WO2000031113A1 - INTRACELLULAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN - Google Patents

INTRACELLULAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN Download PDF

Info

Publication number
WO2000031113A1
WO2000031113A1 PCT/US1999/027244 US9927244W WO0031113A1 WO 2000031113 A1 WO2000031113 A1 WO 2000031113A1 US 9927244 W US9927244 W US 9927244W WO 0031113 A1 WO0031113 A1 WO 0031113A1
Authority
WO
WIPO (PCT)
Prior art keywords
hsp70
cells
cell
protein
complex
Prior art date
Application number
PCT/US1999/027244
Other languages
French (fr)
Inventor
Sheri M. Fujihara
Steven G. Nadler
Original Assignee
Bristol-Myers Squibb Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bristol-Myers Squibb Company filed Critical Bristol-Myers Squibb Company
Priority to JP2000583940A priority Critical patent/JP4892132B2/en
Priority to CA2352286A priority patent/CA2352286C/en
Priority to DK99960422T priority patent/DK1133517T3/en
Priority to EP99960422A priority patent/EP1133517B1/en
Priority to DE69941156T priority patent/DE69941156D1/en
Priority to AU17314/00A priority patent/AU760081B2/en
Publication of WO2000031113A1 publication Critical patent/WO2000031113A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/35Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • the present invention relates to the intracellular delivery, preferably the intranuclear delivery, of compounds using the heat shock protein Hsp70.
  • Hsps Heat shock proteins
  • Hsp70 is one member of the heat shock protein family. (Milner, CM. and Campbell, R.D. Immunogenetics 32:242-251 (1990); Genbank Accession No. M59828).
  • One of the most well characterized functions of Hsp70 is to assist in the translocation of proteins across intracellular membranes into different compartments of the cell.
  • Intracellular transport activity has been reported for viral proteins such as the HSV- 1 structural protein VP22 (Elliott, et. al., ( 1997) Cell 88:223-233) and the HTV Tat protein (Vives, et. al., (1997) J. Biol. Chem. 272: 16010-16017), as well as peptide sequences derived from Antennapedia homeodomain, fibroblast growth factor (Hawiger, (1997) Curr. Opin. Immun. 9: 189-194), and most recently the neuropeptide galanin (Pooga, et. al., (1998) FASEB J. 12:67-77).
  • viral proteins such as the HSV- 1 structural protein VP22 (Elliott, et. al., ( 1997) Cell 88:223-233) and the HTV Tat protein (Vives, et. al., (1997) J. Biol. Chem. 272: 16010-16017), as well as peptide sequences
  • Hsps also serve a number of key functions in the immune response, and over the past few years there has been increasing interest in characterizing the nature of Hsps in generating protective immunity.
  • a series of recent studies (Roman, et. al., (1996) Immunology 88:487-492; Suzue, et. al, (1996) J. Immunol. 156:873-879) demonstrated that Hsp70 could act as a carrier protein to enable a bound peptide or protein substrate to enter the endosomal compartment and subsequently access the MHC class II processing pathway for exogenous antigens.
  • Such treatment with Hsp70-peptide complexes or Hsp70 fusion proteins could elicit cargo-specific proliferative T cell responses.
  • Hsp70 a plasma membrane translocation capacity for Hsp70, such an activity has not been directly demonstrated. It has not been shown whether or not Hsp70 could be utilized to deliver proteins across the plasma and nuclear membranes. There exists a need to deliver compounds, such as proteins or DNA, into the cell nucleus to modulate cellular activity.
  • Applicants have shown that the human 70 kD heat shock protein can translocate across cell membranes to rapidly gain cytoplasmic and nuclear entry. Furthermore, chimeric proteins composed of Hsp70 peptides fused to amino acids 37-409 of the p50 subunit of NF- ⁇ B (Meyer, R., et. al, PNAS 88:966-970 (1991); Genbank Accession No. M58603) also exhibit this translocation property. Though cellular import activity has been reported for various diverse peptides, intranuclear transport generally requires the presence of specific nuclear localization sequences ("NLS").
  • NLS nuclear localization sequences
  • an object of the present invention is to provide a carrier for delivery of molecules with biological function into both cellular and nuclear compartments.
  • a preferred embodiment of the present invention utilizes Hsp70, or a fragment of Hsp70 as described herein, as a vehicle for directed, noninvasive delivery of molecules, such as proteins or DNA, that may modulate gene expression.
  • Hsp70 The 70kD heat shock protein
  • NF- ⁇ B a key transcriptional regulator of inflammatory responses
  • Applicants herein show that a fusion protein composed of a C- terminal Hsp70 peptide and amino acids 37-409 of the p50 subunit of NF- ⁇ B was directed into the nucleus of cells, could bind DNA specifically, and activated kappa Ig expression and TNF ⁇ production.
  • Applicants' invention encompasses the use of Hsp70 as a vehicle for intracytoplasmic and intranuclear delivery of proteins or DNA to modulate gene expression and thereby control immune responses.
  • Figure 1 shows various cell types that exhibit differential Hsp70 uptake activity.
  • Various cells were treated with lO ⁇ g/ml Hsp70-FITC added to the culture media.
  • Human peripheral blood cells were stained with anti-CD 14-PE as a marker for monocytic cells, anti-CD19-PE for B cells, or anti-CD3-PE for T cells. After one hour of incubation at 37°C, cells were washed in PBS, fixed in 2% paraformaldehyde, washed again and re-suspended in PBS for visualization by confocal laser scanning microscopy. Equimolar amounts of BSA-FITC were used in parallel experiments as a control.
  • Figure 1 A shows 70Z/3 cells + Hsp70-FITC
  • Figure IB shows 70Z/3 cells + BSA-FITC
  • Figure 1C shows PBL stained with anti-CD14-PE + Hsp70-FITC
  • Figure ID shows PBL stained with anti-CD14-PE + BSA-FITC
  • Figure IE shows PBL stained with anti-CD 19-PE + Hsp70-FITC
  • Figure IF shows peripheral blood T cells stained with anti-CD3-PE + Hsp70.
  • Figure 2 shows the kinetics of Hsp70 cellular uptake.
  • Figure 2A shows the kinetics of uptake of Hsp70-FITC by 70Z/3 cells. The cells were incubated at 37°C for various times with 1 uM Hsp70-FITC in complete RPMI. Cells were washed once in PBS to separate free Hsp70-FITC, then re-suspended in PBS and analyzed by fluorimeter. Points were experimental and the curve was fitted by a modified regression program (XLlfit).
  • Figure 2B shows the dose effect of Hsp70 on uptake by 70Z/3 cells.
  • FIG. 3 shows that intracellular uptake of Hsp70-FITC was not affected by azide but was inhibited at 4°C.
  • 70Z/3 cells were either untreated ( Figure 3 A) or pretreated for 30 minutes with 0.05% sodium azide (Figure 3B) before incubation with Hsp70-FITC at 37°C, or were preincubated at 4°C for 30 minutes prior to addition of Hsp70-FITC and an additional one hour of incubation at 4°C (Figure 3C).
  • BSA-FITC was added to cells for 1 hour at 37°C as a control ( Figure 3D).
  • Figure 4 shows transport of fusion proteins into the cytoplasm and nucleus.
  • FITC-labeled fusion proteins consisting of either the C terminal 244 (Hsp70/28-p50) or 92 (Hsp70/10-p50) amino acids of Hsp70, fused to amino acids 37-409 of the p50 subunit of NF-kB, were transported into 70Z/3 cells.
  • 70Z/3 cells were treated with full-length Hsp70-FITC ( Figure 4A), Hsp70/28-p50-FITC ( Figure 4B), Hsp70/10- ⁇ 50-FITC ( Figure 4C), or BSA-FITC as a control ( Figure 4D) for 1 hour at 37°C as described.
  • FIG. 5 demonstrates that internalized intracellular Hsp70 or Hsp70-p50 remained stable for up to 24 hours.
  • Cells were treated with either full-length Hsp70- FITC (Figure 5A) or Hsp70/28-p50-FITC ( Figure 5B) for one hour prior to washing and additional incubation at 37°C for increasing times.
  • Cells were harvested at the indicated timepoints, lysed in Laemmli sample buffer, and whole cell lysate proteins were separated by SDS-PAGE. Gels were subjected to fluorimager analysis. Lanes 1: cells untreated; lane 2: no chase; lane 3: 1 hour of chase; lane 4: 2 hours of chase; lane 5: 6 hours of chase; lane 6: 24 hours of chase; lane 7: 4 days of chase.
  • Figure 6 shows that internalized Hsp70-p50 fusion proteins exhibited DNA- binding activity. 70Z/3 cells were treated as indicated for one hour prior to lysis and generation of nuclear extracts. EMS A was performed and specific DNA binding complexes were identified by supershift assay with the indicated antibodies.
  • Figure 6A lane 1: unstimulated cells control; lane 2: LPS-treated; lane 3: Hsp70-p50-treated; lane 4: Hsp70-p50-treated extracts competed with unlabelled NF- ⁇ B oligo; lane 5: same as lane 4 but competed with unlabelled octamer oligo.
  • Lane 6B lane 1 : LPS- treated; lane 2: LPS-treated and supershifted with anti-p50; lane 3: anti-p65; lane 4: anti-c-rel; lane 5: anti-Hsp70; Lanes 6-10, same as lanes 1-5 but using Hsp70-p50 treated extracts.
  • Figure 7 shows that Hsp70-p50-treated cells became activated to express surface kappa Ig and produce TNF .
  • Figure 7A 70Z/3 cells were treated with 10 ng/ml LPS or 30 ⁇ g/ml Hsp70/10-p50 overnight prior to washing and staining with anti-kappa-FITC and FACS analysis.
  • Figure 7B Human peripheral blood lymphocytes were treated with 5 ng/ml LPS or 40 ⁇ g/ml Hsp70/10-p50 or Hsp70/28- p50 for 6 hours, and supernatants were harvested and analyzed for TNF ⁇ levels by ELISA.
  • the present invention demonstrates that the heat shock protein Hsp70 is internalized by cells into both the cytoplasm and nucleus in a cell type specific manner. Although the mechanism of uptake is unknown, the data suggest that the binding and internalization of Hsp70 is energy dependent and involves a high capacity receptor.
  • Hsp70 cell surface-associated and secreted forms of Hsp70 exist (Multhoff, et al., ( 1996) Cell Stress & Chaperones 1: 167-176) suggests that this protein may function in cell-cell communication, perhaps as a means of transferring cellular protection from environmental stressors by regulating transcription.
  • Hsp70 can bind directly to the transactivation domains of both HSF (heat shock factor) (Shi, et al., (1998) Genes Dev.
  • HSF heat shock factor
  • Hsp70 as a cytoplasmic chaperone can interact with transcription factors such as NF- ⁇ B itself, as well as a myriad cofactors such as Hip, Hop, Hsp40, Hsp90, BAG-1 and others (Demand, et al., (1998) Mol. Cell. Biol. 18:2023-2028).
  • Hsp70 release and intercellular transfer of exported Hsp70 has been reported in glial and axonal cells (Hightower, et al., (1989) J. Cell Physiol. 138:257-266); and accumulation of Hsp70 in a variety of human cell lines either by heat shock or by liposomal transfer has been shown to increase cell survival and protect from apoptotic cell death (Lasunskaia, et al., (1997) Apoptosis 2: 156-163). Release of heat shock proteins from cells under harsh or damaging conditions may be a homeostatic mechanism for transfer of a protective stress response to neighboring cells that are unable to mount such a response. In addition, recent reports describing the ability of peptide-bound
  • Hsp70 molecules to induce antitumor or antiviral immunity as well as development of memory CTLs support the notion that these proteins might function to convey a protective immune response by providing an antigen presentation function (Blachere, et al, (1997) J. Exp. Med. 186- 1315-1322; Ciupitu, et al., (1998) J. Exp. Med. 187:685-691).
  • Applicants submit that endogenous Hsp70 (and associated peptides or proteins) is/are released into the environment by infected or apoptosing cells. These Hsp70 protein complexes would subsequently become available to neighboring cells which may be compromised in their immune capacity, and act as a stimulus to boost or strengthen the immune response.
  • Hsp70 as a delivery system has a number of advantages over other previously described protein candidates, including the fact that the protein is of human origin and therefore does not contain foreign (i.e., viral or insect) and potentially immunogenic material. Use of soluble fragments of Hsp70 will potentially reduce immunogenicity further. As Hsp70 is a highly expressed abundant protein, it would likely be well-tolerated in humans, and in fact already plays an immune response role. In addition, the cell type-specificity we observed would allow the targeting of compounds to specific cells of the immune system for more effective regulatory control. And finally, the preferential and long-lived nuclear directed delivery of protein substrates may provide protection from cytoplasmic proteolysis. Our data support the potential use of Hsp70 sequences as a novel tool to deliver molecules that modulate gene expression and subsequently provide i munosuppressive or immunostimulatory control.
  • a fusion protein comprising a fragment of Hsp70 joined to amino acids 37-409 of the NF- ⁇ B p50 subunit (the fusion proteins are referred to herein as Hsp70-p50, Hsp70/28-p50, or Hsp70/10-p50).
  • Hsp70-p50 the fusion proteins are referred to herein as Hsp70-p50, Hsp70/28-p50, or Hsp70/10-p50.
  • the heat shock protein sequence may itself contain transactivation activity.
  • Hsp70 is known to bind heat shock factor in the nucleus and interfere with its transactivation activity via the EEVD domain. Since the Hsp70 sequence in the Examples below was cloned C- terminal to amino acids 37-409 of the NF-kB p50 sequence (SEQ ID NO: l), the EEVD domain is potentially available to provide transactivation, or even to interact with other cellular or nuclear cofactors. Closer analysis of the nuclear complex may yield clues as to other possible components with transcriptional activities. Second, p50 homodimers may simply exhibit transactivation activity in particular circumstances. Fujita, et al. ((1992) Genes Dev.
  • the present invention encompasses the use of Hsp70, or a fragment of Hsp70, to modulate cellular activity, preferably modulate nuclear activity in a cell or cells, for example the activity of transcription factors.
  • nuclear activity encompasses the transcription of nucleic acid molecules in the cell.
  • modulate encompasses enhancement, diminishment, activation or inactivation of cellular activity.
  • the Hsp70 protein or a fragment thereof may be used alone to modulate cellular activity by transfer into the cytoplasm and/or nucleus of a cell, to treat Hsp70-associated disorders.
  • Hsp70-associated disorders refers to any disorder or disease state in which Hsp70 plays a regulatoiy role in the metabolic pathway of that disorder or disease.
  • treating refers to the alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune response (such as transplant rejection).
  • patient refers to a mammal, preferably a human.
