WO2000024778A1 - Epitopes peptidiques specifiques de hla-a2 et hla-dr derives de la trp2 de l'antigene du melanome - Google Patents

Epitopes peptidiques specifiques de hla-a2 et hla-dr derives de la trp2 de l'antigene du melanome Download PDF

Info

Publication number
WO2000024778A1
WO2000024778A1 PCT/US1999/024887 US9924887W WO0024778A1 WO 2000024778 A1 WO2000024778 A1 WO 2000024778A1 US 9924887 W US9924887 W US 9924887W WO 0024778 A1 WO0024778 A1 WO 0024778A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
hla
lymphocytes
melanoma
mammal
Prior art date
Application number
PCT/US1999/024887
Other languages
English (en)
Inventor
Maria R. Parkhurst
Steven A. Rosenberg
Yutaka Kawakami
Paul F. Robbins
Original Assignee
The Government Of The United States Of America Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America Represented By The Secretary, Department Of Health And Human Services filed Critical The Government Of The United States Of America Represented By The Secretary, Department Of Health And Human Services
Priority to AU15985/00A priority Critical patent/AU1598500A/en
Publication of WO2000024778A1 publication Critical patent/WO2000024778A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to the area of cancer diagnostics and therapeutics. More specifically, the invention relates to the identification of novel HLA-A2 and HLA-DR specific epitopes from the melanoma antigen tyrosinase-related protein 2 (TRP2) and their use in diagnostic methods. The invention further relates to pharmaceutical compositions which employ these peptides, therapeutically and prophylactically.
  • TRP2 melanoma antigen tyrosinase-related protein 2
  • T lymphocytes can mediate the regression of melanoma.
  • TIL autologous tumor infiltrating lymphocytes
  • CTL tumor reactive cytotoxic T lymphocytes
  • TRP2 tyrosinase-related protein 2
  • TRP2 has been identified as a melanoma antigen recognized by tumor reactive CTL in both the mouse (12) and human (13).
  • B16 reactive CTL lines generated from splenocytes of C57BL/6 mice immunized with irradiated B16 melanoma cells recognized a TRP2(181-188) (VYDFFVWL: SEQ ID NO: 4) antigen in the context of H-2K b .
  • T cell line raised by repeated in vitro stimulation of murine splenocytes with the TRP2 (181- 188) peptide recognized B 16 melanoma and eliminated 3 day old established pulmonary micrometastases in vivo (12).
  • the TRP2 (197-205) (LLGPGRPYR: SEQ ID NO: 56) peptide was identified as the HLA-A31 restricted epitope recognized by a CTL clone derived from a population of TIL (TIL586).
  • TIL586 CTL clone derived from a population of TIL
  • the adoptive transfer of this TIL with IL-2 into the autologous patient resulted in an objective clinical response (13).
  • the same peptide was also recognized by an independent TIL (TIL 1244) in the context of HL A- A33 (14).
  • HLA-A31 and HLA-A33 were only expressed in 6% and 2% respectively of the 412 melanoma patients referred to the National Cancer Institute (15).
  • HLA-A2 is expressed in about 47% of melanoma patients in the United States with the most common subtype HLA-A * 0201 expressed in approximately 98% of the HLA-A2 positive patients in North America (16).
  • the expression of non-mutated melanoma antigens is heterogeneous among tumors isolated from different patients and between individual cells from single lesions, the development of immunotherapies based on as many antigens as possible may be clinically beneficial. Therefore, to increase the number of patients eligible for TRP2 based treatments, it is desirable to identify additional HLA-A2 restricted epitopes from the TRP2 protein.
  • the invention relates to the identification of HLA-Class I and -Class II restricted epitopes present in tyrosinase-related protein 2, and analogs of the epitopes.
  • the invention relates to the identification of HLA-A2 restricted epitopes present in the 519 amino acid melanoma antigen known as tyrosinase-related protein 2 (TRP2).
  • TRP2 tyrosinase-related protein 2
  • the invention relates to a nine-amino acid peptide designated TRP2 (180-188) which has the amino acid sequence SVYDFFVWL and is demonstrated to induce cytotoxic T lymphocytes (CTL) which specifically react with, and lyse, melanoma cells in the context of HLA-A*0201.
  • CTL cytotoxic T lymphocytes
  • the invention further relates to analogs of TRP2 (180-188) which are capable of specifically reacting with, and lysing, melanoma cells in the context of HLA- A*0201.
  • the invention therefore also relates to nucleic acid sequences which encode TRP2 (180-188) and analogs thereof.
  • the invention further relates to a diagnostic method which utilizes TRP2 (180-188) and/or analogs thereof to detect melanoma in a mammal.
  • the invention also relates to pharmaceutical compositions which comprise TRP2 (180-188), and/or analogs thereof, either alone or in combination with other HLA-A2 specific peptides encoded by TRP2 or other melanoma antigens, and the use of these compositions in the prevention or treatment of melanoma in a mammal.
  • the invention further relates to pharmaceutical compositions which comprise nucleic acid molecules encoding TRP2 (180-188), and or analogs thereof, either alone or in combination with nucleic acid sequences encoding other HLA-A2 specific melanoma antigen peptides and the use of these compositions in the prevention or treatment of melanoma in a mammal.
  • the invention therefore also relates to methods of producing a TRP2 (180-188)-specif ⁇ c T cell response in a mammal utilizing the compositions of the invention.
  • the present invention further relates to isolated T cells having specific reactivity to the TRP2 (180-188) peptide or analogs thereof, to methods of preparing such T-cells, to the use of such T cells as diagnostics and therapeutic reagents, and to pharmaceutical compositions comprising the T cells.
  • the invention also relates to target cells, preferably dendritic cells, which have been incubated in vitro with the TRP2 (180-188) peptide and or analogs thereof, to the use of such target cells as diagnostic and therapeutic reagents, and to pharmaceutical compositions which comprise the target cells.
  • target cells preferably dendritic cells, which have been incubated in vitro with the TRP2 (180-188) peptide and or analogs thereof, to the use of such target cells as diagnostic and therapeutic reagents, and to pharmaceutical compositions which comprise the target cells.
  • the invention relates to TRP2 peptides having at least 9 amino acids and derived from TRP2 which comprise the amino acid sequence Xaa, LPYWNFAT Xaa ⁇ , wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II.
  • the invention further relates to nucleic acid sequences which encode a TRP2 peptide comprising at least 9 amino acids comprising the amino acid sequence Xaa, LPNWNFAT Xaaj and analogs thereof, wherein Xaa, any one of 20 naturally occurring amino acids, preferably is an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa j is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II.
  • Another aspect of the invention is a vector comprising nucleic acid sequences which encode a TRP2 peptide comprising at least 9 amino acids and comprising the amino acid sequence Xaa, LPYWNFATXaa,, and analogs thereof, wherein Xaa, any one of 20 naturally occurring amino acids, preferably is an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II.
  • inventions are host cells transformed or transfected by the vector encoding a TRP2 peptide and optionally are transformed or transfected with an HLA-Class II molecule and the use of the host cells as immunogens or vaccines against cancer.
  • the invention further provides a diagnostic kit and a diagnostic method which utilizes the TRP2 peptides having at least 9 amino acids comprising the amino acid sequence Xaa, LPYWNFATXaa;, wherein Xaa, any one of 20 naturally occurring amino acids, preferably is an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa j is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II or analogs thereof, or the nucleic acid sequence encoding same, or complementary nucleic acid sequence to detect melanoma in a mammal.
  • Another aspect of the invention is a pharmaceutical composition
  • the invention further relates to pharmaceutical compositions which comprise nucleic acid sequences encoding a TRP2 peptide comprising at least 9 amino acids and comprising the amino acid sequence Xaa, LPYWNFATXaa ⁇ wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa j is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class H, or combinations thereof, alone or in combination with nucleic acid sequences encoding other HLA Class Il-specific melanoma antigen peptides for use in the prevention or treatment of melanoma in a mammal.
  • the invention further relates to methods of producing an HLA-Class II restricted T cell response to a TRP2 peptide having at least 9 amino acids and comprising the amino acid sequence Xaa,LPYWNFATXaa 2 wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and XaO is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II, in a mammal utilizing the compositions of the present invention.
