WO2000025809A1 - Compositions comprising notch receptor manipulating agents - Google Patents

Abstract

Medicaments for the treatment of diseases or clinical conditions featuring or characterised by bone deficiency, for example in the form of pharmaceutical compositions or incorporated into devices such as bone screws or bioresorbable implants are provided which comprise a Notch function manipulating agent which does not inhibit differentiation of progenitor or stem cells to mammalian osteoblasts.

Description

COMPOSITIONS COMPRISING NOTCH RECEPTOR MANIPULATING AGENTS

The present invention relates to the field of bone biology and is concerned with the provision of compositions, particularly pharmaceutical compositions, for promoting bone formation and to 5 constructs such as prosthetic devices which comprise such compositions The present invention also concerns methods of treatment and diagnosis, and furthermore to methods of screening candidate agents for promoting bone formation.

Vertebrate bone, as a tissue providing mechanical support for 10 the body, undergoes constant remodelling through the formation and resorption of bone mediated, it is widely thought, by the activities of osteoblasts and osteoclasts respectively. Bone remodeling comprises a complex and highly organised interaction between ceils and the extracellular matrix (ECM). The remodeling 15 process is, however, adaptive in response to requirements of growth or habitual activity. In a normal healthy adult skeleton, the rate of bone formation approximates with the rate of bone resorption, through a process known as coupling. Bone resorption or formation is not, though, a generalised feature of the entire skeleton 20 simultaneously but occurs in discrete sites which may be surrounded by areas of quiescent bone. Where resorption occurs excessively, several clinical problems can occur either at a specific locality or more extensively throughout the skeleton.

For example, osteoporosis is a disease that is characterised 25 by abnormalities in the amount and architectural arrangement of bone tissue. Osteoporosis is a major clinical condition that can lead to fractures of bone following only minimal trauma. Osteoporosis results from a shift in the balance of bone resorption and formation towards resorption so that there is net bone loss. In addition to the 30 distress to sufferers, the direct hospital costs of osteoporosis have been estimated, in the U.S. only, to approach $13 billion and in the UK to approach £750 million. The term Osteoporosis' in fact refers to a group of conditions that are associated with loss of bone tissue and an accompanying architectural abnormality that occurs in cancellous bone space. When the condition develops in post- menopausal women it is referred to as postmenopausal osteoporosis. Fractures occur commonly in the hip, spine and distal radius and are considered in many countries to be a major public health problem (Lindsay R (1993), Clinical Rheumatology Osteoporosis; V.7, No.3). While genetics, diet and life-style appear to be factors in the pathogenesis of the disease, loss of ovarian function is an important determinant, at least in postmenopausal osteoporosis.

One reason for the lowest bone formation in osteoporosis is a reduced number of active osteoblasts. Agents capable of increasing the number of these cells would therefore have utility in conditions characterised by low bone mass.

Other osteoporotic-associated disease states include steroid induced osteoporosis, idiopathic juvenile osteoporosis, post- transplantation osteoporosis where bone resorption is a secondary indication of disorder.

In the disease known as Paget's disease, there is excessive bone formation and osteoclastic resorption of bone and reorganisation with loss of structure leading to deformities and liability to fracture. Long term bed rest or disability for reasons that may not necessarily be directly related to diseases of the bone can lead to bone loss and danger of fracture on remobilisation or rehabilitation.

In cancer, formation of primary and secondary tumours often cause resorption and/or formation and subsequent increased liability to fracture or loss of function Tumour-induced osteolysis may also lead to pathologically raised serum calcium levels, which are believed to increase significantly morbidity in cancer patients.

Several approaches have been taken to treat low bone mass which are based on the use of antiresorptive agents such as bisphosphonates that reduce or inhibit bone loss but none are entirely satisfactory since the subsequent increase in bone formation occurs but slowly.

The use of bisphosphonates to inhibit bone resorption is also not ideal since the degree of side effects is regarded by some as unacceptably high and its use is not well tolerated by a significant proportion of the population.

Oestrogen and other hormone replacements have a history of use for postmenopausal osteoporosis, either alone or in combination with other therapeutics. However suggestions of an increased risk of endometrial and breast cancer, as well as the continuation of menstrual bleeding, which is often unwelcome in the elderly female section of the population who form the majority of sufferers of osteoporosis, has provided a need for an alternative approach. Other treatments for osteoporosis employing agents which affect osteoclast function have been used e.g. Calcitonin or parathyroid hormone but with limited success.

It is an object of the present invention to provide compositions for promoting bone formation which are alternative approach to current and proposed therapies such as the bisphosphonates, parathyroid hormone and its derivatives and bone morphogenetic proteins (BMPs) for treating bone deficiency and abnormalities.

The control of cellular differentiation appears to be mediated, in part, by the activity of the basic helix-loop-helix (bHLH) genes whose expression is in turn controlled by a number of interlinked pathways one of which is the NOTCH pathway (Delidakis et al, 1991 Genetics 129: 803; Jennings et al, 1994 Development 120: 3537 - 3548; Blair, 1996 Science 271 : 1826 - 1832; Guo et al, 1996, Neuron 17: 27-41) Cell-fate determination in many tissues and species has been shown to involve the evolutionarily conserved NOTCH family of receptors and their cognate ligands [S. Artavanis-Tsakonas, Science 268, 1995]. In addition to their function during development, NOTCH proteins and their ligands have been shown to play a role in processes that occur during adult life, including growth factor- induced angiogenesis, haematopoesis and adipogenesis [P. Jones et al. Blood 92, 1998; AB Zimrin, et al Journal Biol Chem 271 , 1996; L.H. Li et al Immunity 8, 1998; C. Garces J Biol Chem 17, 1997]. The NOTCH receptor family members are closely related integral membrane proteins which, on interaction with their ligands preclude or promote cell-fate specification promoting the establishment of distinct mature cell lineages and defined pattern formation [J. L. de la Pompa et al., Development 124, 1997]. These ligands may be present on the plasma membrane of neighbouring cells [R. J. Fleming, K Purcell. S Artavanis-Tsakonas 1998] or as soluble isoforms comprising the extracellular domain of the ligand [H. L. Qi et al Science 283, 1999]. Mammalian NOTCH receptor ligands e.g. Delta-1 , Jagged-1 & -2 have been identified and shown to be homologous to Delta and Serrate in Drosophila melanogaster [B Bettenhausen et al Development 121 , 1995; C E Lindsell et al Cell 80, 1995; R J Fleming et al, Gene Dev 4, 1990; C J Shawber et al, Dev Biol 180, 1996]. These ligands are type I transmembrane proteins which share significant homology, defined by a conserved region among Delta, Serrate and Lag-2 (the DSL domain) and tandem epidermal growth factor (EGF) repeats, thought to be important in receptor-ligand interactions. However recent evidence suggest that proteolytic modification of NOTCH within the trans-Golgi network is a crucial event in functional activation of the receptor [C M Blaumueller et al, Cell 90, 1997]. In Drosophila melanogaster, specific cleavage of NOTCH was originally thought to be mediated by the metallodisintegrin, Kuzbanian (Kuz) [D R Pan, G M Rubin, cell 90, 1997]. However a more recent study shows that the phenotypes produced by dominant negative mutations in the Kuz gene are in fact conferred by an inability to perform the specific cleavage of the NOTCH receptor ligand, Delta [H L Qi et al Science, 283, 91 , 1999], and that a furin-like protease is more likely to be responsible for processing of NOTCH. That observation represented the first indication that NOTCH receptor signalling in vivo may be modulated by both membrane-associated and soluble ligands. All the components of the NOTCH pathway play a central role in the specification of cell fates during development by promoting the ability of a precursor cell to proliferate and blocking its ability to differentiate ( Weinmaster et al, 1991 , Development 113: 199-205; Reaume et al 1992, Dev.Biol.154: 377-387; Stifani et al; 1992, Nature Genet.2: 119-127; Weinmaster et al, 1992,