  • Hsp70 or a fragment of Hsp70, as a chaperone to carry one or more compounds into a cell.
  • Hsp70 or a fragment thereof is joined to a compound to form a complex (herein referred to as an "Hsp70 complex" which includes the Hsp70, or fragment thereof, and any compound associated with or joined to the Hsp70 protein or fragment thereof).
  • the Hsp70 complex is then provided to a cell or cells, or to the environment surrounding a cell or cells, so that the Hsp70 complex is transported into the cytoplasm and/or nucleus of the cell or cells.
  • Hsp70 protein or a fragment thereof include, but are not limited to, proteins, peptides, nucleic acids, and small molecules.
  • Nucleic acids or “polynucleotides” includes individual nucleotides as well as DNA and RNA sequences or fragments thereof.
  • Disease states which may be treated by Hsp70, fragments thereof, and/or Hsp70 complexes of the present invention include transplant rejection and autoimmune diseases, such as rheumatoid arthritis, multiple sclerosis, juvenile diabetes, asthma, and inflammatory bowel disease, as well as inflammatory diseases, cancer, viral replication diseases and vascular diseases.
  • the Hsp70 complexes and pharmaceutical compositions of the present invention are useful in the treatment of transplant rejection (e.g., kidney, liver, heart, lung, pancreas (e.g., islet cells), bone marrow, cornea, small bowel and skin allografts, and heart valve xenografts) and autoimmune diseases, such as rheumatoid arthritis, multiple sclerosis, juvenile diabetes, asthma, inflammatory bowel disease (Crohn's disease, ulcerative colitus), lupus, diabetes, myasthenia gravis, psoriasis, dermatitis, eczema, seborrhoea, pulmonary inflammation, eye uveitis, hepatitis, Grave's disease, Hashimoto's thyroiditis, Behcet's or Sjorgen's syndrome (dry eyes/mouth), pernicious or immunohaemolytic anaemia, idiopathic adrenal insufficiency, polyglandular autoimmune diseases
  • compositions comprising at least one Hsp70 complex comprising a compound that is to be delivered to the cytoplasm and/or nucleus of a cell or cells.
  • the Hsp70 complex may be administered alone or with at least one additional active compound, and any pharmaceutically acceptable earner, adjuvant or vehicle.
  • Additional active compounds encompasses, but is not limited to, an agent or agents selected from the group consisting of an immunosuppressant, an anti-cancer agent, an anti-viral agent, an anti-inflammatory agent, an anti-fungal agent, an antibiotic, or an anti-vascular hyperproliferation compound.
  • pharmaceutically acceptable carrier, adjuvant or vehicle refers to a carrier, adjuvant or vehicle that may be administered to a subject, together with an Hsp70 complex of the present invention, and which does not destroy the pharmacological activity thereof.
  • Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions of the present invention include, but are not limited to, the following: ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems ("SEDDS”) such as d ⁇ - tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens or other similar polymeric delivery matrices, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen
  • Cyclodextrins such as ⁇ -, ⁇ - and ⁇ -cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl- ⁇ - cyclodextrins, or other solubilized derivatives may also be used to enhance delivery of the compounds of the present invention.
  • compositions of the present invention may contain other therapeutic agents as described below, and may be formulated, for example, by employing conventional solid or liquid vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, binders, preservatives, stabilizers, flavors, etc.) according to techniques such as those well known in the art of pharmaceutical formulation.
  • compositions comprising at least one Hsp70 complex of the present invention may be administered by any suitable means, for example, orally, such as in the form of tablets, capsules, granules or powders; sublingually; buccally; parenterally, such as by subcutaneous, intravenous, intramuscular, or intrasternal injection or infusion techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions); nasally such as by inhalation spray; topically, such as in the form of a cream or ointment; or rectally such as in the form of suppositories; in dosage unit formulations containing non-toxic, pharmaceutically acceptable vehicles or diluents.
  • suitable means for example, orally, such as in the form of tablets, capsules, granules or powders; sublingually; buccally; parenterally, such as by subcutaneous, intravenous, intramuscular, or intrasternal injection or infusion techniques (e.g., as
  • compositions of the present invention may, for example, be administered in a form suitable for immediate release or extended release. Immediate release or extended release may be achieved by the use of suitable pharmaceutical compositions comprising the present compounds, or, particularly in the case of extended release, by the use of devices such as subcutaneous implants or osmotic pumps.
  • suitable pharmaceutical compositions comprising the present compounds, or, particularly in the case of extended release, by the use of devices such as subcutaneous implants or osmotic pumps.
  • the present Hsp70 complexes may also be administered liposomally.
  • compositions for oral administration include suspensions which may contain, for example, microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners or flavoring agents such as those known in the art; and immediate release tablets which may contain, for example, microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and/or lactose and/or other excipients, binders, extenders, dis integrants, diluents and lubricants such as those known in the art.
  • the present compounds may also be delivered through the oral cavity by sublingual and/or buccal administration.
  • Molded tablets, compressed tablets or freeze-dried tablets are exemplary forms which may be used.
  • Exemplary compositions include those formulating the present Hsc70 complexes with fast dissolving diluents such as mannitol, lactose, sucrose and/or cyclodextrins. Also included in such formulations may be high molecular weight excipients such as celluloses (avicel) or polyethylene glycols (PEG).
  • Such formulations may also include an excipient to aid mucosal adhesion such as hydroxy propyl cellulose (HPC), hydroxy propyl methyl cellulose (HPMC), sodium carboxy methyl cellulose (SCMC), maleic anhydride copolymer (e.g., Gantrez), and agents to control release such as polyacrylic copolymer (e.g.,
  • Lubricants may also be added for ease of fabrication and use.
  • compositions for nasal aerosol or inhalation administration include solutions in saline which may contain, for example, benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, and/or other solubilizing or dispersing agents such as those known in the art.
  • compositions for parenteral administration include injectable solutions or suspensions which may contain, for example, suitable non-toxic, parenterally acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
  • suitable non-toxic, parenterally acceptable diluents or solvents such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
  • parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal,
  • compositions for rectal administration include suppositories which may contain, for example, a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquify and/or dissolve in the rectal cavity to release the drug.
  • a suitable non-irritating excipient such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquify and/or dissolve in the rectal cavity to release the drug.
  • exemplary compositions for topical administration include a topical carrier such as Plastibase (mineral oil gelled with polyethylene).
  • a "therapeutically effective" amount of an Hsp70 complex of the present invention may be determined by one of ordinary skill in the art, and includes exemplary dosage amounts for an adult human of from about 0.1 to 100 mg/kg of body weight of active compound per day, which may be administered in a single dose or in the form of individual divided doses, such as from 1 to 3 times per day. It will be understood that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.
  • Preferred subjects for treatment include animals, most preferably mammalian species such as humans.
  • terapéuticaally effective is meant an amount necessary to achieve a desired result, for example, alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune response.
  • a desired result for example, alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune response.
  • the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition.
  • Preferred subjects for treatment include animals, most preferably mammalian species such as humans.
  • Hsp70 complexes of the present invention may be employed alone or in combination with each other and/or other suitable therapeutic agents, such as antiinflammatories, antiproliferatives, chemotherapeutic agents, and immunosuppres s ants .
  • suitable therapeutic agents such as antiinflammatories, antiproliferatives, chemotherapeutic agents, and immunosuppres s ants .
  • Hsp70 fusion proteins were generated by PCR amplification of human Hsp70 DNA sequences using primers corresponding to the published sequence and including restriction endonuclease sites to enable directed cloning into a prokaryotic expression vector, ProExHta (Life Technologies, Inc.).
  • NF-kB p50 sequences were generated in the same way, using primers corresponding to the published p50 sequence and cloned upstream of (5' to) Hsp70 sequences in the same expression vector.
  • the cloning vector included a 6x His tag for use in purification of expressed protein over a metal column.
  • DNA was transformed into a bacterial host and protein expression was induced using IPTG. Soluble, expressed fusion protein was purified using conventional affinity purification techniques and subsequently used for the following experiments.
  • Hsp70-FITC or BSA-FITC as a control
  • peripheral blood B cells were resistant to uptake, they could be induced to transport the protein after 48 hours of activation in vitro with anti-CD40 plus anti-Ig antibodies.
  • This method of B cell activation is known to result in the expression of various differentiation and proliferation associated genes.
  • activation of peripheral blood T cells by anti-CD3 and anti-CD28 antibodies did not affect Hsp70 transport. No intracellular uptake was observed by Jurkat T cell line or HeLa fibroblast cell line, but we did observe efficient uptake by two mature B cell lines, RAJI and BJAB.
  • the cell type specificity and inducibility of cellular Hsp70 uptake may reflect differential expression of a required surface or nuclear receptor for the Hsp70 protein. Studies are now in progress to investigate the surface proteins which may be involved in the binding and interaalization of extracellular Hsp70.
  • Hsp70-FITC was not saturable in the concentration range we used (35 nM-1 ⁇ M), indicative of a high capacity receptor-mediated uptake mechanism. In addition, internalization could not be blocked by preincubation with a 10-fold excess of unlabeled Hsp70.
  • the 244 amino acid polypeptide has the following sequence:
  • the 92 amino acid polypeptide has the following sequence:
  • TNF ⁇ production is another example of an inflammatory response also largely regulated by NF- ⁇ B.
  • the internalized fusion protein was also able to induce TNF ⁇ production by human peripheral blood lymphocytes (Figure 7B).
  • Freshly isolated PBLs were incubated with LPS or Hsp70-p50 for 6 hours, after which time supernatants were collected and tested for cytokine levels by ELISA. Again, we found the fusion proteins to be as effective as LPS in inducing TNF ⁇ production, and established that intact protein was responsible for activation by showing that heat denaturation of the fusion protein abolished the effect.
  • Hsp70-p50 fusion proteins Two p50 fusion proteins were constructed using the nucleotide sequence corresponding to amino acids 1-406 of the NF- ⁇ B pi 05 subunit protein. This sequence includes the DNA binding domain as well as the rel homology domain. The two fusion proteins varied in the length of Hsp70 fragment used. The two Hsp70 sequences were both derived from the C-terminus, including either the terminal 276 or 735 nucleotides, which correspond to a 10 kD (the 92 amino acid polypeptide discussed above) and a 28 kD (the 244 amino acid polypeptide discussed above) protein fragment.
  • Hsp70/10-p50 or Hsp70/28-p50 Either the 10 kD or the 28 kD Hsp70 protein was fused C-terminal to the p50 protein, and the resulting fusion proteins were denoted Hsp70/10-p50 or Hsp70/28-p50, respectively.
  • the prokaryotic expression vector ProEX HT (Life Technologies, Gaithersburg, MD) was used for cloning, expression and purification, as per the manufacturer's recommendations . Confocal laser scanning microscopy.
  • Cells were typically treated with 10 ⁇ g/ml FITC-conjugated proteins or as indicated in the text for one hour at 37°C followed by a ash in PBS, fixation in 2% paraformaldehyde, an additional wash in PBS and subsequent visual analysis by confocal microscopy (Bio-Rad, Hercules, CA) using Molecular Dynamics LaserSharp software and Adobe Photoshop. Western blot analysis of imported Hsp70-p50 fusion proteins. Cells were treated with FITC-conjugated proteins for one hour at 37°C, washed in PBS and used for preparation of nuclear extracts. Equal protein amounts were separated by SDS- PAGE.
  • oligonucleotides (Promega, Madison, WI) were end labeled with [ ⁇ - 32 P]ATP and T4 kinase. The conditions for binding reactions with oligonucleotide probes were as previously described.
  • I ⁇ ununo fluorescence assay FACS
  • 70Z/3 cells were treated with either 30 ⁇ g/ml Hsp70/10-p50 fusion protein or 100 ng/ml LPS and incubated overnight at 37°C. Cells were then washed in PBS and fixed in 2% paraformaldehyde prior to staining with FITC-conjugated anti-kappa antibody. After an additional PBS wash, cells were subjected to imaging and analysis on the FACSTAR.
  • TNF ⁇ assay Human peripheral blood lymphocytes were isolated as previously described and treated with 40 ⁇ g/ml Hsp70 fusion protein or LPS for 6 hours. Supernatants were collected and analyzed for TNF ⁇ by ELISA (Genzyme, Cambridge, MA).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Molecular Biology (AREA)
  • Rheumatology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pulmonology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Emergency Medicine (AREA)
  • Cardiology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)

