Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
  • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
  • C12N15/8223—Vegetative tissue-specific promoters
  • C12N15/8229—Meristem-specific, e.g. nodal, apical
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the present invention relates to DNA sequences encoding cell cycle interacting proteins as well as to methods for obtaining the same.
• the present invention also provides vectors comprising said DNA sequences, wherein the DNA sequences are operatively linked to regulatory elements allowing expression in prokaryotic and/or eukaryotic host cells.
• the present invention relates to the proteins encoded by said DNA sequences, antibodies to said proteins and methods for their production.
• the present invention relates to regulatory sequences which naturally regulate the expression of the above described DNA sequences.
• the present invention also relates to a method for controlling or altering growth characteristics of a plant and/or a plant cell comprising introduction and/or expression of one or more cell cycle regulatory proteins functional in a plant or parts thereof and/or one or more DNA sequences encoding such proteins. Also provided by the present invention is a process for disruption plant cell division by interfering in the expression of a substrate for cyclin-dependent protein kinase using a DNA sequence according to the invention wherein said plant cell is part of a transgenic plant.
• the present invention further relates to diagnostic compositions comprising the aforementioned DNA sequences, vectors, proteins and antibodies.
• the present invention also relates to methods for the identification of compounds being capable of activating or inhibiting the cell cycle.
• the present invention relates to transgenic plant cells, plant tissue and plants containing the above-described DNA sequences, regulatory sequences and vectors as well as to the use of the aforementioned DNA sequences, regulatory sequences, vectors, proteins, antibodies and/or compounds identified by the method of the invention in plant cell and tissue culture, plant breeding and/or agriculture.
• G1 the gap between mitosis and the onset of DNA synthesis
• S the phase of DNA synthesis
• G2 the gap between S and mitosis
• this control mechanism is based on two key families of proteins which regulate the essential process of cell division, namely protein kinases (cyclin dependent kinases or CDKs) and their activating associated subunits, called cyclins.
• CDKs protein kinases
• CDKs cyclin dependent kinases
• the activity of these protein complexes is switched on and off at specific points of the cell cycle.
• Particular CDK-cyclin complexes activated at the G1/S transition trigger the start of DNA replication.
• Different CDK-cyclin complexes are activated at the G2/M transition and induce mitosis leading to cell division.
• Each of the CDK-cyclin complexes execute their regulatory role via modulating different sets of multiple target proteins.
• the large variety of developmental and environmental signals affecting cell division all converge on the regulation of CDK activity.
• CDKs can therefore be seen as the central engine driving cell division.
• knowledge about cell cycle regulations is now quite advanced.
• the activity of CDK-cyclin complexes is regulated at five levels: (i) transcription of the CDK and cyclin genes; (ii) association of specific CDKs with their specific cyclin partner; (Hi) phosphorylation/dephosphorylation of the CDK and cyclins; (iv) interaction with other regulatory proteins such as SUC1/CKS1 homologues and cell cycle kinase inhibitors (CKI); and (v) cell cycle phase-dependent destruction of the cyclins and CKIs.
• CKI cell cycle kinase inhibitors
• plants contain a unique class of CDKs, such as CDC2b in Arabidopsis, which are both structurally and functionally different from animal and yeast CDKs.
• CDKs such as CDC2b in Arabidopsis
• CDK cyclin-dependent protein kinase
• Saccharomyces cerevisiae and Schizosaccharomyces pombe only utilize one CDK gene for the regulation of their cell cycle.
• CDK activity is not only regulated by its association with cyclins but also involves both stimulatory and inhibitory phosphorylations.
• Kinase activity is positively regulated by phosphorylation of a Thr residue located between amino acids 160-170 (depending on the CDK protein). This phosphorylation is mediated by the CDK- activating kinase (CAK) which interestingly is a CDK/cyclin complex itself.
• Inhibitory phosphorylations occur at the ATP-binding site (the Tyr15 residue together with Thr14 in higher eukaryotes) and are carried out by at least two protein kinases.
• CDK activity is furthermore negatively regulated by a family of mainly low-molecular weight proteins, called cyclin-dependent kinase inhibitors (CKIs).
• CKIs cyclin-dependent kinase inhibitors
• CDKs are distinguished by several features.
• CDC2aAt gene is expressed constitutively throughout the whole cell cycle.
• CDC2bAt mRNA levels oscillate, being most abundant during the S and G 2 phases.
• multiple cyclins have been isolated from Arabidopsis. The majority displays the strongest sequence similarity with the animal A- or B-type class of cyclins, but also D-type cyclins have been identified. Although the classification of Arabidopsis cyclins is mainly based upon sequence similarity, limited data suggests that this organization corresponds with differential functions of each cyclin class (Renaudin, Plant Mol. Biol. 32 (1996) 1003-1018).
• the technical problem underlying the present invention is to provide means and methods for modulating cell cycle proteins that are particular useful in agriculture and plant cell and tissue culture.
• the present invention relates to a DNA sequence encoding a cell cycle interacting protein or encoding an immunologically active and/or functional fragment of such a protein, selected from the group consisting of: (a) DNA sequences
• (ac) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (aa) or (ab) under stringent hybridization conditions;
• (ad) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (aa) or (ab); (ae) comprising a nucleotide sequence encoding at least the domain binding to CDKs of the protein encoded by the nucleotide sequence of any one of (aa) to (ad);
• (be) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (ba) or (bb) under stringent hybridization conditions;
• (bd) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 40 % identical to the amino acid sequence encoded by the nucleotide sequence of (ba) or (bb);
• (be) comprising a nucleotide sequence encoding at least the cyclin-like interacting domain of the protein encoded by the nucleotide sequence of any one of (ba) to (bd);
• (cc) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (ca) or (cb) under stringent hybridization conditions;
• (cd) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (ca) or (cb);
• (da) comprising a nucleotide sequence encoding at least the mature form of a protein (VB89) comprising the amino acid sequence as given in SEQ ID NO: 8;
• (dc) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (da) or (db) under stringent hybridization conditions;
• (dd) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (da) or (db);
• (de) comprising a nucleotide sequence encoding at least the domain binding to CDKs of the protein encoded by the nucleotide sequence of any one of (da) to (dd);
• (ed) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (ea) or (eb);
• (ee) comprising a nucleotide sequence encoding at least the domain binding to CDKs of the protein encoded by the nucleotide sequence of any one of (ea) to (ed);
• (fa) comprising a nucleotide sequence encoding at least the mature form of a protein (VBDBP) comp ⁇ sing the amino acid sequence as given in SEQ ID NO: 12; (fb) comprising the nucleotide sequence as given in SEQ ID NO: 11 ;
• (fc) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (fa) or (fb) under stringent hybridization conditions;
• (fd) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (fa) or (fb);
• (fe) comprising a nucleotide sequence encoding at least the domain binding to CDKs of the protein encoded by the nucleotide sequence of any one of (fa) to (fd);
• (gc) comprising a nucleotide sequence hybridizing with the complementary strand of a nucleotide sequence as defined in (ga) or (gb) under stringent hybridization conditions;
• (gd) comprising an nucleotide sequence encoding a protein having an amino acid sequence at least 60 % identical to the amino acid sequence encoded by the nucleotide sequence of (ga) or (gb);
• (ge) comprising a nucleotide sequence encoding at least the domain binding to CDKs of the protein encoded by the nucleotide sequence of any one of (ga) to (gd);
• DNA sequences obtainable by screening an appropriate library under stringent conditions with a probe having at least 17 consecutive nucleotides of a nucleotide sequence of any one of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15 to 33, 35, 37, 39, 41 , 48, 49 or 53 to 57;
• DNA sequences comprising a nucleotide sequence encoding a fragment of a protein encoded by a DNA sequence of any one of (a) to (h), wherein said fragment is capable of interacting with a cell cycle protein; and (j) DNA sequences, the nucleotide sequence of which is degenerate as a result of the genetic code to a nucleotide sequence of a DNA sequence as defined in any one of (a) to (i).
• cell cycle interacting protein or “cell cycle protein” as denoted herein means a protein which exerts control on or regulates or is required for the cell cycle or part thereof of a cell, tissue, organ or whole organism and/or DNA replication. It is may also be capable of binding to, regulating or being regulated by cyclin dependent kinases, in particular CDC2a and/or CDC2b and preferably to plant cyclin dependent kinases or their subunits.
• cyclin dependent kinases in particular CDC2a and/or CDC2b and preferably to plant cyclin dependent kinases or their subunits.
• the term also includes peptides, polypeptides, fragments, variant, homologs, alleles or precursors (eg preproteins or proproteins) thereof.
• cell cycle means the cyclic biochemical and structural events associated with growth, division and proliferation of cells, and in particular with the regulation of the replication of DNA and mitosis.
• the cycle is divided into periods called: G 0 , Gapi (Gi), DNA synthesis (S), Gap 2 (G 2 ), and mitosis (M). Normally these four phases occur sequentially, however the cell cycle also includes modified cycles wherein one or more phases are absent resulting in modified cell cycle such as endomitosis, acytokinesis, polyploidy, polyteny, and endoreduplication.
• nucleic acid molecule refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, and RNA. It also includes known types of modifications, for example, methylation, "caps" substitution of one or more of the naturally occuring nucleotides with an analog.
• the DNA sequence of the invention comprises a coding sequence encoding at least the mature form of the above defined cell cycle interacting protein, i.e. the protein which is posttranslationally processed in its biologically active form, for example due to cleavage of leader or secretory sequences or a proprotein sequence or other natural proteolytic cleavage points.
• functional fragment and biologically active form polypeptides are meant that exhibit activity similar, but not necessarily identical, to an activity of the wild-type cell cycle interacting proteins of the invention or an activity that is enhanced over that of the wild-type proteins (either the full-length protein or, preferably, the mature protein), as measured in a particular biological assay.
• Assays of cell cycle interacting activity are disclosed, for example, in Examples 1 to 7, below. These assays can be used to measure cell cycle interacting activity of partially purified or purified native or recombinant protein.
• the cell cycle interacting protein of the invention binds to CDC2, i.e. CDC2a and/or CDC2b, e.g:, from Arabidopsis.
• CDC2a and/or CDC2b e.g:, from Arabidopsis.
• a polypeptide having a functional fragment or the "biological activity" of the cell cycle interacting protein of the invention will bind to CDCs as set forth in Example 1 or 7.
• immunologically active fragment of a cell cycle interacting protein of the invention denotes proteins or peptides which have at least a part of the primary structural conformation for one or more epitopes capable of reacting specifically with antibodies to a protein which is encodable by a nucleic acid molecule as set forth above.
• the peptides and proteins encoded by a nucleic acid molecule of the invention are recognized by an antibody that specifically recognizes an epitope of the cell cycle interacting protein comprising the amino acid residues that are unique for the protein encoded by any one of the aforementioned DNA sequences.
• said peptides and proteins are capable of eliciting an effective immune response in a mammal, for example mouse or rabbit.
• the DNA sequence which encodes for the predicted mature polypeptides of the proteins comprising SEQ ID NOS: 2, 4, 34, 36, 38, 40, 42, 6, 8, 10, 12 or 14 or for the biologically active fragment thereof may include: only the coding sequence for the mature polypeptide or for a biologically active fragment thereof; the coding sequence for the mature polypeptide or for a biologically active fragment thereof and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as intron or non-coding sequence 5' and/or 3' of the coding sequence for the predicted mature polypeptide.
• a “coding sequence” is a nucleotide sequence which is transcribed into mRNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus.
• a coding sequence can include, but is not limited to mRNA, cDNA, recombinant nucleotide sequences or genomic DNA, while introns may be present as well under certain circumstances.
• nucleotide sequences of the present invention can be engineered in order to alter a cell cycle interacting protein coding sequence for a variety of reasons, including but not limited to, alterations which modify the cloning, processing and/or expression of the gene product.
• mutations may be introduced using techniques which are well known in the art, e.g., site-directed mutagenesis to insert new restriction sites, to alter glycosylation patterns, to change codon preference, to produce splice variants, etc.
• CDC2aAt or CDC2bAt as bait and a cDNA library of a cell suspension as prey are used.
• Novel gene products interacting with CDC2aAt or CDC2bAt indicative of hitherto unknown plant cell cycle regulatory nucleotide sequences were identified.
• the library was made from a mixture mRNA from Arabidopsis thaliana cell suspensions harvested at various growing stages: early exponential, exponential, early stationary and stationary phase.
• cDNA clones have been identified in accordance with the invention comprising the nucleotide sequences as depicted in SEQ ID NOS: 1 , 3, 33, 35, 37, 39, 41 , 5, 7, 9, 11 and 13, which encode proteins that are capable of specifically interacting with cdc2aAt or cdc2bAt; see Examples 1 , 2 and 7, below.
• the proteins encoded by the cDNA clones comprised the amino acid sequences depicted in SEQ ID NOS: 2, 4, 34, 36, 38, 40, 42, 6, 8, 10, 12 and 14.
• Computer assisted homology search in genome data bases revealed that novel genes have been identified and/or genes where the (partial) cDNA was described but the particular function of the gene remained unknown.
• the examples of the present invention demonstrate that novel cell cycle interacting proteins and their encoding genes have been identified.
• the possible applications of the these cell cycle interacting proteins and their encoding nucleic acid molecules will be discussed further below and are evident from the description provided in the Examples.
• the homology search was performed with the program BLASTX and BLASTN (version 2.0a19MP-WashU [build decunix3.2 01 :53:29 05-feb-1998] (see Altschul, Nucleic Acids Res. 25 (1997), 3389-3402) on the Arabidopsis thaliana nucleic acids database at ATDB at Stanford (http://genome-www2.stanford.edu/cgi-bin/AtDB/nph-blast2atdb).
• the protein sequences were then used to perform a BLASTP (version 2.0.4 [feb-24-1998]) with BEAUTY post-processing provided by the Human Genome Center, Baylor College of Medicine against the National Center for Biotechnology Information's non-redundant protein database (http://dot.imgen.bcm.tmc.edu:9331/seq-search/protein-search.html). The results of the homology search are described in the appended examples.
• ESTs Expressed Sequence Tags
• ORFs Open Reading Frames
• nucleotide sequences that may be present within for example a section of a chromomsome that has been described in context with an organism's genome sequencing project but hitherto have not been identified to constitute a gene with biological function, nor what the particular biological function of this gene could be.
• the genes comprising the nucleotide sequences of each SEQ ID NOS: 1, 3, 33, 35, 37, 39, 41 , 5, 7, 9, 11 and 13 each encode a member of a novel class of cell cycle interacting proteins.
• the nucleotide sequences of SEQ ID NOS: 3, 33, 35, 37, 39 and 41 define a novel class of PHO80-iike Proteins (PLPs); see also Example 7.
• PHO80-iike Proteins see also Example 7.
• the present invention also relates to DNA sequences hybridizing with the above- described DNA sequences and differ in one or more positions in comparison with these as long as they encode a cell cycle interacting protein.
• hybridizing it is meant that such nucleic acid molecules hybridize under conventional hybridization conditions, preferably under stringent conditions such as described by, e.g., Sambrook (Molecular Cloning; A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).
• stringent conditions such as described by, e.g., Sambrook (Molecular Cloning; A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).
• An example of one such st ⁇ ngent hybridization condition is hybridization at 4XSSC at 65 S C, followed by a washing in 0.1XSSC at 65 S C for one hour.
• an exemplary stringent hybridization condition is in 50 % formamide, 4XSSC at 42 e C.
• Cell cycle interacting proteins derived from other organisms such as mammals, in particular humans may be encoded by other DNA sequences which hybridize to the sequences for plant cell cycle interacting proteins under relaxed hybridization conditions and which code on expression for peptides having the ability to interact with cell cycle proteins.
• Examples of such non-stringent hybridization conditions are 4XSSC at 50 Q C or hybridization with 30-40 % formamide at 42 S C. Further preferred hybridization conditions are described in the examples.
• Such molecules comprise those which are fragments, analogues or derivatives of the cell cycle interacting protein of the invention and differ, for example, by way of amino acid and/or nucleotide deletion(s), insertion(s), substitution(s), addition(s) and/or recombination(s) or any other modification(s) known in the art either alone or in combination from the above-described amino acid sequences or their underlying nucleotide sequence(s).
• PESTFIND program Rosgers, Science 234 (1986), 364-368
• PEST sequences rich in proline, glutamic acid, serine, and threonine
• nucleic acid molecules may be removed from the ceil cycle interacting proteins in order to increase the stability and optionally the activity of the proteins.
• Methods for introducing such modifications in the nucleic acid molecules according to the invention are well-known to the person skilled in the art.
• the invention also relates to nucleic acid molecules the sequence of which differs from the nucleotide sequence of any of the above-described nucleic acid molecules due to the degeneracy of the genetic code.
• nucleic acid molecules of the invention include all nucleotide sequences encoding proteins or peptides which have at least a part of the primary structural conformation for one or more epitopes capable of reacting with antibodies to cell cycle interacting proteins which are encodable by a nucleic acid molecule as set forth above and which have comparable or identical characteristics in terms of biological activity and/or the capability to interact with other proteins.
• proteins encoded by a nucleic acid molecule of the invention are at least capable of interacting with CDC2, particularly CDC2a and/or CDC2b, preferably from a plant such as Arabidopsis thaliana. Whilst the above described proteins may interact with a CDC2 from Arabidopsis thaliana, the most likely interaction is with a CDC2 from the same species from which the gene was isolated (homologous interaction). This capability allows advantageous uses of the proteins of the invention and their encoding nucleic acid molecules as will be described in more detail below.
• Part of the invention is therefore also nucleic acid molecules encoding a polypeptide comprising at least a functional part of a cell cycle interacting protein encoded by a nucleic acid sequence comprised in a nucleic acid molecule according to the invention.
• a polypeptide or a fragment thereof according to the invention is embedded in another amino acid sequence.
• the DNA sequence of the invention encodes a protein having substantially the same amino acid sequence as the proteins defined in SEQ ID NOS: 2, 4, 34, 36, 38, 40, 42, 6, 8, 10, 12 and 14.
• the polynucleotide sequences encoding the cell cycle interacting proteins may be extended utilizing partial nucleotide sequence and various methods known in the art to detect upstream sequences such as promoters and regulatory elements.
• Gobinda (PCR Methods Applic. 2 (1993), 318-322) discloses "restriction-site" polymerase chain reaction (PCR) as a direct method which uses universal primers to retrieve unknown sequence adjacent to a known locus.
• genomic DNA is amplified in the presence of primer to a linker sequence and a primer specific to the known region.
• the amplified sequences are subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one.
• Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
• Inverse PCR can be used to amplify or extend sequences using divergent primers based on a known region (Triglia, Nucleic Acids Res. 16 (1988), 8186).
• the primers may be designed using OLIGO® 4.06 Primer Analysis Software (1992; National Biosciences Inc, Plymouth MN), or another appropriate program to be preferably 22-30 nucleotides in length, to have a GC content of preferably 50% or more, and to anneal to the target sequence at temperatures preferably about 68°-72°C.
• the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Capture PCR (Lagerstrom, PCR Methods Applic.
• Capture PCR is a method for PCR amplification of DNA fragments adjacent to a known sequence in, e.g., human or plant yeast artificial chromosome DNA. Capture PCR also requires multiple restriction enzyme digestions and ligations to place an engineered double-stranded sequence into an unknown portion of the DNA molecule before PCR.
• Another method which may be used to retrieve unknown sequences is that of Parker, (Nucleic Acids Res. 19 (1991), 3055-3060). Additionally, one can use PCR, nested primers and PromoterFinder libraries to walk in genomic DNA (PromoterFinderTM Clontech (Palo Alto CA). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
• Preferred libraries for screening for full length cDNAs are ones that have been size-selected to include larger cDNAs.
• random primed libraries are preferred in that they will contain more sequences which contain the 5' and upstream regions of genes. A randomly primed library may be particularly useful if an oligo d(T) library does not yield a full-length cDNA.
• Genomic libraries are useful for extension into the 5' nontranslated regulatory region. Suitable methods for identifying promoters are also described in WO 99/61619, in particular at pages 50 and 51. Capillary electrophoresis may be used to analyze the size or confirm the nucleotide sequence of sequencing or PCR products; see, e.g., Sambrook, supra. Systems for rapid sequencing are available from Perkin Elmer, Beckmann Instruments (Fullerton CA), and other companies. Computer-assisted identification of cell cycle interacting proteins and their encoding genes
• BLAST2 which stands for Basic Local Alignment Search Tool (Altschul, 1997; Altschul, J. Mol. Evol. 36 (1993), 290-300; Altschul, J. Mol. Biol. 215 (1990), 403-410), can be used to search for local sequence alignments.
• BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying homologs.
• the fundamental unit of BLAST algorithm output is the High-scoring Segment Pair (HSP).
• An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user.
• the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
• the parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occurrence of an HSP (or set of HSPs) within the context of the entire database search. Any database sequence whose match satisfies E is reported in the program output.
• the present invention relates to a method for identifying and obtaining cell cycle interacting proteins comprising a two-hybrid screening assay wherein CDC2a or CDC2b as a bait and a cDNA library of cell suspension culture as prey are used.
• said CDC2a and CDC2b is CDC2aAt and CDC2bAt, respectively.
• CDKs or their corresponding subunits from other plants or other organisms such as mammals may be employed as well.
• the cell culture may be from any organism possessing cell cycle interacting proteins such as animals, preferably mammals.
• nucleic acid molecules encoding proteins or peptides identified to interact with CDC2a or CDC2b in the above mentioned assay can be easily obtained and sequenced by methods known in the art; see also the appended examples. Therefore, the present invention also relates to a DNA sequence encoding a cell cycle interacting protein obtainable by the method of the invention.
• nucleic acid molecules according to the invention are RNA or DNA molecules, preferably cDNA, genomic DNA or synthetically synthesized DNA or RNA molecules. Since cell cycle interacting proteins are supposed to play a key role in the plant cell cycle, corresponding proteins displaying similar properties should be present in other organisms including mammals as well. Nucleic acid molecules of the invention can be obtained, e.g., by hybridization of the above-described nucleic acid molecules with a (sample of) nucleic acid molecule(s) of any source.
• Nucleic acid molecules hybridizing with the above-described nucleic acid molecules can in general be derived from any organism, preferably plants possessing such molecules, preferably from monocotyiedonous or dicotyledonous plants, in particular from plants of interest in agriculture, horticulture or wood culture, such as crop plants, namely those of the family Poaceae, any starch producing plants, such as potato, maniok, leguminous plants, oil producing plants, such as oilseed rape, linenseed, etc., plants using polypeptide as storage substances, such as soybean, plants using sucrose as storage substance, such as sugar beet or sugar cane, trees, ornamental plants etc.
• the nucleic acid molecules according to the invention are derived from crop plants (e.g.
• Nucleic acid molecules hybridizing to the above-described nucleic acid molecules can be isolated, e.g., from libraries, such as cDNA or genomic libraries by techniques well known in the art. For example, hybridizing nucleic acid molecules can be identified and isolated by using the above-described nucleic acid molecules or fragments thereof or complements thereof as probes to screen libraries by hybridizing with said molecules according to standard techniques.
• nucleic acid molecules Possible is also the isolation of such nucleic acid molecules by applying a nucleic acid amplicification technique such as the polymerase chain reaction (PCR) using as primers oligonucleotides derived form the above-described nucleic acid molecules.
• a nucleic acid amplicification technique such as the polymerase chain reaction (PCR) using as primers oligonucleotides derived form the above-described nucleic acid molecules.
• PCR polymerase chain reaction
• nucleic acid molecules may be identified and isolated using microarrays or DNA chips (Southern et al. (1999) Nat. Genet, Jan:21 (1 Suppl.):5-9; Ramsay, (1998) Nature Biotechnology, 16 (1):40).
• Nucleic acid molecules which hybridize with any of the aforementioned nucleic acid molecules also include fragments, derivatives and allelic variants of the above-described nucleic acid molecules that encode a cell cycle interacting protein or an immunologically active or functional fragment thereof. Fragments are understood to be parts of nucleic acid molecules long enough to encode the described protein or a functional or immunologically active fragment thereof as defined above.
• nucleotide sequence of these nucleic acid molecules differs from the sequences of the above-described nucleic acid molecules in one or more nucleotide positions and are highly homologous to said nucleic acid molecules.
• Homology is understood to refer to a sequence identity of at least 40 %, particularly an identity of at least 60 %, preferably more than 80 % and still more preferably more than 90 %.
• substantially homologous refers to a subject, for instance a nucleic acid, which is at least 50% identical in sequence to the reference when the entire ORF (open reading frame) is compared, where the sequence identity is preferably at least 70%, more preferably at least 80%, still more preferably at least 85%, especially more than about 90%, most preferably 95% or greater, particularly 98% or greater.
• sequence identity is preferably at least 70%, more preferably at least 80%, still more preferably at least 85%, especially more than about 90%, most preferably 95% or greater, particularly 98% or greater.
• the deviations from the sequences of the nucleic acid molecules described above can, for example, be the result of nucleotide substitution(s), deletion(s), addition(s), insertion(s) and/or recombination(s); see supra.
• nucleic acid molecules or encoded proteins may also be functionally and/or structurally equivalent.
• the nucleic acid molecules that are homologous to the nucleic acid molecules described above and that are derivatives of said nucleic acid molecules are, for example, variations of said nucleic acid molecules which represent modifications having the same biological function, in particular encoding proteins with the same or substantially the same biological function. They may be naturally occurring variations, such as sequences from other plant varieties or species, or mutations. These mutations may occur naturally or may be obtained by mutagenesis techniques.
• allelic variations may be naturally occurring allelic variants as well as synthetically produced or genetically engineered variants; see supra.
• proteins encoded by the various derivatives and variants of the above-described nucleic acid molecules may share specific common characteristics, such as biological activity, molecular weight, immunological reactivity, conformation, etc., as well as physical properties, such as electrophoretic mobility, chromatographic behavior, sedimentation coefficients, pH optimum, temperature optimum, stability, solubility, spectroscopic properties, etc.
• nucleic acid molecules according to the invention examples of the different possible applications of the nucleic acid molecules according to the invention as well as molecules derived from them will be desc ⁇ bed in detail in the following. Uses of the nucleic acid molecules of the present invention
• the present invention relates to a nucleic acid molecule which hybridizes with the complementary strand of the nucleic acid molecule of the invention and which encodes a mutated version of the protein as defined above which has lost its immunological and/or biological activity.
• This embodiment may prove useful for, e.g., generating dominant mutant alleles of the above-described cell cycle interacting proteins.
• Said mutated version is preferably generated by substitution, deletion and/or addition of 1 to 5 or 5 to 10 amino acid residues in the amino acid sequence of the above-described wild type proteins.
• the invention relates to nucleic acid molecules of at least 15 nucleotides in length hybridizing specifically with a nucleic acid molecule as described above or with a complementary strand thereof. Specific hybridization occurs preferably under stringent conditions and implies no or very little cross-hybridization with nucleotide sequences encoding no or substantially different proteins. Such nucleic acid molecules may be used as probes and/or for the control of gene expression. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary in length. Preferred are nucleic acid probes of 16 to 35 nucleotides in length. Of course, it may also be appropriate to use nucleic acids of up to 100 and more nucleotides in length.
• nucleic acid probes of the invention are useful for various applications. On the one hand, they may be used as primers for amplification of nucleic acid sequences according to the invention.
• the design and use of said primers is known by the person skilled in the art.
• amplification primers comprise a contiguous sequence of at least 6 nucleotides, in particular 13 nucleotides, preferably 15 to 25 nucleotides or more, identical or complementary to the nucleotide sequence depicted in SEQ ID NOS: 1 , 3, 33, 35, 37, 39, 41 , 5, 7, 9, 11 or 13 or to a nucleotide sequence encoding the amino acid sequence of SEQ ID NOS: 2, 4, 34, 36, 38, 40, 42, 6, 8, 10, 12 or 14.
• nucleic acid molecules according to this preferred embodiment of the invention which are complementary to a nucleic acid molecule as described above are preferably at least 17 nucleotides in length and may also be used for repression of expression of a cell cycle gene, for example due to an antisense or triple helix effect or for the construction of appropriate ribozymes (see, e.g., EP-A1 0 291 533, EP-A1 0 321 201 , EP-A2 0 360 257) which specifically cleave the (pre)-mRNA of a gene comprising a nucleic acid molecule of the invention or part thereof.
• nucleic acid molecules may either be DNA or RNA or a hybrid thereof.
• said nucleic acid molecule may contain, for example, thioester bonds and/or nucleotide analogues, commonly used in oligonucleotide anti-sense approaches. Said modifications may be useful for the stabilization of the nucleic acid molecule against endo- and/or exonucleases in the cell.
• Said nucleic acid molecules may be transcribed by an appropriate vector containing a chimeric gene which allows for the transcription of said nucleic acid molecule in the cell.
• nucleic acid probe with an appropriate marker for specific applications, such as for the detection of the presence of a nucleic acid molecule of the invention in a sample derived from an organism, in particular plants.
• An appropriate marker for specific applications, such as for the detection of the presence of a nucleic acid molecule of the invention in a sample derived from an organism, in particular plants.
• Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like.
• Patents teaching the use of such labels include US Patents US-A-3,817,837; US-A-3,850,752; US-A-3,939,350; US-A-3,996,345; US-A- 4,227,437; US-A-4,275,149 and 4,366,241.
• recombinant immunoglobulins may be produced as shown in US-A-4,816,567 incorporated herein by reference.
• PNA peptide nucleic acid
• PNA peptide nucleic acid
• the binding of PNAs to complementary as well as various single stranded RNA and DNA nucleic acid molecules can be systematically investigated using thermal denaturation and BIAcore surface-interaction techniques (Jensen, Biochemistry 36 (1997), 5072-5077).
• the nucleic acid molecules described above as well as PNAs derived therefrom can be used for detecting point mutations by hybridization with nucleic acids obtained from a sample with an affinity sensor, such as BIAcore; see Gotoh, Rinsho Byori 45 (1997), 224-228.
• PNA peptide nucleic acids
• nucleic acid oligonucleotides for example as restriction enzymes or as templates for the synthesis of nucleic acid oligonucleotides are known to the person skilled in the art and are, for example, described in Veselkov, Nature 379 (1996), 214 and Bohler, Nature 376 (1995), 578-581.
• a further application of the nucleic acids of the invention is their use in a two-hybrid system to identify interacting proteins (i.e. proteins that specifically interact with the nucleic acid-encoding products). Methods for preparing and performing the two-hybrid screen are known in the art, including descriptions provided in this document and generally see Hannon G. and Bartel P. Identification of interacting proteins using the two-hybrid system Methods Mol. Cellular Biol. 5 (1995), 289-297.
• the nucleic acid sequence for a cell cycle interacting protein of the invention can also be used to generate hybridization probes for mapping the naturally occurring genomic sequence.
• the sequence may be mapped to a particular chromosome or to a specific region of the chromosome using well known techniques. These include in situ hybridization to chromosomal spreads, flow-sorted chromosomal preparations, or artificial chromosome constructions such as yeast artificial chromosomes, bacterial artificial chromosomes, bacterial P1 constructions or single chromosome cDNA libraries as reviewed in Price (Blood Rev. 7 (1993), 127-134) and Trask (Trends Genet. 7 (1991), 149-154).
• In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps.
• an sequence tagged site based map of the human genome was recently published by the Whitehead-MIT Center for Genomic Research (Hudson, Science 270 (1995), 1945-1954) on a map of the plant genome by way of the Arabidopsis genome is available from http://genome.wwz.Stanford.edu/cgi- bin/AtDB/nph-blast2atdb.
• the placement of a gene on the chromosome of another species may reveal associated marker even if the number or arm of a particular chromosome is not known.
