WO2000032781A1

WO2000032781A1 - A sulfur metabolizing gene from the roots of onion

Info

Publication number: WO2000032781A1
Application number: PCT/NZ1999/000197
Authority: WO
Inventors: Meeghan Deborah Pither-Joyce; Martin Lawrence Shaw; Colin Charles Eady; John Mccallum; Jane Elizabeth Lancaster
Original assignee: New Zealand Institute For Crop & Food Research Limited
Priority date: 1998-11-30
Filing date: 1999-11-26
Publication date: 2000-06-08
Also published as: AU1418500A

Abstract

The invention provides a novel alliinase gene isolated from the roots of onion plants. Also provided is the enzyme encoded by the gene. A binary vector including the gene is described together with its use to transform Allium species, particularly onions. The invention also provides a method of manipulating alliinase levels in plants.

Description

A SULFUR METABOLIZING GENE FROM THE ROOTS OF ONION

Field of invention

The invention relates to a novel sulfur metabolizing gene from the roots of onion. The invention provides the nucleotide sequence and amino acid sequence of the novel gene and the use of the gene to manipulate alliinase levels in plants.

Background of the invention

Members of the Alliaceae family (such as onions, garlic, chives etc) produce volatile sulfur compounds when the tissue is crushed. These compounds give Alliium species their characteristic flavour and pungency.

The sulfur compounds are formed by the action of an enzyme, alliinase, on organic sulfur compounds. As onion and garlic roots grow through the soil they are continually sloughing off old cells and forming new cells, particularly at the root tips. As the cells are sloughed off these volatile sulfur compounds are released into the soil.

The sulfur compounds in the soil are specific attractants to white rot fungus. They stimulate the white rot spores to germinate and invade the roots, killing the plant. White rot fungus cannot be eradicated from the cropping of onion and garlic. It is currently controlled by the application of soil fungicides.

White rot is an international problem of soil production in temperate climates.

A recombinant protein in substantially pure form having the activity of garlic alliinase has already been disclosed (WO 94/08614). The garlic alliinase was structurally different from onion alliinase as determined by the difference in their molecular weight, subunit structure (the onion alliinase is a tetramer and the garlic alliinase is a dimer), Km values, isoelectric pH, amount of glycosylation and spectra and by the fact that there was no cross reactivity of antibodies raised against the garlic alliinase with the onion alliinase. Further studies of alliinase from garlic (Alliin Lyase (Alliinase) from Garlic (Allium sativum) Biochemical characterisation and cDNA cloning - Aharon Rabinkov, Xiao-Zhu Zhu, Gideon Grafi, Gad Galili and David Mirelman, Applied Biochemistry and Biotechnology Vol.

48 (1994) 149-171 ) have shown that clones of cDNAs encoding garlic alliinase exhibit some degree of DNA sequence divergence, especially in their 3' noncoding regions, suggesting that they were encoded by separate genes. Northern and

Western blot analysis has shown that alliinase expression varies between the bulb, leaves and roots of garlic. It has also been suggested that garlic root tissue expresses a distinct alliinase isozyme with very low homology to the bulb enzyme (Alliin Lyase (Alliinase) from Garlic (Allium sativum) Biochemical characterisation and cDNA cloning - Aharon Rabinkov, Xiao-Zhu Zhu, Gideon Grafi, Gad Galili and David Mirelman, Applied Biochemistry and Biotechnology Vol. 48 (1994) 149- 171 ).

Object of the invention

It is an object of the invention to provide a novel alliinase gene from onion or to at least provide the public with a useful choice.

Summary of the invention

The invention provides a substantially pure alliinase gene isolated from the root of an onion plant.

Preferably the alliinase gene is selected from the group comprising:

(a) the nucleic acid sequence shown in Figure 1 (SEQ ID NO:1 );

(b) a fragment of the DNA sequence depicted in Figure 1 ; (c) a DNA sequence derived from (a) or (b) in which one or more amino acid encoding triplets has been added, deleted or replaced without substantially affecting the alliinase activity of the protein encoded thereby; (d) a DNA sequence which is a degenerate equivalent of the sequence of (a) or (b); or

(e) a DNA sequence hybridizable to a sequence (a), (b), (c) or (d).

The invention also provides an alliinase enzyme comprising the amino acid sequence corresponding to the gene.

The invention also provides a substantially pure onion root protein with alliinase activity.