Development 116: 931-941 ; Kopan et al, 1993, J.Cell Biol. 121 : 631 - 641; Lardelli et al., 1993, Exp.Cell Res 204: 364 - 372; Lardelli et al, 1994, Mech Dev. 46: 123-136; Henrique et al., 1995, Nature 375: 787 - 790; Horvitz et al., 1991 , Nature 351 : 535 - 541 ; Franco del Amo et al., 1992, Development 115: 737 - 744). Much of our current understanding of the NOTCH pathway comes from studies in Drosophila melanogaster where genetic analysis has begun to unravel the intricacies of this pathway and its role in cellular differentiation and cell-fate determination. In an adult mammal, NOTCH continues to be expressed in the regenerating tissues of the ovaries and testes, in the peripheral nervous system and in the eye ( reviewed by Fortini et al., 1993, Cell 75 1245 - 1247; Jan et al., 1993, Proc Natl. Acad. Sci. USA 90: 8305 - 8307; Sternberg 1993, Curr Biol. 3 763 - 765; Greenwald 1994, Curr.Opin. Genet. Dev. 4: 556 - 562; Artavaris - Tsakonas et al ., 1994, Science 268: 225 - 232.) The NOTCH gene of Drosophila encodes a 300 kDa transmembrane receptor, consisting of a large extracellular domain of 36 tandem epidermal growth factor (EGF) - like repeats of which repeats 11 and 12 are required for interaction ( Fehon et al., 1990, Cell 61 : 523; Lieber et al., 1992, Neuron 9: 847; de Celis et al., 1993, Proc Natl. Acad. Sci.USA 90: 4037). The intracellular domain has 6 tandem Ankyrin repeats, involved in receptor interactions, and a PEST sequence, thought to be involved in protein degradation (Kidd et la., 1986, Mol.Cell Biol. 6: 3094; Greenwald, 1985, Cell 43: 583; Yochem et al., 1988, Nature 335:547; Yochem & Greenwald, 1989, Cell 58:553).

The NOTCH ligands are membrane-bound and shed proteins with extracellular tandem EGF-like repeats, which modulate ligand binding, and a DSL (Delta, Serrate, Lag2) domain, involved in ligand/receptor interactions ( Tax et al., 1994, nature 368: 150; Henderson et al., 1994, Development 120:2913). The Serrate and Jagged ligands also have an additional cysteine-rich domain between their EGF-like repeats which may mediate protein interactions and maybe unique to those ligands.

NOTCH transduces a signal through a conserved core signalling pathway whereby NOTCH on the receiving cell is activated by binding of the DSL ligand (on the signalling cell or a soluble form present in the extracellular fluid) to an extracellular region of NOTCH.

To acquire active NOTCH receptors on the cell surface, processing of the originally synthesised protein occurs in the Golgi network. This activation requires cleavage and subsequent disulphide bonding of the receptor. A number of mechanisms have been proposed for proteolytic cleavage of the NOTCH receptor, but recent studies (Li et al, 1999) suggest that the previously suggested role for the metallodisinteg n Kubanian is not to process NOTCH. After activation by cleavage, NOTCH receptors are expressed on cell membranes where they are able to bind appropriate ligands.

The binding of the DSL domain of a NOTCH ligand to the NOTCH receptor induces the cleavage of an intracellular region of NOTCH, termed NOTCH intracellular domain (NICD) which interacts with the CSL protein Suppressor of Hairless (Su(H)), to affect activation of Enhancer of Split (E(Spl)) transcription factors ultimately leading to control over the basic helix-loop-helix proteins mentioned supra.

The NOTCH signalling pathway may be regulated at many levels. Cells involved in inductive signalling express either a DSL ligand (and is therefore a signalling cell) or a receptor homologous to NOTCH (and is therefore a receiving cell, although cells may express both), thus control of gene expression dictates whether a cell acts as a signalling or receiving cell. This type of regulation is seen in C. elegans germline induction where the lag-2 NOTCH receptor ligand is expressed in the signalling distal tip cell and the Glp-1 NOTCH receptor is expressed in the receiving germline tissue. In Drosophilia, inductive signalling is required for correct cell fate decision and non-neuronal cells in the developing eye imaginal disc. US Patent No 5780300 describes the expansion of precursor cells, including osteoblast precursor cells by contacting the cells in vitro with an amount of an agonist of Notch function effective to inhibit differentiation of the cell, and exposing the cell in vitro to cell growth conditions such that the cell proliferates. There is clear teaching that the agonist has to be de-activated prior to differentiation for example by removing or diluting the agonist or by administering an antagonist. Reference has been made to the possibility of inducing differentiation, in vivo, after the precursor cell population has been expanded in vitro. There is no teaching that progenitor bone cells will be inhibited from differentiating into osteoblasts in the presence of a Notch function manipulating agent in vivo.

Also disclosed in US Patent No 5780300 are pharmaceutical compositions which comprises a therapeutically effective amount of a recombinant or non-recombinant cell, preferably a stem or progenitor cell. There is no suggestion that the application of a Notch function manipulating agent can be directly to site of the bone defect.

Vamum-Finney et al [1998 Blood 91(11) 4084-4091] have shown that NOTCH1 , NOTCH 2 and jagged 1 are expressed in murine marrow precursor stem cells. Jagged 1 expressed on cells or on beads promoted a 2-3 fold increase in primitive precursor cell populations. These results suggest a potential use for NOTCH ligands in expanding precursor cell populations in vitro. Walker et al 1999 also showed jagged 1 is expressed on bone marrow stromal cell while NOTCH is expressed on CD34+ haemapoietic stem cells populations . This demonstrates the dogma that jagged 1 -NOTCH interaction preserves CD34+ cells in the immature undifferentiated state The role of the NOTCH pathway in bone has subsequently been investigated. Expression of a fusion protein of the NICD with green fluorescent protein after transfection into MC3T3 cells led to a down regulation of expression of the established bone differentiation markers CBFA-1 , collagen type I and alkaline phosphatase (poster ASBMR San Francisco, December 1998 NB after the date of filing). This is in line with the previous dogma that firing the NOTCH signalling pathway causes a general block on differentiation.

We have surprisingly found, against the teachings of established dogma that when conditions characterised by bone deficiency are treated by the direct administration of a Notch function manipulating agent in vivo, cell growth is promoted without the inhibition of differentiation

By the term "NOTCH function manipulating agent" we mean an agent that may directly or indirectly promote bone cell differentiation via the Notch signalling pathway.

In accordance with the present invention there is provided a medicament for the treatment of diseases or clinical conditions featuring or characterised by bone deficiency comprising a Notch function manipulating agent which does not inhibit differentiation of progenitor or stem cells to mammalian osteoblasts.

In accordance with an aspect of the present invention, we provide the use of a NOTCH function manipulating agent in the manufacture of a medicament for treating bone deficiency.

In another aspect, we provide a method of promoting bone formation comprising the step of administrating an effective amount of a NOTCH function function manipulating agent.

In another aspect, we provide a method of treating bone deficiency comprising the step of administrating an effective amount of a NOTCH function function manipulating agent. In other aspects, methods of diagnosis and diagnostic kits are provided. For example, NOTCH receptor and/or NOTCH ligand activity and/or expression may be aberrant in various bone disorders, e.g. in bone deficiency disorders, the receptor and/or ligand may be downregulated. Diagnostic methods and kits based on assays for the receptor and/or ligand or their derivatives or breakdown products in bodily samples ( e.g. blood, urine, bone biopsies, marrow cell biopsies) are provided. Furthermore, the use of DNA based screening techniques ( so-called "DNA fingerprinting") to identify genetic polymorphisms, mutations, deletions or other alterations in an individuals genotype is provided to identify persons at risk from bone disorders, e.g. bone loss.

In other aspects, we also provide a method of screening candidate agents capable of promoting bone formation, the method comprising; a) contacting a candidate agent with a bone cell; b) measuring NOTCH function activity and/or expression; c) selecting candidate agents which activate NOTCH function.

The function manipulating agent of the present invention includes agents which affect, i.e. upregulate, the expression of

NOTCH ligand genes, e.g. the DSL domain containing genes Delta, Serrate and Jagged and gene family members thereof (identifiable by virtue of the ability of their gene sequences to hybridise to, or their homology with Delta, Serrate or Jagged, or the ability of their genes to display phenotypic interactions) . The function manipulating agent of the present invention may upregulate the expression and/or activity of the NOTCH receptor.

Other suitable function manipulating agents include agents which mimic or replicate the binding of the natural, e.g. DSL, ligand to the NOTCH receptor (including receptor family members, e.g. NOTCH 1 , NOTCH2 and NOTCH3). That is, binding of the agent to the NOTCH receptor (preferably to the 11th and 12th EGF-like repeat) leads to cleavage of the receptor, releasing the intracellular fragment NICD which translocates to the nucleus to regulate gene transcription. Alternatively such agents which bind to the same 11th and 12th EGF repeat on the NOTCH receptor to prevent binding of the natural ligand and prevent signalling Preferably such agents comprise a protein or polypeptide. Examples include a natural DSL ligand such as Delta, Serrate, Lag2, Jagged or other gene family member or functionally active fragments and analogues thereof, although agents of the present invention may be structurally and/or chemically unrelated to a natural NOTCH ligand but still retain the ability to behave as a NOTCH function function manipulating agent, particularly those that interact with the same NOTCH receptor domains as the natural ligand(s).

A preferred Notch function manipulating agent is a material which has the amino acid sequence CDDYYYGFGCNKFCRPR and preferably the agent will be a peptide or protein per se; functionally active fragments and analogues (hereinafter referred to as "17- mers") thereof; homologes having a high degree of conservation, in particular those with conserved cysteine regions and vectors therefor such as DNA vectors (plasmids or viruses) which encode peptides and proteins containing the17-mer sequence.

Sequences with DSL-like NOTCH receptor binding properties may be determined using combinatorial methods. For example, random linear peptide libraries displayed on commercially available phages, for example, FliTrx™ Random peptide library (Invitrogen) or could be screened. Alternatively, random cyclised peptides, for example, pSKAN (Display Systems) may be used Functionally active fragments and analogues may be formed by the addition, insertion, modification, substitution or deletion of one or more of the amino acid residues from or to a NOTCH e.g. DSL, ligand. Preferably active analogues and fragments are based on the DSL domain as illustrated in Figure 1 of the accompanying drawings which shows a sequence alignment of the DSL domain from various DSL ligands, showing the cysteine spacing. The 17 amino acid peptide from human Jagged-1 is underlined and is shown in bold.

The term " analogue" is also intended to embrace chimeric proteins, fusion proteins, antidiotypic antibodies, precursors and other functional equivalents or mimics to the above.

The use of the 17 contiguous amino acid sequence CDDYYYGFGCNKFCRPR or functionally active fragment or analogue thereof is also provided in the manufacture of a medicament for promoting bone formation. There is further provided a method of promoting bone formation in a, preferably, mammalian patient comprising the step of administrating an effective amount of the 17 contiguous amino acid sequence CDDYYYGFGCNKFCRPR or functionally active fragment or analogue In other embodiments, the function manipulating agent of the present invention includes agents that modulate the down-stream events following NOTCH receptor cleavage. The agent of the present invention may therefore be a NOTCH function manipulating agent, e.g. anti-sense nucleic acid, of factors that suppress activation or expression of NOTCH pathway events following NOTCH receptor cleavage.

Use of DNA vectors expresiing cDNA of NOTCH function function manipulating agents, e.g. DSL ligands functional analogues and fragments thereof, and cells transfected with constructs expressing said cDNA for promoting bone formation also forms an aspect of the present invention. cDNA and transfected cells as described above may be prepared according to standard techniques known to those skilled in the art.

The present invention further extends to gene therapy for promoting bone formation in, preferably, a mammalian patient in clinical need thereof. Gene therapy may be used to introduce NOTCH function manipulating agents (including nucleic acids encoding the NOTCH function function manipulating agent, where appropriate) to target cells via either direct or in-direct methods using for example retroviruses, adenovirus, adeno-associated virus, herpes virus or other suitable vectors, or by other methods of transfection such as liposomes, electroporation, calcium phosphate precipitated DNA, DEAE dextran, microinjection, polyethylene glycol and protein-DNA complexes. In addition gene therapy approaches may involve the introduction into cells of sequences inducing the constitutive or inducible expression of active NOTCH receptors in order that they stimulate intracellular signalling and bone formation without ligand binding. Preferably, genes encoding NOTCH Function Manipulating

Agents will be placed under the control of a bone specific promoter, e.g. that for osteocalcin.

Examples of inducible expression systems include tetracycline driven inducible systems (tet on/ tet off). The function manipulating agent of the present invention may be coupled to a "bone-seeking" substance such as a tetracycline or bisphosphonate to improve target specificity as known by those skilled in the art.

Function manipulating agents of the present invention may be manufactured according to any appropriate method of choice. Such methods include synthetic or recombinant methods or purification methods, if available, from natural sources.

Pharmaceutical compositions of the present invention may be prepared according to methods well known and called for by accepted pharmaceutical practice. Pharmaceutical compositions preferably comprise the NOTCH function manipulating agent together with a pharmaceutically acceptable carrier and are preferably in unit dosage form. Pharmaceutical compositions of the present invention may comprise a NOTCH function function manipulating agent in the form of a pro-drug which can be metabolically converted to the subject NOTCH function manipulating agent by the recipient host. For example, haloformate ester derivatives of amines/amides or alcohols which in mild acid e.g. in lower gut, hydrolyse to formyl derivatives which decomposes to the subject NOTCH function manipulating agent. Mono, di or triphosphate derivatives of phenols ( e.g. tyrosines in peptides), alcohols ( e.g. Serines in peptides) may be used to increase aqueous solubility of pro-drug. Pharmaceutical compositions may be in any form suitable for administration such as subcutaneous, intravenous, topical, e.g. skin patches, oral (for example, encasing the NOTCH function manipulating agent in liposomes or microsomes), intradermal or subdermal implantation of the NOTCH function manipulating agent in a slow-releasing vehicle.

Pharmaceutical compositions of the present invention may also be used in conjunction, e.g. simultaneously, sequentially or separately with other therapies, for example, the bisphosphonates or BMP's. Pharmaceutical compositions of the present invention may comprise other active agents such as bisphosphonates, parathyroid hormone (PTH), vitamin D, BMPs and estrogen. In another aspect, we also provide a medical device, e.g. bone screw, endoprosthesis such as a hip prosthesis, or a trauma nail such as an intramedullary nail having a bone-contacting surface comprising a NOTCH function manipulating agent.

Aptly the Notch function manipulating agent will be present as a layer, for example as a coating on the bone-contacting surface of the device. Suitably, medical devices according to the present invention may be prepared by adsorbing a NOTCH function manipulating agent peptide onto for example the titanium oxide or other surface of a metallic surface or of a polymer surface e.g. bone screw by incorporating a NOTCH function manipulating agent into a carrier material and coating the carrier onto the medical device.

In an embodiment of this aspect of the invention, the bone contacting surface has been 'derivatised' or modified such that the NOTCH Function Manipulating Agent is directly bonded, aptly by covalent bonds, to the surface. In another aspect of the present invention we provide an artificial scaffold material for promoting bone formation, the scaffold having operatively coupled thereto a NOTCH function manipulating agent.

The scaffold material may be seeded with bone cells or precursors thereof and incubated in vitro prior to implantation at a bone deficit site according to standard tissue engineering techniques.

The scaffold of the present invention may in the form of a three dimensional matrix or layer, for example, a continuous film, or gel. The matrix structure may be manufactured from fibres of a suitable material which is then textile processed ( e.g. braided, knitted, woven or non-woven, melt-blown, felted, hydroentangled) and further manipulated into a desired three dimensional shape. The matrix structure may also assume other forms, e.g. sponges or foams.

Suitable scaffold materials are preferably biodegradable and are not inhibitory to cell growth or proliferation. Preferably the materials should not elicit an adverse reaction from the patients body and should be capable of sterilisation by e.g. ethylene oxide treatment. Preferably, the material is osteoconductive. Suitable materials therefore include biodegradable polyesters such as polylactic acid (PLA), polyglycolic acid (PGA), polydioxanone, polyhydroxyalkanoates, e.g. polyhydroxybutyrate (ICI) and hyaluronic acid derivatives, e.g. HYAFF (Fidia). Further suitable materials include those disclosed in our patent applications WO 91/13638 and WO 97/06835, incorporated herein by reference such as hydrophilic polyurethanes, polyetherpolyester, polyethylene oxide, polyetherpolyamide, carboxymethylcellulose, ethylene-vinyl acetate copolymers, polybutadienes, styrene-butadiene-styrene block copolymers and the like.