Abstract

The present invention provides a carrier for the delivery of molecules with biological function into both cellular and nuclear compartments. The carrier disclosed is heat shock protein 70 ('Hsp70'), or a fragment of Hsp70 as described herein, as a vehicle for directed, non-invasive delivery of molecules, such as proteins, peptides, or DNA, that may modulate cellular activity. The present invention also encompasses the use of Hsp70, or a fragment thereof, to modulate cellular activity, preferably to modulate nuclear activity in a cell or cells.

Description

I TRACELLULAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN
Field of the Invention The present invention relates to the intracellular delivery, preferably the intranuclear delivery, of compounds using the heat shock protein Hsp70.
Background of the Invention Heat shock proteins ("Hsps") are a family of molecular chaperone proteins which have long been known to play essential roles in a multitude of intra- and intercellular processes, including protein synthesis and folding, vesicular trafficking, and antigen processing and presentation. Hsps are among the most highly conserved proteins known, and carry out many of their regulatory activities via protein-protein interactions. Hsp70 is one member of the heat shock protein family. (Milner, CM. and Campbell, R.D. Immunogenetics 32:242-251 (1990); Genbank Accession No. M59828). One of the most well characterized functions of Hsp70 is to assist in the translocation of proteins across intracellular membranes into different compartments of the cell.
Intracellular transport activity has been reported for viral proteins such as the HSV- 1 structural protein VP22 (Elliott, et. al., ( 1997) Cell 88:223-233) and the HTV Tat protein (Vives, et. al., (1997) J. Biol. Chem. 272: 16010-16017), as well as peptide sequences derived from Antennapedia homeodomain, fibroblast growth factor (Hawiger, (1997) Curr. Opin. Immun. 9: 189-194), and most recently the neuropeptide galanin (Pooga, et. al., (1998) FASEB J. 12:67-77). Delivery of protein substrates has been demonstrated by some of these transport peptides as well (Phelan, et. al., (1998) Nature Biotechnology 16:440-443; Fawell, et. al., (1994) Proc. Natl. Acad. Sci. 91:664-668; Rojas, et. al., (1998) Nature Biotechnology 16:370-375).
Hsps also serve a number of key functions in the immune response, and over the past few years there has been increasing interest in characterizing the nature of Hsps in generating protective immunity. A series of recent studies (Roman, et. al., (1996) Immunology 88:487-492; Suzue, et. al, (1996) J. Immunol. 156:873-879) demonstrated that Hsp70 could act as a carrier protein to enable a bound peptide or protein substrate to enter the endosomal compartment and subsequently access the MHC class II processing pathway for exogenous antigens. Such treatment with Hsp70-peptide complexes or Hsp70 fusion proteins could elicit cargo-specific proliferative T cell responses. However, other experiments in which cancer cell- derived Hsp70 used to immunize mice resulted in specific antitumor CTL responses (Udono, et al., (1993) J. Exp. Med. 178: 1391-1396) suggested that the Hsps were using the endogenous MHC class I processing pathway. These data implied that Hsp70 was able to cross the plasma membrane and enter the cytoplasmic compartment of intact cells. Earlier studies (Hightower, et al. (1989) J. Cell
Physiol. 138:257-266) reporting the release of Hsps from axonal cells by a non-heat shock dependent mechanism, support the observation that some Hsp family members can cross the plasma membranes of certain cells.
Although the above studies imply a plasma membrane translocation capacity for Hsp70, such an activity has not been directly demonstrated. It has not been shown whether or not Hsp70 could be utilized to deliver proteins across the plasma and nuclear membranes. There exists a need to deliver compounds, such as proteins or DNA, into the cell nucleus to modulate cellular activity.
Applicants have shown that the human 70 kD heat shock protein can translocate across cell membranes to rapidly gain cytoplasmic and nuclear entry. Furthermore, chimeric proteins composed of Hsp70 peptides fused to amino acids 37-409 of the p50 subunit of NF-κB (Meyer, R., et. al, PNAS 88:966-970 (1991); Genbank Accession No. M58603) also exhibit this translocation property. Though cellular import activity has been reported for various diverse peptides, intranuclear transport generally requires the presence of specific nuclear localization sequences ("NLS"). While heat shock is known to induce increased synthesis and nuclear translocation of endogenous heat shock protein following heat shock factor activation, Applicants show that nuclear localization of exogenous heat shock protein can result without prior heat shock. Applicants have also shown that the transport and nuclear localization properties of Hsp70 are retained within a 90 amino acid C-terminal fragment; successful intranuclear transport has been demonstrated utilizing a C-terminal fragment as well as larger fragments encompassing more of the peptide binding domain. Herein is the first evidence establishing the ability of exogenous Hsp70 fusion proteins to cross the cell membrane, gain nuclear entry and exert a biological function.
Therefore, an object of the present invention is to provide a carrier for delivery of molecules with biological function into both cellular and nuclear compartments. A preferred embodiment of the present invention utilizes Hsp70, or a fragment of Hsp70 as described herein, as a vehicle for directed, noninvasive delivery of molecules, such as proteins or DNA, that may modulate gene expression.
Summary of the Invention The 70kD heat shock protein ("Hsp70") is a highly conserved, ubiquitous protein involved in chaperoning proteins to various cellular organelles. Applicants herein show that when added exogenously to cells, Hsp70 is readily imported into both cytoplasmic and nuclear compartments. Applicants have demonstrated that Hsp70 can be used to chaperone compounds into a cell or cells. Hsp70 was used to deliver NF-κB, a key transcriptional regulator of inflammatory responses, into the nuclear compartment. Applicants herein show that a fusion protein composed of a C- terminal Hsp70 peptide and amino acids 37-409 of the p50 subunit of NF-κB was directed into the nucleus of cells, could bind DNA specifically, and activated kappa Ig expression and TNFα production. Applicants' invention encompasses the use of Hsp70 as a vehicle for intracytoplasmic and intranuclear delivery of proteins or DNA to modulate gene expression and thereby control immune responses.
Description of the Figures
Figure 1 shows various cell types that exhibit differential Hsp70 uptake activity. Various cells were treated with lOμg/ml Hsp70-FITC added to the culture media. Human peripheral blood cells were stained with anti-CD 14-PE as a marker for monocytic cells, anti-CD19-PE for B cells, or anti-CD3-PE for T cells. After one hour of incubation at 37°C, cells were washed in PBS, fixed in 2% paraformaldehyde, washed again and re-suspended in PBS for visualization by confocal laser scanning microscopy. Equimolar amounts of BSA-FITC were used in parallel experiments as a control. Figure 1 A shows 70Z/3 cells + Hsp70-FITC; Figure IB shows 70Z/3 cells + BSA-FITC; Figure 1C shows PBL stained with anti-CD14-PE + Hsp70-FITC; Figure ID shows PBL stained with anti-CD14-PE + BSA-FITC; Figure IE shows PBL stained with anti-CD 19-PE + Hsp70-FITC; and Figure IF shows peripheral blood T cells stained with anti-CD3-PE + Hsp70.
Figure 2 shows the kinetics of Hsp70 cellular uptake. Figure 2A shows the kinetics of uptake of Hsp70-FITC by 70Z/3 cells. The cells were incubated at 37°C for various times with 1 uM Hsp70-FITC in complete RPMI. Cells were washed once in PBS to separate free Hsp70-FITC, then re-suspended in PBS and analyzed by fluorimeter. Points were experimental and the curve was fitted by a modified regression program (XLlfit). Figure 2B shows the dose effect of Hsp70 on uptake by 70Z/3 cells. The cells were incubated at 37°C for one hour with various concentrations of Hsp70-FITC, then washed and analyzed as in (A). Figure 3 shows that intracellular uptake of Hsp70-FITC was not affected by azide but was inhibited at 4°C. 70Z/3 cells were either untreated (Figure 3 A) or pretreated for 30 minutes with 0.05% sodium azide (Figure 3B) before incubation with Hsp70-FITC at 37°C, or were preincubated at 4°C for 30 minutes prior to addition of Hsp70-FITC and an additional one hour of incubation at 4°C (Figure 3C). BSA-FITC was added to cells for 1 hour at 37°C as a control (Figure 3D).
Internalized Hsp70-FITC did not co-localize with transferrin. Cells were treated with both Hsp70-FITC and Texas Red-conjugated transferrin, for one hour at 37°C (Figure 3E).
Figure 4 shows transport of fusion proteins into the cytoplasm and nucleus. FITC-labeled fusion proteins consisting of either the C terminal 244 (Hsp70/28-p50) or 92 (Hsp70/10-p50) amino acids of Hsp70, fused to amino acids 37-409 of the p50 subunit of NF-kB, were transported into 70Z/3 cells. 70Z/3 cells were treated with full-length Hsp70-FITC (Figure 4A), Hsp70/28-p50-FITC (Figure 4B), Hsp70/10- ρ50-FITC (Figure 4C), or BSA-FITC as a control (Figure 4D) for 1 hour at 37°C as described. Intracellular localization of fusion proteins was visualized by confocal laser scanning microscopy. Figure 5 demonstrates that internalized intracellular Hsp70 or Hsp70-p50 remained stable for up to 24 hours. Cells were treated with either full-length Hsp70- FITC (Figure 5A) or Hsp70/28-p50-FITC (Figure 5B) for one hour prior to washing and additional incubation at 37°C for increasing times. Cells were harvested at the indicated timepoints, lysed in Laemmli sample buffer, and whole cell lysate proteins were separated by SDS-PAGE. Gels were subjected to fluorimager analysis. Lanes 1: cells untreated; lane 2: no chase; lane 3: 1 hour of chase; lane 4: 2 hours of chase; lane 5: 6 hours of chase; lane 6: 24 hours of chase; lane 7: 4 days of chase.
Figure 6 shows that internalized Hsp70-p50 fusion proteins exhibited DNA- binding activity. 70Z/3 cells were treated as indicated for one hour prior to lysis and generation of nuclear extracts. EMS A was performed and specific DNA binding complexes were identified by supershift assay with the indicated antibodies. Figure 6A, lane 1: unstimulated cells control; lane 2: LPS-treated; lane 3: Hsp70-p50-treated; lane 4: Hsp70-p50-treated extracts competed with unlabelled NF-κB oligo; lane 5: same as lane 4 but competed with unlabelled octamer oligo. Figure 6B, lane 1 : LPS- treated; lane 2: LPS-treated and supershifted with anti-p50; lane 3: anti-p65; lane 4: anti-c-rel; lane 5: anti-Hsp70; Lanes 6-10, same as lanes 1-5 but using Hsp70-p50 treated extracts.
Figure 7 shows that Hsp70-p50-treated cells became activated to express surface kappa Ig and produce TNF . (Figure 7A) 70Z/3 cells were treated with 10 ng/ml LPS or 30 μg/ml Hsp70/10-p50 overnight prior to washing and staining with anti-kappa-FITC and FACS analysis. (Figure 7B) Human peripheral blood lymphocytes were treated with 5 ng/ml LPS or 40 μg/ml Hsp70/10-p50 or Hsp70/28- p50 for 6 hours, and supernatants were harvested and analyzed for TNFα levels by ELISA.
Detailed Description of the Invention The present invention demonstrates that the heat shock protein Hsp70 is internalized by cells into both the cytoplasm and nucleus in a cell type specific manner. Although the mechanism of uptake is unknown, the data suggest that the binding and internalization of Hsp70 is energy dependent and involves a high capacity receptor.
The observation that cell surface-associated and secreted forms of Hsp70 exist (Multhoff, et al., ( 1996) Cell Stress & Chaperones 1: 167-176) suggests that this protein may function in cell-cell communication, perhaps as a means of transferring cellular protection from environmental stressors by regulating transcription. In fact, several recent reports have described a physical interaction of Hsp70 with the transactivation domains of several transcription factors within the nucleus. For example, Hsp70 can bind directly to the transactivation domains of both HSF (heat shock factor) (Shi, et al., (1998) Genes Dev. 12:654-666), resulting in inhibition of gene transcription, and Wilms tumor suppressor (Maheswaran, et al., (1998) Genes Dev. 12: 1108-1120), resulting in suppression of cellular proliferation. These data and others implicate a role for Hsp70 in the regulation of transcription factors and possibly other nuclear proteins. These data complement others which have shown that Hsp70 as a cytoplasmic chaperone can interact with transcription factors such as NF-κB itself, as well as a myriad cofactors such as Hip, Hop, Hsp40, Hsp90, BAG-1 and others (Demand, et al., (1998) Mol. Cell. Biol. 18:2023-2028). Indeed, release and intercellular transfer of exported Hsp70 has been reported in glial and axonal cells (Hightower, et al., (1989) J. Cell Physiol. 138:257-266); and accumulation of Hsp70 in a variety of human cell lines either by heat shock or by liposomal transfer has been shown to increase cell survival and protect from apoptotic cell death (Lasunskaia, et al., (1997) Apoptosis 2: 156-163). Release of heat shock proteins from cells under harsh or damaging conditions may be a homeostatic mechanism for transfer of a protective stress response to neighboring cells that are unable to mount such a response. In addition, recent reports describing the ability of peptide-bound
Hsp70 molecules to induce antitumor or antiviral immunity as well as development of memory CTLs support the notion that these proteins might function to convey a protective immune response by providing an antigen presentation function (Blachere, et al, (1997) J. Exp. Med. 186- 1315-1322; Ciupitu, et al., (1998) J. Exp. Med. 187:685-691). Applicants submit that endogenous Hsp70 (and associated peptides or proteins) is/are released into the environment by infected or apoptosing cells. These Hsp70 protein complexes would subsequently become available to neighboring cells which may be compromised in their immune capacity, and act as a stimulus to boost or strengthen the immune response.