The invention also provides the use of the onion root alliinase gene in the manipulation of alliinase produced by a plant. Preferably the root alliinase gene is used in an anti-sense orientation to manipulate the level of alliinase produced by the plant. The production of alliinase may be depressed or upregulated.

The invention also provides a vector or plasmid comprising the alliinase gene isolated from the root of an onion plant. The vector is preferably a binary vector. The gene is preferably introduced in an anti-sense orientation.

The invention also provides the use of the vector in the transformation of a suitable host plant to produce a transgenic plant with an altered level of alliinase.

The invention also provides Agrobacterium tumefaciens when transformed by a binary vector including the alliinase gene isolated from the root of an onion.

The invention provides a transgenic plant transformed with the Agrobacterium tumefaciens comprising a binary vector including the alliinase gene isolated from the root of an onion.

The invention particularly provides an Allium species when transformed with Agrobacterium tumefaciens comprising a binary vector including the alliinase gene isolated from the root of an onion. In particular, the invention provides transformed onion plants with modified alliinase levels.

Nucleic acid sequences which hybridize under stringent conditions to the substantially pure nucleic acid sequences are also included to cover homologues and alleles of the gene that encode the enzyme.

Degenerate versions of the gene are also included. Functional variants and analogues and functional fragments of the protein are also included.

The invention also includes vectors and transformants containing the isolated onion root alliinase gene.

Brief description of the drawings

The invention will be described, by way of example only and with reference to the accompanying Drawings in which:

Figure 1 shows the root alliinase nucleotide sequence and corresponding amino acid sequence.

Figure 2 shows a Southern blot transgenic antisense root alliinase plants probed with the gfp gene fragment to indicate the presence of the pBINmgfpERantiroot T- DNA sequence. Lane 1 lambda hindlll marker; Iane2 one copy equivalent control pBINmgfpERantiroot, Iane3 five copy control pBINmgfpERantiroot; lane 4 non transformed onion, lane 5 positive control onion transformed with pBINmgfpER; lane 6-10 transgenic plants transformed with pBINmgfpERantiroot (6&7 and 9&10 are separate clones); Iane1 1-1 2 one copy and 5 copy equivalent control of pBINmgfpERantiroot (with the gfp fragment liberated). Figure 3 shows a Western blot analysis of alliinase enzyme activity from onion root protein extracts. Lane 1 purified alliinase control. Lane 2-5 transgenic onion plants containing the pBINmgfpERantiroot T-DNA. Lane 6 control non-transgenic onion: Table 1 : Plant Alliinase activity (U/mg protein) Non transgenic CLK control(9910)

14.0 transformant 992.1 1 F1 3.4 transformant 994.7G1 1 1 .9 transformant 992.1 1 F2 9.6 transformant 992.9A1 6.3

Detailed description of the invention

1 Plant material

Onion plants (cultivar Pukekohe Longkeeper) were grown in aerated nutrient solution in a glasshouse. Roots were collected and assayed for the alliinase-like activity, to demonstrate the presence of the protein.

Enzyme assay

Alliinase-like activity was measured by a coupled NADH/LDH assay in 0.2M Tricine-KOH pH 8.0, 0.1 mM NADH, 12.5 units per ml lactate dehydrogenase (LDH), 1 μg ml^"1 (v/v) alliinase preparation, 0.01 M S-ethylcysteine sulphoxide at room temperature. The protein concentration was determined using the Spector refinement of the Bradford dye-binding assay (Spector 1978).

Example 1

Molecular cloning and characterisation of a root alliinase gene

Total RNA was isolated from onion root material using TRIZOL Total RNA Isolation Reagent (Gibco-BRL).

The mRNA fraction was isolated from total RNA using the Messagemaker mRNA Isolation Kit (Gibco-BRL). A cDNA library was constructed from the mRNA using the ZAP-cDNA

Synthesis Kit (Stratagene).

Sequence from a 438 bp onion leaf cDNA (AOB249) with ^" 60% homology to bulb alliinase, was obtained through the GenBank database (accession #AA451570).

Primers were designed from the database sequence and synthesized by Gibco-BRL. These were: AOB249-1 (5'GGCTGGTAGCGGCAGTCTACT 3') situated at the 5' end, and AOB249-R (5' TGTCGTAGTTGTACCCAGACG 3') situated at the 3' end.

The primers were used to amplify a 300 bp fragment from root RNA by two step RT-PCR using Ready-To-Go T-Primed First Strand Beads (Amersham Pharmacia Biotech), then PCR with Taq DNA polymerase (Boehringer Mannheim).

