at the target location. Usually, the polymeric carrier will be biodegradable or bioeluting and serve as a temporary wall support while the vector or naked SSRE nucleic acid are released over time.
As can be readily appreciated by one of ordinary skill in the art, the methods and pharmaceutical compositions of the present invention are particularly suited to administration to a mammal, preferable a human subject.
As used herein, "pharmaceutical composition" could mean therapeutically effective amounts of the vector of the invention together with suitable diluents, preservatives, solubilizers, emulsifiers, adjuvant and/or carriers. A "therapeutically effective amount" as used herein refers to that amount which provides a therapeutic effect for a given condition and administration regimen. Such compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g., Tris-HCL, acetate, phosphate), pH and ionic strength, additives such as albumin or gelatin to prevent absoφtion to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), solubilizing agents (e.g., glycerol, polyethylene glycerol), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g., lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or incoφoration of the material into or onto particulate preparations of polymeric compounds such as polylactic acid, polglycolic acid, hydrogels, etc, or onto liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Other embodiments of the compositions of the invention incoφorate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral. In one embodiment the pharmaceutical composition is administered parenterally, intratumorally, paracancerally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, intravascularly, subcutaneously, intraperitonealy, intraventricularly, intracranially.
Further, as used herein "pharmaceutically acceptable carrier" are well known to those skilled in the art and include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions.
Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobial, antioxidants, collating agents, inert gases and the like.
The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., Immunology, Second Ed., 1984, Benjamin/Cummings: Menlo Park, California, p. 384). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvant include, but are not limited to, complete Freud's adjuvant, incomplete Freud's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol. Preferably, the adjuvant is pharmaceutically acceptable.
Controlled or sustained release compositions include formulation in lipophilic depots (e.g. fatty acids, waxes, oils). Also comprehended by the invention are particulate compositions coated with polymers (e.g. poloxamers or poloxamines) and the compound coupled to antibodies directed against tissue-specific receptors, ligands or antigens or coupled to ligands of tissue-specific receptors. Other embodiments of the compositions of the invention incoφorate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral. Suitable excipients are, for example,. water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.
An active component can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms. Pharmaceutically acceptable salts include the acid addition salts and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.
The pharmaceutically acceptable form of the composition includes a pharmaceutically acceptable carrier. In the therapeutic methods and compositions of the invention, a therapeutically effective dosage of the active component is provided. A therapeutically effective dosage can be determined by the ordinary skilled medical worker based on patient characteristics (age, weight, sex, condition, complications, other diseases, etc.), as is well known in the art. Furthermore, as further routine studies are conducted, more specific information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients, and the ordinary skilled worker, considering the therapeutic context, age and general health of the recipient, is able to ascertain proper dosing. Generally, for intravenous injection or infusion, dosage may be lower than for intraperitoneal, intramuscular, or other route of administration. The dosing schedule may vary, depending on the circulation half-life, and the formulation used. The compositions are administered in a manner compatible with the dosage formulation in the therapeutically effective amount. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably one to several, milligrams of active ingredient per kilogram body weight of individual per day and depend on the route of administration. Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Alternatively, continuous intravenous, infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.
This invention provides a method for detecting shear stress or a shear stress related condition in a subject, comprising administering to the subject an amount of the vector which comprises one or more Shear Stress Response Element and a reporter gene, wherein the gene is activated in a shear stress environment, thereby detecting shear stress or a shear stress related condition in the subject.
This invention provides a method for screening test compounds for the ability to regulate endothelial cell expression or angiogenesis and/or vasculogenesis comprising: (a) contacting a endothelial cells with the compound to be tested; (b) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the test compound; (c) stimulating endothelial cells by introduction of the vector provided herein; (d) determining the amount or expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis produced as a result of the vector; (e) comparing the amount of angiogenesis and/or vasculogenesis produced as a result step (b) to that of step (d), wherein an increased amount of expression of the endothelial cells or the amount of angiogenesis and/or vasculogenesis of the test compound means that the test compound regulates endothelial cell expression angiogenesis and/or vasculogenesis. In one embodiment the test compounds are Shear Stress Response Elements, or promoter regions of angiogenic genes.
A "test composition", as used herein, is any composition such as a gene, SSRE, a nucleic acid sequence, a polypeptide, peptide fragment or composition created through the use of a combinatorial library or other combinatorial process that can be assayed for its ability to function in given capacity or compound which mimics the activity of the complex. Often such a test composition, nucleic acid sequence or polypeptide is, because of its sequence or structure, suspected of being able to function in a given capacity.
Any screening technique known in the art can be used to screen for regulators or modulators of angiogenesis and/or vasculogenesis.. Identification and screening of antagonists or agonist is further facilitated by comparing the result of the test composition with the result of the vector described hereinabove These techniques provide for the rational design or identification of agonists and antagonists. U.S. Pat. No. 5,165,938, Screening assays for compounds is incorporated in its entirety.