  • the present invention further relates to isolated T cells having specific reactivity to a TRP2 peptide having at least 9 amino acids and comprising the amino acid sequence Xaa,LPYWNFATXaa 2 wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa, is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II to methods of preparing the specific T cells, and the use of the T cells as a diagnostic and therapeutic use.
  • Xaa is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid
  • Xaa is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class
  • APC antigen presenting cells
  • TRP2 antigen presenting cells
  • TRP2 peptide having at least 9 amino acids and comprising the amino acid sequence Xaa,LPYWNFATXaa 2 wherein Xaa, any one of 20 naturally occurring amino acids, preferably is an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof which are recognized by immune cells in the context of HLA Class II or analogs thereof for use as a diagnostic or therapeutic reagent.
  • APC antigen presenting cells
  • Another obj ect of the invention is to provide a method of monitoring the efficacy of a cancer vaccine therapy in a mammal comprising (A) isolating T lymphocytes from the vaccine-treated mammal (B) measuring immunoreactivity of the T lymphocytes in the presence of the TRP2 peptide having at least 9 amino acids and comprising the amino acid sequence Xaa,LPYWNFATXaa 2 wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa, is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof, an enhancement of immunoreactivity in comparison to immunoreactivity of control lymphocytes is indicative of efficacy.
  • the present invention also relates to polyclonal, monoclonal and recombinant antibody elicited by and immunoreactive with, the TRP2 peptide having at least 9 amino acids and comprising the amino acid sequence Xaa,LPYWNFATXaa 2 wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid and Xaa j is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid, and analogs thereof for use as a diagnostic and/or therapeutic reagent.
  • FIGURES Figure 1 A through IF show the lysis of TRP2 (180-188) peptide pulsed target cells by bulk CTL from patients following 6 in vitro restimulations of the CTL with peptide-pulsed target cells.
  • Specific lysis of control T2 cells(i.e. T2 cells not pulsed with peptide) was compared to that of T2 cells pulsed with 1 M TRP2 (180-188) by CTL from patients AN (a), MU (b), and KU (c) in 4 hr 51 Cr release cytotoxicity assays.
  • the invention relates to the identification of HLA Class I or HLA Class II restricted peptides from the melanoma antigen, tyrosinase-related protein 2.
  • the invention relates to the identification of an HLA-A2 restricted peptide epitope, from the melanoma antigen tyrosinase-related protein 2 (TRP2).
  • TRP2 melanoma antigen tyrosinase-related protein 2
  • This peptide designated TRP2 (180-188) was identified by screening TRP2 derived peptides for the ability to induce cytotoxic T lymphocytes (CTL) which specifically react with, and lyse, melanoma cells in the context of HLA-A*0201.
  • CTL cytotoxic T lymphocytes
  • the invention therefore relates to the amino acid sequence of TRP2 (180- 188), which is shown in SEQ ID NO: 1, or analogs thereof where the term analog as used throughout the specification and claims in context of HLA Class I molecules refers to sequences which are biologically equivalent to the native TRP2 (180-188) peptide in that they are able to induce cytotoxic T lymphocytes (CTL) which specifically react with, and lyse, melanoma cells in the context of HLA- A * 0201.
  • CTL cytotoxic T lymphocytes
  • TRP2 (180-189) (SVYDFFVWLH, shown as SEQ ID NO: 3) constitutes an analog of TRP2 (180-188).
  • analogs of TRP2 include sequences in which one or more residues of SEQ ID NO:l have been conservatively substituted such that the analog is biologically equivalent to the native TRP2 (180-188) peptide.
  • conservative substitutions include the substitution of one-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.
  • the phrase "conservative substitution” also includes the use of a chemically derivatized residue in place of a non-derivatized residue provided that the resulting peptide is biologically equivalent to the native TRP2 (180-188) peptide.
  • Preferred positions to be conservatively substituted in TRP2 (180-188) (SEQ ID NO:l) or its analog TRP2 (180-189) (SEQ ID NO: 3) include, but are not limited to, position 1 (residue 180), position 2 (residue 181) and the carboxy-terminal position (residue 188 in TRP2 (180-188) and residue 189 in TRP2 (180-189) ).
  • TRP2 (180-188) include, but are not limited to, substitution of either leucine or methionine at position 2 and the substitution of leucine for valine at the carboxy terminus.
  • the present invention further relates to the identification of an HLA Class II restricted peptide epitope from the melanoma antigen tyrosinase-related protein 2 and the equivalent peptide epitope from TRP-1.
  • the HLA Class II restricted TRP2 peptides of the present invention are HLA-DR restricted, preferably HLA- DRB 1*1501 or 1502 restricted.
  • the HLA Class II restricted TRP2 peptides of the present invention are expressed on melanomas derived from the majority of individuals that express the major histocompatibility complex
  • HLA-DRB1*1501 or 1502 which is expressed in the Caucasian population at a frequency of between 9 an 19%.
  • the HLA Class II restricted TRP2 peptides and analogs of the present invention are identified by the ability to induce helper T lymphocytes which specifically react with the peptide in the context of peptide pulsed antigen presenting cells expressing the appropriate HLA-Class II molecule.
  • the invention provides a HLA Class Il-restricted peptide of TRP2 comprising an amino acid sequence of at least about nine amino acids in length.
  • the HLA Class Il-restricted peptides of the present invention are as long as about 32 amino acids, preferably less than about 22 amino acids in length, more preferably between about 9 amino acids and about 16 amino acids in length.
  • the peptide comprises the amino acid sequence Xaa,LPYWNFATXaa 2 (SEQ.
  • Xaa is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acid; and Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid.
  • the HLA Class II restricted TRP2 peptides of the present invention of the general formula, Xaa, LPYWNFATXaa; may variably comprise one to about 11 additional amino acids at the N-terminus and/or one to about 11 additional amino acids at the C-terminus.
  • the HLA Class II restricted TRP2 peptide is represented by the formula, Xaa 3 Xaa,LPYWNFATXaa 2 Xaa 4 (SEQ ID NO: 71) wherein Xaa 3 comprises from zero to about 11 amino acids in length, preferably from zero to about 16 amino acids; and Xaa 4 comprises variably from zero to about 11 amino acids in length, preferably from zero to about 16 amino acids in length.
  • Xaa 3 and Xaa 4 may be any of the 20 naturally occurring amino acids.
  • Xaa 3 comprises the amino acid sequence Asp Leu Gin Arg Leu He Gly Asn Glu Ser Phe (SEQ ID NO: 72).
  • Xaa 4 comprises Arg. In yet another embodiment Xaa 4 comprises Arg Asn Glu Cys Asp Val Cys Thr Asp Gin Leu (SEQ ID NO: 73).
  • Other embodiments of the HLA Class II restricted TRP2 peptides invention comprise LPYWNFATG (SEQ. ID NO: 61); ALPYWNFAT (SEQ. ID NO: 62); ALPYWNFATG (SEQ. ID NO: 63); SLPYWNFATG (SEQ. ID NO: 64); QLPYWNFATG (SEQ. ID NO: 65); VLPYWNFATG (SEQ. ID NO: 66); ALPYWNFATGR (SEQ. ID NO: 67); FALPYWNFATG (SEQ. IF NO: 68); LQRLIGNESFALPYWNFATG (SEQ. ID NO: 69); ALPYWNFATGRNECDVCTDQ (SEQ. ID NO: 70) and analogs of each sequence.
  • Analogs of the HLA-Class II restricted TRP2 peptides of the present invention are those peptides having one or more substitutions in the consensus binding motif which results in equivalent or enhanced immuno logical responses as compared to the native motif.
  • an analog of the sequence ALPYWNFAT comprises a single substitution of Phe or He in place of Tyr or a single substitution of He, Leu, Val, or Met in place of Phe, or a combination of substitutions at each position.
  • an analog of the sequence ALPYWNFAT comprises a single substiution of Phe, Tyr, or He in place of Tip or a single substitution of He, Leu, Val, Met, or Phe, in place of Ala, or combinations of substitutions at each position.
  • Class II restricted TRP2 peptides or analogs thereof can be synthesized by automated instruments sold by a variety of manufactures or can be commercially custom-ordered and prepared.
  • the peptide can be expressed from nucleic acid sequences which are capable of directing synthesis of the peptide using recombinant DNA methods known to those of ordinary skill in the art, and purified by methods known in the arts.
  • the present invention also encompasses a nucleic acid sequence encoding a HLA-Class I restricted peptide derived from TRP-2 or encoding an HLA- Class II restricted peptide derived from TRP-2.
  • the nucleic acid sequence of the entire native TRP2 gene is disclosed in U.S. Patent No. 5,831,016 incorporated herein by reference.
  • the invention therefore relates to the nucleic acid sequence encoding TRP2 (180-188) and its analogs with a preferred nucleic acid sequence shown as SEQ ID NO: 2 (AGTGTTTATGATTTTTTTGTGTGGCTC).
  • the invention further relates to the nucleic acid sequence encoding an HLA-Class II restricted TRP2 peptide.
