WO2000029568A1

WO2000029568A1 - Hybridization probe

Info

Publication number: WO2000029568A1
Application number: PCT/JP1999/004520
Authority: WO
Inventors: Tomoyasu Sugiyama; Toshio Ota; Shizuko Ishii; Ai Wakamatsu
Original assignee: Helix Research Institute
Priority date: 1998-11-13
Filing date: 1999-08-23
Publication date: 2000-05-25
Also published as: AU5304499A

Abstract

By using as a spacer nucleotide a nucleotide having an affinity with a base pair bond weaker than that of a/c or g/c, hybridization caused by a base sequence which has been added for labeling can be effectively inhibited.

Description

Technical field

The present invention relates to a labeled DNA and a method for detecting a gene using the labeled DNA.

Labeled DNA is used in a wide range of analysis methods based on the specific binding between DNAs with complementary base sequences. The following methods are known for labeling DNA.

(1) Introduce radioisotope-labeled phosphate to the 5, 5 end of synthetic DNA using T4 polynucleotide kinase

(2) Labeling by direct addition of biotin-digoxigenin, etc. to the end of oligo DNA by chemical method, or

(3) A labeling nucleotide is added to the synthesized oligo MA later using Yuichi Minar Transferase, etc.

However, among these methods, it was difficult to produce a probe with high specific activity in (1) and (2). In these methods, only one labeling molecule per DNA molecule can be introduced because it is based on terminal binding. Therefore, high specific activity is not desirable.

On the other hand, the method of (3), also called the terminal tailing labeling method, is a reaction that links multiple nucleotides. A large number of labeled nucleotides and nucleotide derivatives (hereinafter sometimes referred to as “nucleotides” as a term meaning both at the same time) can be introduced, and high specific activity can be achieved. In this method, steric hindrance of the nucleotide derivative to be introduced becomes a problem, and it becomes difficult to introduce a plurality of nucleotide derivatives. The steric hindrance is steric hindrance such as dexadenylic acid (dAMP), deoxycytidylic acid (dCMP), deoxyguanylic acid (dGMP), thymidylate (dTMP), or dexidyridylate (dUMP) nucleotides as spacers. The problem can be solved by mixing nucleotides without. However, on the other hand, due to the introduced nucleotides, the reaction product as a whole has a different nucleotide sequence from the original DNA. As a result, there is a problem that hybridization occurs due to the nucleotide sequence of the added nucleotides. One of the base sequences that produce such a hybridization is a continuous sequence of only one type of base represented by the poly A tail of cDNA. If the signal / noise ratio (hereinafter referred to as the S / N ratio) decreases due to hybridization due to the nucleotide sequence of nucleotides newly added for labeling, even if the specific activity of the probe is low. Even if it is high, it does not lead to an increase in sensitivity.

To suppress hybridization independent of MA to be labeled due to the base sequence added for labeling, use deoxyadenylic acid (dAMP), deoxycytidylic acid (dCMP), or deoxyguanylic acid (dGMP). Thymidylic acid (dTMP) or dexperidylic acid (dUMP), a single or randomly polymerized polynucleic acid, used as a carrier during hybridization, and a base sequence that causes an increase in signal background Had to be masked. However, even with such a method, it has been difficult to completely remove the hybridization caused by the nucleotide sequence added for labeling.

Now, in gene expression profiling using the current array technology, the immobilized cDNA oligo DNA is labeled with the cDNA of the RNA to be examined and hybridized (reverse northern blotting) ( Science (1999) 283,83-87; Nat Biotechnol (1996) 14, 1675-80). Unlike normal Northern labeling, the target nucleotide sequence is labeled instead of the probe because current labeling methods have difficulty achieving the sensitivity required for such analysis methods. This method works It is excellent in that it can analyze genes. However, in order to examine the variation in expression by comparing signals between different arrays, it is required that the arrays used for the comparison be exactly the same. However, in reality, it is not easy to guarantee uniformity among multiple arrays. Therefore, if two or more RNAs are compared using different arrays, it is necessary to correct the differences between the arrays. Therefore, when there are two types of RNA to be examined, expression changes are usually observed by labeling each with a different fluorescence and observing competitive hybridization on one array. If a probe capable of realizing sufficient sensitivity is provided, the same principle as that of ordinary Northern hybridization can be used, that is, the labeled probe can react with the immobilized target base sequence. If such a method were realized, it would be possible to analyze the expression status of multiple genes based on a single array, which would greatly increase the potential of array technology.