The 300 bp fragment was radioactively labelled by random priming using the Megaprime DNA Labelling Kit (Amersham Pharmacia Biotech) and used to screen the cDNA library by colony hybridisation.

Colonies that gave a positive signal from hybridisation were checked for insert size by colony PCR using M13 forward and reverse primers.

Plasmid DNA was isolated from colonies that had an insert size > 1600 bp using High Pure Plasmid Isolation Kit (Boehringer Mannheim).

Sequencing reactions were performed using the ABI PRISM Big Dye terminator cycle sequencing kit (Perkin Elmer) and analysed on an AB1377 automated sequencer. Sequencing primers were used: SK (Stratagene), M13 reverse, AOB249-1 , Allirootl (5'

TACGAATGGAAGGGAAATGC 3'), and Alliroot2 (5' GCTGATGCCACTACTGGTGA 3'). Example 2

Purification of root protein with alliinase activity

Alliinase was purified from onion roots of the cultivar "Pukekohe Longkeeper". All purification and column steps were at 4°C. Root tissue was homogenized in an equivalent volume (v/v) of Buffer A (50 mM Tris-HCI pH 7.5, 0.5 M NaCl, 30% (v/v) ethylene glycol, 2.5 μg/mL pyridoxal-5-phosphate, 0.05% β-mercaptoethanol, 1 mM phenylmethylsuflonylfluoride (PMSF) and 5 mM 6-amino-n-hexanoic acid). The homogenate was squeezed through two layers of cheese cloth and cell debris removed by centrifugation. The protein precipitating between 1 .33 M and 3.25 M (NH )₂S0 was collected and dissolved in Buffer B (Buffer A lacking PMSF and 6- amino-/7-hexanoic acid), and undissolved material removed by centrifugation. Active 5 mL fractions of the cleared supernatant were eluted from a column of Sephacryl S-200 HR (12 X 5 cm) (Amrad Pharmacia Biotech Ltd) with Buffer B, pooled, and adjusted to 1 mM with respect to MnC and CaCI₂. Samples were then applied to a ConA-Sepharose 4B column (9 X 1 .5 cm) equilibrated in the same buffer. Active fractions were eluted with 5 mM methyl 3-D-glucopyranoside and 200 mM methyl 3-D-mannopyranoside in Buffer B. The fractions were pooled, concentrated and dialysed against 20 mM NaP0 , 30% (v/v) ethylene glycol, 2.5 μg/mL pyridoxal-5-phosphate pH 6.5 (Buffer C). The concentrated sample was applied to a CM-Sepharose CL6-B (4.5 X 1 .5 cm) (Amrad Pharmacia Biotech Ltd) column equilibrated with Buffer C. The column was washed with Buffer C at pH 7.2. Active fractions were eluted in 0-0.2 M NaCl gradient over 5 column volumes in pH 7.2 buffer. Sample purity was established by SDS-polyacrylamide gel electrophoresis, (SDS-PAGE) (Laemmli 1970) followed by visualization with silver staining (Giulian et al. 1983). Subunit sizes were determined using a 10 kDa molecular mass ladder (Gibco-BRL).

Example 3

Determination of amino acid seguences for protein Alliinase, separated by SDS-PAGE, was blotted onto PVDF membrane and visualized by Coomassie staining. The bands were excised and N-terminal sequences were determined using an Applied Biosystems Model 470A on-line gas phase sequencer using standard Applied Biosystems protocols.

Cyanogen bromide peptides for amino acid sequencing were produced by dissolving 70-80 μg of intact alliinase in 50 μλ of 70% formic acid containing 3 mg of cyanogen bromide and incubating overnight at 4°C in the dark. The mixture was diluted 10-fold with water and vacuum-dried under centrifugation. The peptides were separated on 16.5% Tris-Tricine polyacrylamide gels (Bio-Rad), blotted onto PVDF membrane and sequenced.

An onion root alliinase gene has been isolated which encodes an enzyme which produces volatile sulfur compounds. The gene could be used to depress levels of alliinase in onion and garlic roots, as a disease strategy against white rot fungus in roots.

We inserted the root alliinase gene into onion in an anti-sense orientation. This significantly depresses the level of alliinase and thus the amount of volatile sulfides produced in the root. Roots which do not produce volatile sulfides will not stimulate white rot fungal growth. The root alliinase may also be useful in producing volatile sulfur compounds which have a use as flavouring compounds. They may also have therapeutic benefits.

Example 4

Construction of a binary vector containing an anti-sense root alliinase gene for use in onion transformation.