  • the nucleic acid sequence encodes a peptide comprising Xaa, LPYWNFATXaa, or analogs thereof, wherein Xaa, is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acd; and Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid.
  • Xaa is any one of 20 naturally occurring amino acids, preferably an amino acid selected from the group consisting of Ala, Gin, Val, Ser, Leu, He or no amino acd
  • Xaaj is any one of 20 naturally occurring amino acids, preferably Gly, or no amino acid.
  • nucleic acid sequences which are functionally equivalent to the sequences described herein are intended to be encompassed within the present invention.
  • the invention further relates to expression vectors comprising the nucleic acid sequences encoding the HLA Class I restricted TRP2 (180-188) or analogs thereof or comprising the nucleic acid sequences encoding the HLA-Class II restricted TRP2 peptide or analogs thereof.
  • Any expression vector that is capable of carrying and expressing the nucleic acid sequences encoding the HLA Class I restricted TRP2 (180- 188) or the HLA Class II restricted TRP2 peptides or analogs thereof in prokaryotic or eukaryotic host cells may be used including but not limited to recombinant virus such as vaccinia, fowlpox or adenovirus and the like.
  • the invention also encompasses host cells transformed, transfected or infected with the vector to express the HLA-Class II restricted TRP2 peptide or analog thereof.
  • the host cell may endogenously express an appropriate HLA-Class II molecule or may be recombinantly engineered to express an exogenous HLA Class II molecule, using methods known in the art.
  • HLA-A2 is the most commonly expressed family of class I MHC molecules in melanoma patients in the United States with an estimated frequency of 47% and HLA-A * 0201 is the most common subtype, being expressed in approximately 98% of the HLA-A2 positive patients in North America.
  • the MHC Class II allele HLA-DRB1*1501 and 1502 is expressed in the Caucasian population at a frequency of between 9 and 19%.
  • the HLA Class I and HLA Class II restricted TRP2 peptides may be used to screen for melanomas.
  • the present invention also relates to the use of the HLA-Class I restricted TRP2 (180-188) peptide and/or analogs thereof and use of HLA-Class II restricted TRP2 peptides in a method for detecting the presence of melanoma in a mammal, where, as used in this application, the term melanoma includes, but is not limited to, melanomas, metastatic melanomas, melanomas derived from either melanocytes, melanocarcinomas, melanoepitheliomas, melanosarcomas, melanoma in situ, superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral lentiginous melanoma, invasive melanoma or familial atypical mole and melanoma (FAM-M) syndrome.
  • HLA-Class I restricted TRP2 180-188
  • HLA-Class II restricted TRP2 peptides
  • the method of detecting melanoma involves isolating cytolytic T lymphocytes (CTLs) from peripheral blood, lymph nodes or spleens of a mammal using methods known to those skilled in the art and, coincubating the CTLs in vitro with target cells pre-exposed to either TRP2 (180-188) peptide and/or analogs thereof, or to expression vector containing the nucleic acid sequences encoding the TRP2 (180-188) peptide or analogs thereof.
  • Ratios of CTL to target cells to be used in the method range from about 1:1 to about 100:1.
  • Target cells to be used in the method include, but are not limited to, HLA-A2 + TRP2 + melanoma cell lines, HLA-A * 0201 + T2 cells pulsed with TRP2 (180- 188) and or analogs thereof, or antigen presenting cells such as B cells, dendritic cells, macrophages, Langerhan cells pulsed with TRP2 (180-188) and/or analogs thereof as defined above.
  • Target cells also include but are not limited to HLA-DRB1*1501 + or 1502 + B cells, melanoma cells, antigen presenting cells and the like pulsed with a HLA Class II restricted TRP2 peptide or analog thereof or recombinantly expressing the HLA- Class II restricted TRP peptide or analog thereof.
  • the helper T cell response or CTL response to the target cells can be determined by a variety of methods including measuring cytokine release by the helper T cells or CTLs following coincubation with the target cells or by measuring lysis of the target cells by
  • cytokine release by the helper T cells or CTLs is to be utilized as an indicator of the production of a specific helper T cell or specific CTL response to the TRP2 peptides or analogs thereof
  • the cytokine release can be measured by methods known to those skill in the art including immunoassays such as ELISAs and radioimmunoassays.
  • a preferred cytokine to assay for release from stimulated CTLs is IFN as described in the Examples.
  • Other cytokines which can be measured include, but are not limited to, GM-CSF, TNF and IL-2.
  • the lysis of target cells can be measured using methods known to those skilled in the art including the 51 Cr-release assay described in Example 2.
  • cytokine release by the CTLs or specific lysis of target cells by CTLs as measured above is then compared to the cytokine secretion or lysis of target cells by CTLs coincubated in vitro with target control cells where control cells include, but are not limited to, HLA-A2 " TRP2 + or HLA-A2 + TRP2 " cells, or T2 cells or dendritic cells not exposed to peptide.
  • control cells include, but are not limited to, HLA-A2 " TRP2 + or HLA-A2 + TRP2 " cells, or T2 cells or dendritic cells not exposed to peptide.
  • a two-fold or more increase in cytokine release or cytolytic activity as compared to that of the control cells indicates the presence of melanoma.
  • the present invention also relates to methods of treating a mammal having melanoma.
  • the method comprises exposing T lymphocytes, preferably autologous cytotoxic lymphocytes or tumor infiltrating lymphocytes obtained from a patient with melanoma, in vitro to a TRP2 peptide and/or analogs thereof, either alone or in combination with other HLA-A2-restricted epitopes from TRP 2, or in combination with other HLA-DR restricted epitopes from TRP2, or other melanoma antigens to elicit TRP2 specific CTLs or helper T lymphocytes, and administering the TRP2 specific CTLs or helper T lymphcytes to the mammal.
  • T lymphocytes preferably autologous cytotoxic lymphocytes or tumor infiltrating lymphocytes obtained from a patient with melanoma
  • TRP2 peptide and/or analogs thereof either alone or in combination with other HLA-A2-restricted epitopes from T
  • HLA- A* 0201 restricted epitopes have been identified to date from 6 known melanoma antigens: MART-1 (17), gplOO (6, 7, 18- 20), tyrosinase (21), MAGE-3 (22, 23), N-acetylglucosaminyl-transferase-V (GnT-V) (24), and the melanocyte-stimulating hormone receptor MC1R (4) (the epitopes disclosed in references 4, 6, 7 and 17-24 are hereby incorporated by reference), immunotherapies utilizing HLA-A*0201 specific antigens are applicable to a large number of patients.
  • lymphocytes can be subjected to repetitive in vitro stimulation to produce peptide-specific lymphocytes having a greater capacity to recognize human tumor antigens.
  • the method of treating a mammal having melanoma comprises immunizing the mammal with the HLA Class I restricted TRP2 peptide and/or analogs thereof in an amount effective to elicit a HLA Class I restricted TRP2 (180-188) peptide-specific response.
  • the TRP2 (180-188) peptide and/or analogs thereof can be fused with an endoplasmic reticulum signal peptide as described in U. S. patent 5,733,548, hereby incorporated by reference, and the resulting chimeric protein administered to a mammal in an amount effective to prevent melanoma.
  • the method of treating a mammal having a melanoma comprises immunizing the mammal with a HLA-Class II restricted TRP2 peptide, analog, or combination thereof in an amount effective to elicit a HLA-Class II restricted TRP2 peptide specific response.
  • the method may further provide cytokines such as IL- 2, IL-4, and the like, or adjuvants such as RLBI-DetoxTM, alum, and the like for enhancement of the immune response.
  • the HLA-Class II restricted TRP2 peptides of the present invention may also be provided in the form of a TRP2 peptide-protein carrier conjugate, for enhancing the immune response.
  • Protein carriers which may be used include but are not limited to Pseudomonas exotoxin, poly-L-lysine and the like as are known in the art.
  • an expression vector containing the nucleic acid sequences encoding the TRP2 peptide or analogs thereof may be administered to the mammal having melanoma in an amount effective to elicit a TRP2 peptide-specific response.
  • TRP2 peptide or nucleic acid sequences encoding the peptide could be administered to the mammal in combination with other HLA-A2 restricted epitopes or other HLA-Class II restricted epitopes from TRP2 or melanoma antigen such as those identified in MART-1, gplOO, tyrosinase, MAGE-3, GnT-V and MC1R as disclosed above.
  • CTL populations or helper T lymphocyte populations reactive against the TRP2 peptide may then be isolated from a peripheral blood sample or spleen cells of the mammal immunized with the peptide or expression construct from about 3 to about 30 days after immunization.