Applicants have demonstrated the efficient cellular and nuclear uptake as well as long-term intracellular stability of exogenously supplied Hsp70 fusion proteins by a variety of cell types. This rapid and stable transport activity has important implications for the utility of Hsp70-derived peptides as a vehicle for delivering therapeutic agents to the cytoplasm and nucleus where they remain localized for long periods of time. As manipulation of the nuclear import process in particular becomes an increasingly more interesting target for regulated control of gene expression (Fujihara, et al., (1998) Biochem. Pharm. 56: 157-161), it is believed that future emphasis will be placed on developing more potent means of intracellular targeted delivery. The use of Hsp70 as a delivery system has a number of advantages over other previously described protein candidates, including the fact that the protein is of human origin and therefore does not contain foreign (i.e., viral or insect) and potentially immunogenic material. Use of soluble fragments of Hsp70 will potentially reduce immunogenicity further. As Hsp70 is a highly expressed abundant protein, it would likely be well-tolerated in humans, and in fact already plays an immune response role. In addition, the cell type-specificity we observed would allow the targeting of compounds to specific cells of the immune system for more effective regulatory control. And finally, the preferential and long-lived nuclear directed delivery of protein substrates may provide protection from cytoplasmic proteolysis. Our data support the potential use of Hsp70 sequences as a novel tool to deliver molecules that modulate gene expression and subsequently provide i munosuppressive or immunostimulatory control.
Applicants disclose in an embodiment of the present invention a fusion protein comprising a fragment of Hsp70 joined to amino acids 37-409 of the NF-κB p50 subunit (the fusion proteins are referred to herein as Hsp70-p50, Hsp70/28-p50, or Hsp70/10-p50). Although NF-κB p50 homodimers are commonly thought to act as NF-κB transcriptional repressors in most cell types due to the absence of a C-terminal activation domain, the downstream biological events Applicants observed did not reflect a dominant negative effect of the fusion protein on transcriptional activation. There are a number of possible explanations for the Hsp70-p50-induced transactivation observed. First, the heat shock protein sequence, specifically the EEVD domain, may itself contain transactivation activity. Hsp70 is known to bind heat shock factor in the nucleus and interfere with its transactivation activity via the EEVD domain. Since the Hsp70 sequence in the Examples below was cloned C- terminal to amino acids 37-409 of the NF-kB p50 sequence (SEQ ID NO: l), the EEVD domain is potentially available to provide transactivation, or even to interact with other cellular or nuclear cofactors. Closer analysis of the nuclear complex may yield clues as to other possible components with transcriptional activities. Second, p50 homodimers may simply exhibit transactivation activity in particular circumstances. Fujita, et al. ((1992) Genes Dev. 6:775-787) tested the various homo- and heterodimers of NF-κB subunits for transcriptional activation in vitro and determined that addition of p50 alone to some transcription mixtures resulted in significant transcriptional stimulation. They attribute this activation to differences in the fine structure of the nucleotide sequence within the KB motifs. Interestingly, this group observed a four-fold stimulation of transcription by p50 homodimers over control using the Igκ sequence motif. These data would correspond to the activation we observed in studies analyzing surface kappa Ig expression. Third, the Hsp70-p50 subunits may be recruiting other transactivating factors into the DNA binding complex that we have not yet detected.
Therefore, the present invention encompasses the use of Hsp70, or a fragment of Hsp70, to modulate cellular activity, preferably modulate nuclear activity in a cell or cells, for example the activity of transcription factors. The term "nuclear activity" encompasses the transcription of nucleic acid molecules in the cell. The term
"modulate" encompasses enhancement, diminishment, activation or inactivation of cellular activity. The Hsp70 protein or a fragment thereof may be used alone to modulate cellular activity by transfer into the cytoplasm and/or nucleus of a cell, to treat Hsp70-associated disorders. "Hsp70-associated disorders" refers to any disorder or disease state in which Hsp70 plays a regulatoiy role in the metabolic pathway of that disorder or disease. As used herein the term "treating" refers to the alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune response (such as transplant rejection). The term "patient" refers to a mammal, preferably a human. Additionally, the present invention encompasses the use of Hsp70, or a fragment of Hsp70, as a chaperone to carry one or more compounds into a cell. Hsp70 or a fragment thereof is joined to a compound to form a complex (herein referred to as an "Hsp70 complex" which includes the Hsp70, or fragment thereof, and any compound associated with or joined to the Hsp70 protein or fragment thereof). The Hsp70 complex is then provided to a cell or cells, or to the environment surrounding a cell or cells, so that the Hsp70 complex is transported into the cytoplasm and/or nucleus of the cell or cells. Compounds that may be joined to the Hsp70 protein or a fragment thereof include, but are not limited to, proteins, peptides, nucleic acids, and small molecules. "Nucleic acids" or "polynucleotides" includes individual nucleotides as well as DNA and RNA sequences or fragments thereof. Disease states which may be treated by Hsp70, fragments thereof, and/or Hsp70 complexes of the present invention include transplant rejection and autoimmune diseases, such as rheumatoid arthritis, multiple sclerosis, juvenile diabetes, asthma, and inflammatory bowel disease, as well as inflammatory diseases, cancer, viral replication diseases and vascular diseases.
For example, the Hsp70 complexes and pharmaceutical compositions of the present invention are useful in the treatment of transplant rejection (e.g., kidney, liver, heart, lung, pancreas (e.g., islet cells), bone marrow, cornea, small bowel and skin allografts, and heart valve xenografts) and autoimmune diseases, such as rheumatoid arthritis, multiple sclerosis, juvenile diabetes, asthma, inflammatory bowel disease (Crohn's disease, ulcerative colitus), lupus, diabetes, myasthenia gravis, psoriasis, dermatitis, eczema, seborrhoea, pulmonary inflammation, eye uveitis, hepatitis, Grave's disease, Hashimoto's thyroiditis, Behcet's or Sjorgen's syndrome (dry eyes/mouth), pernicious or immunohaemolytic anaemia, idiopathic adrenal insufficiency, polyglandular autoimmune syndrome, glomerulonephritis, scleroderma, lichen planus, viteligo (depigmentation of the skin), autoimmune thyroiditis, and alveolitis, inflammatory diseases such as osteoarthritis, acute pancreatitis, chronic pancreatitis, asthma and adult respiratory distress syndrome, as well as in the treatment of cancer and tumors, such as solid tumors, lymphomas and leukemia, vascular diseases such as restenosis, stenosis and artherosclerosis, and DNA and RNA viral replication diseases, such as retroviral diseases, and herpes. Also within the scope of the present invention are pharmaceutical compositions comprising at least one Hsp70 complex comprising a compound that is to be delivered to the cytoplasm and/or nucleus of a cell or cells. The Hsp70 complex may be administered alone or with at least one additional active compound, and any pharmaceutically acceptable earner, adjuvant or vehicle. "Additional active compounds" encompasses, but is not limited to, an agent or agents selected from the group consisting of an immunosuppressant, an anti-cancer agent, an anti-viral agent, an anti-inflammatory agent, an anti-fungal agent, an antibiotic, or an anti-vascular hyperproliferation compound. The term "pharmaceutically acceptable carrier, adjuvant or vehicle" refers to a carrier, adjuvant or vehicle that may be administered to a subject, together with an Hsp70 complex of the present invention, and which does not destroy the pharmacological activity thereof. Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions of the present invention include, but are not limited to, the following: ion exchangers, alumina, aluminum stearate, lecithin, self-emulsifying drug delivery systems ("SEDDS") such as dα- tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage forms such as Tweens or other similar polymeric delivery matrices, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Cyclodextrins such as α-, β- and γ-cyclodextrin, or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-hydroxypropyl-β- cyclodextrins, or other solubilized derivatives may also be used to enhance delivery of the compounds of the present invention.
The compositions of the present invention may contain other therapeutic agents as described below, and may be formulated, for example, by employing conventional solid or liquid vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, binders, preservatives, stabilizers, flavors, etc.) according to techniques such as those well known in the art of pharmaceutical formulation. Pharmaceutical compositions comprising at least one Hsp70 complex of the present invention may be administered by any suitable means, for example, orally, such as in the form of tablets, capsules, granules or powders; sublingually; buccally; parenterally, such as by subcutaneous, intravenous, intramuscular, or intrasternal injection or infusion techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions); nasally such as by inhalation spray; topically, such as in the form of a cream or ointment; or rectally such as in the form of suppositories; in dosage unit formulations containing non-toxic, pharmaceutically acceptable vehicles or diluents. The pharmaceutical compositions of the present invention may, for example, be administered in a form suitable for immediate release or extended release. Immediate release or extended release may be achieved by the use of suitable pharmaceutical compositions comprising the present compounds, or, particularly in the case of extended release, by the use of devices such as subcutaneous implants or osmotic pumps. The present Hsp70 complexes may also be administered liposomally. Exemplary compositions for oral administration include suspensions which may contain, for example, microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners or flavoring agents such as those known in the art; and immediate release tablets which may contain, for example, microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and/or lactose and/or other excipients, binders, extenders, dis integrants, diluents and lubricants such as those known in the art. The present compounds may also be delivered through the oral cavity by sublingual and/or buccal administration. Molded tablets, compressed tablets or freeze-dried tablets are exemplary forms which may be used. Exemplary compositions include those formulating the present Hsc70 complexes with fast dissolving diluents such as mannitol, lactose, sucrose and/or cyclodextrins. Also included in such formulations may be high molecular weight excipients such as celluloses (avicel) or polyethylene glycols (PEG). Such formulations may also include an excipient to aid mucosal adhesion such as hydroxy propyl cellulose (HPC), hydroxy propyl methyl cellulose (HPMC), sodium carboxy methyl cellulose (SCMC), maleic anhydride copolymer (e.g., Gantrez), and agents to control release such as polyacrylic copolymer (e.g.,
Carbopol 934). Lubricants, glidants, flavors, coloring agents and stabilizers may also be added for ease of fabrication and use.
Exemplary compositions for nasal aerosol or inhalation administration include solutions in saline which may contain, for example, benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, and/or other solubilizing or dispersing agents such as those known in the art.
Exemplary compositions for parenteral administration include injectable solutions or suspensions which may contain, for example, suitable non-toxic, parenterally acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution, an isotonic sodium chloride solution, or other suitable dispersing or wetting and suspending agents, including synthetic mono- or diglycerides, and fatty acids, including oleic acid. The term "parenteral" as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
Exemplary compositions for rectal administration include suppositories which may contain, for example, a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquify and/or dissolve in the rectal cavity to release the drug. Exemplary compositions for topical administration include a topical carrier such as Plastibase (mineral oil gelled with polyethylene). A "therapeutically effective" amount of an Hsp70 complex of the present invention may be determined by one of ordinary skill in the art, and includes exemplary dosage amounts for an adult human of from about 0.1 to 100 mg/kg of body weight of active compound per day, which may be administered in a single dose or in the form of individual divided doses, such as from 1 to 3 times per day. It will be understood that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition. Preferred subjects for treatment include animals, most preferably mammalian species such as humans.
By "therapeutically effective" is meant an amount necessary to achieve a desired result, for example, alleviation of symptoms of a particular disorder in a patient, the improvement of an ascertainable measurement associated with a particular disorder, or the prevention of a particular immune response. It will be understood that the specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition. Preferred subjects for treatment include animals, most preferably mammalian species such as humans.
The Hsp70 complexes of the present invention may be employed alone or in combination with each other and/or other suitable therapeutic agents, such as antiinflammatories, antiproliferatives, chemotherapeutic agents, and immunosuppres s ants .
The following examples are meant to be illustrative of an embodiment of the present invention and do not limit the scope of the invention in any way. All references cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Manufacture of Recombinant Hsp70 The following method was used to make recombinant Hsp70: Hsp70 fusion proteins were generated by PCR amplification of human Hsp70 DNA sequences using primers corresponding to the published sequence and including restriction endonuclease sites to enable directed cloning into a prokaryotic expression vector, ProExHta (Life Technologies, Inc.). NF-kB p50 sequences were generated in the same way, using primers corresponding to the published p50 sequence and cloned upstream of (5' to) Hsp70 sequences in the same expression vector. The cloning vector included a 6x His tag for use in purification of expressed protein over a metal column. DNA was transformed into a bacterial host and protein expression was induced using IPTG. Soluble, expressed fusion protein was purified using conventional affinity purification techniques and subsequently used for the following experiments.