This invention provides methods to monitor shear stress activities, to screen and select for target genes, for gene therapy in other organs and methods of identifying and describing genes which are differentially expressed in vascular disease states, relative to their expression in normal, or non-cardiovascular disease states and a method for the identification and therapeutic use of compounds as treatments of vascular disease.
This invention provides methods for the diagnostic monitoring of patients undergoing clinical evaluation for the treatment of vascular diseases, and for monitoring the efficacy of compounds in clinical trials. Because the SSRE of this invention are modulated, i.e up-regulated or down-regulating, treatment methods can be designed to enhance or increase the expression of these genes which are coupled to the SSREs, particularly in endothelial cells. In addition, detecting expression of these genes in low amounts of normal expression provides for the diagnosis of disease.
This invention provides methods for the identification of genes which are involved in vascular disease. Such genes may represent genes which are differentially expressed in vascular disease conditions relative to their expression in normal, or non-cardiovascular disease conditions. Such differentially expressed genes may represent "target" and/or "fingerprint" genes. "Differential expression" as used herein refers to both quantitative as well as qualitative differences in the genes' temporal and/or tissue expression patterns. Thus, a differentially expressed gene may have its expression activated or completely inactivated in normal versus vascular disease conditions, or under control versus experimental conditions. Such a qualitatively regulated gene will exhibit an expression pattern within a given tissue or cell type which is detectable in either control or cardiovascular disease subjects, but is not detectable in both. Alternatively, such a qualitatively regulated gene will exhibit an expression pattern within a given tissue or cell type which is detectable in either control or experimental subjects, but is not detectable in both. "Detectable", as used herein, refers to an RNA expression pattern which is detectable via the standard techniques of differential display, reverse transcriptase- (RT-) PCR and/or Northern analyses, which are well known to those of skill in the art. Alternatively, a differentially expressed gene may have its expression modulated, i.e., quantitatively increased or decreased, in normal versus cardiovascular disease states, or under control versus experimental conditions. The degree to which expression differs in normal versus cardiovascular disease or control versus experimental states need only be large enough to be visualized via standard characterization techniques, such as, for example, the differential display technique described below. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to quantitative RT-PCR and Northern analyses.
Differentially expressed genes may be further described as target genes and/or fingeφrint genes. "Fingeφrint gene," as used herein, refers to a differentially expressed gene whose expression pattern may be utilized as part of a prognostic or diagnostic cardiovascular disease evaluation, or which, alternatively, may be used in methods for identifying compounds useful for the treatment of cardiovascular disease. A fingeφrint gene may also have the characteristics of a target gene. "Target gene", as used herein, refers to a differentially expressed gene involved in vascular disease in a manner by which modulation of the level of target gene expression or of target gene product activity may act to ameliorate symptoms of cardiovascular disease. A target gene may also have the characteristics of a fingerprint gene. A variety of methods may be utilized for the identification of genes which are involved in cardiovascular disease which are known to those skilled in the art.
For example, test cells, Cultured HUVEC monolayers are exposed to laminar sheer stress by in a specialized apparatus containing liquid culture medium, may also be compared to unrelated cells (e.g., fibrobiasts) that are also treated with the compound, in order to screen out generic effects on gene expression that might not be related to the disease. Such generic effects might be manifest by changes in gene expression that are common to the test cells and the unrelated cells upon treatment with the compound.
In order to identify differentially expressed genes, RNA, either total or mRNA, may be isolated from one or more tissues of the subjects utilized in paradigms such as those described earlier in this Section. RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique which does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel, F. M. et al., eds., 1987-1993, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. New York, both of which are incoφorated herein by reference in their entirety. Additionally, large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, P. (1989, U.S. Pat. No. 4,843,155), which is incorporated herein by reference in its entirety.
Transcripts within the collected RNA samples which represent RNA produced by differentially expressed genes may be identified by utilizing a variety of methods which are well known to those of skill in the art. For example, differential screening (Tedder, T. F. et al., 1988, Proc. Natl. Acad. Sci. USA 85:208-212), subtractive hybridization (Hedrick, S. M. et al., 1984, Nature 308: 149-153; Lee, S. W. et al., 1984, Proc. Natl. Acad. Sci. USA 88:2825), and, preferably, differential display (Liang, P., and Pardee, A. B., 1993, U.S. Pat. No. 5,262,311, which is incoφorated herein by reference in its entirety), may be utilized to identify nucleic acid sequences derived from genes that are differentially expressed.
Subtractive hybridization techniques generally involve the isolation of mRNA taken from two different sources, e.g., control and experimental tissue, the hybridization of the mRNA or single-stranded cDNA reverse-transcribed from the isolated mRNA, and the removal of all hybridized, and therefore double-stranded, sequences. The remaining non-hybridized, single-stranded cDNAs, potentially represent clones derived from genes that are differentially expressed in the two mRNA sources. Such single-stranded cDNAs are then used as the starting material for the construction of a library comprising clones derived from differentially expressed genes.
The differential display technique describes a procedure, utilizing the well known polymerase chain reaction (PCR; the experimental embodiment set forth in Mullis, K. B., 1987, U.S. Pat. No. 4,683,202) which allows for the identification of sequences derived from genes which are differentially expressed. First, isolated RNA is reverse-transcribed into single-stranded cDNA, utilizing standard techniques which are well known to those of skill in the art. Primers for the reverse transcriptase reaction may include, but are not limited to, oligo dT-containing primers, preferably of the reverse primer type of oligonucleotide described below. Next, this technique uses pairs of PCR primers, as described below, which allow for the amplification of clones representing a random subset of the RNA transcripts present within any given cell. Utilizing different pairs of primers allows each of the mRNA transcripts present in a cell to be amplified. Among such amplified transcripts may be identified those which have been produced from differentially expressed genes.