  • Epstein-Barr virus (EBV) can be used to immortalize human lymphocytes or a human fusion partner can be used to produce human-human hybridomas.
  • CTLs or helper T lymphocytes are cultured for about 7 to about 90 days (3) and then screened to determine the clones of the desired reactivity against the TRP2 peptide using known methods of assaying T cell reactivity; CTLs or helper T lymphocytes producing the desired reactivity are thus selected.
  • the selected CTLs or helper T lymphocytes may be administered via one of several routes including but not limited to intravenous, intraperitoneal, intramuscular or subcutaneous.
  • a preferred route of administration is intravenously.
  • a dosage of about 10 7 to about 10 11 CTLs or helper T lymphocytes is desirable to provide the recipient with a dosage of about 10 7 to about 10 11 CTLs or helper T lymphocytes.
  • a preferred dosage is about 5xl0 9 to about 5x10 10 lymphocytes.
  • the invention further relates to CTLs or helper T lymphocytes having specific reactivity to the TRP2 peptide, and to the use of such CTLs or helper T lymphocytes as diagnostic and therapeutic agents.
  • TRP2 180-188 specific CTLs can be used diagnostically to screen target cells (i.e. antigen presenting cells such as dendritic cells, macrophages and Langerhan cells) from a patient by measuring lysis of target cells following coincubation with the peptide-specific CTLs, wherein lysis of the target cells indicates that the patient has melanoma.
  • target cells i.e. antigen presenting cells such as dendritic cells, macrophages and Langerhan cells
  • TRP2 specific CTLs or helper T lymphocytes can be used prognostically to detect HLA-A2 + TRP2 + target cells or HLA-DRB1*1501 + or 1502 + TRP2 + target cells. If such target cell were isolated from a patient's tumor and were recognized by the TRP2 specific CTLs or helper T lymphocytes, the indication would be that the tumor was a melanoma.
  • the method of treating a mammal having melanoma comprises administering target cells which have been exposed in vitro to the TRP2 (180-188) peptide and or analogs thereof or the MHC Class II restricted TRP2 peptide or analogs thereof to a mammal in an amount effective to elicit a specific T lymphocyte response to the TRP2 peptides.
  • TRP2 180-188 peptide and or analogs thereof or the MHC Class II restricted TRP2 peptide or analogs thereof
  • dendritic cells cultured for about 1 week in vitro with about 1000 u ml GM-CSF and 1000 u/ml IL-4 and pulsed with the TRP2 peptide and/or analogs thereof can be administered intravenously to a mammal at a dosage of about lxl 0 8 to about 2xl0 8 cells.
  • the invention therefore also relates to target cells which have been exposed in vitro to the TRP2 (180-188) peptide and/or analogs thereof or the MHC Class II restricted TRP2 peptide or analogs thereof.
  • These target cells can be used as diagnostic and therapeutic reagents.
  • target cells which have been incubated in vitro with the TRP2 (180-188) peptide and/or analogs thereof can be used diagnostically to screen CTLs from a patient by measuring lysis of the target cells following incubation with the CTLs, wherein lysis of the target cells indicates that the patient has melanoma.
  • target cells which have been incubated in vitro with the peptide may be used to screen for peptide-specific helper T lymphocytes from a patient by measuring IFN- ⁇ release.
  • the present invention further relates to a method of preventing melanoma in a mammal, said method comprising administering to the mammal an effective amount of the TRP2 (180-188) peptide and or analogs thereof, alone or in combination with other HLA-A2-restricted epitopes from TRP2 or other melanoma antigens in an amount effective to prevent melanoma in the mammal.
  • the present invention also relates to a method of preventing melanoma in a mammal, comprising administration of an effective amount of an HLA Class II restricted TRP2 peptide and/or analog thereof.
  • the present invention further relates to a method of preventing melanoma in a mammal, said method comprising administering to the mammal an effective amount of an expression vector containing nucleic acid sequences encoding the TRP2 (180-188) peptide and/or analogs thereof, alone or in combination with other HLA-A2-restricted epitopes from TRP2 or other melanoma antigens in an amount effective to prevent melanoma in the mammal.
  • the present invention also relates to a method of preventing melanoma in a mammal, said method comprising the administration of an effective amount of an expression vector containing nucleic acid sequences encoding an HLA-Class II restricted TRP2 peptide or analog thereof to prevent melanoma in the mammal.
  • the nucleic acid sequence encoding at least one MHC Class II restricted peptide may be used directly as an immunogen or vaccine using techniques utilizing "naked" DNA which is directly injected into muscle or skin, or linked to a lipid molecule.
  • the efficacy of the vaccine can be assessed by production of immune cells that recognize the tumor antigen, as assessed by specific lytic activity, specific cytokine production, tumor regression or a combination of these approaches.
  • the vaccine can be administered in conjunction with other molecules such as immunomodulators, for example, IL-2, IL-6, IL-10, IL-12, IL-15, interferon, tumor necrosis factor and the like, adjuvants, chemotherapeutic drugs such as cisplatinum, antiviral such as gancyclovir, amphotericin B, antibiotics and the like.
  • the HLA Class I restricted TRP2 (180-188) peptide and or analogs thereof or the HLA-Class II restricted TRP2 peptide and/or analog thereof may be administered via one of several routes including but not limited to subcutaneous, intradermal, intramuscular, intrathecal, intrapleural, intrauterine, rectal, vaginal, topical, intratumor and the like. Administration may also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation.
  • Such penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be by nasal sprays, for example, or suppositories.
  • the TRP2 peptide or analog thereof is formulated into conventional oral administration form such as capsules, tablets.
  • a preferred route of administration of peptide is via subcutaneous injection in IF A (incomplete Freund's adjuvant).
  • TRP2 peptide or analogs thereof effective to prime, stimulate and/or cause the clonal expansion of peptide-specific T lymphocytes and/or helper T lymphocytes, preferably cytotoxic T lymphocytes, which in turn are capable of preventing or inhibiting melanoma in the recipient.
  • a preferred dosage of TRP2 peptide or an analog thereof is of at least about 1 pg per kg bodyweight, more preferably at least about lng per kg bodyweight, and most preferably at least about l ⁇ g or greater per kg bodyweight of the recipient.
  • nucleic acid of the invention When nucleic acid of the invention is utilized in the method of preventing or treating melanoma, preferred routes of administration are intramuscularly and intradermally, and vectors containing the sequences are administered at a dosage of about 1 to about 10 mg.
  • the dose of peptide or nucleic acid is administered at least once and may be provided as a bolus or a continuous administration. Multiple administrations of the dose over a period of several weeks to months may be preferable. Subsequent doses may be administered as indicated. In general, it is desirable to provide DNA vectors at a dosage of about 1 to about 10 mg, at about 4 week intervals, and peptides at a dosage of about 1 mg, at about 3-4 week intervals.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an HLA-Class I or HLA-Class II restricted TRP2 peptide and/or analogs thereof, alone or in combination with different HLA-A2-restricted epitopes from TRP2, or one or more different HLA-Class II restricted epitopes from TPR2, a combination thereof, or other melanoma antigens.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an expressing vector comprising the nucleic acid sequence encoding an HLA-Class I or HLA-Class II restricted TRP2 peptide and/or analogs thereof, alone or in combination with HLA-A2-restricted epitopes from TRP2, an HLA-Class II restricted epitope from TRP2, or other melanoma antigens.
  • the TRP2 peptides of this invention or analogs thereof may be formulated alone or with any other HLA-A2-restricted epitopes from TRP2, an HLA- Class II restricted epitope from TRP2, or other melanoma antigens with pharmaceutically acceptable carriers into pharmaceutical compositions by methods known in the art.
  • the compositions may further comprise at least one immunostimulatory molecule where immunostimulatory molecules to be used in conjunction with the TRP2 peptide for stimulating antigen specific T cell responses include, but are not limited to, one or more major histocompatibility complex (MHC) molecules, such as class I and class II molecules.
  • MHC major histocompatibility complex
  • composition may further comprise other stimulator molecules including B7.1, B7.2, ICAM-1, ICAM-2, LFA-1, LFA-3, CD72 and the like, and cytokines which include but are not limited to IL-1 through IL-15, TNF ⁇ , IFN ⁇ , RANTES, G-CSF, M-CSF, IFN ⁇ , CTAP III, ENA-78, GRO, 1-309, PF-4, IP-10, LD-78, MGSA, MlP-l ⁇ , MIP-1 ⁇ , or combination thereof, and the like for immunopotentiation.