Example 1 Hsp70-mediated Transport is Cell-Type Specific
To investigate the intracellular localization of exogenously added Hsp70, we fluorescently labeled the full-length Hsp70 protein and tested its ability to become internalized by various cell types. Cells were treated with a final concentration of 10 μg/ml Hsp70-FITC (or BSA-FITC as a control) for 1 hour, then washed and fixed prior to confocal laser scanning microscopy. The bulk of the intracellular Hsp70-
FITC localized uniformly to the nucleus and cytoplasm in murine pre-B 70Z/3 cells, whereas import of BSA-FITC was negligible (Figure 1A and IB). We also observed significant uptake of Hsp70-FITC by human peripheral blood monocytes, but not T cells (Figures 1C-1F). Interestingly, while the staining pattern in peripheral blood monocytes was often uniform throughout the cytoplasm and nucleus, we noted that it was sometimes characterized by punctuate staining, implying vesicular localization within the cytoplasm. Applicants found that the specific staining pattern of the PBLs varied by donor, suggesting that the state of cell activation may play a role in uptake efficiency or intracellular localization of exogenous Hsp70. Consistent with this hypothesis, we found that while resting peripheral blood B cells were resistant to uptake, they could be induced to transport the protein after 48 hours of activation in vitro with anti-CD40 plus anti-Ig antibodies. This method of B cell activation is known to result in the expression of various differentiation and proliferation associated genes. In contrast, activation of peripheral blood T cells by anti-CD3 and anti-CD28 antibodies did not affect Hsp70 transport. No intracellular uptake was observed by Jurkat T cell line or HeLa fibroblast cell line, but we did observe efficient uptake by two mature B cell lines, RAJI and BJAB. In addition, we saw limited cytoplasmic uptake by two monocytic cell lines, THP-1 and U937, but only after extended (6 to 24 hours) incubation with high concentrations ( 100 ug/ml) of Hsp70-FITC. The B cell- and monocyte-specific Hsp70 transport activity we describe is consistent with reports which propose a role for Hsp70 heat shock family members in antigen presentation (Manara, et al, (1993) Blood 82:2865-2871; Vanbuskirk, et al, (1989) J. Exp. Med. 170: 1799-1809) as these cells are generally considered to function as antigen presenting cells. The cell type specificity and inducibility of cellular Hsp70 uptake may reflect differential expression of a required surface or nuclear receptor for the Hsp70 protein. Studies are now in progress to investigate the surface proteins which may be involved in the binding and interaalization of extracellular Hsp70.
Example 2 Kinetics of Hsp70 Cellular Uptake
We next investigated the time-course and dose effect of Hsp70 uptake by 70Z/3 cells. 5x105 cells were incubated at 37°C with 1 μg/ml Hsp70-FITC for increasing periods of time from 10 minutes to 48 hours. After unincorporated Hsp70- FITC was washed away with PBS, intracellular and cell-associated fluorescence was quantified by fluorimeter analysis. From these studies we determined that the internalization process appears to be slow, since maximal internalization is not achieved until between 6-8 hours (Figure 2A), after which time the rate of uptake appears to drop slightly and remain constant for up to 2 days of incubation.
For the dose range study we chose a one-hour incubation time and treated cells with varying amounts of Hsp70-FITC. Our analysis showed that the intensity of intracellular fluorescence increased with increasing concentrations of extracellular Hsp70, up to 100 μg/ml (1.4 μM), and was detectable even when cells were treated with levels as low as 0.1 μg/ml (1.4 nM, Figure 2B). We determined that treatment of cells with an extracellular concentration of 1 μM Hsp70-FITC resulted after one hour of incubation in an intracellular concentration of 700 nM, assuming a volume of 1 pl/cell. This uptake efficiency is comparable to that reported for other peptide sequences (Phelan, et al., (1998) Nature Biotechnology' 16:440-443). The uptake of Hsp70-FITC was not saturable in the concentration range we used (35 nM-1 μM), indicative of a high capacity receptor-mediated uptake mechanism. In addition, internalization could not be blocked by preincubation with a 10-fold excess of unlabeled Hsp70. Example 3 Mechanism of Hsp70-Mediated Intracellular Transport
To investigate the mechanism of transport, we examined the import of Hsp70 under various conditions. Although full-length Hsp70 protein was transported by PBLs in the presence of 0.05% sodium azide, this transport activity was completely eradicated when cells were incubated at 4°C (Figure 3A-3D), suggesting that there is an energy-dependent component to the Hsp70-mediated transport. These data coupled with co-internalization studies using transferrin, which revealed that accumulation of transferrin and Hsp70 occurred in separate intracellular compartments in both 70Z/3 cells (Figure 3E) and in human PBLs, suggested that this mechanism does not involve classical endocytosis.
Example 4 An Exogenous NF-κB-C terminal Hsp70 Fusion Protein Can Be Directed to the Nucleus
Two different fusion proteins composed of either a 244 (SEQ LD NO: 2) or a 92 (SEQ ID NO:3) amino acid Hsp70 C-terminal polypeptide fused to the p50 subunit of the transcription factor NF-κB were generated to examine the ability of the Hsp70 peptide sequence to direct other protein substrates into the cell. The 244 amino acid polypeptide has the following sequence:
PLSLGLETAG GVMTALIKRN STIPTKQTQI FTTYSDNQPG VLIQVYEGER AMTKDNNLLG RFELSGIPPA PRGVPQIEVT FDIDANGILN VTATDKSTGK ANKITITNDK GRLSKEEIER MVQEAEKYKA EDEVQRERVS AKNALESYAF NMKSAVEDEG LKGKISEAD KKVLDKCQEV IS LDANTLA EKDEFEHKRK ELEQVCNPII SGLYQGAGGP GPGGFGAQGP KGGSGSGPTI EEVD
The 92 amino acid polypeptide has the following sequence:
KSAVEDEGLK GKISEADKKK VLDKCQEVIS LDANTLAEK DEFEHKRKEL EQVCNPIISG LYQGAGGPGP GGFGAQGPKG GSGSGPTIEE VD
When added exogenously to cells, both FITC-conjugated fusion proteins entered the cytoplasm and nuclei of 70Z/3 cells (Figure 4) and PBLs (data not shown) with kinetics and specificity similar to the Hsp70 peptide alone. This transport was stable, nonsaturable and occurred without significant protein degradation. Maximal uptake of FITC-Hsp70 remained stable after a 30 minute pulse for 24 hours after washout of unincorporated protein and incubation at 37°C, as determined by confocal microscopy and SDS-PAGE analysis. To assess protein stability, cells were pulsed with either 10 μg/ml FITC-conjugated full-length Hsp70 or Hsp70/28-p50 for 1 hour prior to washing and a chase at 37°C for up to 96 hours. Whole cell extracts were generated by lysis in Laemmli sample buffer, and proteins were separated by SDS- PAGE. Gels were subjected to analysis by fluorimager, and results showed the presence of both the ~75 kD fusion protein as well as full-length Hsp70 itself (distinguishable from endogenous Hsp70 by its fluorescent tag) in whole cell extracts after up to 24 hours of incubation without measurable change in size or appearance of smaller molecular weight degradation products (Figure 5). These data suggest that intracellular targeted Hsp70 was retained by the cell without significant degradation with a half-life of greater than 48 hours.
Example 5 Transported NF-κB p50 Exhibits DNA-Binding Activity
To address whether the internalized fusion proteins retained functional activity, we tested nuclear extracts of Hsp70-p50 fusion protein-treated cells for their ability to bind a specific kappa DNA sequence. We could show that purified fusion proteins were able to bind kappa DNA (data not shown), suggesting that the p50 subunits were not conformationally impaired by the presence of the Hsp70 sequences. After 70Z/3 cells were treated with 100 ng/ml LPS, 10 μg/ml Hsp70/10-p50 or Hsp70/28-p50 for 1 hour, nuclear extracts were prepared and gel shift assays were performed. We found that DNA binding activity was retained by the fusion protein after nuclear uptake by cells, indicating that the import process did not result in significant degradation or loss of activity (Figure 6A). This DNA binding activity was specific, as the complex was competed with an excess of unlabeled NF-κB sequence but not with octamer sequence (Figure 6A). We saw distinct complexes formed by nuclear extracts from cells treated with different fusion proteins; furthermore, they differed from the complex formed by LPS -induced endogenous NF-κB. In supershift experiments we observed that anti-p50 antibodies were able to shift nearly the entire DNA-binding complex from fusion protein-treated cells, as expected, confirming that the fusion protein was likely binding to DNA mainly as a homodimer (Figure 6B). We also observed a detectable decrease in the specific complex upon incubation with both anti-p65 and anti-Hsp70 (directed against the carboxy-terminal four amino acids EEVD) antibodies, indicating the presence of endogenous p65 subunits in addition to recombinant Hsp70-p50 subunits. In contrast, nuclear extracts from control LPS-treated cells formed a complex containing both p50 and p65 subunits, and the supershifted patterns differed from the cells treated with the fusion protein. These data indicate that distinct protein/DNA complexes were formed and suggest that the fusion proteins were binding DNA directly and not simply activating endogenous NF-κB.
Example 6 Hsp70-p50 Fusion Protein Activates Surface kappa Ig Expression and TNFα
Production
Since treatment of cells with Hsp70-p50 fusion proteins could potentially result in the formation of complexes which interact with NF-κB DNA binding sites in cells, we decided to evaluate downstream biological events in the NF-κB pathway. We observed that treatment of various cells with the Hsp70-p50 fusion proteins resulted in activation of several inflammatory and immunological responses normally regulated by NF-κB. Treatment of mouse 70Z/3 pre-B cells with Hsp70/10-p50 fusion protein was shown to be as effective as LPS in inducing high levels of kappa Ig light chain on the surface (Figure 7A). In addition, in contrast to LPS-induced activation, the fusion protein-induced surface kappa expression was abolished by 30 minutes of 65°C heat denaturation of the protein prior to treatment of cells, confirming that intact protein was required for the activation. Similar results were obtained with Hsp70/28-p50 (data not shown). TNFα production is another example of an inflammatory response also largely regulated by NF-κB. We observed that the internalized fusion protein was also able to induce TNFα production by human peripheral blood lymphocytes (Figure 7B). Freshly isolated PBLs were incubated with LPS or Hsp70-p50 for 6 hours, after which time supernatants were collected and tested for cytokine levels by ELISA. Again, we found the fusion proteins to be as effective as LPS in inducing TNFα production, and established that intact protein was responsible for activation by showing that heat denaturation of the fusion protein abolished the effect.
The following experimental procedures were used in the above examples: Expression and purification of the Hsp70-p50 fusion proteins. Two p50 fusion proteins were constructed using the nucleotide sequence corresponding to amino acids 1-406 of the NF-κB pi 05 subunit protein. This sequence includes the DNA binding domain as well as the rel homology domain. The two fusion proteins varied in the length of Hsp70 fragment used. The two Hsp70 sequences were both derived from the C-terminus, including either the terminal 276 or 735 nucleotides, which correspond to a 10 kD (the 92 amino acid polypeptide discussed above) and a 28 kD (the 244 amino acid polypeptide discussed above) protein fragment. Either the 10 kD or the 28 kD Hsp70 protein was fused C-terminal to the p50 protein, and the resulting fusion proteins were denoted Hsp70/10-p50 or Hsp70/28-p50, respectively. The prokaryotic expression vector ProEX HT (Life Technologies, Gaithersburg, MD) was used for cloning, expression and purification, as per the manufacturer's recommendations . Confocal laser scanning microscopy. Cells were typically treated with 10 μg/ml FITC-conjugated proteins or as indicated in the text for one hour at 37°C followed by a ash in PBS, fixation in 2% paraformaldehyde, an additional wash in PBS and subsequent visual analysis by confocal microscopy (Bio-Rad, Hercules, CA) using Molecular Dynamics LaserSharp software and Adobe Photoshop. Western blot analysis of imported Hsp70-p50 fusion proteins. Cells were treated with FITC-conjugated proteins for one hour at 37°C, washed in PBS and used for preparation of nuclear extracts. Equal protein amounts were separated by SDS- PAGE. The gel was fixed in acetic acid and subject to fluorescence analysis by fluorimager and ImageQuant software. Electrophoretic mobility shift assay. Nuclear extracts from 70Z/3 cells were prepared using a modification of established protocols (Tepper, et al., (1995) J. Immunol. 155:2427-2436). Protein concentrations were determined using the Bradford assay, and NF-κB
(5'GATCCGAGGGGACTTTCCGCTGGGGACTTTCCAGG3' (SEQ ID NO:4)) or octamer (5'TGTCGAATGCAAATCACTAGAA3' (SEQ ID NO: 5)) oligonucleotides (Promega, Madison, WI) were end labeled with [γ-32P]ATP and T4 kinase. The conditions for binding reactions with oligonucleotide probes were as previously described. Supershift assays were performed with NF-κB p50, p65 and c-Rel polyclonal antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) and Hsp70 antibody by preincubating the nuclear extracts with 3 ul of the antibody in the reaction buffer for 30 minutes and continuing with the gel retardation assay according to standard procedures. Competition experiments were performed using unlabeled NF-κB and octamer oligonucleotides. Samples were analyzed on native 6% polyacrylamide gels and autoradiographed.
Iπununo fluorescence assay (FACS). 70Z/3 cells were treated with either 30 μg/ml Hsp70/10-p50 fusion protein or 100 ng/ml LPS and incubated overnight at 37°C. Cells were then washed in PBS and fixed in 2% paraformaldehyde prior to staining with FITC-conjugated anti-kappa antibody. After an additional PBS wash, cells were subjected to imaging and analysis on the FACSTAR.
TNFα assay. Human peripheral blood lymphocytes were isolated as previously described and treated with 40 μg/ml Hsp70 fusion protein or LPS for 6 hours. Supernatants were collected and analyzed for TNFα by ELISA (Genzyme, Cambridge, MA).
Although the present invention has been described in some detail by way of illustration and example for puiposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