The root alliinase gene was cut from the multiple cloning site of pBluescript SK- (Stratagene) with the restriction enzymes BamHI and Kpnl. It was then ligated into the multiple cloning site of pART7 (Gleave, A. Plant Molecular Biology 20:1203-1207, 1992) at the Kpnl and BamHI sites. This inserted the root alliinase gene in the anti-sense orientation next to the CaMV 35S promoter. The expression cassette containing the CaMV 35S promoter, anti-sense root alliinase gene and OCS 3', was then removed from pART7 at the Notl sites. The

Notl sites were end filled with Klenow to make blunt ends and then ligated into the binary vector pBIN m-gfp5-ER (Haseloff et al. Proc. Natl. Acad. Sci. USA.

94:2122-21 27, 1997). The pBINm-gfp5-ER vector was prepared for ligation by cutting with Hindlll and end filling the sites to make blunt ends.

Example B

Transformation of Agrobacterium tumefaciens

On ice, 40μl of electro-competent Agrobacterium ( ~ 2x10¹⁰ cells / ml) were mixed with 1 -2μl ( ~ 50ng) of binary vector and left for 1 min. This mixture was transferred to a 0.2cm electroporation cuvette and electroporated at 2.5kV. Immediately after pulsing 1 ml of ice cold SOC medium was added and the mixture transferred to a 25ml vial. This was shaken gently for 1 hr at 28°C. Dilutions of this culture were then plated onto selective medium to select for the presence of the vector. Colonies found to grow on such medium were analysed using standard molecular techniques to show they contained the vector. Cultures of derived from these colonies were grown and stored in 1 ml aliquots of LB plus 30% glycerol at - 70°C

Example 6

Transformation of Allium so. with Agrobacterium tumefaciens

1 ml aliquots of Agrobacterium tumefaciens containing a binary vector with the genes of choice contained within the T-DNA were grown to log phase in 50ml LB media containing 50 mg/l of the appropriate selective agent. The following morning cultures were replenished with an equal volume of LB containing antibiotic and 100μM acetosyringone and grown for a further 4 hours. Agrobacteria were isolated by 10 minute centrifugation at 4500 rpm and resuspended in an equal volume of P5 (Eady et al. 1998a) containing 200 μM acetosyringone. Isolated immature embryos 0.5-5. Omm in length, were placed onto P5 media for up to 36 hrs prior to transformation. Embryos were then transferred into 0.8 ml of Agrobacteria and vortexed for 30 seconds. Following this treatment, embryos were cut into ~ 1 mm lengths and placed under vacuum for 30 minutes before transfer to P5 media ( " 40 embryos per plate). After 6 days cocultivation, in the dark at 26°C, embryo pieces were transferred to P5 plus 10 mg/l geneticin and

200 mg/l timentin. These embryo pieces were cultured in the dark under the same conditions as described for the production of secondary embryos (Eady et al.

1998). Cultures were transferred to fresh medium every 2 weeks. After 3-4 transfers, growing material was transferred to P5 plus 25 mg/I geneticin and grown for a further 8 weeks. During this time pieces of putative transgenic tissue which reached " 2 mm² were transferred to regeneration medium (Eady et al. 1998). Shoot cultures were maintained for 12 weeks and developing shoots were transferred to 1 /2MS media (Murashige and Skoog 1962) plus 20 mg/l geneticin to induce rooting. Rooted plants were either transferred to 1/2MS plus 120 g/l sucrose to induce bulbing or transferred to soil in the glasshouse(12 hr 12-23°C day, 12hr 4-1 6°C night).

This method is the subject of protection in the applicant's patent application number NZ 333992.

Example 7

Transgenic onion plants containing the antisense root alliinase gene construct.

Onion immature embryos were transformed according to the protocol of Eady et al (1999) with the pBINmgfpER plasmid (Haseloff 1997)modified to contain the antisense root alliinase gene construct.

Six putative transformants that fluoresced (to indicate the presence of the gfp gene) and grew on media containing geneticin (to indicate presence of the nptll gene) were obtained from three experiments. Three of these transformants or clones thereof were analysed by Southern Blot analysis for the successful transfer of the T-DNA insert from the binary vector. Roots from these plants were also analysed biochemically for root alliinase enzyme activity following the protocol of Clark et al (1998). Western Blots of the desalted protein (0.5μg/Iane) extracts were probed with an anti-alliinase antibody and visualised colourmetrically using a goat-antirabbit-alkaiine phosphatase system

Results Southern Analysis

All three plants analysed contained at least one copy of the T-DNA sequence containing the antisense root alliinase DNA sequence (Fig 2) indicating that re integration of modified alliinase sequences into allium species has been achieved.

The Western blot of Figure 3 shows the relative amounts of the root alliinase in protein extracts taken from the transgenic and control roots. These extracts were then run on a 10% SDS page gel and transferred to nitrocellulose paper using standard techniques. This was then incubated with rabbit polyclonal antibodies raised against the purified alliinase (Clark S. A. 1993. Molecular cloning and cDNA encoding alliinase from onion (Allium cepa L.), Ph D. thesis, University of Canterbury, Christchurch, New Zealand). These antibodies have been shown to bind specifically to the alliinase protein. Goat anti-rabbit alkaline phosphatase was added to specifically bind this antibody and after washing, the membrane was immersed in NBT (4 nitrotetrazolium chloride) and BCIP (5 bromo 4 chloro 3 indolyl phosphate) for 30 minutes in the dark. Colour develops at the site of the phosphatase in proportion to the amount alliinase present. The Western blot therefore shows the relative amounts of alliinase protein present in the roots of the transgenic and control onion plants. The control onion plant has the greatest colour development and has the most alliinase per unit of root protein. The intensity relates to the activity of the enzyme shown in the table and indicates that the activity is related to the amount of alliinase protein and not changes in enzyme activity. This is what is expected when using antisense technology to reduce enzyme activity.

It is to be appreciated that the scope of the invention is not limited to the described embodiments and therefore that numerous variations and modifications may be made to these embodiments without departing from the scope of the invention as set out in this specification.

Moreover, where specific processing steps, materials and apparatus have been described, and known equivalents exist, such equivalents are incorporated as if specifically set forth.

Industrial Applicability

The isolation of a novel alliinase gene from the roots of onion and the insertion into plants provides a means of manipulating alliinase levels which could assist in the modification of flavour, pungency and control of disease in such plants.

Claims

1 . A substantially pure alliinase gene isolated from the root of an onion plant.

2. The alliinase gene according to claim 1 selected from the group comprising: (a) the nucleic acid sequence shown in Figure 1 (SEQ ID NO:1 );

(b) a fragment of the DNA sequence depicted in Figure 1 ;

(c) a DNA sequence derived from (a) or (b) in which one or more amino acid encoding triplets has been added, deleted or replaced without substantially affecting the alliinase activity of the protein encoded thereby;

(d) a DNA sequence which is a degenerate equivalent of the sequence of (a) or (b); or

(e) a DNA sequence hybridizable to a sequence (a), (b), (c) or (d).

3. A substantially pure alliinase enzyme isolated from the root of an onion plant.

4. The alliinase enzyme according to claim 3 whose DNA sequence is encoded by the sequence shown in Figure 1.

5. A vector or plasmid comprising the alliinase gene as claimed in claim 1 or claim 2.

6. A vector as claimed in claim 5 which is a binary vector.

7. A binary vector as claimed in claim 6 in which the alliinase gene is inserted into the vector in an anti-sense orientation.

8. The use of an onion root alliinase gene to manipulate the level of alliinase produced by a plant.

9. The use of an alliinase gene according to claim 2 to manipulate the level of alliinase produce by a plant.

10. The use of the vector as claimed in claim 6 or 7 in a method of transformation of a suitable host plant to produce a transgenic plant with an altered level of alliinase production.

1 1. Agrobacterium tumefaciens when transformed by a binary vector comprising an alliinase gene isolated from the root of an onion.

12. Agrobacterium tumefaciens as claimed in claim 1 1 comprising the binary vector as claimed in claim 7.

13. A transgenic plant produced by transformation of the plant with Agrobacterium tumefaciens as claimed in either of claim 1 1 or 12.

14. A transgenic plant according to claim 13 which is an onion plant.

1 5. The use of a substantially pure alliinase gene isolated from the root of an onion plant according to claim 1 or claim 2 to transform a plant to produce a transgenic plant with an altered level of alliinase production in the plant root.

16. The use according to claim 1 5 in which the altered level is a depressed level.

17. The use as claimed in claim 1 5 or 16 wherein the plant root is an onion root.

18. The use as claimed in any one of claims 1 5-17 in which the root alliinase gene is used in an anti-sense orientation to depress the level of alliinase produced by the transgenic plant.

19. The use according to claim 18 in which the plant is an onion plant.