By the way, it is known that the use of inosinic acid as a substrate in a nucleic acid amplification reaction prevents formation of a secondary structure of an amplification product. The formation of a secondary structure is said to lead to a decrease in resolution in, for example, gel electrophoresis, and thus, the use of inosinic acid can be expected to result in an increase in sensitivity. This principle is used in MA synthesis PCR (Proc. Natl. Acad. Sci. USA., 76, 2232-2235) and an RNA synthesis system (JP-A-6-165699). In addition, it has been reported that PCR using 7-deza-2, -deoxyguanosine-5, -triphosphate (c7dGTP) can also suppress the formation of complex secondary structures (W090 / 03443). However, all of these reports are aimed at preventing the formation of secondary structures in nucleic acid amplification products, and do not suggest the prevention of non-specific base pairing in hybridization assays. Absent. In terms of structure, these methods differ from the present invention in that a part of the base sequence of the target nucleic acid is converted to inosine. Disclosure of the invention

An object of the present invention is to provide a labeled DNA that satisfies the two conditions of high specific activity and high specificity.

The present inventors believe that one of the causes of impairing the specificity of the hybridization of DNA labeled with 3, terminal tailing is a nucleotide sequence composed of nucleotides and nucleotides added for labeling. I noticed that As long as its constituent bases are a, c, t, g, or u, the base sequence added for labeling causes hybridization to nucleic acids having base sequences complementary to those base sequences. I will. Therefore, it was conceived that the specificity could be improved by making the nucleotides or nucleotides added for labeling have low affinity for base pairing. Furthermore, the present invention has been completed by selecting nucleotide dinucleotides that can serve as a substrate for terminal transferase, in order to enable a 3′-terminal tailing labeling method that gives a probe with high specific activity. That is, the present invention relates to the following labeled DNA, and a method for producing the labeled DNA and its use.

(1) A hybridization probe obtained by adding a nucleotide sequence containing a labeled nucleotide or nucleotide derivative to DNA to be labeled, wherein the added nucleotide sequence has the following characteristics a) and b) Hybridization probe.

a) Nucleotide and / or nucleotide derivatives whose base pairing affinity with bases constituting the target base sequence is weaker than hydrogen bonding between a / t, a / u and g / c

b) Can be introduced into labeled MA by nucleotide addition reaction with terminal transferase

(2) The hybridization probe according to (1), wherein the nucleotide of a) is inosinic acid.

(3) the base sequence to be added is labeled nucleotide or nucleotide derivative, The hybridization probe according to (2), which is composed of unlabeled inosinic acid or a derivative thereof.

(4) The hybridization probe according to (3), wherein the labeled nucleotide or nucleotide derivative is labeled inosinic acid or an inosinic acid derivative.

(5) Under stringent hybridization conditions for the DNA to be labeled, the nucleotide sequence added for labeling may hybridize with any nucleotide sequence alone. Can not do

The hybridization probe according to (1).

(6) A method for detecting a nucleic acid having a base sequence complementary to DNA to be labeled, using the hybridization probe according to any one of claims 1 to 5.

(7) The detection method according to (6), wherein the detection target is an MA or cDNA library.

(8) In terminal 3, tailing labeling of DNA using terminal transferase, the affinity of base pairing is weaker than the hydrogen bonding between a / t, a / u, and g / c. A method for labeling MA using a nucleotide and / or a nucleotide derivative that can be a substrate for a nucleotide addition reaction by evening minal transferase as a substrate.

(9) The method for labeling DNA according to (8), wherein the nucleotide is deoxydeoxyinosine 5,3-phosphate.

(10) The method for labeling DNA according to (8), wherein a nucleotide and a Z or nucleotide derivative having a weak base pair bond are mixed with a labeled nucleotide or nucleotide derivative to form a substrate.