We claim:
1. A method for delivering a compound into a cell or cells, said method comprising associating said compound with Hsp70, or a fragment of Hsp70, to form an
Hsp70 complex, and providing said Hsp70 complex to said cell or to the environment surrounding said cell so that said Hsp70 complex is imported into said cell or cells.
2. The method of claim 1 wherein said compound is delivered into the nucleus of said cell or cells.
3. The method of claim 1 wherein said Hsp70 complex comprises a compound selected from the group consisting of a protein, a peptide, a nucleotide, a polynucleotide, and a small molecule.
4. The method of claim 3 wherein said polynucleotide comprises the p50 subunit of the transcription factor NF-κB.
5. A method of delivering a polynucleotide to the nuclear compartment of a cell or cells, said method comprising joining said polynucleotide with Hsp70, or a fragment of Hsc70, to form an Hsp70 complex, and providing said complex to said cell or cells so that said complex is transported into the nuclear compartment of said cell or cells.
6. The method of claim 5 wherein said fragment of Hsp70 comprises an amino acid sequence as shown in SEQ ID NO:2.
7. The method of claim 5 wherein said fragment of Hsp70 comprises an amino acid sequence as shown in SEQ ID NO: 3.
8. The method of claim 5, 6 or 7 wherein said polynucleotide comprises the p50 subunit of the transcription factor NF-κB.
9. A pharmaceutical composition comprising an Hsp70 complex, said Hsp70 complex comprising a first portion and a second portion, said first portion comprising Hsp70 protein, or a fragment thereof; and said second portion comprising a compound capable of modulating the activity of a cell or cells.
10. The pharmaceutical composition of claim 9 wherein said Hsp70 complex comprises a compound selected from the group consisting of a protein, a peptide, a nucleotide, a polynucleotide, and a small molecule.
11. The pharmaceutical composition of claim 10 wherein said polynucleotide comprises the p50 subunit of the transcription factor NF-κB.
12. A method of modulating nuclear activity of a cell or cells comprising administering to a cell or cells Hsp70 protein or a fragment thereof, so that said Hsp70 protein or fragment thereof is capable of translocating to the nuclear compartment of said cell or cells.
13. A method of treating a disease in a patient comprising administering to said patient a therapeutically effective amount of a pharmaceutical composition according to claims 9, 10 or 11.
PCT/US1999/027244 1998-11-24 1999-11-17 INTRACELLULAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN WO2000031113A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP2000583940A JP4892132B2 (en) 1998-11-24 1999-11-17 Intracellular targeted transport of compounds by 70 kD heat shock protein
CA2352286A CA2352286C (en) 1998-11-24 1999-11-17 Intracellular targeted delivery of compounds by 70 kd heat shock protein
DK99960422T DK1133517T3 (en) 1998-11-24 1999-11-17 Intranuclear targeted transport of compounds using 70 kd heat shock protein
EP99960422A EP1133517B1 (en) 1998-11-24 1999-11-17 INTRANUCLEAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN
DE69941156T DE69941156D1 (en) 1998-11-24 1999-11-17 INTRANUCLEAR, TRANSPORT OF CONNECTIONS THROUGH THE 70KD HEAT SHOCK PROTEIN
AU17314/00A AU760081B2 (en) 1998-11-24 1999-11-17 Intracellular targeted delivery of compounds by 70 kD heat shock protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10987298P 1998-11-24 1998-11-24
US60/109,872 1998-11-24