• New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for interacting genes using positional cloning or other gene discovery techniques. Once such gene has been crudely localized by genetic linkage to a particular genomic region, any sequences mapping to that area may represent associated or regulatory genes for further investigation.
• the nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier or affected individuals.
• the present invention also relates to vectors, particularly plasmids, cosmids, viruses, bacteriophages and other vectors used conventionally in genetic engineering that contain a nucleic acid molecule according to the invention.
• vectors particularly plasmids, cosmids, viruses, bacteriophages and other vectors used conventionally in genetic engineering that contain a nucleic acid molecule according to the invention.
• Methods which are well known to those skilled in the art can be used to construct various plasmids and vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989), (1994).
• Plasmids and vectors to be preferably employed in accordance with the present invention include those well known in the art.
• the nucleic acid molecules and vectors of the invention can be reconstituted into liposomes for delivery to target cells.
• nucleic acid molecule present in the vector is linked to (a) control sequence(s) which allow the expression of the nucleic acid molecule in prokaryotic and/or eukaryotic cells.
• control sequence refers to regulatory DNA sequences which are necessary to effect the expression of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism. In prokaryotes, control sequences generally include promoter, ribosomal binding site, and terminators. In eukaryotes generally control sequences include promoters, terminators and, in some instances, enhancers, transactivators or transcription factors. The term “control sequence” is intended to include, at a minimum, all components the presence of which are necessary for expression, and may also include additional advantageous components.
• operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
• a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
• the control sequence is a promoter, it is obvious for a skilled person that double-stranded nucleic acid is preferably used.
• the vector of the invention is preferably an expression vector.
• An "expression vector” is a construct that can be used to transform a selected host cell and provides for expression of a coding sequence in the selected host.
• Expression vectors can for instance be cloning vectors, binary vectors or integrating vectors.
• Expression comprises transcription of the nucleic acid molecule preferably into a translatable mRNA. Regulatory elements ensuring expression in prokaryotic and/or eukaryotic cells are well known to those skilled in the art.
• eukaryotic cells comprise normally promoters ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript, for example in plants, those of the 35S RNA from Cauliflower Mosaic Virus (CaMV).
• CaMV Cauliflower Mosaic Virus
• Other promoters commonly used are the polyubiquitin promoter, and the actin promoter for ubiquitous expression.
• the termination signals usually employed are from the Nopaline Synthase promoter or from the CAMV 35S promoter.
• a plant translational enhancer often used is the TMV omega sequences, the inclusion of an intron (lntron-1 from the Shrunken gene of maize, for example) has been shown to increase expression levels by up to 100-fold.
• Additional regulatory elements may include transcriptional as well as translational enhancers.
• Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., the P L , lac, trp or tac promoter in E. coli, and examples of regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the CMV-, SV40-, RSV-promoter (Rous sarcoma virus), CMV-enhancer, SV40- enhancer or a globin intron in mammalian and other animal cells.
• suitable expression vectors are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM ⁇ , pRc/CMV, pcDNAI , pcDNA3 (In-vitrogene), pSPORTl (GIBCO BRL).
• An alternative expression system which could be used to express a cell cycle interacting protein is an insect system.
• Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
• the coding sequence of a nucleic acid molecule of the invention may be cloned into a nonessential region of the virus, such as the poiyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of said coding sequence will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein coat.
• the recombinant viruses are then used to infect S. frugiperda cells or Trichoplusia larvae in which the protein of the invention is expressed (Smith, J. Virol. 46 (1983), 584; Engelhard, Proc. Nat. Acad. Sci. USA 91 (1994), 3224-3227). Further promoters and expression systems that may be used in accordance with the present invention are described in the prior art, for example WO 99/61619.
• the above-described vectors of the invention comprises a selectable and/or scorable marker.
• Selectable marker genes useful for the selection of transformed plant cells, callus, plant tissue and plants are well known to those skilled in the art and comprise, for example, antimetabolite resistance as the basis of selection for dhfr, which confers resistance to methotrexate (Reiss, Plant Physiol. (Life Sci. Adv.) 13 (1994), 143- 149); npt, which confers resistance to the aminoglycosides neomycin, kanamycin and paromycin (Herrera-Estrella, EMBO J.
• hygro which confers resistance to hygromycin
• Additional selectable genes namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman, Proc. Natl. Acad. Sci.
• mannose-6-phosphate isomerase which allows cells to utilize mannose
• ODC omithine decarboxylase
• DFMO DFMO
• deaminase from Aspergillus terreus which confers resistance to Blasticidin S (Tamura, Biosci. Biotechnol. Biochem. 59 (1995), 2336-2338).
• Useful scorable marker are also known to those skilled in the art and are commercially available.
• said marker is a gene encoding luciferase (Giacomin, PI. Sci. 116 (1996), 59-72; Scikantha, J. Bact. 178 (1996), 121), green fluorescent protein (Gerdes, FEBS Lett. 389 (1996), 44-47) or ⁇ -glucuronidase (Jefferson, EMBO J. 6 (1987), 3901-3907).
• luciferase PI. Sci. 116 (1996), 59-72; Scikantha, J. Bact. 178 (1996), 121
• green fluorescent protein Gerdes, FEBS Lett. 389 (1996), 44-47
• ⁇ -glucuronidase Jefferson, EMBO J. 6 (1987), 3901-3907.
• the present invention furthermore relates to host cells comprising a vector as described above or a nucleic acid molecule according to the invention wherein the nucleic acid molecule is foreign to the host cell.
• nucleic acid molecule is either heterologous with respect to the host cell, this means derived from a cell or organism with a different genomic background, or is homologous with respect to the host cell but located in a different genomic environment than the naturally occurring counterpart of said nucleic acid molecule. This means that, if the nucleic acid molecule is homologous with respect to the host cell, it is not located in its natural location in the genome of said host cell, in particular it is surrounded by different genes. In this case the nucleic acid molecule may be either under the control of its own promoter or under the control of a heterologous promoter.
• the vector or nucleic acid molecule according to the invention which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained in some form extrachromosomally.
• the nucleic acid molecule of the invention can be used to restore or create a mutant gene via homologous recombination (Paszkowski (ed.), Homologous Recombination and Gene Silencing in Plants. Kluwer Academic Publishers (1994)).
• the host cell can be any prokaryotic or eukaryotic cell, such as bacterial, insect, fungal, plant or animal cells.
• Preferred fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S.
• prokaryotic is meant to include all bacteria which can be transformed or transfected with a DNA or RNA molecules for the expression of a protein of the invention.
• Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis.
• eukaryotic is meant to include yeast, higher plant, insect and preferably mammalian cells.
• the protein encoded by the polynucleotide of the present invention may be glycosylated or may be non-glycosylated.
• the cell cycle interacting proteins of the invention may or may not also include an initial methionine amino acid residue.
• a polynucleotide of the invention can be used to transform or transfect the host using any of the techniques commonly known to those of ordinary skill in the art. Furthermore, methods for preparing fused, operably linked genes and expressing them in, e.g., mammalian cells and bacteria are well-known in the art (Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989).
• Another subject of the invention is a method for the preparation of cell cycle interacting proteins which comprises the cultivation of host cells according to the invention which, due to the presence of a vector or a nucleic acid molecule according to the invention, are able to express such a protein, under conditions which allow expression of the protein and recovering of the so-produced protein from the culture. It is also to be understood that the proteins can be expressed in a cell free system using for example in vitro translation assays known in the art.
• the term "expression” means the production of a protein or nucleotide sequence in the cell. However, said term also includes expression of the protein in a cell-free system. It includes transcription into an RNA product, post-transcriptional modification and/or translation to a protein product or polypeptide from a DNA encoding that product, as well as possible post-translational modifications. Depending on the specific constructs and conditions used, the protein may be recovered from the cells, from the culture medium or from both.
• the terms “protein” and “polypeptide” used in this application are interchangeable. “Polypeptide” refers to a polymer of amino acids (amino acid sequence) and does not refer to a specific length of the molecule.
• polypeptides and oligopeptides are included within the definition of polypeptide.
• This term does also refer to or include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
• the protein of the invention may also be expressed as a recombinant protein with one or more additional polypeptide domains added to facilitate protein purification.
• Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp, Seattle WA).
• metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals
• protein A domains that allow purification on immobilized immunoglobulin
• the domain utilized in the FLAGS extension/affinity purification system Immunex Corp, Seattle WA.
• the inclusion of a cleavable linker sequences such as Factor XA or enterokinase (Invitrogen, San Diego CA) between the purification domain and the protein of interest is useful to facilitate purification.
• One such expression vector provides for expression of a fusion protein compromising a cell cycle interacting protein and contains nucleic acid encoding 6 histidine residues followed by thioredoxin and an enterokinase cleavage site.
• the histidine residues facilitate purification on IMIAC (immobilized metal ion affinity chromatography as described in Porath, Protein Expression and Purification 3 (1992), 263-281) while the enterokinase cleavage site provides a means for purifying the cell cycle interacting protein from the fusion protein.
• fragments of the protein of the invention may be produced by direct peptide synthesis using solid-phase techniques (cf Stewart et al.
• the protein of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like; see, Scopes, "Protein Purification", Springer-Verlag, N.Y. (1982). Substantially pure proteins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred, for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the proteins may then be used therapeutically (including extracorporeally) or in developing and performing assay procedures.
• the present invention furthermore relates to ceil cycle interacting proteins encoded by the nucleic acid molecules according to the invention or produced or obtained by the above-described methods, and to functional and/or immunologically active fragments of such cell cycle interacting proteins.
• the proteins and polypeptides of the present invention are not necessarily translated from a designated nucleic acid sequence; the polypeptides may be generated in any manner, including for example, chemical synthesis, or expression of a recombinant expression system, or isolation from a suitable viral system.
• the polypeptides may include one or more analogs of amino acids, phosphorylated amino acids or unnatural amino acids. Methods of inserting analogs of amino acids into a sequence are known in the art.
• polypeptides may also include one or more labels, which are known to those skilled in the art.
• proteins according to the invention may be further modified by conventional methods known in the art.
• By providing the proteins according to the present invention it is also possible to determine fragments which retain biological activity. This allows the construction of chimeric proteins and peptides comprising an amino sequence derived from the protein of the invention, which is crucial for its, e.g., binding activity and other functional amino acid sequences, e.g. GUS marker gene (Jefferson, EMBO J. 6 (1987), 3901 -3907).
• fragment of a sequence or "part of a sequence” means a truncated sequence of the original sequence referred to.
• the truncated sequence can vary widely in length; the minimum size being a sequence of sufficient size to provide a sequence with at least a comparable function and/or activity of the original sequence referred to, while the maximum size is not critical. In some applications, the maximum size usually is not substantially greater than that required to provide the desired activity and/or function(s) of the original sequence.
• the truncated amino acid sequence will range from about 5 to about 60 amino acids in length. More typically, however, the sequence will be a maximum of about 50 amino acids in length, preferably a maximum of about 30 amino acids. It is usually desirable to select sequences of at least about 10, 12 or 15 amino acids, up to a maximum of about 20 or 25 amino acids.
• folding simulations and computer redesign of structural motifs of the protein of the invention can be performed using appropriate computer programs (Olszewski, Proteins 25 (1996), 286-299; Hoffman, Comput. Appl. Biosci. 11 (1995), 675-679).
• Computer modeling of protein folding can be used for the conformational and energetic analysis of detailed peptide and protein models (Monge, J. Mol. Biol. 247 (1995), 995- 1012; Renouf, Adv. Exp. Med. Biol. 376 (1995), 37-45).
• the appropriate programs can be used for the identification of interactive sites of the cell cycle interacting protein and its receptor, its ligand or other interacting proteins by computer assistant searches for complementary peptide sequences (Fassina, Immunomethods 5 (1994), 114- 120. Further appropriate computer systems for the design of protein and peptides are described in the prior art, for example in Berry, Biochem. Soc. Trans. 22 (1994), 1033- 1036; Wodak, Ann. N. Y. Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986), 5987-5991. The results obtained from the above-described computer analysis can be used for, e.g., the preparation of peptide mimetics of the protein of the invention or fragments thereof.
• pseudopeptide analogues of the natural amino acid sequence of the protein may very efficiently mimic the parent protein (Benkirane, J. Biol. Chem. 271 (1996), 33218- 33224).
• incorporation of easily available achiral (-amino acid residues into a protein of the invention or a fragment thereof results in the substitution of amide bonds by polymethylene units of an aliphatic chain, thereby providing a convenient strategy for constructing a peptide mimetic (Banerjee, Biopolymers 39 (1996), 769-777).
• Superactive peptidomimetic analogues of small peptide hormones in other systems are described in the prior art (Zhang, Biochem. Biophys. Res. Commun.
• peptide mimetics of the protein of the present invention can also be identified by the synthesis of peptide mimetic combinatorial libraries through successive amide alkylation and testing the resulting compounds, e.g., for their binding and immunological properties. Methods for the generation and use of peptidomimetic combinatorial libraries are described in the prior art, for example in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715.
• a three-dimensional and/or crystallographic structure of the protein of the invention can be used for the design of peptide mimetic inhibitors of the biological activity of the protein of the invention (Rose, Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558).
• the present invention relates to antibodies specifically recognizing a cell cycle interacting protein according to the invention or parts, i.e. specific fragments or epitopes, of such a protein.
• the antibodies of the invention can be used to identify and isolate other cell cycle interacting proteins and genes in any organism, preferably plants.
• These antibodies can be monoclonal antibodies, polyclonal antibodies or synthetic antibodies as well as fragments of antibodies, such as Fab, Fv or scFv fragments etc.
• Monoclonal antibodies can be prepared, for example, by the techniques as originally described in Kohler and Milstein, Nature 256 (1975), 495, and Galfre, Meth. Enzymol.
• antibodies or fragments thereof to the aforementioned peptides can be obtained by using methods which are described, e.g., in Harlow and Lane “Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbor, 1988; Coligan, "Current Protocols in Immunology", Wiley/Greene, NY (1991). These antibodies can be used, for example, for the immunoprecipitation and immunolocalization of proteins according to the invention as well as for the monitoring of the synthesis of such proteins, for example, in recombinant organisms, and for the identification of compounds interacting with the protein according to the invention.
• surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies selections, yielding a high increment of affinity from a single library of phage antibodies which bind to an epitope of the protein of the invention (Schier, Human Antibodies Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183 (1995), 7- 13). In many cases, the binding phenomena of antibodies to antigens is equivalent to other ligand/anti-ligand binding.
• Plant cell division can conceptually be influenced in four ways: (i) inhibiting or arresting cell division, (ii) maintaining, facilitating or stimulating cell division, (iii) uncoupling DNA synthesis from mitosis and cytokinesis or (iv) uncoupling ceil division from intrinsic developmental or external environmental conditions.
• Modulation of the expression of a cell cycle interacting protein encoded by a nucleotide sequence according to the invention has surprisingly an advantageous influence on plant cell division characteristics, in particular on the disruption of the G1/S and/or G2/M transition and as a result thereof on the total make-up of the plant concerned or parts thereof.
• An example is that DNA synthesis, or mitosis may be negatively influenced by . interfering with the formation of a cyclin-dependent protein kinase complex.
• overexpression of the CDK complex interacting protein accelerates reentry into the cell cycle.
• cyclin-dependent protein kinase complex means the complex formed when a, preferably functional, cyclin associates with a, preferably, functional cyclin dependent kinase. Such complexes may be active in phosphorylating proteins and may or may not contain additional protein species.
• protein kinase means an enzyme catalyzing the phosphorylation of proteins.
• transformed plants can be made modulating the nucleotide sequence according to the invention.
• Such an modulation of the new gene(s), proteins or inactivated variants thereof will either positively or negatively have an effect on cell division.
• Methods to modify the expression levels and/or ratios and/or the activity are known to persons skilled in the art and include for instance overexpression, co-suppression, the use of ribozymes, sense and anti-sense strategies, gene silencing approaches.
• Sense strand refers to the strand of a double- stranded DNA molecule that is homologous to a mRNA transcript thereof.
• the "anti- sense strand” contains an inverted sequence which is complementary to that of the "sense strand”.
• the nucleic acid molecules according to the invention are in particular useful for the genetic manipulation of plant cells in order to modify the characteristics of plants and to obtain plants with modified, preferably with improved or useful phenotypes.
• the invention can also be used to modulate the cell division and the growth of cells, preferentially plant cells, in in vitro cultures.
• the plant cell division rate and/or the inhibition of a plant cell division can be influenced by overexpression or reducing the expression of a gene encoding a protein according to the invention.
• Overexpression of a ceil cycle interacting protein encoding gene according to the invention promotes cell proliferation, while reducing gene expression arrests cell division or prevents reentry into the cell cycle.
• Part of the invention is thus the usage of the nucleic acid molecules as mentioned hereinbefore as a negative or positive regulator of cell proliferation.
• a transformed plant can thus be obtained by transforming a plant cell with a gene encoding a polypeptide concerned or fragment thereof alone or in combination.
• tissue specific promoters in one construct or being present as a separate construct in addition to the sequence concerned, can be used.
• cell division of the meristems of the plant can be manipulated, positively and/or negatively respectively.
• overproduction of the cell cycle interacting protein of the invention enhances growth and results in cell division to be less sensitive to an arrest caused by environmental stress such as salt, nutrient deprivation, drought, chilling and the like.
• the present invention relates to a method for the production of transgenic plants, plant cells or plant tissue comprising the introduction of a nucleic acid molecule or vector of the invention into the genome of said plant, plant cell or plant tissue.
• the molecules are placed under the control of regulatory elements which ensure the expression in plant cells.
• regulatory elements may be heterologous or homologous with respect to the nucleic acid molecule to be expressed as well with respect to the plant species to be transformed.
• regulatory elements comprise a promoter active in plant cells. These promoters can be used to modulate (e.g. increase, decrease, alter) cell cycle interacting protein content and/or composition in a desired tissue or under certain conditions.
• constitutive promoters are used, such as the 35 S promoter of CaMV (Odell, Nature 313 (1985), 810-812) or promoters from such genes as rice actin (McElroy et al. (1990) Plant Cell 2:163-171) maize H3 histone (Lepetit et al. (1992) Mol. Gen. Genet 231 :276-285) or promoters of the polyubiquitin genes of maize (Christensen, Plant Mol. Biol. 18 (1982), 675-689).
• tissue specific promoters see, e.g., Stockhaus, EMBO J. 8 (1989), 2245-2251 or Table A). Table A: Exemplary tissue specific or tissue-preferred promoters for use in the performance of the present invention.
• the promoters listed in the table are provided for the purposes of exemplification only and the present invention is not to be limited by the list provided therein. Those skilled in the art will readily be in a position to provide additional promoters that are useful in performing the present invention. The promoters listed may also be modified to provide specificity of expression as required.
• promoters which are specifically active in tubers of potatoes or in seeds of different plants species, such as maize, Vicia, wheat, barley etc.
• Inducible promoters may be used in order to be able to exactly control expression under certain environmental or developmental conditions such as pathogens, anaerobia, light, etc.
• An example for inducible promoters are the promoters of genes encoding heat shock proteins.
• microspore-specific regulatory elements and their uses have been described (W096/16182).
• the chemically inducible Tet-system may be employed (Gatz, Mol. Gen. Genet. 227 (1991); 229-237). Further suitable promoters are known to the person skilled in the art and are described, e.g., in Ward (Plant Mol.
• the regulatory elements may further comprise transcriptional and/or translational enhancers functional in plants cells. Furthermore, the regulatory elements may include transcription termination signals, such as a poly-A signal, which lead to the addition of a poly A tail to the transcript which may improve its stability.
• nucleic acid molecule according to the invention is expressed in sense orientation it is in principle possible to modify the coding sequence in such a way that the protein is located in any desired compartment of the plant cell.
• these include the nucleus, endoplasmatic reticulum, the vacuole, the mitochondria, the plastids, the apoplast, the cytoplasm etc. Since the interacting component of the protein of the invention excerts its effects in the cytoplasm and/or nucleus, corresponding signal sequences are preferred to direct the protein of the invention in the same compartment. Methods how to carry out this modifications and signal sequences ensuring localization in a desired compartment are well known to the person skilled in the art.
• Methods for the introduction of foreign DNA into plants are also well known in the art. These include, for example, the transformation of plant cells or tissues with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes, the fusion of protoplasts, direct gene transfer (see, e.g., EP-A 164 575), injection, electroporation, biolistic methods like particle bombardment, pollen-mediated transformation, plant RNA virus-mediated transformation, liposome-mediated transformation, transformation using wounded or enzyme-degraded immature embryos, or wounded or enzyme-degraded embryogenic callus and other methods known in the art.
• the vectors used in the method of the invention may contain further functional elements, for example "left border”- and “right border”-sequences of the T-DNA of Agrobacterium which allow for stably integration into the plant genome.
• methods and vectors are known to the person skilled in the art which permit the generation of marker free transgenic plants, i.e. the selectable or scorable marker gene is lost at a certain stage of plant development or plant breeding. This can be achieved by, for example cotransformation (Lyznik, Plant Mol. Biol. 13 (1989), 151-161 ; Peng, Plant Mol. Biol.
• Suitable strains of Agrobacterium tumefaciens and vectors as well as transformation of Agrobacteria and appropriate growth and selection media are well known to those skilled in the art and are described in the prior art (GV3101 (pMK90RK), Koncz, Mol. Gen. Genet. 204 (1986), 383-396; C58C1 (pGV 3850kan), Deblaere, Nucl. Acid Res. 13 (1985), 4777; Bevan, Nucleic. Acid Res. 12(1984), 8711 ; Koncz, Proc. Natl. Acad. Sci. USA 86 (1989), 8467-8471; Koncz, Plant Mol. Biol.
• Agrobacterium tumefaciens Although the use of Agrobacterium tumefaciens is preferred in the method of the invention, other Agrobacterium strains, such as Agrobacterium rhizogenes, may be used, for example if a phenotype conferred by said strain is desired.
• transformation refers to the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for the transfer.
• the polynucleotide may be transiently or stably introduced into the host cell and may be maintained non-integrated, for example, as a plasmid or as chimeric links, or alternatively, may be integrated into the host genome.
• the resulting transformed plant cell can then be used to regenerate a transformed plant in a manner known by a skilled person.
• the plants which can be modified according to the invention and which either show overexpression of a protein according to the invention or a reduction of the synthesis of such a protein can be derived from any desired plant species.
• They can be monocotyledonous plants or dicotyledonous plants, preferably they belong to plant species of interest in agriculture, wood culture or horticulture interest, such as crop plants (e.g. maize, rice, barley, wheat, rye, oats etc.), potatoes, oil producing plants (e.g. oilseed rape, sunflower, pea nut, soy bean, etc.), cotton, sugar beet, sugar cane, leguminous plants (e.g. beans, peas etc.), wood producing plants, preferably trees, etc.
• crop plants e.g. maize, rice, barley, wheat, rye, oats etc.
• potatoes oil producing plants
• oil producing plants e.g. oilseed rape, sunflower, pea nut, soy bean, etc.
• the present invention relates also to a transgenic plant cell which contains (preferably stably integrated into its genome) a nucleic acid molecule according to the invention linked to regulatory elements which allow expression of the nucleic acid molecule in plant cells and wherein the nucleic acid molecule is foreign to the transgenic plant cell.
• a nucleic acid molecule according to the invention linked to regulatory elements which allow expression of the nucleic acid molecule in plant cells and wherein the nucleic acid molecule is foreign to the transgenic plant cell.
• foreign see supra.
• the presence and expression of the nucleic acid molecule in the transgenic plant cells leads to the synthesis of a cell cycle interacting protein and leads to physiological and phenotypic changes in plants containing such cells.
• the present invention also relates to transgenic plants and plant tissue comprising transgenic plant cells according to the invention. Due to the (over)expression of a cell cycle interacting protein of the invention, e.g., at developmental stages and/or in plant tissue in which they do not naturally occur these transgenic plants may show various physiological, developmental and/or morphological modifications in comparison to wild-type plants. Therefore, part of this invention is the use of cell cycle genes and/or cell cycle interacting proteins to modulate the level of cell cycle interacting proteins and/or plant cell division and/or growth in plant cells, plant tissues, plant organs and/or whole plants.
• To the scope of the invention also belongs a method to influence the activity of cyclin- dependent protein kinase in a plant cell by transforming the plant cell with a nucleic acid molecule according to the invention and/or manipulation of the expression of said molecule. More in particular using a nucleic acid molecule according to the invention, the disruption of plant cell cycle can be accomplished by interfering in the expression of a substrate for cyclin-dependent protein kinase. The latter goal may be achieved, for example, with methods for reducing the amount of active cell cycle interacting proteins.
• transgenic plants overexpressing a A. thaliana cell cycle interacting gene of the invention its coding region can be cloned, e.g., into the pAT7002 vector (Aoyama and Chua, Plant J. 11 (1997), 605-612).
• This vector allows inducible expression of the cloned inserts by the addition of the glucocorticoid dexamethasone.
• PCR polymerase chain reaction
• the coding region of the cell cycle interacting gene can be amplified using appropriate primers, whereby a first primer contains an Xhol and a second primer contains an Spel restriction site. The obtained PCR fragment can be purified and cut with Xhol and Spel.
• the resulted binary vector can be transferred into Agrobacterium tumefaciens.
• This strain can be used to transform Nicotiana tabacum cv. Petit havana using, e.g., the leaf disk protocol (Horsh, Science 227 (1985), 1229-1231) and Arabidopsis thaliana using, e.g., the root transformation protocol (Valvekens, PNAS 85 (1988), 5536-5540).
• Transgenic plants can then be selected on hygromycine 20 mg/l. Plants can be tested for the gene of interest inducible expression as follows. 2 to 3 leaves of each transformant can be cut in two.
• RNA can be extracted from these leaves using the Trizol reagents (Gibco-BRL) according to the manufactures and a northern gel can be run using, e.g., 5 ⁇ g of RNA.
• the gel can be blotted on a nitro-cellulose filter (HybondN+, Amersham) and hybridised with a gene specific probe.
• seeds of transformants can be put on Vz MS medium with 1 % sucrose, both with and without dexamethasone. As a control SR1 seeds should be included.
• transgenic plants In the presence of dexamethasone the growth behaviour of the transgenic plants as compared to the control plants is expected to be modified. For example, these transgenic plants may grow faster and/or have additional cells. Furthermore, said plant may be less sensitive to environmental stress compared to the corresponding wild type plant.
• the invention also relates to a transgenic plant cell which contains (preferably stably integrated into its genome) a nucleic acid molecule according to the invention or part thereof, wherein the transcription and/or expression of the nucleic acid molecule or part thereof leads to reduction of the synthesis of a cell cycle interacting protein.
• the reduction is achieved by an anti-sense, sense, ribozyme, co-suppression and/or dominant mutant effect.
• Antisense and “antisense nucleotides” means DNA or RNA constructs which block the expression of the naturally occurring gene product.
• nucleic acid molecules according to the invention opens up the possibility to produce transgenic plant cells with a reduced level of the protein as described above and, thus, with a defect in the cell cycle.
• Techniques how to achieve this are well known to the person skilled in the art. These include, for example, the expression of antisense-RNA, ribozymes, of molecules which combine antisense and ribozyme functions and/or of molecules which provide for a co-suppression effect; see also supra.
• the nucleic acid molecule encoding the antisense-RNA is preferably of homologous origin with respect to the plant . species used for transformation.
• nucleic acid molecules which display a high degree of homology to endogenously occurring nucleic acid molecules encoding a cell cycle interacting protein.
• the homology is preferably higher than 80%, particularly higher than 90% and still more preferably higher than 95%.
• the reduction of the synthesis of a protein according to the invention in the transgenic plant cells can result in an alteration in, e.g., cell division. In transgenic plants comprising such cells this can lead to various physiological, developmental and/or morphological changes, preferably to improved regeneration and transformation capacity of, e.g., cultured cells or wounded tissue.
• the present invention also relates to transgenic plants comprising the above- described transgenic plant cells. These may show, for example, a deficiency in cell division and/or reduced growth characteristics compared to wild type plants due to the stable or transient presence of a foreign DNA resulting in at least one of the following features:
• the present invention also relates to cultured plant tissues comprising transgenic plant cells as described above which either show overexpression of a protein according to the invention or a reduction in synthesis of such a protein.
• Any transformed plant obtained according to the invention can be used in a conventional breeding scheme or in in vitro plant propagation to produce more transformed plants with the same characteristics and/or can be used to introduce the same characteristic in other varieties of the same or related species. Such plants are also part of the invention. Seeds obtained from the transformed plants genetically also contain the same characteristic and are part of the invention.
• the present invention is in principle applicable to any plant and crop that can be transformed with any of the transformation method known to those skilled in the art and includes for instance corn, wheat, barley, rice, oilseed crops, cotton, tree species, sugar beet, cassava, tomato, potato, numerous other vegetables, fruits.
• the invention also relates to harvestable parts and to propagation material of the transgenic plants according to the invention which either contain transgenic plant cells expressing a nucleic acid molecule according to the invention or which contain cells which show a reduced level of the described protein.
• Harvestable parts can be in principle any useful parts of a plant, for example, flowers, pollen, seedlings, tubers, leaves, stems, fruit, seeds, roots etc.
• Propagation material includes, for example, seeds, fruits, cuttings, seedlings, tubers, rootstocks etc.
• the regulatory sequences that naturally drive the expression of the above described cell cycle interacting proteins may prove useful for the expression of heterologous DNA sequences in certain plant tissues and/or at different developmental stages in plant development.
• the present invention relates to a regulatory sequence of a promoter naturally regulating the expression of a nucleic acid molecule of the invention described above or of a nucleic acid molecule homologous to a nucleic acid molecule of the invention.
• a genomic library consisting of plant genomic DNA cloned into phage or bacterial vectors can be screened by a person skilled in the art.
• Such a library consists e.g.
• genomic DNA prepared from seedlings, fractionized in fragments ranging from 5 kb to 50 kb, cloned into the lambda GEM11 (Promega) phages. Phages hybridizing with the probes can be purified. From the purified phages DNA can be extracted and sequenced. Having isolated the genomic sequences corresponding to the genes encoding the above-described cell cycle interacting proteins, it is possible to fuse heterologous DNA sequences to these promoters or their regulatory sequences via transcriptional or translational fusions well known to the person skilled in the art.
• 5'-upstream genomic fragments can be cloned in front of marker genes such as luc, gfp or the GUS coding region and the resulting chimeric genes can be introduced by means of Agrobacterium tumefaciens mediated gene transfer into plants or transfected into plant cells or plant tissue for transient expression.
• marker genes such as luc, gfp or the GUS coding region
• the resulting chimeric genes can be introduced by means of Agrobacterium tumefaciens mediated gene transfer into plants or transfected into plant cells or plant tissue for transient expression.
• the expression pattern observed in the transgenic plants or transfected plant cells containing the marker gene under the control of the regulatory sequences of the invention reveal the boundaries of the promoter and its regulatory sequences.
• said regulatory sequence is capable of conferring expression of a heterologous DNA sequence in main and lateral root meristems, shoot apical meristems, embryos at the globular, heart and torpedo stages, floral meristems and/or cambial cells in the stem.
• regulatory sequence refers to sequences which influence the specificity and/or level of expression, for example in the sense that they confer cell and/or tissue specificity; see supra. Such regions can be located upstream of the transcription initiation site, but can also be located downstream of it, e.g., in transcribed but not translated leader sequences.
• promoter within the meaning of the present invention refers to nucleotide sequences necessary for transcription initiation, i.e. RNA polymerase binding, and may also include, for example, the TATA box.
• nucleic acid molecule homologous to a nucleic acid molecule of the invention includes promoter regions and regulatory sequences of other cell cycle interacting protein encoding genes, such as genes from other species, for example, maize, alfalfa, potato, sorghum, millet, coix, barley, wheat and rice the coding region of which share substantial homology to the cell cycle interacting proteins of the invention and which display substantially the same expression pattern.
• promoters are characterized by their capability of conferring expression of a heterologous DNA sequence in meristematic tissue and cells and other tissues mentioned above.
• regulatory sequences from any species can be used that are functionally homologous to the regulatory sequences of the promoter of the above defined nucleic acid molecules, or promoters of genes that display an identical or similar pattern of expression, in the sense of being expressed in the above- mentioned tissues and cells.
• the expression conferred by the regulatory sequences of the invention may not be limited to, for example, root meristem cells but can include or be restricted to, for example, subdomains of meristems.
• the particular expression pattern may also depend on the plant/vector system employed.
• heterologous DNA sequences driven by the regulatory sequences of the invention predominantly occurs in the meristem unless certain elements of the regulatory sequences of the invention, were taken and designed by the person skilled in the art to control the expression of a heterologous DNA sequence in other cell types.
• regulatory elements may be added to the regulatory sequences of the invention.
• transcriptional enhancers and/or sequences which allow for induced expression of the regulatory sequences of the invention may be employed.
• a suitable inducible system is for example tetracycline-regulated gene expression as described, e.g., by Gatz, supra.
• the regulatory sequence of the invention may preferably be derived from the above described cell cycle interacting genes. Plants that may be suitable sources for such genes have been described above.
• said regulatory sequence is part of a recombinant DNA molecule.
• the regulatory sequence in the recombinant DNA molecule is operatively linked to a heterologous DNA sequence.
• heterologous with respect to the DNA sequence being operatively linked to the regulatory sequence of the invention means that said DNA sequence is not naturally linked to the regulatory sequence of the invention.
• Expression of said heterologous DNA sequence comprises transcription of the DNA sequence, preferably into a translatable mRNA.
• Regulatory elements ensuring expression in eukaryotic cells, preferably plant cells are well known to those skilled in the art. They usually comprise poly-A signals ensuring termination of transcription and stabilization of the transcript, see also supra. Additional regulatory elements may include transcriptional as well as translational enhancers; see supra.
• the heterologous DNA sequence of the above-described recombinant DNA molecules encodes a peptide, protein, antisense RNA, sense RNA and/or ribozyme.
• the recombinant DNA molecule of the invention can be used alone or as part of a vector to express heterologous DNA sequences, which, e.g., encode proteins for, e.g., the control of disease resistance, modulation of nutrition value or diagnostics of cell cycle related gene expression.
• the recombinant DNA molecule or vector containing the DNA sequence encoding a protein of interest is introduced into the cells which in turn produce the RNA and optionally protein of interest.
• the regulatory sequences of the invention can be operatively linked to a lethal gene for use in the production of male and female sterility in plants.
• lethal genes include the Bacillus amyloliquefaciens ribonuclease (Hartlet, J. Mol. Biol. 89 (1985)) and the Bacillus amyloliquefaciens ribonuclease expressed with or without its inhibitor, barstar.
• Another example for a lethal gene is the catalytic A fragment of diphteria toxin (Tweeten, J. Bacteriol. 156 (1983), 680-685). Expression of diphteria toxin within yeast cells causes ADP-ribosylation of elongation factor 2, which leads to inhibition of protein synthesis and eventual cell death (Mattheakis, Mol. Cell. Biol. 12 (1992), 4026-4037).
• said protein can be a scorable marker, e.g., luciferase, green fluorescent protein or ⁇ -galactosidase.
• a scorable marker e.g., luciferase, green fluorescent protein or ⁇ -galactosidase.
• This embodiment is particularly useful for simple and rapid screening methods for compounds and substances described herein below capable of modulating cell cycle interacting protein gene expression.
• a cell suspension can be cultured in the presence and absence of a candidate compound in order to determine whether the compound affects the expression of genes which are under the control of regulatory sequences of the invention, which can be measured, e.g., by monitoring the expression of the above-mentioned marker.
• other marker genes may be employed as well, encoding, for example, a selectable marker which provides for the direct selection of compounds which induce or inhibit the expression of said marker.
• the regulatory sequences of the invention may also be used in methods of antisense approaches.
• the antisense RNA may be a short (generally at least 10, preferably at least 14 nucleotides, and optionally up to 100 or more nucleotides) nucleotide sequence formulated to be complementary to a portion of a specific mRNA sequence and/or DNA sequence of the gene of interest. Standard methods relating to antisense technology have been described; see, e.g., Klann, Plant Physiol. 112 (1996), 1321-1330.
• the antisense RNA binds to its target sequence within a cell, thereby inhibiting translation of the mRNA and down- regulating expression of the protein encoded by the mRNA.
• the invention relates to nucleic acid molecules of at least 15 nucleotides in length hybridizing specifically with a regulatory sequence as described above or with a complementary strand thereof. For the possible applications of such nucleic acid molecules, see supra.
• the present invention also relates to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering that comprise a recombinant DNA molecule of the invention.
• said vector is an expression vector and/or a vector further comprising a selection marker for plants.
• selector markers see supra.
• Methods which are well known to those skilled in the art can be used to construct recombinant vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989).
• the recombinant DNA molecules and vectors of the invention can be reconstituted into liposomes for delivery to target cells; see also supra.
• the present invention furthermore relates to host cells transformed with a regulatory sequence, a DNA molecule or vector of the invention.
• Said host cell may be a prokaryotic or eukaryotic cell; see supra.
• the present invention provides for a method for the production of transgenic plants, plant cells or plant tissue comprising the introduction of a nucleic acid molecule, recombinant DNA molecule or vector of the invention into the genome of said plant, plant cell or plant tissue.
• a nucleic acid molecule, recombinant DNA molecule or vector of the invention into the genome of said plant, plant cell or plant tissue.
• further regulatory sequences such as poly A tail may be fused, preferably 3' to the heterologous DNA sequence, see also supra.
• Further possibilities might be to add Matrix Attachment Sites at the borders of the transgene to act as "delimiters" and insulate against methylation spread from nearby heterochromatic sequences.
• the present invention relates also to transgenic plant cells which contain stably integrated into the genome a recombinant DNA molecule or vector according to the invention.
• the present invention also relates to transgenic plants and plant tissue comprising the above-described transgenic plant cells. These plants may show, for example, modified architecture, increased yield or an increased tolerance to diseases, e.g., nematodes, geminiviruses or to stresses, e.g., salt, heat, nutrient deprivation, etc.
• the invention also relates to harvestable parts and to propagation material of the transgenic plants according to the invention which contain transgenic plant cells described above. Harvestable parts and propagation material can be in principle any useful part of a plant; see supra.
• the present invention also relates to the use of the above described regulatory sequences and recombinant DNA molecules of the invention for the expression of heterologous DNA sequences.
• nucleic acid molecules and proteins of the present invention provide a basis for the development of mimetic compounds that may be inhibitors or activators of cell cycle interacting proteins or their encoding genes. It will be appreciated that the present invention also provides cell based screening methods that allow a high-throughput-screening (HTS) of compounds that may be candidates for such inhibitors and activators.
• HTS high-throughput-screening
• the present invention further relates to a method for the identification of an activator or inhibitor of genes encoding cell cycle interacting proteins comprising the steps of:
• the present invention further relates to a method for identifying and obtaining an activator or inhibitor of cell cycle interacting proteins comprising the steps of:
• read out system in context with the present invention means any substrate that can be monitored, for example due to enzymatically induced changes. It also includes DNA sequences which upon transcription and/or expression in a cell, tissue or organism provide for a scorable and/or selectable phenotype. Such read out systems are well known to those skilled in the art and comprise, for example, substrates for protein kinases, recombinant DNA molecules and marker genes as described above.
• plurality of compounds in a method of the invention is to be understood as a plurality of substances which may or may not be identical.
• Said compound or plurality of compounds may be chemically synthesized or microbiologically produced and/or comprised in, for example, samples, e.g., cell extracts from, e.g., plants, animals or microorganisms.
• said compound(s) may be known in the art but hitherto not known to be capable of suppressing or activating cell cycle interacting proteins.
• the reaction mixture may be a cell free extract or may comprise a cell or tissue culture. Suitable set ups for the method of the invention are known to the person skilled in the art and are, for example, generally described in Alberts et al., Molecular Biology of the Cell, third edition (1994), in particular Chapter 17.
• the plurality of compounds may be, e.g., added to the reaction mixture, culture medium, injected into the cell or sprayed onto the plant.
• the cell or tissue that may be employed in the method of the invention preferably is a host cell, plant cell or plant tissue of the invention described in the embodiments hereinbefore.
• a sample containing a compound or a plurality of compounds is identified in the method of the invention, then it is either possible to isolate the compound from the original sample identified as containing the compound capable of suppressing or activating cell cycle interacting proteins, or one can further subdivide the original sample, for example, if it consists of a plurality of different compounds, so as to reduce the number of different substances per sample and repeat the method with the subdivisions of the original sample.
• the steps described above can be performed several times, preferably until the sample identified according to the method of the invention only comprises a limited number of or only one substance(s).
• said sample comprises substances of similar chemical and/or physical properties, and most preferably said substances are identical.
• the immobilized polymers are contacted with a labeled receptor and scanned for label to identify polymers binding to the receptor.
• the synthesis and screening of peptide libraries on continuous cellulose membrane supports that can be used for identifying binding ligands of the polypeptide of the invention and thus possible inhibitors and activators is described, for example, in Kramer, Methods Mol. Biol. 87 (1998), 25-39. This method can also be used, for example, for determining the binding sites and the recognition motifs in the polypeptide of the invention.
• the substrate specificity of the DnaK chaperon was determined and the contact sites between human interleukin-6 and its receptor; see Rudiger, EMBO J.
• antagonists of the polypeptide of the invention can be derived and identified from monoclonal antibodies that specifically react with the polypeptide of the invention in accordance with the methods as described in Doring, Mol. Immunol. 31 (1994), 1059-1067. More recently, WO 98/25146 described further methods for screening libraries of complexes for compounds having a desired property, especially, the capacity to agonize, bind to, or antagonize a polypeptide or its cellular receptor.
• the complexes in such libraries comprise a compound under test, a tag recording at least one step in synthesis of the compound, and a tether susceptible to modification by a reporter molecule. Modification of the tether is used to signify that a complex contains a compound having a desired property.
• the tag can be decoded to reveal at least one step in the synthesis of such a compound.
• Other methods for identifying compounds which interact with the proteins according to the invention or nucleic acid molecules encoding such molecules are, for example, the in vitro screening with the phage display system as well as filter binding assays or "real time" measuring of interaction using, for example, the BIAcore apparatus (Pharmacia).
• Mimetic analogs of the polypeptide of the invention or biologically active fragments thereof can be generated by, for example, substituting the amino acids that are expected to be essential for the biological activity with, e.g., stereoisomers, i.e. D-amino acids; see e.g., Tsukida, J. Med. Chem. 40 (1997), 3534-3541.
• Pro-mimetic components can be incorporated into a peptide to reestablish at least some of the conformational properties that may have been lost upon removal of part of the original polypeptide; see, e.g., Nachman, Regul. Pept. 57 (1995), 359-370.
• the polypeptide of the invention can be used to identify synthetic chemical peptide mimetics that bind to or can function as a ligand, substrate, binding partner or the receptor of the polypeptide of the invention as effectively as does the natural polypeptide; see, e.g., Engleman, J. Clin. Invest. 99 (1997), 2284-2292.
• the nucleic acid molecule of the invention can also serve as a target for activators and inhibitors.
• Activators may comprise, for example, proteins that bind to the mRNA of a gene encoding a polypeptide of the invention, thereby stabilizing the native conformation of the mRNA and facilitating transcription and/or translation, e.g., in like manner as Tat protein acts on HIV-RNA.
• methods are described in the literature for identifying nucleic acid molecules such as an RNA fragment that mimics the structure of a defined or undefined target RNA molecule to which a compound binds inside of a cell resulting in retardation of cell growth or cell death; see, e.g., WO 98/18947 and references cited therein.
• nucleic acid molecules can be used for identifying unknown compounds of pharmaceutical and/or agricultural interest, and for identifying unknown RNA targets for use in treating a disease.
• These methods and compositions can be used in screening for novel antibiotics, bacteriostatics, or modifications thereof or for identifying compounds useful to alter expression levels of proteins encoded by a nucleic acid molecule.
• the conformational structure of the RNA fragment which mimics the binding site can be employed in rational drug design to modify known antibiotics to make them bind more avidly to the target.
• One such methodology is nuclear magnetic resonance (NMR), which is useful to identify drug and RNA conformational structures.
• NMR nuclear magnetic resonance
• Still other methods are, for example, the drug design methods as described in WO 95/35367, US-A-5,322,933, where the crystal structure of the RNA fragment can be deduced and computer programs are utilized to design novel binding compounds which can act as antibiotics.
• the compounds which can be tested and identified according to a method of the invention may be expression libraries, e.g., cDNA expression libraries, peptides, proteins, nucleic acids, antibodies, small organic compounds, hormones, peptidomimetics, PNAs or the like (Milner, Nature Medicine 1 (1995), 879-880; Hupp, Cell 83 (1995), 237-245; Gibbs, Cell 79 (1994), 193-198 and references cited supra).
• expression libraries e.g., cDNA expression libraries, peptides, proteins, nucleic acids, antibodies, small organic compounds, hormones, peptidomimetics, PNAs or the like
• genes encoding a putative regulator of cell cycle interacting protein and/or which excert their effects up- or downstream the cell cycle interacting protein of the invention may be identified using, for example, insertion mutagenesis using, for example, gene targeting vectors known in the art (see, e.g., Hayashi, Science 258
• Said compounds can also be functional derivatives or analogues of known inhibitors or activators.
• Such useful compounds can be for example transacting factors which bind to the cell cycle interacting protein or regulatory sequences of the invention.
• the protein or regulatory sequence of the invention can be used as an affinity reagent in standard protein purification methods, or as a probe for screening an expression library.
• the identification of nucleic acid molecules which encode proteins which interact with the cell cycle interacting proteins described above can also be achieved, for example, as described in Scofield (Science 274 (1996),
• yeast strain expressing this fusion protein and comprising a lacZ reporter gene driven by an appropriate promoter, which is recognized by the GAL4 transcription factor, is transformed with a library of cDNAs which will express plant proteins or peptides thereof fused to an activation domain.
• a peptide encoded by one of the cDNAs is able to interact with the fusion peptide comprising a peptide of a protein of the invention, the complex is able to direct expression of the reporter gene.
• the nucleic acid molecules according to the invention and the encoded peptide can be used to identify peptides and proteins interacting with cell cycle interacting proteins. It is apparent to the person skilled in the art that this and similar systems may then further be exploited for the identification of inhibitors of the binding of the interacting proteins.
• the transacting factor modulation of its binding to or regulation of expression of the cell cycle interacting protein of the invention can be pursued, beginning with, for example, screening for inhibitors against the binding of the transacting factor to the protein of the present invention.
• Activation or repression of cell cycle interacting proteins could then be achieved in plants by applying of the transacting factor (or its inhibitor) or the gene encoding it, e.g. in a vector for transgenic plants.
• the active form of the transacting factor is a dimer, dominant-negative mutants of the transacting factor could be made in order to inhibit its activity.
• further components in the pathway leading to activation e.g. signal transduction
• repression of a gene involved in the control of cell cycle then can be identified. Modulation of the activities of these components can then be pursued, in order to develop additional drugs and methods for modulating the cell cycle in animals and plants.
• the present invention also relates to the use of the two-hybrid system as defined above for the identification of cell cycle interacting proteins or activators or inhibitors of such poteins
• Determining whether a compound is capable of suppressing or activating cell cycle interacting proteins can be done, for example, by monitoring DNA duplication and cell division. It can further be done by monitoring the phenotypic characteristics of the cell of the invention contacted with the compounds and compare it to that of wild-type plants. In an additional embodiment, said characteristics may be compared to that of a cell contacted with a compound which is either known to be capable or incapable of suppressing or activating cell cycle interacting proteins.