Other scaffold materials are collagen based e.g. cross-linked collagen/elastin material, cross-linked collagens manufactured from acid-soluble type I bovine collagen sources, collagen gels, (for example those sold under the trade names COLLASTAT and COLETICA). Collagen from natural or recombinant sources may be used.

Modified or chaemeric recombinant fibrillar collagens (herein "modified collagen") are also provided which incorporate a NOTCH function manipulating agent and features that promote its assembly, stability and use as a biomaterial. The modified collagen may be used as a scaffold material described supra. Approaches include use of the C-terminal globular domain from type I collagen to promote triple helix formation; the removal or alteration of the collagenase cleavage site to suppress degradation; the inclusion of additional lysines to promote cross-linking and the alteration of N- terminal globular domain cleavage site to promote the retention of the N-terminal domain in the mature fibre. For example, the chordin/SOG sequence of collagen I la could be substituted for the protein/polypeptide function manipulating agent. Analogous domain shuffling approaches may be used to incorporate protein/peptide function manipulating agent into other extracellular matrix components ( e.g. fibronectin link protein or collagen IV) or ECM binding molecules or sequences (e.g. heparin binding domains). See, for example, WO 97/08311 , the entire contents of which are incorporated herein by reference. In other specific embodiments, we provide a bone substitute material comprising a composite material comprising any one of the above scaffold materials and a crystalline phase (e.g. an apatite such as hydroxyapatite) incorporating a NOTCH function manipulating agent. In a preferred aspect of the invention the Notch function manipulating agent is delivered as a scaffold in the form of a gel. In an especially preferred embodiment of the invention the gel will comprise a 17-er and at least one, more preferably all, of the components of a recombinant or non-recombinant fibrin. Typically the gel will comprise thrombin, fibrinogen and Factor XIII or another transglutaminase to cross-link the gel.

Methods of screening candidate agents for use in promoting bone formation forms another aspect of the present invention. The method comprises the step of contacting a candidate agent with a bone cell (preferably osteoblasts) in preferably an in vitro assay and measuring NOTCH function activity and/or expression. Candidate agents which activate NOTCH function can therefore be selected. Preferably, the method comprises the step of selecting a candidate agent on the basis of NOTCH function activation and increased bone formation or other marker of bone formation in the same or separate assay.

The invention also covers the development of animal models useful in the investigation of bone disorders. The role of NOTCH function in the skeletal system may be investigated using non- human mammalian, e.g. mouse, transgenic knock-outs wherein the NOTCH pathway or various components of NOTCH pathway such as the NOTCH receptor or DSL ligand can be selectively "deleted". The ability of candidate agents to rescue the DSL ligand knocked- out phenotype may be usefully exploited to screen candidate agents and also to measure efficacy and other parameters of the candidate agent. These may be generated using a number of methods, including retroviral transfer of DNA into an early stage embryo, microinjection of DNA into the male pronucleus of a fertilised oocyte or embryonic stem (ES) cells where ES cells are removed from a blastocyst, transfected with DNA in culture and then microinjected back into blastocysts. Pseudopregnant females are then implanted with the engineered embryo and subsequent transgenic offspring identified by Southern blotting or PCR. Such methodologies are standard and well-known to those skilled in the art. Non-human transgenic mammalian animals over-expressing (so-called "knock- ins") the NOTCH pathway or components thereof are also provided.

Conditional non-human mammalian transgenic knock-outs may be used wherein the knock-out is inducible or restricted to a particular bone cell-type (e.g. osteoblast). Cre is a site-specific DNA recombinase (SSR) from E.coli P1 phage which mediates recombination of two directly repeated loxP sites, resulting in the excision of the intervening "floxed" DNA fragment. Thus, essential fragments of the target gene (i.e. a NOTCH pathway component) may be knocked out. This is achieved by mating a mouse with a floxed target gene (e.g. NOTCH ligand flanked by two loxP sites) with a cre transgenic mouse. The offspring that receives both genes undergoes Cre-mediated recombination of the loxP sites, resulting in excision of the NOTCH ligand gene. Germ-line mutations in transgenic mice , which have Cre-mediated deletion of target genes in the germ-line, can be generated. NOTCH pathway knock-outs that are restricted to e.g. osteoblasts, may be generated by constructing a cre expression vector that is under the transcriptional control of a gene that is only expressed in osteoblasts.

NOTCH proteins that bind to and interact with components of the NOTCH pathway can be identified using protein- protein interaction detection systems, including yeast and mammalian two- hybrid system and phage display libraries.

Two-hybrid systems allow interactions to be detected between a bait protein (such as NOTCH receptor, ligand or effector proteins) and proteins expressed from a specific cell library (such as osteoblasts). cDNA fragments from the desired cell or tissue type are ligated into a phagemid vector containing a transcriptional activation domain for a reporter gene. The bait protein is ligated to a DNA binding domain for the reporter gene in another phagemid vector. Yeast cells are then co-transformed with both phagemid vectors. When an interacting protein from the library binds to the bait protein this brings the DNA binding and DNA activation domains into close contact, resulting in the expression of the reporter gene. The cDNA that encodes the interacting protein can then be identified and characterised. Reporter genes used in the yeast and mammalian systems include histidine, b-galactosidase, chloramphenicol acetyltransferase or firefly luciferase. Such methods may be used to identify novel NOTCH function manipulating agents for use in the present invention. The preferred two hybrid system method is use of the NOTCH human receptor as the bait protein in a mammalian system.

Phage display may be used as an alternative to the above two-hybrid system for identifying protein interactions in the NOTCH system present in bone according to methods well known to those skilled in the art. Briefly, RNA from bone is prepared from which cDNA is synthesised by first-strand synthesis. The cDNA is then cloned into a vector such as pSKAN (Display systems Biotech Inc, CA, USA) so as to express the products of the cDNA as fusion proteins on the phage glllp, physically linked within the phage particle to the encoding gene. The extracellular domain of NOTCH receptor may be generated by polymerase chain reaction (PCR) and cloned into a standard expression vector. The identity of the insert may be confirmed by DNA sequencing, N-terminal sequencing and Western blotting using anti-NOTCH antibodies. The purified protein may then be biotinylated using standard kits and coupled to steptavidin coated plates. Interacting phage clones may be identified using automated DNA sequencing using public databases. The functional activity of phage displayed sequences may be determined using standard assays for osteoblast activity.

Embodiments of the present invention may be used (including prophylactically where this is appropriate and considered to be a therapy) to treat diseases and conditions such as osteoporosis, rheumatoid arthritis, hypercalcaemia of malignancy, bone fractures (particularly compound and non-union), bone deficit sites as a result, for example, of organ transplantation procedures, bone cysts, tumours and other lytic skeletal lesions, promoting bone formation in limb lengthening procedures, osteolysis as a result of, for example, stress shielding, other implant loosening, iliac crest bone deficiency, cleft palate and other cranio-facial procedures, deep bone septis, Paget's disease, dental applications such as stimulation of alveolar bone formation following gingival diseases. It will be understood that the present invention has medical and veterinary applications.

A characteristic of NOTCH function activation is increased activity/expression of Hairy-related gene transcription (e.g. Enhancer of Split, HES family, groucho or Transducin-like Enhancer of Split (TLE)), via the actions of NICD and CSL effectors (e.g. Su(H), C- promoter binding factor (CBF1 ), RBPJ_kappa) . Alternatively, NOTCH activation may be reflected by changes in activity in the RAS/MAP kinase signalling pathway via changes in Deltex, Disabled, ABL, GRB2 and Son of Sevenless (SOS). Thus reporter gene assays may be used wherein DNA promoter constructs containing binding sites for, e.g.Su(H), are joined to a reporter gene in a suitable expression vector. Examples of reporter genes include chloramphenicol acetyltransferase (CAT), β-galactosidase, firefly and Reniila luciferase, growth hormone (GH), β-glucuronidase , alkaline phosphatase (AP) and green fluorescent protein (GFP). The expression of the reporter gene can be measured in cells, that have been transfected with the reporter gene construct after exposure to NOTCH function manipulating agents. The reporter gene can be detected by assaying for the mRNA by Northern blot analysis, ribonuclease protection assays or reverse transcription polymerase reaction (RT-PCR), by measuring the protein levels by Western blot analysis, or more conveniently by assaying for the enzymatic activity of the reporter protein. A NOTCH function manipulating agent may be identified by an increase in reporter gene expression, measured as an increase in reporter gene mRNA, protein or enzymatic activity of the protein.