Publications (1)

Publication Number Publication Date
WO2000031113A1 true WO2000031113A1 (en) 2000-06-02

Family

ID=22330008

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/027244 WO2000031113A1 (en) 1998-11-24 1999-11-17 INTRACELLULAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN

Country Status (10)

Country Link
EP (1) EP1133517B1 (en)
JP (1) JP4892132B2 (en)
AU (1) AU760081B2 (en)
CA (1) CA2352286C (en)
CY (1) CY1110350T1 (en)
DE (1) DE69941156D1 (en)
DK (1) DK1133517T3 (en)
ES (1) ES2327986T3 (en)
PT (1) PT1133517E (en)
WO (1) WO2000031113A1 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002022656A2 (en) * 2000-09-13 2002-03-21 Gabriele Multhoff An hsp70 peptide stimulating natural killer (nk) cell activity and uses thereof
WO2003082346A1 (en) * 2002-04-02 2003-10-09 'asgl-Farmatsevticheskie Innovatsii', Zakrytoe Aktsionernoe Obschestvo Recombinant chimeric protein for the target delivery of dna to eukariotic target cells
WO2006020743A2 (en) * 2004-08-13 2006-02-23 General Electric Company Heat shock protein as a targeting agent for endothelium-specific in vivo transduction
WO2009036349A1 (en) * 2007-09-12 2009-03-19 Anaphore, Inc. Hsp70-based treatment for autoimmune diseases
US8071533B2 (en) 2006-03-20 2011-12-06 University Of Medicine And Dentistry Of New Jersey Compositions and methods for modulating store-operated calcium entry
WO2013070529A1 (en) 2011-11-09 2013-05-16 Trustees Of Dartmouth College Compositions and methods for inhibiting the interaction between cftr and cal
WO2016156536A1 (en) 2015-03-31 2016-10-06 Universite Pierre Et Marie Curie (Paris 6) Pro-apoptotic set and pp2a peptides
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11097015B2 (en) 2018-10-10 2021-08-24 Amicus Therapeutics, Inc. Disulfide bond stabilized polypeptide compositions and methods of use
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2643468T3 (en) * 2010-11-22 2018-11-30 Amicus Therapeutics, Inc. Novel signal sequences to improve protein expressions and secretion of recombinant enzymes and other proteins

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH08510756A (en) * 1993-06-04 1996-11-12 ホワイトヘッド インスティチュート フォー バイオメディカル リサーチ Stress proteins and their use
ATE318899T1 (en) * 1996-11-26 2006-03-15 Stressgen Biotechnologies Corp FUSION PROTEINS INCLUDING STRESS PROTEINS FOR PRODUCING AN IMMUNE RESPONSE

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
DANG ET AL: "Nuclear and nucleolar targeting sequences of c-erb-A, c-myh, N-myc, p53, HSP70 and HIV tat proteins", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 264, no. 30, 25 October 1989 (1989-10-25), pages 18019 - 18023, XP002923303 *
ELLIOTT, CELL, vol. 88, 1997, pages 223 - 233
FAWELL, PROC. NATL. ACAD. SCI., vol. 91, 1994, pages 664 - 668
FIX J.A.: "Oral controlled release technology for peptides: status and future prospects", PHARMACEUTICAL RESEARCH, vol. 13, no. 12, 1996, pages 1760 - 1764, XP002923307 *
HAWIGER, CURR. OPIN. IMMUN., vol. 9, 1997, pages 189 - 194
JOHNSON ET AL: "Exogenous HSP70 becomes cell associated, but not internalized by stressed arterial smooth muscle cells", IN VITRO CELLULAR AND DEVELOPMENTAL BIOLOGY, vol. 29A, October 1993 (1993-10-01), pages 807 - 812, XP002923306 *
LECLAIR ET AL: "The p50 subunit of NF-kB associates with the NF-IL6 transcription factor", PROC. NATL. ACAD. SCI. USA,, vol. 89, September 1992 (1992-09-01), pages 8145 - 8149, XP002923305 *
MARGULIS ET AL: "Liposomal delivery of purified heat shock protein hsp70 into rat pancreatic islets as protection against interleukin 1beta-induced impaired beta-cell function", DIABETES, vol. 40, November 1991 (1991-11-01), pages 1418 - 1422, XP002923302 *
MILNER, C.M.; CAMPBELL, R.D., IMMUNOGENETICS, vol. 32, 1990, pages 242 - 251
PERKINS ET AL: "Distinct combination of NF-kB subunits determine the specificity of transcriptional activation", PROC. NATL. ACAD. SCI. USA,, vol. 89, March 1992 (1992-03-01), pages 1529 - 1533, XP002923304 *
PHELAN, NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 440 - 443
POOGA, FASEB J., vol. 12, 1998, pages 67 - 77
ROJAS, NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 370 - 375
ROMAN, IMMUNOLOGY, vol. 88, 1996, pages 487 - 492
See also references of EP1133517A4
SUZUE, J. IMMUNOL., vol. 156, 1996, pages 873 - 879
TAKAKURA ET AL: "Macromolecular carrier systems for targeted drug delivery: pharmacokinetic consideration on biodistribution", PHARMACEUTICAL RESEARCH, vol. 13, no. 6, 1996, pages 820 - 831, XP002923301 *
VIVES, J. BIOL. CHEM., vol. 272, 1997, pages 16010 - 16017

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002022656A3 (en) * 2000-09-13 2002-09-26 Gabriele Multhoff An hsp70 peptide stimulating natural killer (nk) cell activity and uses thereof
US7517948B2 (en) 2000-09-13 2009-04-14 Multimmune Gmbh Hsp70 peptide stimulating natural killer (NK) cell activity and uses thereof
WO2002022656A2 (en) * 2000-09-13 2002-03-21 Gabriele Multhoff An hsp70 peptide stimulating natural killer (nk) cell activity and uses thereof
WO2003082346A1 (en) * 2002-04-02 2003-10-09 'asgl-Farmatsevticheskie Innovatsii', Zakrytoe Aktsionernoe Obschestvo Recombinant chimeric protein for the target delivery of dna to eukariotic target cells
WO2006020743A2 (en) * 2004-08-13 2006-02-23 General Electric Company Heat shock protein as a targeting agent for endothelium-specific in vivo transduction
WO2006020743A3 (en) * 2004-08-13 2006-07-20 Gen Electric Heat shock protein as a targeting agent for endothelium-specific in vivo transduction
US8071533B2 (en) 2006-03-20 2011-12-06 University Of Medicine And Dentistry Of New Jersey Compositions and methods for modulating store-operated calcium entry
WO2009036349A1 (en) * 2007-09-12 2009-03-19 Anaphore, Inc. Hsp70-based treatment for autoimmune diseases
US10745467B2 (en) 2010-03-26 2020-08-18 The Trustees Of Dartmouth College VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders
US10781254B2 (en) 2010-03-26 2020-09-22 The Trustees Of Dartmouth College VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof
WO2013070529A1 (en) 2011-11-09 2013-05-16 Trustees Of Dartmouth College Compositions and methods for inhibiting the interaction between cftr and cal
US10933115B2 (en) 2012-06-22 2021-03-02 The Trustees Of Dartmouth College VISTA antagonist and methods of use
US11180557B2 (en) 2012-06-22 2021-11-23 King's College London Vista modulators for diagnosis and treatment of cancer
US11752189B2 (en) 2012-06-22 2023-09-12 The Trustees Of Dartmouth College Vista antagonist and methods of use
US11529416B2 (en) 2012-09-07 2022-12-20 Kings College London Vista modulators for diagnosis and treatment of cancer
US11242392B2 (en) 2013-12-24 2022-02-08 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments
US11014987B2 (en) 2013-12-24 2021-05-25 Janssen Pharmaceutics Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11123426B2 (en) 2014-06-11 2021-09-21 The Trustees Of Dartmouth College Use of vista agonists and antagonists to suppress or enhance humoral immunity
US10370455B2 (en) 2014-12-05 2019-08-06 Immunext, Inc. Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists
WO2016156536A1 (en) 2015-03-31 2016-10-06 Universite Pierre Et Marie Curie (Paris 6) Pro-apoptotic set and pp2a peptides
US11009509B2 (en) 2015-06-24 2021-05-18 Janssen Pharmaceutica Nv Anti-VISTA antibodies and fragments
US10899836B2 (en) 2016-02-12 2021-01-26 Janssen Pharmaceutica Nv Method of identifying anti-VISTA antibodies
US11987630B2 (en) 2016-02-12 2024-05-21 Janssen Pharmaceutica Nv Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
US11525000B2 (en) 2016-04-15 2022-12-13 Immunext, Inc. Anti-human VISTA antibodies and use thereof
US11603402B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11603403B2 (en) 2016-04-15 2023-03-14 Immunext, Inc. Anti-human vista antibodies and use thereof
US11649283B2 (en) 2016-04-15 2023-05-16 Immunext, Inc. Anti-human vista antibodies and use thereof
US11097015B2 (en) 2018-10-10 2021-08-24 Amicus Therapeutics, Inc. Disulfide bond stabilized polypeptide compositions and methods of use

Also Published As

Publication number Publication date
DK1133517T3 (en) 2009-11-23
ES2327986T3 (en) 2009-11-05
EP1133517A4 (en) 2003-01-08
DE69941156D1 (en) 2009-09-03
EP1133517A1 (en) 2001-09-19
CA2352286A1 (en) 2000-06-02
EP1133517B1 (en) 2009-07-22
AU1731400A (en) 2000-06-13
JP4892132B2 (en) 2012-03-07
AU760081B2 (en) 2003-05-08
CA2352286C (en) 2011-07-12
PT1133517E (en) 2009-08-12
CY1110350T1 (en) 2015-04-29
JP2002530426A (en) 2002-09-17

Similar Documents

Publication Publication Date Title
EP1133517B1 (en) INTRANUCLEAR TARGETED DELIVERY OF COMPOUNDS BY 70 kD HEAT SHOCK PROTEIN
Zou et al. Progress in research and application of HIV-1 TAT-derived cell-penetrating peptide
Fischer et al. Cellular delivery of impermeable effector molecules in the form of conjugates with peptides capable of mediating membrane translocation
US7514530B2 (en) Peptide carrier for delivering siRNA into mammalian cells
US10131888B2 (en) Intracellular protein delivery
KR20030025901A (en) Cell permeable peptides for inhibition of inflammatory reactions and methods of use
JPH03200800A (en) Novel protein-polycation composite
JPH05506991A (en) Novel protein-polycation conjugate
US10206976B2 (en) Protein particles comprising disulfide crosslinkers and uses related thereto
JPH11505805A (en) Compositions containing nucleic acids and ligands for therapeutic treatment
JPH09510352A (en) Heparin-binding growth factor for gene therapy and anterior eye disease
US20210169920A1 (en) Compositions and methods of modulating hif-2a to improve muscle generation and repair
CA3040645A1 (en) Peptide-based non-proteinaceous cargo delivery
US6730302B1 (en) Intracellular targeted delivery of compounds by 70 kD heat shock protein
JP2020072716A (en) Novel cell-penetrating compositions and methods using the same
TW201514200A (en) Artificial transcription factors for the treatment of diseases caused by OPA1 haploinsufficiency
JP2013071904A (en) Peptide having anti-influenza virus activity
JP6758022B2 (en) Vascular endothelial cell growth factor receptor inhibitor peptide
Beerens Intercellular spread of the transgene product to improve the efficiency of cancer gene therapy
TW201441249A (en) Artificial transcription factors and their use for the treatment of maladapted wound healing in the eye

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: AU

Ref document number: 2000 17314

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 583940

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref document number: 2352286

Country of ref document: CA

Ref country code: CA

Ref document number: 2352286

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 17314/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1999960422

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999960422

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 17314/00

Country of ref document: AU