(11) A kit for synthesizing a hybridization probe comprising the following elements.

i) nucleotide and / or nucleotide derivatives having the following characteristics a) and b):

a) The affinity of base pairing with the base constituting the target base sequence is between a / t, a / u Weaker than hydrogen bond between g and c

b) It can be introduced into DNA to be labeled by nucleotide addition reaction by evening minal transferase

ii) Labeled nucleotide or nucleotide derivative

iii) Yuichi Minoru Transferase

(12) A method for preventing hybridization that is not based on the sequence of DNA to be labeled by a hybridization probe in which a base sequence containing a labeled nucleotide is added to DNA, wherein the base sequence is added to the base sequence to be added. A method of inserting a nucleotide and / or a nucleotide derivative whose affinity of pair binding is weaker than hydrogen bonding between a / t, a / u, and g / c. The DNA to be labeled according to the present invention is a DNA that specifically binds to a target base sequence by hybridization. Generally called a probe. This DNA is usually composed of a base sequence complementary to the target base sequence. Alternatively, it can be designed so that hybridization can be performed even with a certain degree of mutation. A strand capable of hybridizing to the target base sequence under stringent conditions and capable of maintaining a stable double strand that does not elute even under washing under normal conditions Have a length. In the present invention, as the MA to be labeled, the one that is usually used can be applied as it is. That is, depending on the purpose of detection, it may be a chemically synthesized oligonucleotide or a DNA fragment obtained by cutting the plasmid chromosome or the like. It can also be a PCR product or cDNA obtained by an enzymatic synthesis of nucleic acids, or a fragment thereof. On the other hand, the target base sequence is not particularly limited as long as it is capable of base pairing, such as DNA, RNA or DNA-MA hybrid. The specificity and strength of the hybridization between the target base sequence and the probe are determined by the type of base constituting the base pairing and the reaction conditions. Hybrida The factors that affect the analysis and general conditions are summarized below (Molecular Cloning, Cold spring harbor laboratory press, 1989). Reaction solution temperature 6 8 ° C

Salt concentration 6 x S S C

(20 x SSC: 3 M NaCK 0.3 M sodium citrate)

pH 7.0

Sodium dodecyl sulfate 0.5%

5 Denhardt's reagent

(Composition of 50 x Denhardt's reagent:

O. Olg / mL Ficoll type 400; manufactured by Pharmacia

O.Olg / mL polyvinyl alcohol

O. Olg / mL (serum albumin factor V; manufactured by Shigma) In the present invention, a hybridization probe is prepared by adding a nucleotide sequence containing a labeled nucleotide or a nucleotide derivative to DNA to be labeled. Is configured. The added base sequence contains a labeled nucleotide or nucleotide derivative and has the following features a) and b).

a) Nucleotides and / or nucleotide derivatives whose affinity for base pairing with bases constituting the target base sequence is weaker than hydrogen bonds between a / t, a / u, and g / c Including

Nucleotides whose base pairing affinity is weaker than hydrogen bonds between a / t, a / u, and g / c means that the nucleotides are common to all bases such as atgc and u. A weaker affinity than that between the complementary bases tacg and a Means to have. Alternatively, it can be described that any of the bases constituting the target base sequence has a weaker affinity than a partner which usually should perform complementary base pairing. Further, a nucleotide derivative means a compound obtainable by introducing a functional group into a nucleotide. Alternatively, nucleotides chemically synthesized by mimicking the structure of natural nucleotides, or even nucleotides whose base pairing has been weakened by chemically modifying the structure of natural nucleotides, may be subjected to the conditions described above. ) And b) are included in the nucleotide derivative having a weak base pair bond in the present invention. Further, the present invention is characterized in that the nucleotides, nucleotide derivatives, and nucleotides can be introduced into DNA to be labeled by a nucleotide addition reaction using terminal transferase. This is a necessary condition for use in the 3'-end tailing labeling method. Examples of nucleotides satisfying the above conditions include inosinic acid and xanthylic acid. Above all, inosinic acid is an easily available nucleotide, and is a desirable nucleotide capable of reliably achieving the effects of the present invention even from a functional viewpoint. For example, when a terminal transferase is allowed to act using deoxyinosine 5′-phosphate as a substrate, a nucleotide sequence containing deoxyinosine acid can be added to the 3 ′ end of DNA. In general, inosinic acid was considered to form a base pair bond with a certain strength regardless of the type of base. Therefore, insertion into a sequence for labeling as in the present invention has a risk of increasing nonspecific reaction. In practice, however, inserting inosinic acid into the sequence to be added makes it possible to significantly suppress nonspecific reactions.

In the hybridization probe or the method for producing the same according to the present invention, it is essential to include the nucleotide having a weak base pair bond, and to allow the presence of other nucleotides (for example, atcg and u or a derivative thereof). be able to. These nucleotides may be labeled. However However, when a nucleotide other than the nucleotide having a weak base pair bond and a nucleotide other than a nucleotide or a nucleotide derivative is contained as a constituent base, the conditions must be such that the portion added for labeling does not cause hybridization. . Desirable conditions are such that the added nucleotide sequence cannot hybridize with any nucleotide sequence by itself under the conditions of stringent hybridization of the DNA to be labeled.

In order to achieve such conditions, the proportion of the nucleotide (or nucleotide derivative) having a weak base pair bond in the sequence added for labeling is increased. Although the minimum required ratio is affected by the composition and overall length of the nucleotides mixed with the type, a general range cannot be shown, but those skilled in the art will be empirical based on the disclosure of the present invention. Can be set to In addition, any nucleotide or nucleotide derivative added to the DNA to be labeled can be a target of labeling. Therefore, it is also possible to combine unlabeled nucleotides with labeled inosinic acid. In this case, the spacer may be composed of only unlabeled nucleotides, or non-labeled inosinic acid as a spacer may be mixed. For example, in the case of tailing labeling with deoxyinosine 5'-triphosphate (a nucleotide having a low affinity) and digoxigenin-labeled deoxyduracil 5,3-phosphate, the ratio of the latter is set to 1/10 or less, whereby the content of the present invention is reduced. Can meet the requirements.

3. Even-minal transferase, which is used for end-tailing labeling, randomly adds nucleotides to the 3 'end of DNA without discriminating the type of base. Therefore, the ratio of the constituent bases to the base sequence to be added is adjusted by the concentration ratio between nucleotides to be added as a substrate and nucleotides. If the ratio is specifically shown, for example, when deoxyinosine 5 'triphosphate is used in combination with digoxigenin-labeled deoxyperacyl 5' triphosphate label, the concentration of the former should be 2- to 10-fold excess. Expected to improve the specific activity of the label and reliably suppress nonspecific reactions it can. In general, labeled nucleotides and derivatives thereof tend not to be substrates for the addition reaction by the mininal transferase, so experience appropriate concentration ratios according to the type of label and the nucleotide to be combined. Make sure to set it manually. Although it is impossible to strictly control the sequence of each nucleotide only by the concentration ratio, empirical conditions based on the disclosure in the present specification are based on the conditions under which the sequence of nucleotides that can cause stochastic hybridization does not occur. It is obvious for a person skilled in the art to set.

By the way, in order to increase the composition ratio of nucleotides having a weak base pair bond, for example, a labeling sequence composed of only deoxyinosinic acid is desirable. Such an embodiment can be realized by combining labeled deoxyinosinic acid as a labeled nucleotide. When the constituent base is only deoxyinosine acid, the concentration ratio of labeled deoxyinosine 5'-phosphate to unlabeled deoxyinosine 5'-phosphate is determined based on the conditions that give the labeled probe with the highest specific activity. 'End-tailing signs may be used.

The 3'-end tailing labeling method is known (Molecular Cloning, Cold spring harbor laboratory press, 1989). That is, a labeled nucleotide and a spacer (unlabeled nucleotide) are added as a substrate to the DNA (or oligonucleotide) to be labeled, and terminal transferase is allowed to act. At this time, in the present invention, a nucleotide such as deoxyinosine 5′-triphosphate may be added as a supplier. For terminal transferase, generally, an enzyme derived from puppy thymus is used, but the origin is not particularly limited. The reaction solution may also contain a buffer to keep the reaction environment at the optimal pH, a protective agent for enzymes such as serum albumin, or an appropriate material such as cobalt chloride to supply metal ions necessary for the expression of enzyme activity. Add salt. The base sequence for labeling can be obtained by reacting with the terminal transferase of OOunits for about 15 minutes at 37 ° C.

In order to reduce the variation in specific activity between batches, it is desirable to unify the reaction conditions. For that purpose, a reaction terminator can be used for the purpose of controlling the reaction time. For example, by adding glycogen and ethylenediaminetetraacetic acid (EDTA), the enzyme activity of terminal transferase is rapidly lost and the reaction is stopped. In the present invention, the labeled nucleotide or nucleotide derivative that constitutes the nucleotide sequence for labeling together with the nucleotide (or nucleotide derivative) may be any nucleotide. Even if the nucleotides for labeling are scattered in the nucleotide sequence for labeling, even if they are bases capable of normal base pairing, they are arranged in a dispersed manner, so that it is difficult to hybridize. . Therefore, general nucleotides such as atcg or u may be combined, or as described above, nucleotides having low base pairing affinity such as inosinic acid may be used even for labeled nucleotides. Examples of the labeled nucleotide constituting the base sequence for labeling include nucleotides substituted with a radioactive isotope ³² P. Examples of the nucleotide derivative for labeling include a nucleotide in which a fluorescent compound or a binding ligand is introduced into a functional group of the nucleotide. Specific examples of the compound that induces nucleotides include the following. Fluorescent compounds: fluorescein, rhodamine, aminomethylcoumarin

Binding ligands: digoxigenin, biotin

Elements necessary for carrying out the 3′-end tailing labeling method according to the present invention described herein can be combined in advance to prepare a kit for synthesizing a probe for hybridization. The kit according to the present invention essentially includes nucleotides and / or nucleotide derivatives, nucleotides, and terminal transferase, and further includes a buffer suitable for the reaction, a reaction terminator, and a reagent for recovering DNA after the reaction. Can be combined.

The hybridization probe according to the present invention can be used for detecting various nucleic acids. That is, it can be used for a wide range of applications, such as screening for cDNA, detecting genes of pathogenic microorganisms and viruses, or analyzing mutations in oncogenes. Can be. Further, the hybridization probe according to the present invention can be applied to various assay formats. Well-known assay formats, such as a dot hybridization assay for observing the reaction with the target DNA fixed at the same time, and an in situ hybridization assay for observing the localization of the nucleic acid in the fixed tissue. It can be applied to a robot. 3. The assay using a hybridization probe, which can be obtained by the terminal tailing labeling method, is known (Molecular Cloning, Cold spring harbor laboratory press, 1989). However, since hybridization due to the base sequence added for labeling has been significantly reduced, masking with a polynucleic acid is unnecessary. The target of hybridization is not limited to DNA, but may be RNA. Alternatively, it can be used for colony and plaque screening. Hereinafter, gene expression profiling using array technology will be described as one application example based on the sensitivity and specificity of the hybridization probe according to the present invention. The use of the highly sensitive and highly specific hybridization probe according to the present invention enables accurate expression profiling of many types of RNA without correcting the array. Alternatively, the hybridization probe of the present invention can also be used for detecting single nucleotide polymorphisms (SNPs).

That is, the RNA to be examined for expression or its cDNA is arrayed in a mixture on one support without labeling. As samples, cMA from various tissues and cDNA of cells over time after drug administration can be used. An excessive amount of the probe (first probe) according to the present invention specific to the gene to be examined is hybridized in this array, a signal from the probe is detected, and the expression state is analyzed. Next, the duplex is exposed to denaturing conditions based on the Tm value of the probe, and the probe is released from the target base sequence fixed on the array. Denaturation conditions may be temperature control or hybridization control by electrical control. Techniques for controlling proteins are also known (Nat Biotechnol (1999) 17, 365-370). Subsequently, instead of the probe for the next gene (second probe), the expression state is analyzed in the same manner. A series of operations is repeated for the number of genes that need to be examined. In this method, since a single array is used repeatedly, the expression profile of a large number of genes can be analyzed with high accuracy. Since a series of operations can be easily automated, it can be understood that the hybridization probe of the present invention realizes a drastic increase in efficiency of gene expression profiling. Of course, it goes without saying that the hybridization probe of the present invention brings about the same efficiency in the analysis of SNP.

The principle of the method of use described here is the so-called dot-blot of cDNA or MA. However, the major features are that highly sensitive and highly specific oligo DNA is used as a probe, and hybridization of various types of probes is performed sequentially using the same array. Instead of an array with immobilized cDNA or RNA, tissue sections can be used as samples (Nature Med. (1998) 4, 844-847). BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a photograph showing the results of a hybridization process of 3, tail-labeled oligonucleotides using deoxyinosinic acid as a probe according to the present invention. In the figure, dIMP indicates deoxyinosinic acid, and dAMP indicates deoxyadenylic acid.

FIG. 2 is a photograph showing the results of Northern hybridization using a 3′-tering-labeled oligonucleotide as a probe according to the present invention using deoxyinosinic acid as a spacer. In the figure, one band indicates that the probe specifically detected the target mRNA. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in more detail with reference to Examples.

[Example 1] Labeling of oligonucleotide

(1) Specific oligonucleotides for the gene with access code X75861 (c cctacaaagaaaatggagagcct; SEQ ID NO: 1) registered on the GenBank Sequence Data Base managed and operated by the National Center for Biotechnology Information (National Institutes of Health, USA) ) Was prepared by a synthetic method (manufactured by GIBCO), and the lOOpmol was used to label the oligonucleotide 3 'end with terminal transferase. For the labeling, a reaction solution containing 0.5 mM deoxyinosine 5'3 phosphoric acid (weak nucleotide) and 0.05 mM digoxigenin-labeled deoxyduracinole 5,3 phosphate (labeled nucleotide) (0.2 M dipotassium codylate, 25 mM Trishydroxyaminomethane, 0.25 mg / ml serum albumin, 5 mM conodium chloride, pH 6.6) or 0.5 mM deoxyadenine 5,3 phosphate and 0.05 mM labeled deoxydilacil 5 for comparison. 'In a reaction solution containing 3 phosphoric acid, 2.5 units // zL of overnight transfer was allowed to act, and the mixture was incubated at 37 ° C for 15 minutes.

(2) The mixture was transferred on ice, and a stop solution (final concentration: 10 μg / ml glycogen, 0.2 mM ethylenediaminetetraacetic acid) was added. Further, lithium chloride was added thereto at a final concentration of 0.4 mM and three volumes of ethanol, and the mixture was kept at -30 ° C for 2 hours.

(3) The mixture was centrifuged at 12,000 g to precipitate MA, and the precipitated DNA was washed with 70% ethanol and dried. The dried labeled DNA was dissolved in 100 L of water.

[Example 2] Immobilization of target gene

Immobilization of plasmid DNA on a nylon membrane was performed as follows. About 0.1 ng / 0.1L of target DNA was heated at 96 ° C for 10 minutes. This was rapidly cooled on ice, and a 1 L / dot amount was spotted on a nylon membrane for nucleic acid blot (manufactured by Behringer). 2xSSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7), and then irradiate the target with a UV crosslinker (Stratagene) using a UV crosslinker according to the attached protocol. Immobilized. As target DNAs, in addition to the access code X75861, eight types of cDNAs having base sequences unrelated to this DNA were prepared. All of these cDNAs have a poly A tail at the 3 'end.

[Example 3] Hybridization with labeled oligonucleotide

Hybridization was performed as follows. First, a pre-hybridization of the membrane was performed. Hybridization solution with or without lmg / ml poly A (6xSSC, l% (w / v) blocking solution (Boehringer), 0.1% (w / v) N The nylon membrane was incubated in lauroyl sarcosine, 0.02% (w / v) sodium dodecyl sulfate) at 68 ° C for 3 hours.

Next, hybridization was carried out between the Niopen membrane and the labeled oligonucleotide. 5 pmol / ml of labeled oligo DNA was added to the hybridization solution, and the mixture was incubated at 60 ° C. for 12 hours. The nylon membrane was immersed in a washing solution (6 × SS 0.1% sodium dodecyl sulfate) and washed four times at 60 ° C. for 15 minutes.

The luminescence detection method was used for detection of the labeled oligonucleotides hybridized. The measurement was carried out using a luminescence detection kit manufactured by Boehringer according to the instruction manual. Briefly, a labeled oligo-MA on a nylon membrane was bound with an alkaline phosphatase-labeled anti-labeled digoxigenin antibody, and luminescence was added to the luminescent substrate of Alfa rifosiferase. Luminescence was detected by exposing to X-ray film.

The results are shown in FIG. Oligonucleotides labeled with 3'-tering using deoxyinosine 5, 3-phosphate as a probe specifically hybridize to a plasmid having as its insert a cDNA having the same DNA base sequence. However, it does not hybridize to cDNA of an unrelated DNA sequence. In contrast, 3 'tailing labeled orifices using deoxyadenine 5,3 phosphate as a donor Golnucleotides are non-specific hybridizations that are not based on the sequence of MA that should also be labeled with plasmids that have cDNA as an insert unrelated to their DNA base sequence. This non-specific hybridization was not suppressed even if the plasmid was previously masked with a polyA oligonucleotide.

[Example 4] Northern hybridization using oligo DNA tailed and labeled with inosinic acid as a probe

RNA was prepared as follows. That is, an RNA extraction buffer (0.14 M NaCl, 1.5 mM MgCl ₂ , 10 mM TrisCl (pH 8.6), 0.5% Nonidet) was added to animal culture cell line NT2 (purchased from Stratagene, and cell culture was performed according to the attached manual). After adding P-40 and 10 mM vanadyl-ribonucleoside complex), the mixture was allowed to stand on ice for 10 minutes, and then centrifuged at 10,000 xg, 4 ° C for 15 minutes to extract the upper layer. Further, an equal volume of a proteinase cleavage buffer (0.2 TrisCl (pH 7.8), 25 mM EDTA (pH 8.0), 0.3 M NaCl, 2% SDS) was added to obtain a cell solution. Proteinase K was added at a final concentration of 400 zl / ml and incubated at 37 ° C for 90 minutes. The aqueous phase was extracted by adding a phenol-chloroform solution. Further, a phenol-chloroform solution was added once more to extract an aqueous phase, and 2.5 volumes of ethanol was added thereto. The precipitate formed by centrifugation at 5000 X g at 4 ° C for 10 minutes was washed with 70% ethanol, and air-dried to obtain total RNA. Dissolve the total RNA in 0, incubate at 65 ° C for 5 minutes, and add 2x column loading buffer (lx column loading buffer: 20 mM TrisCl (pH7.6), 0.5 M NaCl ヽ 1 mM EDTA (pH 8.0), 0.1% sodium lauroyl sarcosinate) was added to the same volume. This was added to a column of oligo dT cellulose (manufactured by Col laborative Biomedical Products) swollen with a column loading buffer to obtain an eluate. The eluate was added to the column again, and this operation was repeated three times. After washing the column with 5 volumes of lx column loading buffer, add 2 volumes of column elution buffer (10 mM TrisCl (pH7.6), 1 mM EDTA (pH 8.0), 0.05% SDS). The eluate was collected. 0.1 volume of 3M sodium acetate and 2.5 volumes of ethanol were added. Centrifuge at 12,000 X g at 4 ° C for 10 minutes The precipitate formed was washed with 70% ethanol and air-dried to obtain mRNA. The electrophoresis of mA was performed as follows. That is, the mRNA was converted to a sample solution for electrophoresis (4 jl formamid 2 μ. \ Formaldehyde ヽ 1 JUL \ 1 Ox MOPS ヽ \ μ \ H ₂₀ ) (ΙΟχ MOPS: 14.9 g / 1 MOPS, 6.8 g / Dissolved in 1 sodium acetate ^ 3.7 g / 1 EDTA, pH 7.0), heated at 65 ° C for 10 minutes, and immediately cooled with ice. The RNA Agarosugeru was electrophoresed using a (lg agarose, 10x MOPS, 73.3 ml H 2 0 s 16.7 ml formaldehyde). Blotting of RNA from agarose gel to Nylon Fil Yuichi (Perlinger) was performed according to a standard method. Molecular Cloning. A laboratory manual / 2nd edition (1989) p7.46-7.50, Cold Spring Harbor Laboratory Press). Next, the nylon membrane was irradiated with ultraviolet light to immobilize RNA.