PCR reaction conditions should be chosen which optimize amplified product yield and specificity, and, additionally, produce amplified products of lengths which may be resolved utilizing standard gel electrophoresis techniques. Such reaction conditions are well known to those of skill in the art, and important reaction parameters include, for example, length and nucleotide sequence of oligonucleotide primers as discussed above, and annealing and elongation step temperatures and reaction times. The pattern of clones resulting from the reverse transcription and amplification of the mRNA of two different cell types is displayed via sequencing gel electrophoresis and compared. Differences in the two banding patterns indicate potentially differentially expressed genes. Once potentially differentially expressed gene sequences have been identified via bulk techniques such as, for example, those described above, the differential expression of such putatively differentially expressed genes should be corroborated. Corroboration may be accomplished via, for example, such well known techniques as Northern analysis and/or RT-PCR.
Additionally, methods may be employed which result in the simultaneous identification of pathway genes which encode the protein interacting with a protein involved in cardiovascular disease. These methods include, for example, probing expression libraries with labeled protein known or suggested to be involved in cardiovascular disease, using this protein in a manner similar to the well known technique of antibody probing of lambda gt 1 1 libraries.
Compounds identified via assays such as those described herein may be useful, for example, in elaborating the biological function of the target gene product, and for ameliorating diseases discussed above. In instances whereby a disease condition results from an overall lower level of target gene expression and/or target gene product in a cell or tissue, compounds that interact with the target gene product may include compounds which accentuate or amplify the activity of the bound target gene protein.
In addition, animal-based cardiovascular disease systems, such as those described, may be used to identify compounds capable of ameliorating cardiovascular disease symptoms. Such animal models may be used as test substrates for the identification of drugs, pharmaceuticals, therapies, and interventions which may be effective in treating cardiovascular disease. For example, animal models may be exposed to a compound, suspected of exhibiting an ability to ameliorate cardiovascular disease symptoms, at a sufficient concentration and for a time sufficient to elicit such an amelioration of cardiovascular disease symptoms in the exposed animals. The response of the animals to the exposure may be monitored by assessing the reversal of disorders associated with cardiovascular disease, for example, by counting the number of atherosclerotic plaques and/or measuring their size before and after treatment. Antisense and ribozyme molecules which inhibit expression of the target gene may also be used in accordance with the invention to inhibit the aberrant target gene activity. Among the compounds which may exhibit the ability to ameliorate cardiovascular disease symptoms are antisense, ribozyme, and triple helix molecules.
The present invention provides a kit comprising the all the essential materials and reagents required. This generally will comprise selected expression constructs. Also included may be various, media for replication of _ the expression constructs and host cells for such replication. Such kits will comprise distinct containers for each individual reagent. When the components of the kit are provided in one or more liquid solutions, the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred. For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case, the container means may itself be an inhalent, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the body, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit. The components of the kit may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
The kits of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained. Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalent, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle. The following examples are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention.
EXPERIMENTAL DETAILS SECTION
EXAMPLE 1: Construction of "synthetic" shear stress responsive hybrid promoter constructs based on known SSREs.
MATERIALS AND METHODS
Cone - Plate shear stress apparatus.: A cone-plate viscometer was used, the design of which and the operating parameters have been described in details (26, 36). Shear stress is produced in the fluid contained between a stationary base plate and a rotating cone. By adjusting the cone angle, the viscosity of the medium and the cone rotational speed a wide broad of shear stress magnitudes (1-50 dynes/cm) and patterns (laminare, turbulent, disturbed-laminar and oscillatory) can be achieved. Confluent endothelial monolayers can be grown either on 11 mm in diameter twelve tissue culture coated coverslips to achieve multiple sampling under the same flow and medium conditions, or alternatively, on a 17 cm in diameter tissue culture coated coverslip for molecular biology procedures requiring high cell quantities. These two configurations enable promoter analysis (deletion and hybrid promoter systems) in transfected endothelial cells, as well as, electro mobility shift assays (EMSA), run-on experiments, RNA and protein extraction, and the results of which are described in the following sections.
Four positive SSREs were defined and tested, which include the PDGF/B SSRE which binds NFkB and NFAT, the PDGF/A SSRE which binds Spl and Egrl, the MCP-1 TRE which is binding site for fos and jun and the tissue factor SSRE, which is a binding site for Spl. Interestingly, most of these promoters contain more than one of the described SSREs. PDGF-B promoter contains a binding site for fos and jun and an spl binding site in addition to the PDGF/B-SSRE. MCP-1 encodes for the PDGF/B-SSRE in addition to its TRE site. Tissue factor promoter contains NFkB, fos and jun binding sites, in addition to its spl/SSRE site. Shear stress responsiveness in vivo, is the result of the cooperative action of several SSREs in each promoter. The vector pGL2-promoter, as shown in Figure 1 , containing the luciferase gene and the SV40 promoter (Promega, Madison, WI, U.S.A) was used as a backbone to all of the described constructs.
5 Two oligonucleotides containing a combination of the known SSRE's were ligated into this backbone:
1. NR1 NR2-Luc:
o CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCT
This oligonucleotide contains the PDGF-B/SSRE sequence (GAGACCCCC) twice, the Sp-1 binding site (GGGGCGGGGCG) twice, the TRE site (TGACTCC) twice and polylinkers to the restrictions enzymes Miul and Xhol.
2. NR3/NR4-Luc:
TCGAGGGGGGCGGGGGCGGGGGTGACTCCGAGACCCCCACCCCCCGCCCCC GCCCCCACTGTGGCTCTGGGGGTCTAG
This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bglll. These constructs were ligated 5 'to the SV40 promoter (both NR1/NR2 and NR3/NR4) to create the vectors 5' NR1/NR2-Luc and 5' NR3 NR4-Luc and also 3' to the luciferase gene (3' NR3/NR4-Luc) to test the positional effect of the SSREs. These constructs were used to transfect endothelial cells, and their expression was compared to already existing hybrid promoters containing each of the SSREs alone.
Transfection of endothelial cells:
The efficiency of transfection of primary cells in general, and more specifically primary endothelial cells, is very low (1-5%). In order to detect significant differences in the inducibility of the various SSRE constructs, and since the inducibility of endothelial genes containing the SSREs is only about 2-5 folds, higher efficiency of transfection should be achieved. To that end several commercially available transfection kits as well as a modified calcium phosphate method adapted by to suit endothelial cells were used. In these experiments three kits were used: The Tfx 20 and 50 (Promega, U.S.A). Fugene (Gibco-BRL, U.S.A) and Effectine (Qiagene, U.S.A). Endothelial cells from arterial and capillary origin (Bovine Aortic Endothelial cells -BAEC, and Bovine brain Capillary Edothelial cells - BBC were used for transfecion.
The efficiencies of transfection of BAEC with the various techniques were: Modified calcium phosphate (concentration of sodium hydrogen phosphate 1.4 mM),22%, Effectine - 19%, Fugene - 15%, Tfx 20 - 16%, and Tfx 50-20%. The efficiencies of transfection of BBC with the various methods were: Modified Calcium phosphatase: 8%, Effectine - 15%, Fugene - 15%, and Tfx 20 - 13% Tfx 50 - 7%.
Transfection of SSRE constructs into endothelial cells: Endothelial cells were transfected in triplicate with three constructs: NR1/2 which contains the combination of all four SSREs, SSRE-Luc which contains a single copy of the PDGF-B/SSRE and the core plasmid PGL, and co-transfected with the Renilla luciferase vector. Two days after transfection the cells were transferred to a medium containing 5% calf serum and either incubated under static conditions or exposed to shear stress (10 dynes/cm , 2 hrs). The cells were extracted and the ratio luciferase/renilla luciferase was calculated. The induction of expression was calculated for the average ratio of the triplicates in shear stress versus, static experiments.
RESULTS
Table 1: The induction of SSRE-hybrid promoter vectors by shear stress.
Figure imgf000049_0001
Table II. The induction of SSRE-hybrid promoter vectors by shear stress
Figure imgf000049_0002
EXAMPLE 2: Transfection of NR3/NR4 and NR1/2/3/4
The vector pGL3 -enhancer, as shown in Figure 2, containing the luciferase gene and the SV40 promoter (Promega, Madison, WI, U.S.A) was used as a backbone to all of the described constructs.
Two oligonucleotides containing a combination of the known SSRE's were ligated into this backbone:
1. NR3/NR4-Luc:
TCGAGGGGGGCGGGGGCGGGGGTGACTCCGAGACCCCCACCCCCCGCCCCC GCCCCCACTGTGGCTCTGGGGGTCTAG
This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A and from the TF promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bgll. -These constructs were ligated 5'to the SV40 promoter (both NR1/NR2 and NR3/NR4) to create the vectors 5' NR1/NR2-Luc and 5' NR3/NR4-Luc and also 3' to the luciferase gene (3' NR3/NR4-Luc) to test the positional effect of the SSREs. These constructs were used to transfect endothelial cells, and their expression was compared to already existing hybrid promoters containing each of the SSREs alone.
1. NR1/NR2/NR3/NR4-Luc:
CGCCTGAGACCCCCGGGGCGGGGCGGAGACCCCCTGACTCCCCACTCTGGG GGCCCCGCCCCGCCTCTGGGGGACTGAGGGAGCTTCGAGGGGGGCGGGGGC GGGGGTGACTCCGAGACCCCCACCCCCCGCCCCCGCCCCCACTGTGGCTCTG GGGGTCTAG
This oligonucleotide contains the PDGF-B/SSRE sequence (GAGACCCCC) three times, the Sp-1 binding site (GGGGCGGGGCG) twice, the TRE site (TGACTCC) twice and polylinkers to the restrictions enzymes Miul and Xhol and This oligonucleotide contains the Spl /Egrl sequence from the PDGF-A promoter (GGGGGCGGGGGCGGGGG) twice, the PDGF-B/SSRE once (GAGACCCCC), the TRE site (TGACTCC) once, and polylinkers to the restriction enzymes Xhol and Bgll. REFERENCES
1. Breier G., Damert A., Plate KH and Rissau W., 1997. Thrombosis and Haemostatis. 78:678-83.
2. Iruela-Arispe ML and Dvorak HF 1997. Thrombosis and Haemostatis 78:672-77.
3. Folkman J. and D'Amore PA 1996. Cell 87: 1 153-56.
4. Schapper W. and Ito WD 1996. Circ. Res. 79-31 1. 5. Ware J.A. and Simons M. 1997. Nature Med. 3: 158-64.
6. Hannahan D. 1997. Science 277:48-50.
7. Ferrara N., Carver-Moore K. Chen H., et al. 1996. Nature 380:439-42.
8. Shalaby F., Rossant J., Yamaguchi T.P., et al. 1995 Nature 376:62-66.
9. Fong GH, Rossant J., Gertenstein M., et al. 1995 Nature 376:66-70. 10. Dumont D.J. 1994. Genes Dev. 8: 1897-1903.
1 1. Sato TN, Tzoawa Yl, Deutsch U., et al. 1995. Nature 376:70-74.
12. Suri C, Jones PF., Patan S. et al. 1996. Cell 87:1171-80.
13. Maisonpierre PC, Suri C, Jones PF., et al. 1997. Science 277:55-60.
14. Vikkula M., Boon L.M., Carraway ML., et al. 1996. Cell 87: 1 181-90. 15. Leveen P., Pekny M. Gebre-Medhim S., et al. 1994. Genese Dev. 8: 1875-87.
16. Soriano P. 1994 Genes Dev. 8: 1888-1892.
17. Dickson MC, Martin JS, CoU.S. Pat. No.ins FM et al. 1995. Development 121 : 1845-54.
18. Carmeliet P., Mackman N., Moons L., et al. 1996. Nature 383:73-75. 19. Rissau W. and Flame I. 1995 Ann Rev. Cell. Dev. Biol. 1 1 :73-105.
20. Rissau W. 1997, Nature 386:671 -675.
21. Stone J., Chan-Ling T., Peter J. et al., 1996. Invest. Opthalmol. Visual Sci. 37:290-99.
22. Alon t., Hemo In., Itin A., et al. 1995. Nature Med. 1 : 1024-28. 23. Frangos JA ed. 1993. In: Physical forces and the mammalian cell.
Academics, San Diego, California.
24. Caro CG, Fitz-Geral JM, and Schorter RC. 1971. Proc. Natl. Acad. Sci. 177: 109-159.
25. Ku DN, Giddens DP, Zarins CK and Galgov S 1985. Arteriosclerosis. 5:293-302.
26. Resnick N. and Gimbrone Jr. MA. 1995 FASEB J. 9:874-882.
27. Davies PF, Physiol. Rev. 1995 28. Resnick N., Collins T. Atkinson W. Bonthron DT, Dewey FC Jr. and Gimbrone MA Jr. 1993. Proc. Natl. Acad. Sci. U.S. Pat. No.A 90:4591-4595.
29. Kuwabara K. et al. 1995. Proc. Natl. Acad. Sci. U.S. Pat. No.A 92:4606-610.
30. Shweiki D., Itin A., Soffer D. and Keshet E. 1992. Nature 359:843-45.
31. Tuder RM., Flook BE, and Voelkel NF 1995 J. Clin. Invest. 95:1798-1807.
32. Levy AP., Levy NS Loscalzo J. et al. 1995. Circ. Res. 76:756-766.
33. Schaper W., and Schaper J. 1993. In:Collateral Circulation: Heart, Brain, kidney, limb, London UK, Kluwer Academic Publishers.
34. Yang HT., Ogilvia RW., and Terjung RL 1994. Circ. Res. 74:235-43.
35. Ziche M. Morbidell L. Choudhuri R. et al. 1997. J. Clin. Invest. 99:2625-34.
36. BU.S. Pat. No.solari SR, Dewey CF Jr., and Gimbrone MA Jr. 1982. Rev. Sci. Instrum 53:1851-1854.

Claims

WHAT IS CLAIMED IS:
1. A vector comprising a multiple number of nucleic acids of promoter Shear Stress Response Elements (SSRE) and one or more genes.
2. The vector of claim 1, wherein the gene codes for a protein or peptide.
3. The vector of claim 2, wherein the genes codes for a transcription factors, cell cycle proteins, signaling molecules, degrading proteins, transmembrane protein, enzyme, secreted factors, growth factor, angiogenic factor, or thrombogenic factor.
4. The vector of claims 1, wherein the genes is or codes for NFkB, MCP-1, NFAT, spl/Egr 1, c-fos, c-jun, c-myc, PDGF A, PDGF B, TM, b-FGF, TGF, eNOS, HO-1, cu/Zn SOD, VCAM-1 , I-CAM, Connecxin 43, PGI synthase, smad 6, smad 7, TGF, HB-EG CNP, COX-2, thrombospondin, ICAM, ELAM-1, cyclooxygenase, angiopeitin 1 , tenscin, angiopeitin 2, laminin Bl, IL-1, 11-2, 11-3, 11-4, 11-4, IL-6, 11-7, 11-8, 11-9, 11-10, 11-1 1 , 11-12, ACE or VEGF, a tumor suppressor gene, tyrosine kinases, or serine kinases.
5. The vector of claim 1 , wherein the Shear Stress Response Element is within the regulatory regions of growth factors, thrombogenic factors or angiogenic genes.
6. The vector of claim 1 , wherein the Shear Stress Response Element is a Shear Stress
Response Element which binds to NFKB, NFAT, SPl , or Egrl .
7. The vector of claim 1, wherein the Shear Stress Response Element is a Shear Stress
Response Element which comprises is a binding site for fos, jun, or SPl .
8. The vector of claim 1, wherein the nucleic acids are in a sense or anti-sense orientation.
9. A vector comprising a multiple number of nucleic acids of promoter Shear Stress
Response Elements (SSRE) and a nucleic acid of an antisense molecule, ribozyme, double stranded RNA, or a nucleic acid which codes for a repressor antibody, mutant protein which inhibits the synthesis of, or activity of the protein or peptide,.
10. The vector of claim 1, wherein the vector comprises a combination of the Shear Stress Response Element including but not limited to: Shear Stress Response
Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE, or Shear Stress Response Element SPl .
1 1.The vector of claim 1 , wherein the Shear Stress Response Element is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress
Response Element SPl, and Shear Stress Response Element TRE.
12. The vector of claim 1, wherein the Shear Stress- Response Element is Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response Element TRE and Shear Stress Response Element SPl .
13. The vector of claim 1, wherein the Shear Stress Response Element is Shear Stress Response Element PDGF-B, Shear Stress Response Element PDGF-B, Shear Stress Response Element SPl, Shear Stress Response Element TRE, Shear Stress Response Element PDGF-A, Shear Stress Response Element PDGF-B, Shear Stress Response
Element TRE and Shear Stress Response Element SPl
14. The vector of claim 10, wherein the nucleic acid of the Shear Stress Response Element PDGF-A is set forth in SEQ ID NO. 1.
15. The vector of claim 10, wherein the nucleic acid of the Shear Stress Response Element PDGF-B is set forth in SEQ ID NO. 2.
lό.The vector of claim 10, wherein the nucleic acid of the Shear Stress Response Element SP-1 is set forth in SEQ ID NO. 3.
17. The vector of claim 10, wherein the nucleic acid of the Shear Stress Response Element TRE is set forth in SEQ ID NO. 4.
18. The vector of claim 1 1, wherein the nucleic acid is set forth in SEQ ID NO 5.
19. The vector of claim 1 1, wherein the nucleic acid is set forth in SEQ ID NO 6.
20. The vector of claim 12, wherein the nucleic acid is set forth in SEQ ID NO 7.
21. The vector of claim 1, wherein the vector is a plasmid, YAC, BAC, adenovirus, adeno-associated virus, rhabdovirus, herpes simplex virus, swinepox virus, or vaccinia virus.
22. The vector of claim 1 , further comprising a reporter gene.
23. The vector of claim 22, wherein the reporter gene is luciferase, galactosidase, or lacatamase.
24. The vector of claim 1 , wherein the nucleic acid is under the control of a promoter.
25. The vector of claim 24, wherein the promoter is SV40, Rous Sarcoma Virus, Cytomegalovirus, or Human Cytomegalovirus promoter.
26. A host cell which comprises the vector of claim 1.
27. A pharmaceutical composition comprising the vector of claim 1 and a suitable diluent or carrier.
28. A pharmaceutical composition comprising the vector of claim 9 and a suitable diluent or carrier.
29.A pharmaceutical composition comprising the vector of claims 10 and 1 1 and a suitable diluent or carrier.
30. A method of stimulating endothelial cell proliferation comprising transfecting the 5 endothelial cells with an effective amount of the vector of claims 1 , 10 and 1 1 , wherein the Shear Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby stimulating endothelial cell proliferation.
31. A method of inhibiting endothelial cell proliferation comprising transfecting the I o endothelial cells with an effective amount of the vector of claim 9, wherein the Shear
Stress Response Element transcriptionally regulate endothelial cell gene expression, thereby inhibiting endothelial cell proliferation.
32. The method of claims 30, wherein the endothelial cells are vascular endothelial cells 5 or capillary endothelial cells.
33. A method of stimulating angiogenesis comprising contacting the cells with an effective amount of the vector of claim 1 , thereby stimulating angiogenesis.
0 34.A method of modulating vascular permeability in a mammal, comprising administering to said mammal an effective amount of the pharmaceutical composition of claims 28 or 29, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Element to be 5 activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby modulating vascular permeability in the mammal.
35. A method of stimulating the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of the of the 0 vector of claims 1 , 10 and 1 1 , or pharmaceutical composition of claims 29, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby stimulating the formation, maturation or regression of blood vessels.
5 36.A method of inhibiting the formation, maturation or regression of blood vessels of a subject, comprising administering to said subject an effective amount of the vector of claim 9, or pharmaceutical composition of claim 28, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response o Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby inhibiting the formation, maturation or regression of blood vessels.
37. A method of modulating genes or proteins involved in a diseases which comprises 5 administering to a subject with the disease an effective amount of the pharmaceutical composition of claims 28 or 29 or the vectors of claims 9, 10, or 11, wherein the vector or pharmaceutical composition is administered to the subject in the vasculature with the proviso that the vasculature has shear stress, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby modulating genes or proteins involved in the vascular diseases.
38. A method of treating a subject having a vasculogenic and/or angiogenic disorder comprising administering to the subject an amount of the pharmaceutical composition of claims 27 or 28, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear stress and transcriptionally regulate endothelial cell gene expression, thereby treating the subject having the vasculogenesis and/or angiogenesis disorder.
39. A method of down regulating angiogenesis comprising administering to the subject an amount of the vector of claim 9, or pharmaceutical composition of claim 28, wherein the pharmaceutical composition is administered to the mammal in the vasculature with the proviso that the vasculature has shear stress forces, so as to permit the Shear Stress Response Elements to be activated by the shear, thereby down regulating angiogenesis.
40. The method of claim 38, wherein the vasculogenic and/or angiogenic disorder is a cardiovascular disorders, neoplastic disorder, ischemia, atherosclerosis, hypertension, diabetes, hypercholesterolemia or wound healing.
41. The method of claim 39, further comprising administering to the subject an agent which acts as a vasoconstrictor, inflammatory agent, vasolidator, fibrinolytic activators, Tumor Necrosis Factor (TNF), or thrombotic factors.
42. A method for detecting shear stress or a shear stress related condition in a subject, comprising administering to the subject an amount of the vector which comprises one or more Shear Stress Response Elements, wherein the reporter gene is activated in a shear stress environment, thereby detecting shear stress or a shear stress related condition in the subject.
43. A method for screening test compounds for the ability to regulate angiogenesis and/or vasculogenesis comprising:
(a) contacting endothelial cells with the compound to be tested;
(b) assaying the amount angiogenesis and/or vasculogenesis produced as a result of the test compound; (c) stimulating endothelial cells by introduction of the vector of claim l ;
(d) assaying the amount of angiogenesis and/or vasculogenesis produced as a result of the vector;
(e) comparing the amount of angiogenesis and/or vasculogenesis produced as a result step (b) to that of step (d), wherein an increased amount of angiogenesis and/or vasculogenesis of the test compound means that the test compound regulates angiogenesis and/or vasculogenesis.
44.The method of claim 43, wherein the test compounds are Shear Stress Response Elements, or promoter regions of angiogenic genes.
PCT/IL1999/000702 1998-12-24 1999-12-23 Multiple shear stress responsive elements (ssre) and methods of use thereof WO2000039275A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP99961261A EP1141266A4 (en) 1998-12-24 1999-12-23 Expression vectors comprising multiple shear stress responsive elements (ssre) and a gene of interest and methods of use thereof
JP2000591168A JP2002533113A (en) 1998-12-24 1999-12-23 Expression vector containing a plurality of shear stress response elements (SSREs) and a gene of interest, and uses thereof
AU17954/00A AU1795400A (en) 1998-12-24 1999-12-23 Expression vectors comprising multiple shear stress responsive elements (ssre) and a gene of interest and methods of use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US11386398P 1998-12-24 1998-12-24
US09/220,510 US6440726B1 (en) 1998-12-24 1998-12-24 Expression vectors comprising multiple shear stress responsive elements (SSRE) and methods of use for treating disorders related to vasculogenesis and/or angiogenesis in a shear stress environment
US60/113,863 1998-12-24
US09/220,510 1998-12-24

Publications (2)

Publication Number Publication Date
WO2000039275A2 true WO2000039275A2 (en) 2000-07-06
WO2000039275A3 WO2000039275A3 (en) 2000-10-26

Family

ID=26811564

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL1999/000702 WO2000039275A2 (en) 1998-12-24 1999-12-23 Multiple shear stress responsive elements (ssre) and methods of use thereof

Country Status (4)

Country Link
EP (1) EP1141266A4 (en)
JP (1) JP2002533113A (en)
AU (1) AU1795400A (en)
WO (1) WO2000039275A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7247714B2 (en) 2001-10-16 2007-07-24 Atherogenics, Inc. Protection against oxidative stress and inflammation by a cytoprotective response element
CN109371046A (en) * 2018-09-29 2019-02-22 上海交通大学 A kind of induction type oxin-antitoxin element for thermophilic microorganism genetic manipulation
CN112656763A (en) * 2020-12-29 2021-04-16 吉林大学 Preparation method of drug-loaded nano-micelle based on shear force response
USD1018557S1 (en) 2019-05-17 2024-03-19 Opsens, Inc. Display screen or portion thereof with graphical user interface

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101678074B (en) * 2007-03-22 2014-04-23 韩国加图立大学产学合作基金会 Novel use of ec-sod and method for preparing thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834306A (en) * 1994-12-23 1998-11-10 Sri International Tissue specific hypoxia regulated therapeutic constructs
US5834248A (en) * 1995-02-10 1998-11-10 Millennium Pharmaceuticals Inc. Compositions and methods using rchd534, a gene uregulated by shear stress

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001517081A (en) * 1997-04-08 2001-10-02 ザ ユナイテッド ステイツ オブ アメリカ アズ リプリゼンティッド バイ ザ アドミニストレイター オブ ザ ナショナル アエロノーティクス アンド スペイス アドミニストレイション(ナサ) Production of functional proteins: balance between shear stress and gravity

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834306A (en) * 1994-12-23 1998-11-10 Sri International Tissue specific hypoxia regulated therapeutic constructs
US5834248A (en) * 1995-02-10 1998-11-10 Millennium Pharmaceuticals Inc. Compositions and methods using rchd534, a gene uregulated by shear stress

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RESNICK ET AL.: 'Platelet-derived growth factor B chain promoter contains a cis-acting fluid shear-stress-responsive element' PROC. NATL. ACAD. SCI. USA vol. 90, May 1993, pages 4591 - 4595, XP002075319 *
See also references of EP1141266A2 *
SHYY ET AL.: 'The cis-acting phorbol ester "12-0-tetradecanoylphorbol 13-acetate"-responsive element is involved in shear stress-induced monocyte chemotactic protein 1 gene expression' PROC. NATL. ACAD. SCI. USA vol. 92, August 1995, pages 8069 - 8073, XP002928997 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7247714B2 (en) 2001-10-16 2007-07-24 Atherogenics, Inc. Protection against oxidative stress and inflammation by a cytoprotective response element
CN109371046A (en) * 2018-09-29 2019-02-22 上海交通大学 A kind of induction type oxin-antitoxin element for thermophilic microorganism genetic manipulation
USD1018557S1 (en) 2019-05-17 2024-03-19 Opsens, Inc. Display screen or portion thereof with graphical user interface
CN112656763A (en) * 2020-12-29 2021-04-16 吉林大学 Preparation method of drug-loaded nano-micelle based on shear force response
CN112656763B (en) * 2020-12-29 2022-07-15 吉林大学 Preparation method of drug-loaded nano-micelle based on shear force response

Also Published As

Publication number Publication date
JP2002533113A (en) 2002-10-08
AU1795400A (en) 2000-07-31
EP1141266A2 (en) 2001-10-10
EP1141266A4 (en) 2002-09-25
WO2000039275A3 (en) 2000-10-26

Similar Documents

Publication Publication Date Title
US6121246A (en) Method for treating ischemic tissue
US5652225A (en) Methods and products for nucleic acid delivery
USRE37933E1 (en) Viral vectors and their use for treating hyperproliferative disorders, in particular restenosis
US8916378B2 (en) Polynucleotide constructs, pharmaceutical compositions and methods for targeted downregulations of angiogenesis and anticancer therapy
JP5856059B2 (en) SDF-1 delivery for treating ischemic tissue
Gorski et al. Inhibition of endothelial cell activation by the homeobox gene Gax
JP2004500880A (en) Liver-specific gene expression cassette and method of use
JP3684371B2 (en) Endothelial cell proliferation inhibitor and use thereof
US5658729A (en) Method, reagent and kit for evaluating susceptibility to premature atherosclerosis
US6440726B1 (en) Expression vectors comprising multiple shear stress responsive elements (SSRE) and methods of use for treating disorders related to vasculogenesis and/or angiogenesis in a shear stress environment
EP1141266A2 (en) Expression vectors comprising multiple shear stress responsive elements (ssre) and a gene of interest and methods of use thereof
JP4733337B2 (en) Recombinant viral and non-viral vectors containing human urokinase-type plasminogen activator gene and various types of fibrosis such as liver fibrosis, renal fibrosis, pulmonary fibrosis, pancreatic fibrosis, cardiac fibrosis, And its usefulness in the treatment of hypertrophic scars
AU2001270614B2 (en) Chimeric promoters for controlling expression in smooth muscle cells
US20130210898A1 (en) Recombinant viruses and their use for treatment of atherosclerosis and other forms of coronary artery disease and method, reagent, and kit for evaluating susceptibility to same
Kameda et al. Kidney-targeted naked DNA transfer by retrograde injection into the renal vein in mice
US7569543B2 (en) Compositions of Angiopoietin, fragments, mutants and analogs thereof and uses of the same
US20130164262A1 (en) Recombinant Viruses and their Use for Treatment of Atherosclerosis and Othe Forms of Coronary Artery Disease and Method, Reagent, and Kit for Evaluating Susceptibiity to Same
Ehsan et al. Antisense and gene therapy to prevent restenosis
JP2002535372A (en) Plasminogen kringle 4 region fragment and methods of use
Simmons et al. Adenovirally Mediated Gene Transfer of Functional Human Tissue–type Plasminogen Activator to Murine Lungs
Ojalvo et al. Therapeutic angiogenesis following intramuscular gene transfer of vascular endothelialgrowth factor 121 in a dog model of hindlimb ischemia
Beck Jr Cell-cell interactions and microenvironmental influences in vascular development

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: AU

Ref document number: 2000 17954

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 591168

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999961261

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999961261

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999961261

Country of ref document: EP