  • cytokines which include but are not limited to IL-1 through IL-15, TNF ⁇ , IFN ⁇ , RANTES, G-CSF, M-CSF, IFN ⁇ , CTAP III, ENA-78, GRO, 1-309, PF-4, IP-10, LD-78, MGSA, MlP-l ⁇ , MIP-1 ⁇ , or combination thereof, and the like for immunopotentiation.
  • the present invention also encompasses antibody elicited by, and immunoreactive with, the HLA-Class II restricted TRP2 peptides.
  • the antibody may be polyclonal, monoclonal, chimeric, or recombinant antibody.
  • Recombinant antibody includes, but is not limited to single chain antibody which may be made by methods known in the art.
  • the antibody of the present invention has utility as a diagnostic reagent in assays to detect cancer cells and in assays to monitor cancer vaccine therapy.
  • the antibody may be provided in kit form along with other standard reagents for immunoassays.
  • the antibody of the present invention may be used therapeutically in the form of a pharmaceutical composition to inhibit the growth of cancer cells expressing TRP2 peptides.
  • the Skmel23 human melanoma cell line was kindly provided by Thierry Boon (Ludwig Institute for Cancer Research, Brussels, Belgium), and A375 was purchased from American Type Culture Collection (Rockville, MD). All other human melanoma cell lines were established in our laboratory (31). Melanoma cell lines and T2 cells (HLA-A*0201 + peptide transporter associated protein deficient T cell-B cell hybrid-(32) were routinely cultured in RPMI1640 (Mediatech, Herndon, VA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Bio fluids, Rockville, MD) and 2 mM L-glutamine (Biofluids). The COS-7 monkey kidney cell line was kindly provided by W.
  • CM complete medium
  • TRP2 mRNA in melanoma cell lines was previously assessed by Northern Blot analysis (13).
  • the expression of HLA-A2 was evaluated by FACS using an anti-HLA-A2 monoclonal antibody (One Lambda, Canoga Park, CA), and for some cell lines, DNA sequencing confirmed the presence of HLA-A*0201 (HLA laboratory, National Institutes of Health, Bethesda, MD).
  • the expression of TRP2, HLA-A2 or HLA-A*0201 in melanoma cell lines was as follows: 397mel (HLA-A2 " , TRP2 + ), 888mel (HLA-A2 " , TRP2 + ), A375 (HLA-A*0201 + , TRP2 ),
  • COS-7 cells expressing HLA-A*0201 and TRP2 or MART-1 were generated by co-transfection (Lipofectamine Plus; Gibco) with cDNAs encoding these proteins (pCDNA3 plasmid; Invitrogen). Peptide synthesis and HLA-A *0201 binding affinity assays
  • Candidate peptides were selected from TRP2 which conformed to a permissive HLA-A*0201 binding motif were selected from TRP2 based on the following set of criteria: (1) peptides which bind with high affinity to HLA-A*0201 are generally 9 or 10 amino acids in length and contain L or M at the second position from the amino-terminus (P2) and V or L at the carboxy-terminus (P9 or P10) (30); (2) amino acids at secondary anchor positions, most notably PI and P3, can significantly affect peptide binding to HLA-A*0201 (28; 29); and (3) many previously identified HLA-A*0201 restricted epitopes from nonmutated melanoma antigens are 9 amino acids in length and have a dominant residue at P2 or the C-terminus, but not both primary anchor positions (37; 38).
  • GILGFNFTL SEQ ID NO: 57
  • Fmoc fluorenylmethoxycarbonyl
  • AMS 422 Gilson Co., Worthington, OH
  • MART-l(27-35) AAGIGILTV: SEQ ID NO: 58
  • the relative binding affinity of each TRP2 peptide to HLA-A* 0201 was experimentally determined on the basis of the inhibition of binding of a standard radiolabeled peptide to purified MHC molecules as previously described (33). Briefly, the test peptide was coincubated at various concentrations (1 nM to 100 mM) with soluble HLA-A*0201 heavy chain, human ⁇ 2 -microglobulin, and 5 nM 125 I-labeled HBc (18-27) with Y substituted at P6 (FLPSDYFPSN: SEQ ID NO: 59). The concentration of the test peptide necessary to inhibit the binding of the iodinated peptide by 50% (ID 50 ) was calculated.
  • TRP2 (217-225) was purified (>95%) by reverse- phase HPLC on a POROS 10 column (PerSeptive Biosystems, Cambridge, MA) using a 0.05% trifluoroacetic acid/water-acetonitrile gradient, and the molecular weight was verified by mass spectrometry (Bio-Synthesis, Inc.).
  • TRP2(180-188) and the FluMl peptide were commercially synthesized, purified (>95%), and characterized by amino acid analysis (Peptide Technologies).
  • the binding affinities of TRP2 peptides to HLA-A*0201 were evaluated on the basis of the inhibition of binding of a standard radiolabeled peptide to purified MHC molecules (33).
  • the concentration of test peptide necessary to inhibit the binding of the standard peptide by 50% (ID 50 ) was calculated, and peptide binding affinity was defined as high (ID 50 ⁇ 50 nM), intermediate (50 nM ⁇ ID 50 ⁇ 500 nM), or weak (500 nM ⁇ ID 50 ).
  • TRP2 Recognition of TRP2 by bulk T cell cultures was evaluated about 7 days after each stimulation on the basis of IFN ⁇ secretion by CTLs in response to T2 cells preincubated with peptide, HLA-A2 + TRP2 + melanoma cells, or, in some experiments, COS-7 cells expressing HLA-A*0201 and TRP2.
  • T2 cells were incubated with peptide 1 to 3 hr at 37° C and were either used directly (peptide-loaded) or were washed twice prior to use (peptide-pulsed).
  • 10 5 responder T cells were coincubated with 10 5 stimulator cells (250 ⁇ l total) about 20 hr at 37° C, and the concentration of human IFN ⁇ in coculture supernatants was measured using a commercially available ELISA kit (Endogen, Cambridge, MA).
  • 4 hr 51 Cr release cytotoxicity assays were also performed to evaluate the recognition of TRP2 by bulk CTL as previously described (36). Briefly, 51 Cr-labeled T2 cells were incubated with 1 ⁇ M peptide for about 1 hr at 37° C and washed twice. These cells and 51 Cr-labeled melanoma cells were coincubated with effector cells (peptide stimulated CTLs) (5000 targets/well; multiple E:T ratios; 150 ⁇ l total) 4 hr at 37° C, and the radioactivity in coculture supernatants was determined by gamma counting. The percent specific lysis of target cells by CTL was calculated, and spontaneous 51 Cr release from target cells never exceeded 20% of the maximum.
  • effector cells peptide stimulated CTLs
  • Peptide binding affnity to HLA-A*0201 was evaluated by measuring the concentration of peptide necessary to inhibit the binding of a standard radiolabeled peptide by 50% (IDso). Relative binding affnity was defined as high (I DsO ⁇ 50 nM), intermediate (50 n M ⁇ I DsO ⁇ 500 nM ), or weak (ID50>500 nM).
  • IDso concentration of peptide necessary to inhibit the binding of a standard radiolabeled peptide by 50%
  • Relative binding affnity was defined as high (I DsO ⁇ 50 nM), intermediate (50 n M ⁇ I DsO ⁇ 500 nM ), or weak (ID50>500 nM).
  • Peptide Sequence ID No Sequence ID 50 (nM) 1
  • Example 1 Identification of HLA-A*0201 Binding Peptides From TRP2 Of the 51 TRP2 peptides which fit the extended HLA-A* 0201 binding motif as described in the Methods section, only 16 actually bound to HLA-A*0201 with high (ID 50 ⁇ 50 nM)or intermediate affinity (50 nM ⁇ ID 50 ⁇ 500 nM) (Table 1).
  • TRP2 peptides with ID 50 ⁇ 2000 nM were used to stimulate peripheral blood lymphocytes (PBL) in vitro from 4 HLA-A*0201 + patients with metastatic melanoma.
  • T cell cultures were established by plating peripheral blood mononuclear cells (PBMC) in 24 well plates (1.5xl0 6 cells/ml; 2 ml/well) in CM containing peptide (5 ⁇ g/ml for TRP2 peptides or 2 ⁇ g/ml for MART- 1(27-35)) and GM-CSF (200 U/ml; PeproTech, Rocky Hill, NJ) and IL-4 (100 U/ml; PeproTech) to promote the differentiation of dendritic cells (34).
  • PBMC peripheral blood mononuclear cells
  • CM containing peptide 5 ⁇ g/ml for TRP2 peptides or 2 ⁇ g/ml for MART- 1(27-35)
  • GM-CSF 200 U/ml
  • PeproTech Rocky Hill, NJ
  • IL-4 100 U/ml; PeproTech
  • rIL-2 Choiron Co., Emeryville, CA
  • lymphocytes were restimulated with peptide-pulsed autologous PBMC as previously described (35). 2 LFN ⁇ secretion in response to peptide-loaded T2 cells and HLA-A2 + TRP2 + melanomas was measured 7 days after the third and fourth restimulations (days 32 and 39).
  • responder lymphocytes were harvested and replated in new 24-well plates (2 5xl0 5 cells/ml, 2 ml/well) m CM
  • TRP2 In patients HU and IN, TRP2 (431-439), TRP2 (180-188), TRP2 (217-225), and MART-1 (27-35) induced peptide reactive T cells, and in patient CA, peptide specific CTL were generated with TRP2 (476-484) and TRP2 (217-225). However, no TRP2 peptide induced CTL specifically recognized HLA-A2 + TRP2 + melanoma cells; only T cells from patients HU and IN stimulated with the positive control peptide MART-1 (27-35) specifically secreted IFN ⁇ in response to HLA-A2 + melanomas (data not shown).
  • PBL from additional HLA-A*0201 + melanoma patients were stimulated in vitro with the two TRP2 peptides which most efficiently induced peptide-reactive CTL in the initial screening: PBL from 4 HLA-A*0201 + melanoma patients (MU, KU, AN, and WE) were stimulated in vitro with TRP2(180-188), and PBL from 4 separate patients (MC, WO, LE, and CA) were stimulated with TRP2(217-225) using a standard protocol which had previously been used successfully to generate melanoma reactive CTL with peptides from MART-1 and gplOO (40, 41).