The specific oligodoxynucleotide (gtcacagaattttgagaccca; SEQ ID NO: 2) for EF1 was from GIBC0. Labeling of the oligonucleotide with terminal transferase was carried out in the same manner as described above. Hybridization of a filter with immobilized RNA from EF1 and labeled oligodoxynucleotides, and detection of hybridization by chemiluminescence were performed in the same manner as described above. The results are shown in FIG. A single band is detected at the expected size (l. Okb). As is evident from FIG. 2, the hybridization probe according to the present invention has sufficient sensitivity and specificity necessary for detecting the plotted mENA. Therefore, it supports that gene expression profiling ゃ SNP can be detected based on this principle. Industrial applicability

According to the present invention, hybridization caused by a base sequence added for labeling is effectively suppressed. In addition, since the nucleotide used in the present invention serves as a substrate for terminal transfer Xase, the label can be easily bound only by adding it as a substrate for the 3′-terminal tailing labeling method. The nucleotide (or nucleotide derivative) having a weak base pairing affinity used in the present invention functions as a nucleotide for labeling itself or as a spacer, so that efficient introduction of labeled nucleotides can be achieved. To give a high-titer labeling oligonucleotide. Thus, according to the present invention, it is possible to achieve both of the two problems of suppressing non-specific reactions and providing a high-titer labeled oligonucleotide. In other words, the improvement of the S / N ratio in the hybridization can be easily realized based on the present invention.

Claims

Claims A hybridization probe comprising a DNA to be labeled and a base sequence containing a labeled nucleotide or a nucleotide derivative, wherein the added base sequence has the following characteristics a) and b) A hybridization probe comprising:

a) Nucleotide and / or nucleotide derivatives whose base pairing affinity with the base constituting the target base sequence is weaker than the hydrogen bond between a / t, a / u and g / c

b) Can be introduced into DNA to be labeled by nucleotide addition reaction with Yuminaru transferase

2. The hybridization probe according to claim 1, wherein the nucleotide of a) is inosinic acid.

3. The hybridization probe according to claim 2, wherein the base sequence to be added is composed of a labeled nucleotide or a nucleotide derivative, and an unlabeled inosinic acid or a derivative thereof.

4. The hybridization probe according to claim 3, wherein the labeled nucleotide or nucleotide derivative is labeled inosinic acid or an inosinic acid derivative.

Under the conditions of stringent hybridization for the DNA to be labeled, the nucleotide sequence added for labeling is such that this sequence alone cannot hybridize with any base sequence. Item 2. The hybridization probe according to Item 1.

A method for detecting a nucleic acid having a base sequence complementary to DNA to be labeled, using the hybridization probe according to any one of claims 1 to 5.

7. The detection method according to claim 6, wherein the detection target is an RNA or cDNA library.

8. In the end-tailing labeling method of DNA with evening minal transferase, the affinity of base pairing is higher than that of hydrogen bonding between a / t, a / u, and g / c. A method for labeling DNA using a nucleotide and / or nucleotide derivative as a substrate, which is weak and can serve as a substrate for nucleotide addition reaction by terminal transferase.

9. The method for labeling DNA according to claim 8, wherein the nucleotide is deoxydeoxyinosine 5 ′ triphosphate.

10. The method of labeling DNA according to claim 8, wherein a substrate is obtained by mixing a nucleotide or a Z derivative having a weak base pair bond with a labeled nucleotide or a nucleotide derivative to form a substrate.

1 1. A kit for synthesizing a hybridization probe containing the following elements. i) nucleotides and / or nucleotide derivatives with the following features a) and b):

a) The affinity of base pairing with the base constituting the target base sequence is weaker than the hydrogen bonding between a / t, a / u and g / c

b) Can be introduced into DNA to be labeled by nucleotide addition reaction with terminal transferase

ii) labeled nucleotide or nucleotide derivative

iii) Terminal transfer

12. A method for preventing hybridization that is not based on the sequence of the DNA to be labeled by a hybridization probe in which a base sequence containing a labeled nucleotide is added to DNA, wherein the base sequence has an affinity for base pairing. A method of inserting a nucleotide and / or nucleotide derivative whose sex is weaker than a hydrogen bond between a / t, a / u, and g / c.