• the compounds isolated by the above methods also serve as lead compounds for the development of analog compounds.
• the analogs should have a stabilized electronic configuration and molecular conformation that allows key functional groups to be presented to the receptor in substantially the same way as the lead compound.
• the analog compounds have spatial electronic properties which are comparable to the binding region, but can be smaller molecules than the lead compound, frequently having a molecular weight below about 2 kD and preferably below about 1 kD.
• Identification of analog compounds can be performed through use of techniques such as self-consistent field (SCF) analysis, configuration interaction (Cl) analysis, and normal mode dynamics analysis.
• SCF self-consistent field
• Cl configuration interaction
• normal mode dynamics analysis normal mode dynamics analysis.
• the inhibitor or activator identified by the above-described method may prove useful as a herbicide, pesticide, insecticide, antibiotic, tumor suppressing agent and/or as a cell growth regulator.
• the invention relates to a compound obtained or identified according to the method of the invention said compound being an activator of cell cycle interacting proteins or an inhibitor of cell cycle interacting proteins.
• the above-described compounds include, for example, cell cycle kinase inhibitors.
• Cell- cycle kinase inhibitor (CKI) is a protein which inhibit CDK/cyclin activity and is produced and/or activated when further cell division has to be temporarily or continuously prevented.
• the antibodies, nucleic acid molecules, inhibitors and activators of the present invention preferably have a specificity at least substantially identical to the binding specificity of the natural ligand or binding partner of the cell cycle protein of the invention, in particular if cell cycle stimulation is desired.
• An antibody or inhibitor can have a binding affinity to the cell cycle interacting protein of the invention of at least 10 5 M " ⁇ preferably higher than 10 7 M '1 and advantageously up to 10 10 M "1 in case cell cycle suppression should be mediated.
• a suppressive antibody or inhibitor of the invention has an affinity of at least about 10 "7 M, preferably at least about 10 "9 M and most preferably at least about 10 '11 M; and cell cycle stimulating activator has an affinity of less than about 10 '7 M, preferably less than about 10 '6 M and most preferably in order of 10 "5 M.
• nucleic acid molecules it is preferred that they have a binding affinity to those encoding the amino acid sequences depicted in SEQ ID NO: 2, 4, 34, 36, 38, 40, 42, 6, 8, 10, 12 or 14 of at most 2-, 5- or 10-fold less than an exact complement of 20 consecutive nucleotides of the above described nucleic acid molecules.
• the compound identified according to the above described method or its analog or derivative is further formulated in a therapeutically active form or in a form suitable for the application in plant breeding or plant cell and tissue culture.
• a therapeutically active form or in a form suitable for the application in plant breeding or plant cell and tissue culture For example, it can be combined with a agriculturally acceptable carrier known in the art.
• the present invention also relates to a method of producing a therapeutic or plant effective composition comprising the steps of one of the above described methods of the invention and combining the compound obtained or identified in the method of the invention or an analog or derivative thereof with a pharmaceutically acceptable carrier or with a plant cell and tissue culture acceptable carrier.
• the present invention generally relates to compositions comprising at least one of the aforementioned nucleic acid molecules, vectors, proteins, regulatory sequences, recombinant DNA molecules, antibodies or compounds.
• said composition is for use as a medicament, a diagnostic means, a kit or as a plant effective composition.
• compositions useful in agriculture and in plant cell and tissue culture are provided.
• Plant protection compositions can be prepared by employing the above-described methods of the invention and synthesizing the compound identified as inhibitor or activator in an amount sufficient for use in agriculture.
• the present invention also relates to a method for the preparation of an agricultural plant protection composition comprising the above-described steps of the method of the invention and synthesizing the compound so identified or an analog or derivative thereof.
• the compound identified by the above-described method may be preferentially formulated by conventional means commonly used for the application of, for example, herbicides and pesticides or agents capable of inducing systemic acquired resistance (SAR).
• SAR systemic acquired resistance
• certain additives known to those skilled in the art stabilizers or substances which facilitate the uptake by the plant cell, plant tissue or plant may be used.
• the cell cycle interacting proteins of the invention appear to function in the cell division cycle which is similar in plants and animals. Accordingly, the nucleic acid molecules and proteins of the invention or derivatives thereof as well as the above described activators and inhibitors may be used to modulate the cell division cycle in animal, preferably mammalian cells which is integral to the development and spread of cancerous cells.
• a cell cycle interacting protein that acts as a basal transcription factor may promote cancer cell growth.
• cells could be transfected with antisense sequences to cell cycle interacting protein encoding polynucleotides or provided with antagonists to the protein or its encoding gene.
• the above described antagonists or antisense molecules may be used to slow, stop, or reverse cancer cell growth.
• the present invention also relates to a method of producing a therapeutic agent comprising the steps of the methods described hereinbefore and synthesizing the activator or inhibitor obtained or identified in step (c) or an analog or derivative thereof in an amount sufficient to provide said agent in a therapeutically effective amount to a patient.
• compositions can also include, depending on the formulation desired, pharmaceutically acceptable, usually sterile, non-toxic carriers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration.
• diluents are selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological saline, Ringer's solutions, dextrose solution, and Hank's solution.
• the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like.
• a therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which ameliorate the symptoms or condition.
• Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population).
• ED50 the dose therapeutically effective in 50% of the population
• LD50 the dose lethal to 50% of the population.
• the dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
• the invention also relates to a diagnostic composition
• a diagnostic composition comprising at least one of the aforementioned nucleic acid molecules, vectors, proteins, antibodies or compounds and optionally suitable means for detection.
• Said diagnostic compositions may be used for methods for determining expression of cell cycle interacting proteins by detecting the presence of the corresponding mRNA which comprises isolation of mRNA from a cell and contacting the mRNA so obtained with a probe comprising a nucleic acid probe as described above under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the protein in the cell.
• Further methods of detecting the presence of a protein according to the present invention comprises immunotechniques well known in the art, for example enzyme linked immunosorbent assay.
• the present invention relates to a kit comprising at least one of the aforementioned nucleic acid molecules, regulatory sequences, recombinant DNA molecules, vectors, proteins, compounds or antibodies of the invention.
• the kit of the invention may contain further ingredients such as selection markers and components for selective media suitable for the generation of transformed host cells and transgenic plant cells, plant tissue or plants.
• the kit may include buffers and substrates for reporter genes that may be present in the recombinant gene or vector of the invention.
• the kit of the invention may advantageously be used for carrying out the method of the invention and could be, inter alia, employed in a variety of applications referred to herein, e.g., in the diagnostic field or as research tool.
• the parts of the kit of the invention can be packaged individually in vials or in combination in containers or multicontainer units. Manufacture of the kit follows preferably standard procedures which are known to the person skilled in the art.
• the kit or its ingredients according to the invention can be used in plant cell and plant tissue cultures, for example, for any of the above described methods for detecting inhibitors and activators of cell cycle genes.
• inventions and its ingredients are expected to be very useful in breeding new varieties of, for example, plants which display improved properties such as nutritial value or disease resistance.
• proteins according to the invention from other organisms such as yeast and animals to influence cell division progression in those other organisms such as mammals or insects.
• one or more DNA sequences, vectors or proteins of the invention or the above-described antibody or compound are, for instance, used to specifically interfere in the modulation of the protein levels or activity of any protein involved in disruption of the expression levels of genes involved in G1/S and/or G2/M transition in the cell cycle process in transformed plants, particularl :
• the plant cell division rate and/or the inhibition of a plant cell division can be influenced by (partial) elimination of a gene or reducing the expression of a gene encoding a protein according to the invention.
• Said plant cell division rate and/or the inhibition of a plant cell division can also be influenced by eliminating or inhibiting the activity of the protein according to the invention by using for instance antibodies directed against said protein.
• As a result of said elimination or reduction greater organisms or specific organs or tissues can be obtained; greater in volume and in mass too.
• inhibition of cell division by various adverse environmental conditions such as drought, nutrient deprivation, high salt content, chilling and the like can be delayed or prevented by reduction or enhancing (e.g.
• an important aspect of the current invention is a method to modify plant architecture by overproduction or reduction of expression of a sequence according to the invention under the control of a tissue, cell or organ specific promoter.
• Another aspect of the present invention is a method to modify the growth inhibition of plants caused by environmental stress conditions above mentioned, or more particularly salt stress or nutrient deprivation by appropriate use of sequences according to the invention.
• cell division in the meristem of both main and lateral roots, shoot apical or the vascular tissue of a plant can be manipulated.
• any of the DNA sequences of the invention can be used to manipulate (reduce or enhance) the level of endopolyploidy and thereby increasing the storage capacity of, for example, endosperm cells.
• DNA sequences, vectors or proteins, regulatory sequences or recombinant DNA molecules of the invention or the above-described antibody or compound can be used to modulate, for instance, endoreduplication in storage cells, storage tissues and/or storage organs of plants or parts thereof.
• endoreduplication means recurrent DNA replication without consequent mitosis and cytokinesis.
• Preferred target storage organs and parts thereof for the modulation of endoreduplication are, for instance, seeds (such as from cereals, oilseed crops), roots (such as in sugar beet), tubers (such as in potato) and fruits (such as in vegetables and fruit species). Furthermore it is expected that increased endoreduplication in storage organs and parts thereof correlates with enhanced storage capacity and as such with improved yield.
• a plant with modulated endoreduplication in the whole plant or parts thereof can be obtained from a single plant cell by transforming the cell, in a manner known to the skilled person, with the above- described means.
• the present invention also relates to the use of a DNA sequence, vector, protein, antibody, regulatory sequences, recombinant DNA molecule, nucleic acid molecules or compound of the invention for modulating plant ceil cycle, plant cell division and/or growth, for influencing the activity of cell cycle interacting protein, for disrupting plant cell division by influencing the presence or absence or by interfering in the expression of a cyclin-dependent protein, for modifying growth inhibition of plants caused by environmental stress conditions, for inducing male or female sterility, for influencing cell division progression in a host as defined above or for use in a screening method for the identification of inhibitors or activators of cell cycle proteins.
• nucleic acid molecules according to the invention are used as molecular markers in plant breeding.
• the present invention also relates to the use of a DNA sequence or regulatory sequence of the invention as a marker gene in plant or animal cell and tissue culture or as a marker in marker-assisted plant breeding.
• the overexpression of nucleic acid molecules according to the invention may be useful for the alteration or modification of plant/pathogen interaction.
• pathogen includes, for example, bacteria, viruses and fungi as well as protozoa.
• DNA sequences of section (b) encoding PLP proteins described herein before and corresponding vectors, proteins etc. of the invention, in particular PHO80-like proteins (PLPs) may be used to improve the tolerance of plants towards suboptimal nutrient conditions, in particular levels of phosphate. Therefore such sequences may be used to uncouple optimal phosphate conditions from the plant growth rate resulting in enhanced growth rates in normal conditions or stress conditions such as low phosphate.
• Plants with modified expression of the PLP genes can display enhanced growth rates in normal growth conditions and in different stress conditions, in particular in the case of nutritional deprivation. Plants with modified expression of the PLP genes encompasses a method for conferring plant tolerance towards low levels of phosphate, meaning they may also be useful as a transgenic selective markers.
• the cDNA clone (LDV24) was isolated according to the invention as a novel protein interacting with the CDC2aAt protein in a two-hybrid screen.
• This clone encodes a protein showing strongest homology to the cyclins PHO80, PCL1 and PCL2 from Saccharomyces cerevisiae and to the PREG protein from Neurospora crassa, and was renamed PLP5 (PHO80-like protein).
• PLP1 to PLP4 four cDNAs, named PLP1 to PLP4, were isolated by RT-PCR technology from Arabidopsis thaliana according to the invention. Tissue specific expression analysis was performed. Two-hybrid analysis demonstrated all plant PLPs interact with the A. thaliana CDKs. Overexpression and antisense constructs were designed and introduced into plants.
• Phosphorus availability is considered one of the major growth-limiting factors for plants in many natural ecosystems.
• the primary source of phosphorus in soils is inorganic phosphate (Pi).
• Phosphorous is one of the most important nutrients for all organisms as it is part of many key biomolecules, like DNA, RNA, and lipids.
• Pi plays an essential role in the energy transfer chain and multiple metabolic pathways (Robinson (1996) Annals of botany 77, 179-185). For these reasons, plants have developed several adaptive mechanisms to overcome Pi stress, which involve both morphological and metabolic changes.
• the most common adaptation under limiting Pi are: (a) morphological adaptations such as root growth and architecture changes or (b) metabolic adaptations are represented by: (i) changes in the respiration rate and phospholipid content of chloroplasts. Phosphate availability affects the thylakoid lipid composition, the relative amount of sulfolipids, and a concomitant decrease in phosphatidylglycerol. Also several enzymes of the glycolytic pathway are altered (Theodorou and Plaxton (1993) Plant Physiol. 101 , 339-344), (ii) secretion of protons and organic acids.
• Pi deficiency induces a high-affinity Pi transporter in root and leaf cells.
• Pi deficiency induces a high-affinity Pi transporter in root and leaf cells.
• phosphate is still available in the cell, but not outside, the synthesis of extra- and intracellular (cytoplasmatic and vacuolar) RNases by Pi starvation is induced (Kock et al. (1998) Plant Mol Biol 27, 477-85). Also the stimulation of phosphatase activities in response to Pi starvation are well documented.
• the rest of the plant exhibits significant metabolic alteration such as: (a) activation of Pi recycling, (b) alteration of plant respiration rate (alternative pathway of glycolisis and mitochondria electron transport), (c) modification in the photosynthesis and photosynthate partitioning in leaves, (d) changes in Pi flow in the vascular system.
• E.coli a two component regulatory system governs the transcription of many genes that are responsive to the Pi levels of the environment.
• S. cerevisiae many mutants (pho series mutants) have been isolated.
• transcription of the PH05 gene, encoding a repressible acid phosphatase (rAPase) is under the control of the phosphate availability in the medium via a complex network of intracellular regulatory factors that comprises at least five genes: PH02, PH04, PH80, PH081 and PH085.
• PH02 and PH04 encode the activators necessary for transcription of PH05.
• the PH04 protein When the levels of Pi are high, the PH04 protein is hyperphosphorylated, impeding its nuclear import (and then the interaction with the PH02 transcription factor). This phosphorylation is mediated by the PHO80/PHO85 cyclin/CDK complex, thus being negative regulatory factors for the PH05 expression.
• the PH085 encodes a non-essential protein kinase with 50% identity to the CDC28, and PHO80 encodes a protein with homology to other yeast cyclins. Unlike the well-understood PHO regulation system in S.cerevisiae, the basis on which the plants are able to respond to external phosphate concentration are not yet understood.
• PH085 and PHO80 might have substrates that mediate other responses than phosphate starvation, such as regulation of growth and cell division.
• S. cerevisiae PH085 protein can interact with the G1 specific cyclins PCL1 and PCL2 (close homologues to the PHO80).
• PH085 is required for G1 progression. This result suggests that PH085 is involved in a regulatory pathway that links the nutrient status of the cell with cell division activity (Gilliquet and Berben (1993) FEMS Microbiol Lett ,108, 333-9).
• the plant homolog to the cyclin PHO80 has been isolated for the time. They have also identified a family of such PHO80-like proteins (PLPs).
• PLPs PHO80-like proteins
• the invention therefore encompasses such nucleotide sequences, proteins and their derivatives, variants and homologs. It also provides transgenic plants comprising PLPs.
• the above described embodiments of the present invention may be preferably performed with PLP nucleic acids and protein, for example as illustrated below.
• An embodiment of the invention includes a method for modulating (i.e. increasing or decreasing), in a transgenic plant, the expression of PLP genes.
• the method comprises transforming a plant cell (as described previously) with a vector comprising a nucleotide sequence of a PLP of the invention.
• modulating the PLP protein may be by use of a promoter to up or down regulate gene expression or to regulate expression in certain tissues or under certain environmental conditions.
• a constitutive or root-specific promoter is used.
• One embodiment of the invention includes a method for improving the tolerance of plants towards suboptimal nutrient conditions, in particular levels of phosphate, by modulating PLP expression and/or activity. Another embodiment includes a method for improving the growth of plants in normal conditions or suboptimal nutrient conditions, in particular levels of phosphate, by modulating PLP expression and/or activity.
• An embodiment of the invention includes a method for providing enhanced rate or frequency of seed germination comprising modulating PLP expression and/or activity.
• coding regions of the PLP genes can be altered by insertion, deletion, substitution or addition to decrease the activity of the encoded protein.
• An embodiment of the invention includes using a PLP gene in combination with one or more another PLP genes. Similarly they may be used in combination with other transgenes that confer another phenotype to the plant. Likewise, it is possible to first confer, improved phosphate sensitivity to a plant in accordance with the method of the invention and to then in an additional step transform such plant in accordance thereof with a further nucleic acid molecule, the presence of which results in another new phenotype characteristic of said plant.
• the result of the present invention displays at least two new properties compared to a naturally occurring wild-type plant, that is improved phosphate sensitivity and: a phenotype that is due to the presence of a further nucleic acid molecule in said plants e.g. herbicide or insectide tolerance, resistance to pathogens, improvement of starch composition and/or production etc.; see also supra.
• An embodiment of the invention includes a method for using of PLPs as a positive or negative selectable marker during transformation procedures (Wickert et al. (1998) J. Bacteriology 180 (7):1887-1894). Overexpression of the PLP would mean that it could be used as a positive selectable marker during transformation procedures while antisense/cosuppression means it could be used as a negative selective marker.
• the selective agent is an antibiotic, preferably hygromycin.
• FIG. 1 Expression of the PLP genes in Arabidopsis tissues. A gel blot of RT-PCR from the Arabidopsis tissues indicated and from suspension cultured cell is shown. Total RNA was prepared from these tissues, which were harvested complete from 4 weeks old plants. The present invention is further illustrated by reference to the following non-limiting examples.
• Example 1 Identification of cell cycle interacting proteins using the two hybrid system with CDC2b as a bait
• a two-hybrid screening was performed using as bait a fusion between the GAL4 DNA- binding domain and CDC2bAt.
• Vectors and strains used were provided with the Matchmaker Two-Hybrid System (Clontech, Palo Alto, CA).
• the bait was constructed by inserting the CDC2bAt PCR fragment into the pGBT9 vector.
• the PCR fragment was created from the cDNA using primers to incorporate EcoRI restriction enzyme sites (5'- CGGATCCGAATTCATGGAGAACGAG-3' (SEQ ID NO: 15) and 5'- CGGATCCGAATTCTCAGAACTGAGA-3') (SEQ ID NO: 16).
• the PCR fragment was cut with EcoRI and cloned into the EcoRI site of pGBT9, resulting in the plasmid pGBTCDC2B.
• the GAL4 activation domain cDNA fusion library was obtained from Clontech from mRNA of Arabidopsis thaliana cell suspensions harvested at various growing stages: early exponential, exponential, early stationary, and stationary phase.
• PCR fragments were digested with Alu ⁇ and fractionized on a 2% agarose gel. Plasmid DNA of which the inserts gave rise to different restriction patterns were electroporated into Escherichia coli XL1-Blue, and the DNA sequence of the inserts was determined. Extracted DNA was also used to retransform HF7c to test the specificity of the interaction.
• Example 2 Identification of cell cycle interacting proteins using the two hybrid system with CDC2a as a bait
• CDC2aAt-interacting proteins For the identification of cell cycle interacting proteins also a two hybrid system based on GAL4 recognition sites to regulate the expression of both his3 and lacZ reporter genes was used to identify CDC2aAt-interacting of proteins.
• the bait used for the two-hybrid screening was constructed by inserting the CDC2aAt coding region into the pGBT9 vector (Clontech). The insert was created by PCR using the CDC2aAt cDNA as template. Primers were designed to incorporate EcoRI restriction enzyme sites. The primers used were 5'-CGAGATCTGAATTCATGGATCAGTA-3' (SEQ ID NO: 19) and
• cDNA fusion library was used constructed from Arabidopsis thaliana cell suspension cultures. This library was constructed using RNA isolated from cells harvested at 20 hours, 3, 7 and 10 days after dilution of the culture in new medium. These time point correspondent to cells from the early exponential growth phase to the late stationary phase. mRNA was prepared using Dynabeads oligo(dT) 25 according to the manufacturer's instructions (Dynal).
• the GAL4 activation domain cDNA fusion library was generated using the HybriZAPTM vector purchased with the HybriZAPTM Two-Hybird cDNA Gigapack cloning Kit (Stratagene) following the manufacturer's instructions.
• the resulting library contained approximately 3J0 6 independent plaque-forming units, with an average insert size of 1 Kb.
• Example 3 Cell cycle interacting proteins associating with Cdc2aAt or Cdc2bAt
• cDNA clones were obtained by the method described in Example 1 and 2, which are further described below. The specificity of the interaction those clones was verified by the ⁇ transformation of yeast with pGBTCDC2A or pGBTCDC2B and the corresponding cDNA clones. As controls, pGBTCDC2A or pGBTCDC2B was cotransformed with a vector containing only the GAL4 activation domain (pGAD424); and the nine cDNA vectors were each cotransformed with a plasmid containing only the GAL4 DNA binding domain (pGBT9). Transformants were plated on medium with or without histidine.
• Vb89 clone encode the Arabidopsis thaliana HAL3 homologue, isolated recently and of which the function was unknown. Unexpectingly, the Vb89 clone interacts with CDC2bAt, but not with CDC2aAt in the two- hybrid system. The interaction of Vb89 with CDC2bAt highlights an important role of Vb 89 in cell cycle control.
• the publicly available databases were screened with the cDNA VB89. An overall perfect homology with HAL3, already known in the databases was found. With the help of BLASTX U80192 (score 1.9e-106) was found as the best homologue.
• This sequence is a partial cDNA from A.thaliana (entered in the databank: 28-APR-1997)(with publ.: Culianez-Macia,F.A., Espinosa-Ruiz,A. and Serrano,R, Arabidopsis thaliana HAL3 homolog gene, unpublished). Except that VB89 is longer, there are no major differences with this cDNA.
• HAL3 is a halotolerant gene isolated in Saccharomyces cerevisiae (Ferrando, 1995 Molecular and Cellular Biology, 15:5470-5481.). Hal3p can inhibit the Ppz1 protein phosphatase resulting in an increased resistance to sodium and lithium. These effect is largely a result of the increased expression of the ENA/PMR2A gene. This gene codes for a P-type ATPase responsible for sodium efflux (De Nadal et al., 1998 Proc. Natl. Acad. Sci. USA, 95: 7357-7362).
• the HAL3 gene has also been isolated independently (as SIS2) and characterized on the basis of its ability to increase, when present in high copy number, the growth rate of sit4 mutants (Di Como et al., 1995 Genetics, 139: 95- 107.).
• the SIT4/PPH1 gene encodes a type 2A-related Ser/Thr protein phosphatase that is required in late G1 for normal G1 cyclin expression and for bud formation.
• overexpression of HAL3/SIS2 stimulates the rate of cyclin accumulation in sit4 mutants.
• Vb89 or HAL3 gene isolated according to the invention may be used to confer salt tolerance on plants and/or improved growth under such conditions.
• the gene is expressed in plants using various types of promoters, such as a constitutive promoter, a tissue-specific promoter, preferably a root- specific promoter or an inducible promoter, preferably a salt-inducible promoter.
• VbDAHP 3- deoxy-D-arao/t70-heptulosonate 7-phosphate
• the VbDAHP clone interacts with CDC2bAt, but not with CDC2aAt in the two-hybrid system.
• the publicly available databases were screened with the cDNA VBDAHP (SEQ ID NO: 9). An overall perfect homology was found with DAHP (AROG_ARATH 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase [Arabidopsis thaliana]), already known in the databases.
• DAHP 3-deoxy-D-arao/t70- heptulosonate 7-phosphate
• Both genes, DHS1 and DHS2 may have distinct physiological roles, as there are differentially expressed in plants subjected either to physical wounding or to infiltration by virulent and aviruient strains of Pseudomonas syringae.
• Other enzymes in the Arabidopsis aromatic pathway are also encoded by duplicated genes, an arrangement that may allow independent regulation of aromatic amino acid biosynthesis by distinct physiological requirements such as protein synthesis and secondary metabolism.
• VbHSF clone is very similar to the Arabidopsis thaliana Heat-Shock Transcription Factor HSF3.
• the VbHSF clone interacts with CDC2bAt, but not with CDC2aAt with the two-hybrid system.
• Organisms synthesize heat shock proteins (HSPs) in response to sublethal heat stress and concomitantly acquire increased tolerance against a subsequent, otherwise lethal, heat shock.
• Heat shock factor (HSF) is essential for the transcription of many HSP genes.
• HSF3 and HSF4 were isolated from an Arabidopsis cDNA library (Prandl et al., Mol Gen Genet (1998) May; 258(3):269-78).
• Transgenic Arabidopsis plants were generated containing constructs that allow expression of HSF3 and HSF4 or the respective translational beta-glucuronidase (GUS) fusions.
• GUS translational beta-glucuronidase
• transgenic plants bearing HSF3/HSF3-GUS transcription of several heat shock genes is derepressed.
• HSF3/HSF3-GUS functioning as transcription factor.
• HSF3/HSF3-GUS-overexpressing Arabidopsis plants show an increase in basal thermotolerance, indicating the importance of HSFs and HSF-reguiated genes as determinants of thermoprotective processes. Plants transgenic for HSF3/HSF3-GUS exhibit no other obvious phenotypic alterations.
• HSF activity upon overexpression suggests the titration of a negative regulator of HSF3 or an intrinsic constitutive activity of HSF3.
• Stable overexpression of HSFs may be applied to other organisms as a means of derepressing the heat shock response.
• Heat shock factors can serve as auxiliary proteins in formation of CDK/cyclin complexes.
• HSP70-2 assists in CDC2/cylinB1 complex formation through interaction with CDC2 and that this interaction establishes and/or maintains the CDC2 protein in a conformation that is competent for cyclin B1 binding (Zhu et al., 1997 Development 124: 3007-3014).
• VbHSF protein was overproduced in E.coii, purified to homogeneity, and coupled to Sepharose beads.
• the VbHSF-Sepharose beads were used during binding and kinase assays:
• VbHSF expression and purification a fusion protein with a His-Tag sequence was generated.
• the VbHSF-coding region was PCR amplified using the primers 5'-CCATATGGAATTCGCACGAGGC-3' (SEQ ID NO: 21) and
• E.coii BL21 cells Novagen
• the lysate-Ni-NTA mixture was loaded on a column and the column was washed with 5 volumes of wash buffer containing 50 mM NaH 2 P0 (pH 8.0), 300 mM NaCl and 20 mM imidazole.
• the fusion protein was eluted with 3 volumes elution buffer (50 mM NaH 2 P0 4 (pH 8.0), 300 mM NaCl and 250 mM imidazole).
• the purified VbHSF protein was coupled to CNBr-activated Sepharose 4B (Pharmacia, Uppsala, Sweden) at a concentration of 5 mg/ml of gel according to the manufacturer's instruction.
• Protein extracts were prepared from 2-day-old ceil suspensions of A. thaliana Col-0 in homogenization buffer (HB) containing 50 mM Tris-HCL (pH 7.2), 60mM ⁇ - glycerophosphate, 15mM nitrophenyl phosphate, 15mM EGTA, 15mM MgCI 2 , 2mM dithiothreitol, 0.1 mM vanadate, 50 mM NaF, 20 ⁇ g/ml leupeptin, 20 ⁇ g/ml aprotenin, 20 ⁇ g/ml soybean trypsin inhbitor (SBTI), 100 ⁇ M benzamidine, 1mM phenylmethylsulfonylfluoride, and 0.1 % Triton X-100.
• HB homogenization buffer
• SBTI soybean trypsin inhbitor
• the kinase assays were performed with Cdk complexes purified from total plant protein extracts by p13 suc1 -sepharose affinity binding, according to Azzi et al. (1992).
• VbHSF-Sepharose and control beads were used during a Histon H1 kinase assay as described by Hemerly et al. (1995). After 20 min incubation at 30°C, samples were analysed by SDS-PAGE and autoradiographed. We could not detect any difference in [ 32 P] phosphate incorporation in histon H1 comparing the control and the VbHSF samples.
• VbHSF (or HSF3) is phosphorylated by CDK. This suggests a regulatory role of phosphorylation of VbHSF by CDK/cyclin complexes namely that HSF3 activity is affected by phosphorylation, and hence its ability to confer thermotolerance on a plant may be manipulated.
• the invention provides a method for conferring thermotolerance on a plant by modifying the activity of HSF3, preferably via its phosphorylation state. Therefore, a nucleic acid of HSF3 is introduced into a plant cell, plant tissue or plant that encodes a HSF3 with a modified phosphorylation state.
• a state of enhanced phosphorylation can be mimicked by replacing the phosphorylated amino acids by a glutamic acid or aspartic acid.
• a method to prevent phosphorylation and to mimick a non phosphorylation state comprises replacing the phosphorylated amino acids by an amino acid that cannot be phosphorylated (other than glutamic acid or aspartic acid), namely an amino acid that is not tyrosine, serine or threonine.
• the invention would also relate to transgenic plants, tissues and cells obtainable by the methods above and comprising a HSF3 with modified activity. As mentioned previously such transgenic plants may display improved tolerance to stress, in particular heat stress.
• Example 7 LDV24 (SEQ ID NO: 3) - PHO80-like protein (PLP)
• the LDV24 gene renamed the PLP5 gene encodes a protein interacting with CDC2a and being highly similar to the PREG1 and PHO80 proteins of Neurospora crassa and Saccharomyces cerevisiae, respectively.
• the publicly available databases were screened with the cDNA LDV24. With the BLASTX as best homologue the PREG(AF051226) protein from Picea mariana (score: 1.5e-35) and PREG(AC003672) protein from Arabidopsis (score: 3Je-35) were found. But there is homology with (P20052
• PHO80 itself shows similarity to the Saccharomyces cerevisiae G1 -specific cyclins HCS26 and OrfD (Kaffman, Science 263 (1994) 1153-1155).
• the catalytic CDK subunit binding to PHO80 is PH085, a CDK with roles in both the cell cycle and metabolic controls (Lenburg and O'Shea 1996, TIBS 21 , p383-387).
• PHO80 in complex with PH085 regulates phosphatase gene expression. When inorganic phosphate in the medium is abundant the PHO80-PHO85 complex phosphorylates the PH04 transcription factor.
• Phosphorylated PH04 remains mainly cytoplasmic, resulting in the repression of expression of the PH05 phosphatase gene (O'Neill et al. 1996, Science 271 , p209-212).
• the PHO80-PHO85 complex is inhibited by the CDK inhibitor PH081 , and transcription of PH05 is activated.
• the levels of PH05 expression are sensitive to the levels of PHO80.
• Overexpression of PHO80 results in a partial defect of PH05 activation when phosphate is limiting (Yoshida et al. 1989, MGG 217, p40-46; Madden et al. 1988, Nucleic Acids Res.
• deletion of PHO80 results in the presence of high levels of inorganic phosphate (Madden et al. 1988, Nucleic Acids Res. 16, p2625-2637). Similar effects can be expected for plants when the LDV24 gene is deleted or overexpressed. This might result in an adapted growth in conditions where organic phosphate is present at limiting or exceeding levels. More phosphate accumulation might positively affect the rate of plant growth and biomass production.
• Table 2 List of the forward and reverse primers used for isolatin the PLP1 -4 enes.
• Table 3a cDNA and deduced amino-acid sequence of the A. thaliana PLP genes.
• Table 4 Amino acid sequence identity and similarity (bold) between the different A. thaliana PLPs.
• the single-stranded cDNA products were subjected to PCR using 0.2 mM concentrations of 5' and 3' specific primers (see Table 2).
• Protein-protein interactions between the different PLPs and CDKs were studied using a two-hybrid system based upon GAL4 recognition sites to regulate the expression of the his3 reporter gene.
• Vectors and strains used were provide with the Matchmaker Two- Hybrid (Clontech, Palo Alto, CA).
• the baits used for the two-hybrid analysis were constructed by inserting the PLPs coding region into the pGBT9 (as an fusion protein with the DNA binding domain of the GAL4 transcription factor) and pGAD424 (as an fusion protein with the transcriptional activation domain of the GAL4 transcription factor) vectors.
• the inserts were created by PCR using the PLPs cDNA as template and primers to incorporate EcoRI and BamH ⁇ restriction enzyme sites (see Table 2), resulting into the plasmids pGTBPLPI to pGBTPLP5 and pGADPLPI to pGADPLP ⁇ .
• Vectors were tested for self activation, and ⁇ GBTPLP2, pGBTPLP3 and pGBTPLP ⁇ were found positive, excluding their use for studying protein-protein interactions. All other constructions were tested for their interaction with the CDC2aAt and CDC2bAt proteins, cloned in pGTB9 and pGAD424. (De Veylder et al. (1997) FEBS Lett 412, 446-52).
• the sensitivity of the PCR reaction is able to detect the insertion of a T-DNA in the target gene.
• the seeds of the generated T-DNA lines are grouped in primary pools of 48 families. Approximately 100 seeds from each family are mixed and ground in vitro on a large Petri plate. The seedlings plants (10-15 days, stage 2 rossetes leaves) are used for DNA extraction as described Doyle and Doyle, Focus 12:13-15. Aliquots of 20 ul of the resuspended DNA (100-300 ng/ul) from each of the 16 primary pools are used to prepare 2 ml of one hyper-pools . Each hyper-pool represents 768 independent T-DNA lines. Aliquots of 5 ul (15-30 ng/ul) of each hyper-pools (46 hyper- pools, at present) are charged in a 96-well microplate, where the PCR amplification reaction will be performed.
• T-DNA lines http://nasc.nott.ac.uk : 8300 ⁇ ol2ii/pelietier.html
• PGKB5 sequence http://nasc.nott.ac.uk :8300 ⁇ ol2ii/bouchez.html
• the oligonucleotides primers for the Arabidopsis eye PHO were designed from the cDNA sequence obtained from the identified clone interacting with the Arabidopsis cdc2a kinase in a two hybrid screen. A toward and reverse primers were tested for specificity, and yield a good PCR amplification using the wild-type genomic DNA of Arabidopisis plants, ecotype WS, as template. The designed primers did not show unespecific amplification in combination with the T-DNA primers Tag3 nor Tag5.
• Foward primer F2 5'-ATTGCACACTACTTGGATCGCATT-3' (SEQ ID NO: 48)
• Reverse primer R1 5'-GATAGAATGGGAACGGCTAG-3' (SEQ ID NO: 49)
• Each gene primer was used in combination with a T-DNA primer, in the PCR screen.
• ADN 5 ul (10-30 ng /ul)
• T-DNA primer 2.5 ul (10 uM)
• Taq Polymerase 1.0 ul (1 U /ul)
• the PCR conditions were: 2' -94 C
• the gene probe was prepared from the digested plasmid containing the cDNA encoding for the cyclin PHO 80 identifed in the two hybrid screen.
• the T-DNA probes correspond to a mix of left border (fragment of 1 kb after Kpnl digestion of plasmid pBS-LB) and right border (fragment of 0,8 kb after Sstl-EcoRV digestion of the pBS-RB)
• the digested gel purifed fragments were labelled using the ALKPHOS (Amersham, RPN 3680) non-radiactive labelling kit. The hybridization and washing were done according with the instructions of the manufacturer.
• the gene sequence is homologous to the Arabidopsis EST N37922, however there is not a genomic sequence homolog in the data base. At the protein level, it is homologous (score of 5e-30) to the PREG-like protein of Arabidopsis (AC003672), to the yeast cyclin PCL 7 partner of the cdc PHO 85 (score 1e-9), and to the yeast cyclin PHO80 (score 1e-
• the length of the Arabidopsis PREG-like protein (AC003672) homologous to the cyclin PHO 80, is 202 aminoacids. If the PLP5 belong to the family of the PREG-like proteins, the T-DNA insertion should be located approximaly at aminoacid position 157.
• Forward primer F1 5'-cgatccagctttcattgattcg-3' (SEQ ID NO: 53)
• Reverse primer R1 5'-GATAGAATGGGAACGGCTAG-3' (SEQ ID NO: 54)
• the PCR fragment obtained was sequenced by dye terminator using the forward primer
• the alignment of the cDNA with the partial genomic sequence revealed the presence of one intron indicated in bold.
• the underlined sequece represent the insertion site of the T-DNA in the mutant line.
• the 48 lines from the positive pool were grown in growth chamber for two weeks. Plants were harvested and frozen in liquid nitrogen. Plants (1g) were grinded with a pestle and a mortar and homogeneized in 6ml buffer containing 78mM Tris HCI pH8, 40mM EDTA, 390 mM NaCl, 1 % SDS, 15mM sodium bisulfite at 65°C for 30 min. 2ml potassium acetate 5M were added and the mixture was incubated on ice for 20 min. Supernatants were recovered after centrifugation (20 min, 4500 rpm, 4°C) and 4ml isopropanol (- 20°C) was added and incubated for at least 30 min at 4°C.
• the final pellet was recoved after centrifugation (5min, 13700 rpm, 4°C) and washed with 70% ethanol. The final pellet was taken in 20 microliters of Tris-EDTA (100mM-10mM) buffer pH8.0 and used for PCR (1/100 dilution).
• the positive line identified from the INRA collection was grown in growth chamber under four types of conditions:
• Plants were then examined for obvious phenotypes and kanamycin segregation which gives an indication on the number of T-DNA insertions, the linkage of insertions and the sex effect.
• Homozygous plants were detected by PCR first using the following combination of primers (F2-Tag5 and F2-R1).
• R1 5' CTATCTTACCCTTGCCGATCAGC 3' (SEQ ID NO: 57)
• plants were grown directly in the green house on soil, watered, under 12 h photoperiod and normal light intensity. Such plants were also used to make crosses with wild type plants in order to clean the genotype from unwanted short T-DNA insertions in other genes not detected by kanamycin resistance gene.
• Gus activity is expressed when a T-DNA is inserted into a gene in the proper direction; This allows to detect where mutated gene is expressed.
• Preliminary data (Nusseaume, CEA Cadarache) indicated that GUS activity could be detected in the positive line containing PLP5 mutant.
• Tissues (whole plantlets: two weeks old) were fixed in 80%acetone for 1 h at -20°C. Tissues were then incubated with 1 mg/ml 5-bromo,4-chloro, 3indolyl, beta Dglucuronide in OJ M potassium phosphate buffer pH7 containing 0.1% triton X100, 10mM EDTA, 2mM potassium ferrocyanide, 2mM potassium ferricyanide. Tissues were vacuum infiltrated for 10 min and incubated for at least 1 hour at 37°C. 70% ethanol was used to destain the tissues prior to microscopic analysis.
• Vitamins 500x
• Mutant 11 a mutant containing an insertion in the PLP5 gene was identified and called Mutant 11 (mutl 1).
• final germination capacity is similar for WS and 11 K11 but mean time germination is longer (about 18h) for homozygous mut11 at 10mM.
• a similar phenomenon is observed at 25mM hygromycin but final germination is similar. As a consequence cotyledon emergence is delayed.
• mutl 1 is more sensitive to hygromycin, suggesting a role of pho80 and/or other components of the signalling cascade in sensitivity to hygromycin.
• Transgenics overexpressing mut11 could be more resistant to hygromycin.
• Overexpression of the PLP5 would mean that could be used as a positive selectable marker during transformation procedures while antisense/cosuppression could be used as a negative selective marker.
• Example 8 Extension of cell cycle interacting protein encoding polynucleotides to full length or to recover regulatory elements
• the cell cycle interacting protein encoding nucleic acid sequences (SEQ ID NOS: 1 , 3, 33, 35, 37, 39, 41 , 5, 7, 9, 11 and 13) are used to design oligonucleotide primers for extending a partial nucleotide sequence to full length or for obtaining 5' sequences from genomic libraries.
• One primer is synthesized to initiate extension in the antisense direction (XLR) and the other is synthesized to extend sequence in the sense direction (XLF).
• Primers allow the extension of the known cell cycle interacting protein encoding sequence "outward" generating amplicons containing new, unknown nucleotide sequence for the region of interest.
• the initial primers are designed from the cDNA using OLIGO® 4.06 Primer Analysis Software (National Biosciences), or another appropriate program, to be preferably 22-30 nucleotides in length, to have a GC content of preferably 50% or more, and to anneal to the target sequence at temperatures preferably about 68°-72°C. Any stretch of nucleotides which would result in hairpin structures and primer-primer dimerizations is avoided.
• the original, selected cDNA libraries prepared from mRNA isolated from actively dividing cells or a plant genomic library are used to extend the sequence; the latter is most useful to obtain 5' upstream regions. If more extension is necessary or desired, additional sets of primers are designed to further extend the known region.
• Step 1 94°C for 1 min (initial denaturation)
• Step 4 94° for 15 sec
• Step 5 65°C for 1 min
• Step 7 Repeat steps 4-6 for 15 additional cycles
• Step 8 94°C for 15 sec
• Step 11 Repeat step 8-10 for 12 cycles
• a 5-10 ⁇ l aliquot of the reaction mixture is analyzed by electrophoresis on a low concentration (about 0.6-0.8%) agarose mini-gel to determine which reactions were successful in extending the sequence. Bands thought to contain the largest products were selected and cut out of the gel. Further purification involves using a commercial gel extraction method such as QIAQuickTM (QIAGEN Inc). After recovery of the DNA, Klenow enzyme was used to trim single-stranded, nucleotide overhangs creating blunt ends which facilitate religation and cloning.
• the products are redissolved in 13 ⁇ of ligation buffer, 1 ⁇ l T4-DNA ligase (15 units) and 1 ⁇ l T4 polynucleotide kinase are added, and the mixture is incubated at room temperature for 2-3 hours or overnight at 16°C.
• Competent E. coli cells (in 40 ⁇ l of appropriate media) are transformed with 3 ⁇ l of ligation mixture and cultured in 80 ⁇ l of SOC medium (Sambrook, supra). After incubation for one hour at 37°C, the whole transformation mixture is plated on Luria Bertani (LB)-agar (Sambrook, supra) containing 2xCarb.
• Step 2 94°C for 20 sec
• Step 5 Repeat steps 2-4 for an additional 29 cycles
• VbDBP VbDBP interacts with CDC2b but not with CDC2a.
• the publicly available databases were screened with the cDNA VBDPBP (N- term). With the help of BLASTX gene21 from AC003680 (score 1.0e-27) was found as best homologue. This is a genomic sequence from A.thaliana (entered in the databank:20-MAR-1998), chromosome II.
• the prediction made here gives 1 big exon, but the new predictions made in accordance with the present invention gave two exons (the big one, followed by a small one).
• the cDNA VBDPBP shows not so high homology (gene 21 might only be from the same family as VBDPBP) with the big exon, so completion of the cDNA will confirm one or the other annotation and might give a new sequence.
• Other homologues are D87261) PCF2 [Oryza sativa] (score 9.2e-27) and D87260) PCF1 [Oryza sativa] (score 8.5e-24) both with publication: Kosugi, S. and Ohashi.Y.
• PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene.
• Plant Cell 9 (9), 1607-1619 (1997).
• BLASTN/nr an other genomic sequence from chromosome V, AB010072 (2e-12) (08-JAN-1998) sequenced by the KAOS-people (P1 clone: MEE6) was found.
• the region with homology is located between (18754..18848) has no annotations at all.
• the publicly available databases was screened with the cDNA VBDPBP (C-term (SEQ ID NO: 15)) but nothing was found with BLASTX.
• PCF1 and PCF2 are proteins isolated in rice that specifically bind to sites I la and Mb in the promotor region of the rice PCNA gene (Kosugi et al., 1997).
• the rice proliferating cell nuclear antigen (PCNA) protein is an auxiliary protein of DNA polymerase (that participates in a variety of processes, such as DNA replication, DNA repair synthesis, and cell cycle control through reactions with the CDK-cyclin-CKI complex.
• the PCNA gene is induced at the G1 -to-S phase boundary and is well conserved in eukaryotes.
• the expression of the rice PCNA gene is restricted exclusively to meristematic regions and is controlled at the transcriptional phase.
• PCNA protein is also present in proliferating cells but absent from nondividing cells and terminally differentiated plant tissues.
• PCF2 with a high level of DNA binding activity in meristematic tissues, may act as transcriptional activator for these genes.
• These proteins have a deduced basic helix-loop-helix (bHLH) motif that is responsible for DNA binding and dimerization.
• bHLH basic helix-loop-helix
• PCF1 and PCF2 are novel types of bHLH proteins that are distinct from other known bHLH transcriptional factors.
• PCF1 and PCF2 specifically bind to cis elements in the Rice proliferating cell nuclear antigen gene.
• the Plant Cell 9, 1607-1619.
• Example 10 Vb33 (SEQ ID NO: 5)
• the Vb33 clone encodes a protein interacting with CDC2b but not with CDC2a.
• the publicly available databases were screened with the cDNA VB33. With the BLASTX as best homologue a predicted gene on the Z49937 sequence having a similarity with an ankyrin motif (score 0.62) was found. This sequence comes from C.elegans cosmid and the gene F14F3.2 was predicted based on a C.elegans EST (yk192g4.5).
• Example 11 LDV115 (SEQ ID NO: 1)
• the LDV115 gene encodes a protein interacting with CDC2a but not with CDC2b and showing limited similarity to the Saccharomyces cerevisiae WEB1 protein.
• the publicly available databases were screended with the cDNA LDV1 5. With the BLASTX it was found as best homologue the WEB1 protein from S. pombe (AB004537)(score 6.7e-17). This protein as well as the other hits were mainly due to proline-richness of the LDV115 translation. The homology is low but spread over about 50% of the S. pombe protein, which might indicate that LDV115 is at least a member of the family.
• the VVEB1 gene was isolated as a yeast homologue of the adenoviral E1A gene (Zieler et al., 1995, MCB 15, p3227-3237).
• the protein products of the E1A gene are implicated in a variety of transcriptional and cell cycle events, involving interactions with several proteins present in the human cells, including parts of the transcriptional machinery and negative regulators of cell division such as the Rb gene product and p107.
• WEB1 is identical to SEC31 , a protein involved in budding of transport vesicles from the endoplasmic reticulum (Pryer et al. (1993), J. Cell. Biol. 120, p865-875).

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Cell Biology (AREA)
• Botany (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Peptides Or Proteins (AREA)
• Investigating Or Analysing Biological Materials (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Publications (2)

Family

ID=8233168

Family Applications (1)

Country Status (6)

Cited By (5)

Citations (2)

• 1999
  • 1999-12-17 CA CA002355901A patent/CA2355901A1/en not_active Abandoned
  • 1999-12-17 MX MXPA01006104A patent/MXPA01006104A/es not_active IP Right Cessation
  • 1999-12-17 WO PCT/EP1999/010084 patent/WO2000036124A2/en not_active Application Discontinuation
  • 1999-12-17 BR BR9916831-6A patent/BR9916831A/pt not_active IP Right Cessation
  • 1999-12-17 EP EP99963579A patent/EP1141353A2/en not_active Withdrawn
  • 1999-12-17 AU AU19823/00A patent/AU776605B2/en not_active Ceased

Patent Citations (2)

Non-Patent Citations (9)

Also Published As

Similar Documents

Legal Events