  • PBMC peripheral blood mononuclear cells
  • culture medium containing 1 ⁇ M peptide (instead of 5 ⁇ g/ml) without GM-CSF and IL-4, and 300 IU/ml IL-2 was added two days later.
  • the lymphocytes were then restimulated weekly with peptide-pulsed autologous PBMC as described above (see footnote 2) beginning at day 7 (instead of day 1 las in the initial screening), except that the PBMC were added to the responsive lymphocytes at a responder to stimulator ratio of about 1:10.
  • IFN ⁇ secretion in response to peptide-loaded T2 cells, COS-7 cells expressing HLA- A*0201 and TRP2, and HLA-A2 + TRP2 + melanoma cells was measured about 7 days after each stimulation beginning at one week.
  • Tfrelevant peptide IFN ⁇ release in response to T2 cells preincubated with 5 g/ml of the peptide used for PBL sensitization.
  • **underlined values indicate that LFN ⁇ release in response to T2 cells preincubated with the relevant peptide was >50 pg/ml and at least twice background with either media or T2 cells pre-loaded with the FluMl peptide.
  • TRP2(217- 225) Specific peptide recognition by bulk CTL stimulated with TRP2(217- 225) was apparent as early as week 3 from one patient (WO), and by week 5, T cell cultures from 3 of the 4 patients (MC, WO, and LE) specifically released IFN ⁇ in response to peptide-loaded T2 cells. Similar to the initial TRP2 peptide screening, none of the bulk cultures stimulated with TRP2(217-225) recognized COS-7 transfectants or HLA-A2 + TRP2 + melanoma cells (data not shown).
  • TRP2 (180-188) induced peptide reactive T cells from 2 of 4 patients (KU and MU) after only 2 restimulations (week 3). More significantly, at week 3, bulk CTL from patient KU specifically secreted IFN ⁇ when cocultured with COS-7 cells expressing HLA-A*0201 and TRP2 and HLA-A2 + TRP2 + melanoma cells. By week 5, the same pattern of recognition was observed by CTL from patient MU.
  • IFN ⁇ release by CTL was measured in response to T2 cells pulsed with various concentrations of TRP2 (180-188) between 10 '5 and 10 "12 M.
  • Peptide-induced CTL from patients KU and MU recognized TRP2 (180-188) pulsed on T2 cells at a concentration of 10 "9 M, whereas T cells from patient AN did not specifically release IFN ⁇ at a peptide concentration below 10 "7 M.
  • This correlated with specific tumor recognition in that IFN ⁇ release by T cells from patient AN in response to HLA-A2 + TRP2 + melanoma cells was generally lower than that from patients KU and MU (Table 3).
  • ⁇ underlined values indicate that IFN ⁇ release in response to T2 cells preincubated with TRP2(180-188) or HLA-A2 + TRP2 + targets was >50 pg/ml and at least twice background with any HLA-A2 " or TRP2 " target.
  • Specific lysis of peptide-pulsed T2 cells and melanomas by CTL induced with TRP2 (180-188) was also measured at week 7 in 4-hr 51 Cr-release cytotoxicity assays. CTL from all 3 patients specifically lysed T2 cell pulsed with 1 ⁇ M TRP2 (180-188) compared to T2 cells without exogenous peptide (Fig. 1 a-c).
  • Example 2 The lack of specific melanoma recognition by bulk T cell cultures stimulated with TRP2(180-188) in the initial peptide screening in Example 2 may have been due to a technical difference between that experiment and the latter.
  • PBL were stimulated with peptides in vitro using a protocol which had been used successfully to generate melanoma reactive CTL with MART-1 and gplOO peptides (40, 41).
  • This protocol differed from that used in the initial peptide screening in that GM-CSF and IL-4 were absent in the initial culture period, and the first restimulation was performed on day 7 as opposed to day 11.
  • TRP2 (180-188) (SVYDFFVWL) is a melanosomal enzyme expressed in most mammalian melanocytic cells and may represent an ideal target antigen for the immunotherapeutic treatment of patients with melanoma.
  • This protein has previously been identified as a melanoma antigen recognized by tumor reactive T cells in the context of HLA-A31 (13) and HLA-A33 (14). However, the frequencies of these alleles among melanoma patients in the United States are low compared to that of HLA-A*0201 , which is the most commonly expressed class I HLA allele in the
  • TRP2(180-188) may be valuable for the development of vaccines for the treatment of patients diverse in HLA expression since a supermotif has been defined for a family of MHC molecules including 4 subtypes of HLA-A2 (HLA- A*0201, HLA-A*0202, HLA-A*0205, and HLA-A*0206) and two independent class I HLA molecules (HLA-A*6802 and HLA-A*6901 ) which bind small peptides with aliphatic residues at P2 and the C-terminus (67), and TRP2(180-188) conforms to this supermotif since it contains L at P9 and V at P2.
  • TRP2(180-188) may therefore bind with high affinity to 6 class I MHC molecules in addition to HLA-A*0201 and H-2K b (unpublished data).
  • the TRP2(180-188) peptide was predicted to be within the top 25 highest binding affinity peptides for HLA-A*0201 (ranked #2), HLA-A*0205 (ranked #1), HLA-A3 (#22), HLA-B7 (#14), HLA-B*3901 (#8), HLA-Cw*0301 (#1), and HLA-Cw*0602 (#12).
  • TRP2(180-188) is likely to be presented on the surfaces of melanomas expressing a wide variety of class I HLA molecules.
  • the monkey kidney cell line COS was transfected with cDNAs that encoded a number of the melanocyte antigens that had previously been shown to be recognized by HLA class I restricted T cells.
  • cDNAs that encoded a number of the melanocyte antigens that had previously been shown to be recognized by HLA class I restricted T cells.
  • the autologous EBV B cells were pulsed with COS transfectants, it was found that cells that had been transfected with a construct encoding human TRP-2 were stimulatory (Table 5).
  • purified recombinant TRP-2 protein was recognized by clone 7 T cells (Table 6). Table 5
  • Tumor cells were treated for 48 hours with interferon gamma (IFN- ⁇ ) before use as stimulators.
  • IFN- ⁇ interferon gamma
  • A5 ALPYWNFATGRNECDVCTDQ >500 3250
  • SLPYWNFATG is derived from the sequence of TRP-1, a gene product with a very similar sequence to TRP-2.
  • the substitution of S for A at the first position in the sequence does not appear to affect recognition, implying that recognition of cells expressing these gene products would be very similar. This in fact was shown to be true by the transfection of autologous EBV B cell with constructs encoding TRP-1 and TRP-2 (Table 8). Recognition of both gene products was observed using fusion constructs containing the invariant chain (Ii) amino terminal 80 amino acids, which was used to target these products to the class II presentation pathway. In addition, recognition of the TRP-1 and TRP-2 gene products was also observed in the absence of the Ii targeting sequence.
  • Synthetic peptides derived from the melanocyte-stimulating hormone receptor MC1R can stimulate HLA-A2-restricted cytotoxic T lymphocytes that recognize naturally processed peptides on human melanoma cells. Cancer Res., 57: 4348-4355, 1997.
  • Simultaneous humoral and cellular immune response against cancer-testis antigen NY-ESO-1 definition of human histocompatibility leukocyte antigen (HLA)-A2- binding peptide epitopes. J.Exp.Med., 187: 265-270, 1998. ⁇ .Kawakami, Y., Eliyahu, S., Delgado, C.H., Robbins, P.F., Sakaguchi, K, Appella, E., Yannelli, J.R., Adema, GJ., Miki, T., and Rosenberg, S.A. Identification of a human melanoma antigen recognized by tumor-infiltrating lymphocytes associated with in vivo tumor rejection. Proc.Natl.Acad.Sci.U.S.A., 91: 6458- 6462, 1994.
  • a peptide recognized by human cytolytic T lymphocytes on HLA-A2 melanomas is encoded by an intron sequence of the N-acetylglucosaminyltransferase V gene. J.Exp.Med., 183: 1173- 1183, 1996. 25. Parker, K.C., Bednarek, M.A., Hull, L.K., Utz, U., Cunningham, B., Zweerink, H.J., Biddison, W.E., and Coligan, J.E. Sequence motifs important for peptide binding to the human MHC class I molecule, HLA-A2. J.Immunol, 149: 3580- 3587, 1992.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention porte sur de nouveaux épitopes restreints des classes I et II de HLA dérivés de la protéine 2 apparentée à la tyrosinase de l'antigène du mélanome, ainsi que de nouveaux épitopes restreints de HLA-A*0201 présents dans la protéine 2 apparentée à la tyrosinase (TRP2) de l'antigène du mélanome. L'invention porte aussi sur un peptide à neuf acides aminés appelé TRP2 (180-188), dont il a été démontré qu'il pouvait induire des lymphocytes T cytotoxiques (CTL), lesquels réagissent spécifiquement à des cellules présentant un mélanome et les lysent dans le cadre de HLA-A2 ou HLA-A*0201. L'invention porte en outre sur un peptide à neuf acides aminés dérivé de TRP2, qui induit des lymphocytes T auxiliaires dans le cadre de HLA-DR. L'invention porte enfin sur des méthodes diagnostiques et des compositions pharmaceutiques qui mettent en oeuvre ledit antigène associé aux tumeurs à des fins thérapeutiques ou prophylactiques.
PCT/US1999/024887 1998-10-26 1999-10-22 Epitopes peptidiques specifiques de hla-a2 et hla-dr derives de la trp2 de l'antigene du melanome WO2000024778A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15985/00A AU1598500A (en) 1998-10-26 1999-10-22 Hla-a2 and hla-dr specific peptide epitopes from the melanoma antigen trp2