The present invention will be further illustrated by reference to the accompanying drawings and the following examples

The expression of Notch receptors by bone cells suggests that the Notch signalling pathway functions in bone and that specific interactions of Notch receptors with their cognate ligands controls cell fate determination in bone. In addition to Notch receptor expression, the Notch ligand Jagged-1 is expressed on the plasma membrane of osteoblastic cells, and cleaved, releasing an extracellular fragment that includes the receptor binding (DSL) domain. Unexpectedly, and in contrast to the established dogma, whether directly or indirectly, peptides homologous to this DSL domain (JA) promote osteoblast cell differentiation and bone formation both in vitro and in vivo. In vitro, this response is impaired significantly by antisense oligonucleotides to Notch 1 receptor mRNA. Evidence is hereby presented that the metallodisintegrin ADAM 10, the orthologue of the Drosophila melanogaster metallodisintegrin Kuzbanian may be a candidate for this processing event due its subcellular localisation and catalytic activity. These observations not only demonstrate a fundamental role for constitutive Notch receptor signalling in osteogenesis but also that bone-targeted Notch receptor ligands could have therapeutic potential in the treatment of osteopenic disorders.

Thus it can be demonstrated that a number of the components of a functional notch signalling pathway are present in: a number of human pre-osteoblast cell lines and ii) rat trabecular bone. Specifically the notch receptors 1 ,2, and 3 and a putative agent (AdamlO) involved in the processing and release of the soluble jagged are showed to be present via the standard molecular technique of Northern blotting and histological techniques; namely immunocytochemistry and in situ hybridisation as described in the methods below.

The presence of the same functional pathway in both systems is illustrated in the following examples which suggest differentiation (as demonstrated in tissue culture by standard markers e.g. alkaline phosphatase and / or osteocalcin), can be replicated using in vivo models of bone repair.

In the examples and demonstrations illustrated herein the following standard materials and methods were employed: Materials

All reagents were obtained from Sigma unless otherwise stated. PCR primers and Jagged-1 peptides, J-A (aa 188-204, CDDYYYGFGCNKFCRPR) and J-C (aa 1096-1114, KRRKPGSHTHSASEDNTTN) were synthesised by Genosys (U.K.). Antisense oligonucleotides were designed and synthesised by Biognostik (Germany), the oligonucleotides used were custom designed antisense oligonucleotides to Notch 1.

Cell Culture The human osteosarcoma cell lines, MG-63, TE-85 and

SaOS-2 were obtained from European Collection of Animal Cell Cultures (Porton Down). They were grown as an adherent monolayer in Dulbecco's modified minimum essential medium (DMEM) (Life Technologies) containing 10% Foetal Calf Serum (FCS), 2mM L-glutamine, 100U/ml penicillin and 100mg/ml streptomycin. The cells were maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2- For Northern Blot analysis MG-63 cells were maintained in serum free conditions for 24 hours prior to extraction of total RNA. Primary Human osteoblast-like cells (HOB) were isolated using standard methods. Briefly, fragments of normal human trabecular bone were obtained from femoral chondyles of surgically amputated limbs obtained from patients aged between 65 and 85 years. The fragments were thoroughly rinsed free of connective tissue and debris with phosphate buffered saline (PBS). Then, trabecular explants were seeded into Petri dishes or 75crτι2 flasks and cultured in Eagle's minimum essential medium (MEM) (Life Technologies) supplemented with 10% FCS, 2mM L-glutamine, 100U/ml penicillin and 100μg/ml streptomycin. The bone explants were then incubated at 37°C in a humidified atmosphere of 95% air and 5% CO2. For Northern Blot analysis HOB cells were maintained in serum-free conditions for 24 hours prior to extraction of total RNA.

Methods: RNA Isolation Total RNA was isolated using a single step guanidinium thiocyanate purification. Briefly, 5x10^ cells were lysed in 1ml TRIZOL reagent (Life Technologies). Following addition of cholorform, RNA was recovered by aqueous phase centrifugation at

12000g at 4°C. RNA was then precipitated with isopropanol and resuspended in diethylpyrocarbonate treated water.

Methods: Reverse-transcriptase polymerase chain reaction (RT-PCR^

DNase I treatment for 1 hour at 37°C was used to remove contaminating genomic DNA. First strand cDNA was synthesised using Superscript II reverse transcriptase (Gibco BRL) primed with random hexamers (Pharmacia). Specific Primers (either specific or degenerate) were designed to allow investigation of expression Notch-1 , -2,-3 and Jagged -1 and -2 (for sequences see below). PCR was performed for 35 cycles of 94°C/30 sec, 50°C/30 sees and 72°C/30 sees. Control reactions without template were performed to confirm primer specificity.

Notch 1 i) 5' ACGCGGGCAACAAGGTC 3' ii) 5' CTCGCGGCCGTAGTAGGGGAAGAT 3' Notch 2 i) 5' CCCTGGGCTACACTGGGAAAAACTG 3' ii) 5' GGCAGGGGTTGGACGCACACTCA 3'

Notch 3 i) 5' AGACGGCGTGGGCTCCTTTTC 3' ii) 5' CGCAGCGACCCCCGTTTTGACA 3'

Jagged 1 i) S'-TGGACAAACAAACAGGACAAC-S' ii) 5'- CTCCCCCAACAACAAAAATAC-3'

Jagged 2 i) 5'-TTCCTCTCACACAAATTCACC-3' ii) 5'- TTTGCTCTCTCCTTTCATACAG-3'

The PCR products were electrophoresed on a 1 % low melting point agarose gel in Tris-Borate-EDTA (TBE). The products were excised and extracted using the Wizard DNA purification system (Promega) or Geneclean II kit (BIO 101) and ligated in the pCR2.1 vector as described by the manufacturers (Invitrogen).

DNA Sequencing

DNA sequencing was performed using ABI 373 DNA sequencer (Applied Biosystems Incorporation) using synthetic oligonucleotide primers. The DNA sequences obtained were compared to SEQNET database in order to confirm identity with Notch-1 , -2,-3 and Jagged -1 and -2.

Methods: Immunocytochemical studies in cultured cells

MG-63 cells were seeded at an initial density of 5x1θ4/cm2 and allowed to adhere overnight. The cells were rinsed with PBS then fixed in 4% paraformaldehdye for 5 minutes. The cells were blocked with 10% normal rabbit serum for 30 minutes to minimise non-specific binding. The specific Notchl antibody was added to the cells and incubated at 4°C overnight. Primary antibody binding was detected using a rabbit anti goat-TRITC-conjugated secondary antibody (1 :100 dilution) for 45 minutes. For the demonstration of intracellular localisation of ADAM 10, MG-63 cells were fixed in methanol/ acetone (1 :1 ) for 10 minutes. The procedure was essentially as described above although the nuclear stain DAPI was added simultaneously with the TRITC-labelled secondary antibody. As described above all dilutions were made in PBS, pH 7.4 and incubations performed at room temperature (unless otherwise stated) with three PBS washes prior to incubations. Negative controls received the same concentration of normal goat IgGs (Vector Laboratories) in place of primary antibody and the sections were mounted in Citifluor (Chem Lab).

Methods: Immunolocalisation of ADAM10 in neonatal rat tibiae

Longitudinal sections (7mm) of neonatal rat tibiae were collected on Vectabond treated slides (Vector Laboratories) and stored at -35°C until required. Before immunolocalisation, the sections were fixed in 4% paraformaldehyde for 5 minutes following which endogenous peroxidase activity was depleted with 3% hydrogen peroxide treatment for 30 minutes. A further preincubation was performed with 10% normal goat serum (Vector Laboroatories) for 30 minutes to block non-specific antibody binding. Sections were then incubated with the specific ADAM10 antibody (1 :200 dilution) followed by biotinylated goat anti rabbit secondary antibody (1 :200 dilution) for 15 minutes and avidin-biotinylated-peroxidase reagent (ABC Elite, Vector Laboratories; 1 :50 dilution) for a further 20 minutes. Peroxidase activity was visualised with 0.5mg/ml 3,3'- diaminobenzidine and 0.3% hydrogen peroxide. All dilutions were made in PBS, pH 7.4 and incubations performed at room temperature with three PBS washes prior to incubations. Negative controls received the same concentration of normal rabbit IgGs (Vector Laboratories) in place of primary antibody. Sections were counterstained with Haemotoxylin prior to mounting in glycerol/ PBS.

Methods: In situ Hybridisation for Notch receptor homologues. The 320 base pair region (257-577) of the Notch 2 and a 450 base pair region (position 165-330) of the Notch 3 receptor were cloned into pCR2.1 vector as described by the manufacturers (Invitrogen). Plasmid DNA was linearised using Not 1 or Hind III restriction endonucleases to allow production of sense and antisense probes which were prepared using an SP6T7 in vitro transcription kit (Promega). In situ hybridisation was performed essentially as described previously Briefly, paraformaldehyde fixed sections of neonatal rat tibiae were rehydrated in 2mg/ml glycine/PBS, and demineralised in 0.2M HCI for 20 mins before acetylation. Sections were hybridised for 4 hours at 42°C followed by post hybridisation washes, dehydration and dipping in LM1 Hypercoat emulsion (Amersham) for autoradiography.

Methods: Northern Blot Analysis

15-20mg of total RNA from TE-85, SaOS₂, MG-63 and HOBs were electrophoresed on a 1 % agarose-formaldehyde gel, transferred to a charged nylon membrane, Zetaprobe (BioRad) by capillary blotting and fixed by UV crosslinking. Membranes were prehybridised at 68°C for an hour in QuikHyb (Stratagene). The cDNA for with Notch-1 , -2,-3 and Jagged -1 and -2 were a32p. labelled using a random priming method (Boehringer Manheim). The membrane was then hybridised in QuikHyb for a further hour at

68°C in the presence of the specific probe and 100mg/ml heat- denatured salmon sperm. The membrane was washed at a final stringency of 0.1 x SSC, 0.1% SDS at 60°C and exposed to autoradiography film at -70°C. Ethidium bromide staining of the 28S ribosomal RNA band served to standardise RNA loading.

Methods: Biotinylation of plasma membranes and subcellular fractionation of MG-63 cells At approximately 85% confluency, MG-63 cell monolayers were washed with phosphate buffered saline (PBS). The cells were incubated at room temperature in the presence of Biotinamidocaproate N-hydroxy-succinimide ester (0.2mg/ml) in 40mM bicarbonate buffer for 20 minutes on a rotary shaker. The cells were washed with ice cold PBS to remove excess biotin then incubated in lysis buffer (1 % Triton X-100 in Tris buffered saline (TBS)) in the presence of an inhibitor cocktail (benzamide 1 mM, leupeptin 1 mg/ml, captopril 5mM, actinonin 2mM, E-64 1 mM) on ice for 20 minutes. The cell lysate was centrifuged at 10000g for 10 minutes following which the pellet was washed with PBS and stored at -20°C until required. Agarose-immobilised streptavidin was added to the cell supernatant and maintained at 4°C for 2 hours on a rotary shaker. Following brief centrifugation the agarose pellet was collected and washed with ice cold PBS. Fractionation samples were resuspended and boiled in 4x sample buffer and assayed for the presence of the Notchl receptor by Western Blot analysis.

In longitudinal sections of 3 day old neonatal rat tibiae, Notch- 1 receptor mRNA was expressed specifically on osteoblasts lining trabecular surfaces and on osteocytes embedded within metaphyseal trabeculae Control sections treated with sense riboprobe showed insignificant hybridisation (not shown).

A Northern Blot analysis of Notch receptor gene expression in osteoblast cell types is shown in Figure 2. The analysis shows expression of mRNA for Notchl , Notch-2 and Notch-3 receptor by MG63 (Lane 1 ), SaOS2 (Lane 2), TE-85 (Lane-3) osteoblast cell lines and primary human osteoblasts (HOB) (Lane 4). Sizes of transcripts are as indicated in the legend. Ethidium bromide staining of the 28s ribosomal RNA bands serves to standardise loading.

Demonstration 1 : The effects of Jagged 17-mer on human pre-osteoblasts in vitro

.Primary calvarial bone cells (CBCs) were treated with the 17- mer peptide (JA) and found there was an increase in osteoprogenitor differentiation as demonsrated by increased bone nodule formation alkaline phosphatase activity, and synthesis of the bone extracellular matrix protein osteocalcin, compared with cells treated with a Jagged cytoplasmic domain peptide (JC) or vehicle alone. To confirm the specificity of the JA induced response, antisense oligonucleotides specific for the Notch-1 receptor were constructed. Figure 3 illustrates the Effect of DSL domain peptides on bone formation in vitro. In the primary calvarial bone cells treated with vehicle or the JC peptide (Figs. 3A.3C) constitutive levels of nodule formation were observed. When the cells were treated with the JA peptide there was a significant induction of bone nodule formation The area of these Von Kossa stained bone nodules was assessed by image analysis. In cultures of JA-treated calvarial bone cells there was an increased in bone nodule (*p<0.05) with no significant difference in either the JC peptide or vehicle treated cultures (D). Similar increases in alkaline phosphatase were seen in JA treated culturing but not JC (E). This data is representative of at least three independent experiments.

In cells treated with this antisense oligonucleotide, synthesis of 210kDa full length and 120kDa processed immunoreactive Notch- 1 proteins was abolished in both cell lysates and subcellular fractions In Notch-1 antisense-treated calvarial osteoblasts, there was a significant reduction in alkaline phosphatase activity and osteocalcin synthesis (se Fig. 4) to lower than constitutive levels The specificity of the effect of the JA peptide was confirmed by its inability to restore to constitutive levels, expression the same markers of osteoblast differentiation in antisense treated cells. Since Jagged 1 signalling is mediated by the Notch-1 receptor in other tissues [B Bettenhausen et al., Development, 121 , 1995; C E Lindsell, et al., Cell 80, 1995; R J Fleming et al., Gene Dev 4, 1990; C J Shawber et al., Dev Biol 180, 1996], these observations implicate the same Notch 1 receptor signalling pathway as a regulatory feature of the osteogenic process.

Methods: Antisense Studies.

For antisense studies the calvarial osteoblasts were cultured as described in the presence or absence of 2.5μM of the Notch-1 receptor antisense or scrambled oligonucleotides from Biognostik. Bone nodule formation, alkaline phosphatase activity and osteocalcin synthesis were used as markers to osteoblastic differentiation.

As can be seen from the data given in Figure 4, the calvarial bone cells treated with the Notch 1 antisense oligonucleotideexhibited a significant reduction in constitutive alkaline phosphatase activity (^**p<0.01) and osteocalcin synthesis (*p,0.05). The presence of the JA peptide within the culture could not significantly overcome the inhibitory effects of the antisense oligonucleotide.

Methods: Alkaline phosphatase

Calvarial osteoblasts were cultured initially as described above. The cells were incubated in the presence of DMEM containing 10% FCS, 100mg/ml L-ascorbic acid phosphate alone, in the presence of the DSL peptides and/or Notch 1 receptor antisense oligonucleotides. The treatments were changed every 2-3 days during the experimental period (14-21 days). Cultures were then washed with PBS and then incubated in the presence of 5mM p- nitrophenyl phosphate (5-20 minutes) following which endogenous Alkaline phosphatase activity (nmol) was assessed colourimetrically (Sigma Diagnostics). For each treatment alkaline phosphatase activity was standardised for total cellular protein (Biorad) and expressed as nmol of Alkaline phosphatase/ per min/per mg protein. Alkaline phosphatase activity and standard errors of the mean (n=4) were computed. Statistical analysis was performed using ANOVA with Tukey's test. MG-63 cells were seeded at an initial density of 5x10⁴/ per well in 24 well plates (Corning) and allowed to adhere overnight in DMEM containing 10% FCS. The culture medium was changed to DMEM containing 10% FCS, 100mg/ml L-ascorbic acid phosphate (Wako) alone, in the presence of the DSL peptide and/or Notchl receptor antisense oligonucleotides. The treatments were changed every 2 days during the experimental period (7 days).

Methods: Nodule assay

Calvarial osteoblasts were derived from 2-3 day old rats. Osteoblasts were seeded at an initial density of 7x10^/ per well in 24 well plates (Corning) and allowed to adhere overnight. The culture medium was then changed to DMEM containing 10% FCS,100mg/ml L-ascorbic acid phosphate (Wako), plus vehicle, peptide J-A or JC (10μM). Cultures were then washed with PBS, fixed for 10 min. in 4% paraformaldehyde in PBS and mineralised nodules stained by incubation with 3% silver nitrate (Von Kossa's stain). The total nodule area for each well of the 24-well plate was measured using an image analyser (Leica Q500MC). For each experiment the mean nodule area per well and standard errors of the mean (n=8) were computed. Statistical analysis was performed using ANOVA with Tukey's test. Demonstration 2: The effects of full-length extracellular jagged-1 on human osteoblasts in vitro

This Demonstration is given to show that the release of a soluble full-length extracellular domain of a Notch Function Manipulating agent (jagged-1 ) has an osteogenic effect in cultures of a bone cell line MG63. The evidence suggests the soluble Notch Function Manipulating agen may be more osteogenic than the membrane bound form.

Members of the metallodisintegrin family have been implicated in proteolysis of membrane-anchored growth factors, cytokines, receptors and more recently the Notch receptor ligand, Delta [ H L Qi, et al., Science 283, 91 , 1999]. To determine whether ADAM 10 could play a similar role in the processing of membrane- associated Notch-1 receptor and/or its cognate ligand Jagged-1 , fluoresecent flow cytometry and Western blot analysis was performed using a specific Jagged-1 extracellular domain antibody (JagEC). Analysis if FITC-labelled MG-63 cells showed the presence of a sub-population of cells defined on the basis of their plasma membrane expression of the amino terminus of Jagged-1. Marked alterations in cellular fluoresence was observed when in the cells were incubated in the presence of recombinant ADAM 10 (Fc- ADAM10) and its phylogenetic family member TNFalpha convertase (TACE), which suggests that both of these metallodisintegrins have the capacity to process membrane-associated Jagged-1 (Figure 5). These observations were confirmed by Western blot analysis in which a 47kDa immunoreactive protein, consistent with JagEC, was detected within supernatant of ADAM10-treated MG-63 cells (not shown).

To show the effects of this ability of ADAM 10 to process Jagged-1 , MG-63 cells with exogenous ADAM 10 were treated in the presence or absence of PMA and the non specific hydroxamate based metalloproteinase inhibitor, BB94(batimastat). ADAM 10 but not PMA induced processing of Jagged-1 releasing the N-terminal domain into the media. This event was partially inhibited by BB94. In MG-63 cells transfected with an active ADAM10 construct, there was increased proteolytic cleavage, leading to the same release of Jagged-1 into the media. To confirm that this released JagEC domain was active and able to regulate bone cell differentiation, alkaline phosphatase activity was assessed in the cells transfected with the ADAM 10 construct. In cells transfected with ADAM10 there was an approximate 50% increase in alkaline phosphatase activity when appropriate osteoinductive agents were also present.

Methods: Construction of AdamlO expression constructs

The Fc-ADAM10 construct was by Celltech (Slough, UK). The Fc-ADAMIO catalytic domain fusion protein (Fc-ADAM10 CAT) was expressed in a stable NSO mouse myeloma line. The cells were then grown under serum-free conditions in the presence of ampicillin and the most productive clones were identified by two site ELISA for the human IgG Fc domain as previously described (Amour et al, 1998). In brief, using the eukaryotic expression vector pEE12.2 the ADAMIOmetalloproteinase domain was fused to the human lgG1 hinge region and heavy chain constant domains. Purified Fc- ADAM10 CAT protein was then obtained using Protein A chromatography. The fusion protein was then eluted with 0.2 M, glycine pH 2.9, and dialysed overnight against PBS. Methods: Concentration and analysis of Media

Conditioned media or supernatant were concentrated 5x using a Centricon filter (Amicon,) unless otherwise stated. The concentrated media was resuspended and boiled in 4x reducing sample buffer and assayed for the presence of the Jagged 1 extracellular domain by Western Blot analysis. Briefly, the samples were analysed using SDS-PAGE and transferred onto nitrocellulose membrane and blocked with 5% dried milk in Tris buffer saline containing 0.05% Tween-20 (TBS-T) for an hour to minimise non specific binding. The primary Jagged-1 antibody was diluted (1g/ml) in TBS-T containing 0.1 % dried milk as carrier and then incubated for one hour. Primary Jagged-1 antibody recognition was detected using a horse radish peroxidase (HRP)-labelled rabbit anti-goat lgG(1 :3000) for a further hour. Specific antibody binding was visualised by ECL (Amersham) with 2-5 minute film exposure Methods: Treatment of Subconfluent MG63 Cells.

Subconfluent MG63 cells were treated with EDTA, washed, fixed with paraformaldehyde, and then blocked with normal goat serum to eliminate non-specific binding then incubated with the specific Jagged N-terminal domain peptide antibody (20-41 ) for 1 hour at RT. Control samples were incubated with normal goat IGG instead of the specific antibody. After washing, the cells were incubated with a FITC conjugated rabbit antigoat secondary antibody, then passed through a Beckton Dickson FACS SCAN. 5- 10,000 cells were analysed per sample and dead cells gated out. Methods: Western Blot Analysis

Western Blotting was undertaken using standard techniques. Briefly, subcellular fractions of MG-63 cells were analysed using SDS-PAGE and transferred onto polyvinylidenedifluoride (PVDF) membrane and blocked with 5% dried milk for an hour. The primary Notch 1 antibody was diluted (1 :300), secondary rabbit anti- goat IgG (1 :3000) in TBS containing 0.05% Triton X-100 and 0.1% dried milk as carrier. Antibody binding was visualised by ECL (Amersham) with 5-10 minute film exposure.

Figure 5 illustrates the flow cytometry analysis of Jagged-1 expression and processing by ADAM 10. Antibodies were used to recognise non-specific interaction of the secondary antibody (A) and specific Jagged 1 (B). Total cellular fluorescence observed in the presence of Jagged 1 antibody shows a population of MG-63 cells expressing the Jagged-1 extracellular domain (JagEC) on the plasma membrane. Alteration of total cellular fluorescence, when the cells are pre-treated with ADAM 10, correlates with a reduction in plasma membrane-associated JagEC (C).

Figure 6 demonstrates that processing of Jagged-1 occurs in these cell but at low levels The phorbol ester, PMA did not induce this proteolytic event. Specific cleavage of Jagged 1 by ADAM 10 correlates with the generation of a 47kDa immunoreactive protein and this processing event can be inhibited by the metalloproteinase inhibitor BB94. Lack of responsiveness to PMA, mirrors the absence of enhanced ADAM 10 gene expression in response to PMA by Northern blot analysis (unpublished data).

Figure 7 illustrates the effect of overexpression of ADAM10 on alkaline phosphatase. Transfection of MG63 cells with an overexpression construct of Adam 10 involves shedding of a protein that results with Jagged antibodies into the medium (A). Lane 1 Control medium

Lane 2 Medium from cells overexpressing Adam 10.

Alkaline phosphatase activity in response to overexpression of Adam 10 in the presence or absence of osteo inductive agents (OID). Vector alone + OID causes constitutive alkaline phosphatase activity. ADAM 10 overexpression alone does not alter alkaline phospatase expression significantly but in the presence of OID ADAM 10 overexpression causes a highly significant increase in activity compared with controls (P<0.01 ). Example 1 The effects of jagged-1 17-mer injected directly into medullary cavity of long bones

The following example demonstrates the osteogenic effect of the core 17mer when applied in solution to a model of long bone repair.

Three groups of 6-14 week old male B6CBA mice were anaesthetised. Injections were performed by injecting obliquely in a distal direction through the medial aspect of the tibia into the medullary cavity, avoiding contact with the opposite endosteal surface. Group A received JA peptide (5μg)in 25ul of phosphate buffered soution (PBS), group B received the same weight of sham peptide JC (5μg) in 25ul of PBS and group C was injected with the same volume (25μl) of the PBS vehicle. Subcutaneous injections of the same compounds were injected subcutaneously over the medial aspect of the opposite leg. On the 1st and 5th days, were also injected subcutaneously (at a remote site) with the fluorochrome calcein, to mark sites of bone mineralisation. One week after the final injection, the animals were euthanased and the tibiae processed for plastic embedding after which they were sectioned and viualised by UV confocal microscopy. Areas of new bone formation were measured a standard distance from the distal end of the tibial tuberosity using an image analysis system. All analysis was performed blind.

To determine whether the same soluble Notch ligands could also promote osteogenesis in vivo, the JA or JC peptides were injected directly into the medullary cavity of Wistar rats on a single occasion. At the end of the experimental period, significant induction of intramedullary bone formation in animals treated with the JA peptide (p<0.05,*) was observed but not in the animals treated with JC or vehicle alone. The new bone formation was not associated with outgrowth from the endosteal surface, but had been initiated de novo from within the bone marrow (Figure 8). Interestingly, in similar studies performed by subcutaneous injection over the tibial periosteal surface, no osteogenic response was observed (data not shown). The differences in osteogenic responsiveness to the JA peptide at these locations is therefore consistent with the differences in Notch receptor expression shown at those sites within the skeleton.

In transverse sections of the tibia, UV microscopy illustrated by Figure 8 revealed little or no osteogenic response to ultra medullary injections of vehicle or JC( Figs 8A.8C). However in animals treated with the JA peptide new intramedullarly bone formation was observed (*p<0.05) that was not associated with outgrowth from the endosteal surface, but that had been initiated within the marrow cells (Fig 8B). The amount of intramedullary bone formation was assessed by image analysis.

Example 2 The effects of Jagged-1 17mer loaded in fibrin in the rat calvarial defect model

The following example supplies an enabling disclosure for the repair of defects in calvarial bone using a medicament of the invention when supplied within a fibrin gel.

The osteogenic potential of a 17 amino acid base Jagged-1 peptide was assessed in a rat cranial defect model. This model has been described previously (Bosch et al., 1998); where two full depth bilateral defects, each of 5 mm diameter, are created with a burr and trephine, through the perietal bones of the cranium to the dural surface of brain. Full repair of these defect with new cortico- cancellous bone has been previously described not to have occured by 12 months, and the defect is described as of "critical size", being the smallest intraosseous defect that will not heal by bone formation during the lifetime of the animal.

Under general anaesthetic, a 5 mm diameter single defect was created in each of the perietal bones of skeletally mature Sprague Dawley rats, weighing a minimum of 450g. Jagged peptide (17-mer) was delivered to the left defect site in a fibrin gel at final concentrations of 100 mM and 25 mM. Gels were prepared according to the following instructions. Jagged peptide was added to Formulation Buffer (10 mM Tris/CI pH 7.4, 100 mM NaCI, 20 mM Lysine, 20 mM Arginine. Fibrinogen (46mg/ml) was mixed with the peptide solution at a ratio of 3:1. Thrombin at an activity of 50 U/ml (prepared in formulation buffer with 50 mM CaCI₂) was added in a ratio of 1 :10 to the Fibrinogen/peptide solution immediately prior to delivery of the solution to the freshly created defect. Following mixing, 10 ml of sample was injected into the defect. Addition of the thrombin to the solution initiated setting of the gel within 1 minute of its delivery at the site. The defect created in the right parietal bone was used as a control site and was either left unfilled, or was implanted with unloaded fibrin gel. The defects were observed until the solutions gelled. The overlying soft tissues were sutured and the skin was closed using standard surgical techniques. Animals were returned to cages and observed while they recovered from the anaesthetic. Twice daily observations were made throughout the duration of the study. At 28 days the animals were sacrificed by overdose and the cranium was removed. Radiographs were taken of the explanted crania, which were then placed in formalin, prior to histological processing

Bone repair was evaluated by radiographical interpretation of tissue within the defect sites, and by histological microscopic examination. Radiographs were scored for percentage of radiographically opaque material within the defect site.

1. Bosch C, Melsen B and Vargervik K (1998) Importance of the critical-size bone defect in testing bone-regenerating materials Histological assessment of 5 m coronal sections stained with heamotoxylin and eosin show the cranial defects implanted with Jagged/fibrin gel to be filled with newly created bone identified by collagen characteristic of that seen in repairing bone (Figure 9B) wheras at the control site connective tissue only was present indicating that there was no spontaneous bone formation.

As is shown in Figure 10 sites implanted with Jagged peptide had opaque material covering 84%+/-9, (n=6) of the defect. In comparison, sites filled with control fibrin gels showed material covering an average of 53% +/-22 (n= 7), and control defect sites 69%+/-12, (n=5).

Claims

1. A medicament for the treatment of diseases or clinical conditions featuring or characterised by bone deficiency comprising a Notch function manipulating agent which does not inhibit differentiation of progenitor or stem cells to mammalian osteoblasts.

2. The medicament as claimed in any one of claims 1 to 3 wherein the manipulating agent up-regulates the expression and/or activity of the Notch receptor.

3. The medicament as claimed in any one of claims 1 to 3 in which the manipulating agent binds to the Notch receptor.

4. The medicament as claimed in any one of claims 1 to 3 in which the manipulating agent contains a protein or peptide having the amino acid sequence CDDYYYGFGC NKFCRPR or functionally active fragments, analogues or derivatives thereof or DNA vectors encoding said protein or peptide.

5. The medicament as claimed in claim 4 wherein the protein or polypeptide is selected from the group: Delta, Serrate, Lag 2 Jagged or functionally active fragments, analogues, homologues or derivatives thereof.

6. The medicament as claimed in any one of claims 1 to 5 wherein the Notch function manipulating agent is coupled with a bone seeking agent.

7. The medicament of claim 6 wherein the bone-seeking agent is a tetracycline or bisphosphonate.

8. The medicament of any of claims 1 to 7 further comprising a bone morphogenic protein or an oestrogen.

9. A medical device having a bone-contacting surface comprising a medicament as claimed in any one of claims 1 to 8.

10. A medical device as claimed in claim 9 wherein the medicament is a surface layer.

11. A medical device as claimed in claim 10 wherein the surface layer is a coating.

12. Amedical device as claimed in any of claims 9 to 11 wherein the medicament is chemically bonded to a derivatised bone- contacting surface.

13. A medical device as claimed in any one of claims 9 to 11 wherein the device is a bone screw, an endoprosthesis or a trauma nail.

14. A medical device as claimed in claim in any one of claims 9 to 11 wherein the device comprises a scaffold.

15. A medical device as claimed in claim 13 wherein the scaffold is constructed from a biodegradable polymeric material.

16. A medical device as claimed in either claim 13 or claim 14 wherein scaffold is a gel comprising a pharmaceutically acceptable carrier for said medicament.

17. A medical device as claimed in claim 15 wherein the gel comprises thrombin or fibrinogen.

18. A medical device as claimed in claim 15 or 16 wherein said gel comprises recombinant or non-recombinant fibrin.

19. A medical device as claimed in any one of claims 9 to 18 wherein the medicament comprises a protein or peptide having the amino acid sequence CDDYYYGFGC NKFCRPR or functionally active fragments, analogues or derivatives thereof or DNA vectors encoding said protein or peptide.

20. Use of a Notch function manipulating agent in the manufacture of a medicament for the treatment of diseases or clinical conditions featuring or characterised by bone deficiency.

21. Use as claimed in claim 20 wherein the Notch function manipulating agent comprises a protein or peptide having the amino acid sequence CDDYYYGFGC NKFCRPR or functionally active fragments, analogues or derivatives thereof or DNA vectors encoding said protein or peptide

22. A method of promoting bone formation comprising the step of administrative an effective amount of a Notch function agonist.

23. A method as claimed in claim 22 wherein the Notch function manipulating agent comprises a protein or peptide having the amino acid sequence CDDYYYGFGC NKFCRPR or functionally active fragments, analogues or derivatives thereof or DNA vectors encoding said protein or peptide.