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10557798P 1998-10-26 1998-10-26
US60/105,577 1998-10-26

Publications (1)

Publication Number Publication Date
WO2000024778A1 true WO2000024778A1 (fr) 2000-05-04

Family

ID=22306609

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/024887 WO2000024778A1 (fr) 1998-10-26 1999-10-22 Epitopes peptidiques specifiques de hla-a2 et hla-dr derives de la trp2 de l'antigene du melanome

Country Status (2)

Country Link
AU (1) AU1598500A (fr)
WO (1) WO2000024778A1 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003016342A2 (fr) * 2001-08-17 2003-02-27 Aventis Pasteur Limited Antigenes tumoraux pour la prevention et/ou le traitement du cancer
EP1377304A2 (fr) * 2001-03-19 2004-01-07 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Nouvelle isoforme de la trp2 contenant des epitopes cytotoxiques de lymphocytes t a restriction de hla-a2
WO2006119527A2 (fr) 2005-05-11 2006-11-16 Avir Green Hills Biotechnology Research Development Trade Ag Diagnostic du melanome
DE102005041616A1 (de) * 2005-09-01 2007-03-08 Johannes-Gutenberg-Universität Mainz Melanom-assoziierte MHC Klasse I assoziierte Oligopeptide und deren Verwendungen
US7803566B2 (en) 2003-01-24 2010-09-28 The University Of Massachusetts Identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes
US7939090B2 (en) 2003-10-21 2011-05-10 Cedars-Sinai Medical Center System and method for the treatment of cancer, including cancers of the central nervous system
US8067535B2 (en) * 2003-01-24 2011-11-29 The University Of Massachusetts Identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes
US8097256B2 (en) 2006-09-28 2012-01-17 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US8383768B2 (en) 2009-05-07 2013-02-26 Immunocellular Therapeutics, Ltd. CD133 epitopes
US9023338B2 (en) 2006-09-26 2015-05-05 Cedars-Sinai Medical Center Cancer stem cell antigen vaccines and methods
US9068020B2 (en) 2008-09-02 2015-06-30 Cedars-Sinai Medical Center CD133 epitopes
US10137182B2 (en) 2013-02-14 2018-11-27 Immunocellular Therapeutics, Ltd. Cancer vaccines and vaccination methods

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997029195A2 (fr) * 1996-02-09 1997-08-14 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Antigene du cancer humain de proteine 1 et 2 apparentee a la tyrosinase et genes le codant

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997029195A2 (fr) * 1996-02-09 1997-08-14 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Antigene du cancer humain de proteine 1 et 2 apparentee a la tyrosinase et genes le codant

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BLOOM E.A.: "Identification of TRP2 as a tumor rejection antigen for the B16 melanoma", J.EXPERIMENTAL MEDICINE, vol. 183, no. 3, 3 February 1997 (1997-02-03), pages 453 - 459, XP002133803 *
PARKHURST E.A.: "Identification of a shared HLA-A*0201-restricted T-ell pitope from the melanoma antigen TRP2", CANCER RESEARCH, vol. 58, 1 November 1998 (1998-11-01), MD US, pages 4895 - 4901, XP002133804 *
REYNOLDS E.A.: "HLA-independen heterogeneity of CD8+ T-cell responses to MAGE-3, melan-A/MART-1, gp100, tyrosinase, MC1R andTRP2 in vaccine-treated melanoma patients", JOURNAL OF IMMUNOLOGY, vol. 161, no. 12, 15 December 1999 (1999-12-15), BALTIMORE US, pages 6970 - 6976, XP002133805 *
ZEH E.A.: "High avidity CTLs for two self-antigens demonstrate superior in vitro and in vivo antitumor efficacy", JOURNAL OF IMMUNOLOGY, vol. 1622, no. 2, 15 January 1999 (1999-01-15), BALTIMORE US, pages 989 - 994, XP002133806 *

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1377304A2 (fr) * 2001-03-19 2004-01-07 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Nouvelle isoforme de la trp2 contenant des epitopes cytotoxiques de lymphocytes t a restriction de hla-a2
EP1377304A4 (fr) * 2001-03-19 2005-02-09 Us Gov Health & Human Serv Nouvelle isoforme de la trp2 contenant des epitopes cytotoxiques de lymphocytes t a restriction de hla-a2
WO2003016342A3 (fr) * 2001-08-17 2003-11-27 Aventis Pasteur Antigenes tumoraux pour la prevention et/ou le traitement du cancer
WO2003016342A2 (fr) * 2001-08-17 2003-02-27 Aventis Pasteur Limited Antigenes tumoraux pour la prevention et/ou le traitement du cancer
US7803566B2 (en) 2003-01-24 2010-09-28 The University Of Massachusetts Identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes
US8067535B2 (en) * 2003-01-24 2011-11-29 The University Of Massachusetts Identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes
US7939090B2 (en) 2003-10-21 2011-05-10 Cedars-Sinai Medical Center System and method for the treatment of cancer, including cancers of the central nervous system
WO2006119527A2 (fr) 2005-05-11 2006-11-16 Avir Green Hills Biotechnology Research Development Trade Ag Diagnostic du melanome
DE102005041616A8 (de) * 2005-09-01 2008-05-29 Johannes-Gutenberg-Universität Mainz Melanom-assoziierte MHC Klasse I assoziierte Oligopeptide und deren Verwendungen
DE102005041616B4 (de) * 2005-09-01 2011-03-17 Johannes-Gutenberg-Universität Mainz Melanom-assoziierte MHC Klasse I assoziierte Oligopeptide und für diese kodierende Polynukleotide und deren Verwendungen
JP2009511424A (ja) * 2005-09-01 2009-03-19 ヨハネス グーテンベルク ウニベルジテート マインツ メラノーマ関連ｍｈｃクラスｉ関連オリゴペプチドおよびその使用
DE102005041616A1 (de) * 2005-09-01 2007-03-08 Johannes-Gutenberg-Universität Mainz Melanom-assoziierte MHC Klasse I assoziierte Oligopeptide und deren Verwendungen
JP2012180359A (ja) * 2005-09-01 2012-09-20 Johannes Gutenberg Univ Mainz メラノーマ関連ｍｈｃクラスｉ関連オリゴペプチドおよびその使用
US20150366957A1 (en) * 2005-09-01 2015-12-24 Johannes Gutenberg-Universität Mainz Melanoma-Associated MHC Class I Associated Oligopeptides and the Uses Thereof
US9023338B2 (en) 2006-09-26 2015-05-05 Cedars-Sinai Medical Center Cancer stem cell antigen vaccines and methods
US8097256B2 (en) 2006-09-28 2012-01-17 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US8871211B2 (en) 2006-09-28 2014-10-28 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US9095538B2 (en) 2006-09-28 2015-08-04 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US9433667B2 (en) 2006-09-28 2016-09-06 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US10226519B2 (en) 2006-09-28 2019-03-12 Cedars-Sinai Medical Center Cancer vaccines and vaccination methods
US9068020B2 (en) 2008-09-02 2015-06-30 Cedars-Sinai Medical Center CD133 epitopes
US9382308B2 (en) 2008-09-02 2016-07-05 Cedars-Sinai Medical Center CD133 epitopes
US8604167B2 (en) 2009-05-07 2013-12-10 Immunocellular Therapeutics, Ltd. CD133 epitopes
US8383768B2 (en) 2009-05-07 2013-02-26 Immunocellular Therapeutics, Ltd. CD133 epitopes
US10137182B2 (en) 2013-02-14 2018-11-27 Immunocellular Therapeutics, Ltd. Cancer vaccines and vaccination methods
US11096996B2 (en) 2013-02-14 2021-08-24 Precision Lifesciences Group Llc Cancer vaccines and vaccination methods

Also Published As

Publication number Publication date
AU1598500A (en) 2000-05-15

Similar Documents

Publication Publication Date Title
Parkhurst et al. Identification of a shared HLA-A* 0201-restricted T-cell epitope from the melanoma antigen tyrosinase-related protein 2 (TRP2)
AU706443B2 (en) Melanoma antigens
AU749544B2 (en) Tumor antigen peptides originating in cyclophilin B
AU785151B2 (en) Novel MHC class II restricted T cell epitopes from the cancer antigen, NY ESO-1
US20080107668A1 (en) Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
WO2007150077A2 (fr) Immunogènes inducteurs de la production de lymphocytes t cytotoxiques utilisables en vue de la prévention, du traitement et du diagnostic du cancer
CA2546794A1 (fr) Proteines appartenant a la famille bcl-2, fragments associes, et utilisation therapeutique de ces proteines et fragments sur des patients atteints du cancer
WO2009036246A2 (fr) Immunogènes qui induisent des lymphocytes t cytotoxiques et leur utilisation dans la prévention, le traitement et le diagnostic du cancer
WO2000024778A1 (fr) Epitopes peptidiques specifiques de hla-a2 et hla-dr derives de la trp2 de l'antigene du melanome
US6951917B1 (en) MHC-class II restricted melanoma antigens and their use in therapeutic methods
US8252545B2 (en) Peptides of a melanoma antigen and their use in diagnostic, prophylactic, and therapeutic methods
US6664232B1 (en) HLA-A2 restraint tumor antigen peptide originating in SART-1
AU1412900A (en) Novel tumor antigen protein art-1 and tumor antigen peptide thereof
US20050158332A1 (en) MHC-Class II restricted melanoma antigens and their use in therapeutic methods
CA2441225C (fr) Nouvel isoforme trp2 contenant des epitopes lymphocytes t cytotoxiques restreints par hla-a2
Visser et al. Molecular characterization of melanoma-derived antigens

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: AU

Ref document number: 2000 15985

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase