WO2000024428A2 - Renforcement de l'immunisation de chats par l'acide nucleique induite par des lipides cationiques - Google Patents

Renforcement de l'immunisation de chats par l'acide nucleique induite par des lipides cationiques Download PDF

Info

Publication number
WO2000024428A2
WO2000024428A2 PCT/US1999/024769 US9924769W WO0024428A2 WO 2000024428 A2 WO2000024428 A2 WO 2000024428A2 US 9924769 W US9924769 W US 9924769W WO 0024428 A2 WO0024428 A2 WO 0024428A2
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
nucleic acid
acid molecule
felid
lipid
Prior art date
Application number
PCT/US1999/024769
Other languages
English (en)
Other versions
WO2000024428A3 (fr
Inventor
Joel R. Haynes
Ramani S. Wonderling
Dan T. Stinchcomb
Original Assignee
Heska Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heska Corporation filed Critical Heska Corporation
Priority to AU11312/00A priority Critical patent/AU1131200A/en
Priority to US09/830,221 priority patent/US6770282B1/en
Publication of WO2000024428A2 publication Critical patent/WO2000024428A2/fr
Publication of WO2000024428A3 publication Critical patent/WO2000024428A3/fr
Priority to US10/864,903 priority patent/US7314627B2/en
Priority to US11/866,558 priority patent/US8029776B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/205—Rhabdoviridae, e.g. rabies virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55572—Lipopolysaccharides; Lipid A; Monophosphoryl lipid A
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a method to introduce a nucleic acid molecule into a felid by administration of a nucleic acid molecule-cationic lipid complex composition.
  • the present invention relates to the parenteral administration of a nucleic acid molecule-cationic lipid complex to elicit and/or enhance an immune response to the protein encoded by the administered nucleic acid molecule.
  • DNA vaccination represents a means of expressing an antigen in vivo for the generation of humoral and cellular immune responses.
  • DNA vaccines employ genes encoding antigens, rather than using the proteins themselves, to induce immune responses.
  • the DNA upon administration to the host, is transcribed and translated in vivo to produce an antigen. Processing and presentation of the antigen stimulates the animal's immune system to elicit a humoral and/or cellular response to the antigen. This immune response can potentially confer protective immunity to the animal.
  • DNA vaccines appear to have advantages over protein antigen-based vaccines, standard "killed" pathogen vaccines, live, attenuated vaccines, and recombinant viral vector vaccines. For example, DNA vaccines appear to be more effective in producing an antigen with a properly folded, native three-dimensional conformation and in generating a cellular immune response than are protein antigens. DNA vaccines also do not exhibit at least some of the safety problems of killed, live or virally-vectored vaccines. For example, a killed virus preparation may contain residual live viruses or may need to be mixed with reactogenic adjuvants, such as those associated with vaccine- related fibrosarcomas in cats, in order to stimulate an effective immune response.
  • An attenuated virus may mutate and revert to a pathogenic phenotype.
  • Viral vector vaccines genetically engineered to express a gene encoding the desired antigen may stimulate the production of antibodies that react with the virus as well; such antibodies may render futile any further attempt to use that virus as a vector, even with a different gene insert.
  • DNA vaccines apparently are non-reactogenic and, if they elicit an immune response, that response is targeted against the antigen of choice.
  • DNA vaccines typically include a bacterial plasmid, a strong viral promoter, the gene of interest, and a polyadenylation/transcriptional termination sequence.
  • the plasmid is typically grown in bacteria, purified, dissolved in a saline solution, and then simply injected into an animal.
  • Current understanding of how to use DNA vaccines to generate an effective immune response is not complete. Most of our understanding of the mechanisms of DNA vaccine action is derived from rodent studies. In mice, bone marrow-derived antigen-presenting cells have been shown to induce cytotoxic T lymphocyte responses following intramuscular inoculation of naked plasmid DNA. In some cases, DNA vaccination has also been shown to stimulate antigen- specific antibodies, some of which may be neutralizing antibodies.
  • DNA vaccines have also been administered to large animals, albeit with varying degrees of success. While there are some clear examples of DNA vaccine efficacy in large animals, other studies cite relatively weak responses, requirement for large amounts of DNA, or the need for multiple immunizations. As such, it is apparent that further technology development is required to maximize DNA vaccine efficacy in humans and large animals.
  • Immune responses to DNA vaccination appear to vary according to the vehicle used with the DNA vaccine, the antigen expressed by the DNA vaccine, the route of administration, and the species of mammal into which the DNA vaccine is injected.
  • Investigators have used different vehicles and/or genes encoding cytokines and other stimulatory molecules in an attempt to enhance the immune response to the antigens encoded by DNA vaccines with mixed success.
  • cationic lipids have been used to deliver nucleic acids to cells in vitro and in vivo, there is no consensus in the literature about whether cationic lipids reproducibly enhance the immunogenicity of DNA vaccines.
  • Ishii et al., 1997, AIDS Research and Human Retroviruses 13, 1421-1424 demonstrated enhanced immune responses to V3 peptide following I.M., intraperitoneal (I.P.), intradermal (I.D.), intranasal (I.N.) or subcutaneous (S.Q.) administration to mice.
  • I.M. intraperitoneal
  • I.D. intradermal
  • I.N. intranasal
  • S.Q. subcutaneous
  • the present invention relates to a method to elicit an immune response to an antigen in a felid.
  • This method includes the step of parenterally administering to the felid a composition comprising a nucleic acid molecule encoding the antigen in which the nucleic acid molecule is complexed with a cationic lipid.
  • this method enhances the immune response in a felid compared to a method in which a naked DNA vaccine is administered to a felid.
  • a method to deliver a nucleic acid molecule to a felid comprises parenterally administering to the felid a composition that includes a nucleic acid molecule complexed with a cationic lipid.
  • the present invention relates to a method to elicit an immune response to an antigen in a felid.
  • the method includes the step of parenterally administering to the felid a composition comprising a nucleic acid molecule encoding the antigen in which the nucleic acid molecule is complexed with a cationic lipid.
  • a composition comprising a nucleic acid molecule encoding the antigen in which the nucleic acid molecule is complexed with a cationic lipid.
  • cationic lipids did not enhance the ability of a nucleic acid molecule to elicit an immune response, compared to, for example, delivery of a naked, or unformulated, nucleic acid molecule (i.e., a nucleic acid molecule that is not complexed with, for example, a lipid or other transfection-facilitating agents).
  • a naked, or unformulated, nucleic acid molecule i.e., a nucleic acid molecule that is not complexed with, for example, a lipid or other transfection-facilitating agents.
  • monkeys administered a nucleic acid molecule-cationic lipid complex did not exhibit seroconversion to the antigen encoded by the nucleic acid molecule.
  • the inventors have demonstrated that while parenteral administration to a felid of a nucleic acid molecule complexed with a cationic lipid results in the felid successfully seroconverting in response to the antigen encoded by the nucleic acid molecule, intranasal administration of such a composition did not result in seroconversion.
  • the ability to demonstrate seroconversion in cats parenterally administered a nucleic acid molecule complexed with a cationic lipid is completely unpredictable based on previous studies and, as such, is inventive.
  • One embodiment of the present invention is the use of a composition comprising a nucleic acid molecule encoding an antigen complexed with a cationic lipid to elicit an immune response in a felid.
  • a or “an” entity refers to one or more of that entity; for example, a nucleic acid molecule, an antigen, and a cationic lipid refers to one or more nucleic acid molecules, antigens, and cationic lipids, respectively; or to at least one nucleic acid molecule, antigen, and cationic lipid, respectively.
  • the terms “a” (or “an”), "one or more” and “at least one” can be used interchangeably herein.
  • a nucleic acid molecule of the present invention also referred to herein as a nucleic acid, can be DNA or RNA.
  • a nucleic acid molecule encodes an antigen that elicits an immune response in a felid.
  • a nucleic acid molecule can simply be a molecule that encodes such an antigen, i.e., a coding region, or the nucleic acid molecule can comprise a coding region operatively linked to a regulatory sequence.
  • the phrase operatively linked refers to the joining of a coding region to one or more regulatory sequences such that the coding region is expressed using such regulatory sequence(s) in a felid.
  • regulatory sequences include transcription control sequences and translation control sequences that can be recognized by felid cellular mechanisms in order to effect transcription and translation of a coding region.
  • Transcription control sequences are sequences that control the initiation, elongation, and termination of transcription (e.g., promoters, enhancers, introns, polyA sites, terminators).
  • Translation control sequences control the initiation, elongation and termination of translation.
  • Additional regulatory sequences include signal sequences that effect secretion of a protein from a cell and a combination of a signal sequence and a transmembrane sequence (i.e., membrane anchoring domain) that causes a protein to be partially extracellular and partially retained in the membrane and/or cytoplasm.
  • a preferred nucleic acid molecule of the present invention is a plasmid or viral genome that includes a coding region for the desired antigen operatively linked to strong eukaryotic regulatory sequences, including a strong promoter and strong transcription termination/polyadenylation sequences.
  • a preferred plasmid can replicate in bacte ⁇ a.
  • nucleic acid molecule Procedures by which such a nucleic acid molecule is produced are known to those skilled in the art, and are disclosed, for example, in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press.
  • Appropriate plasmids are known in the art, and may include, but are not limited to, pUC 19 and BLUESCRTPT®.
  • a preferred plasmid is pUC19.
  • Appropriate regulatory sequences are known to those skilled in the art.
  • a suitable promoter includes, but is not limited to the cytomegalovirus immediate early promoter (CMV IE) with or without intron A, a long terminal repeat (LTR) promoter from a retrovirus, or a strong cellular promoter such as ⁇ -actin, with CMV IE with intron A being preferred.
  • CMV IE cytomegalovirus immediate early promoter
  • LTR long terminal repeat
  • suitable transcription termination sequences include, but are not limited to, bovine growth hormone, SV40 virus or rabbit beta-globin polyadenylation sequences, with a bovine growth hormone sequence being preferred.
  • a suitable antigen is any antigen that effects an immune response, and as such includes allergens and autoantigens as well as other antigens.
  • An antigen can refer to the full-length antigen or any portion thereof that is capable of eliciting an immune response.
  • Preferred antigens are those that elicit an immune response that protects an animal from disease. Examples of such antigens include, but are not limited to, a protozoan parasite antigen, a helminth parasite antigen, an ectoparasite antigen, a fungal antigen, a bacterial antigen, and a viral antigen.
  • viral antigens include, but are not limited to, antigens from adenoviruses, caliciviruses, coronaviruses, distemper viruses, hepatitis viruses, herpesviruses, immunodeficiency viruses, infectious peritonitis viruses, leukemia viruses, oncogenic viruses, papilloma viruses, parainfluenza viruses, parvoviruses, rabies viruses, and reoviruses, as well as other cancer-causing or cancer-related viruses.
  • antigens from adenoviruses include, but are not limited to, antigens from adenoviruses, caliciviruses, coronaviruses, distemper viruses, hepatitis viruses, herpesviruses, immunodeficiency viruses, infectious peritonitis viruses, leukemia viruses, oncogenic viruses, papilloma viruses, parainfluenza viruses, parvoviruses, rabies viruses, and reoviruses,
  • bacterial antigens include, but are not limited to, antigens from Actinomyces, Bacillus, Bacteroides, Bordetella, Bartonella, Borrelia, Brucella, Campylobacter, Capnocytophaga, Clostridium, Corynebacterium, Coxiella, Dermatophilus,
  • Enterococcus Enterococcus, Ehrlichia, Escherichia, Francisella, Fusobacterium, Haemobartonella, Helicobacter, Klebsiella, L-form bacteria, Leptospira, Listeria, Mycobacteria, Mycoplasma, Neorickettsia, Nocardia, Pasteurella, Peptococcus, Peptostreptococcus, Proteus, Pseudomonas, Rickettsia, Rochalimaea, Salmonella, Shigella, Staphylococcus, Streptococcus, and Yersinia.
  • fungal antigens include, but are not limited to, antigens from Absidia, Acremonium, Alternaria, Aspergillus, Basidiobolus, Bipolaris, Blastomyces, Candida, Chlamydia, Coccidioides, Conidiobolus, Cryptococcus, Curvalaria, Epidermophyton, Exophiala, Geotrichum, Histoplasma, Madurella, Malassezia, Microsporum, Moniliella, Mortierella, Mucor, Paecilomyces, Penicillium, Phialemonium, Phialophora, Prototheca, Pseudallescheria,
  • protozoan and helminth parasite antigens include, but are not limited to, antigens from Babesia, Balantidium, Besnoitia, Cryptosporidium, Eimeria, Encephalitozoon, Entamoeba, Giardia, Hammondia, Hepatozoon, Isospora, Leishmania, Microsporidia, Neospora, Nosema, Pentatrichomonas, Plasmodium, Pneumocystis, Sarcocystis, Schistosoma, Theileria, Toxoplasma, and Trypanosoma, Acanthocheilonema, Aelurostrongylus, Ancylostoma, Angiostrongylus, As
  • ectoparasite antigens include, but are not limited to, antigens (including protective antigens as well as allergens) from fleas; ticks, including hard ticks and soft ticks; flies, such as midges, mosquitos, sand flies, black flies, horse flies, horn flies, deer flies, tsetse flies, stable flies, myiasis-causing flies and biting gnats; ants; spiders, lice; mites; and true bugs, such as bed bugs and kissing bugs.
  • suitable allergens include food, grass, weed, tree pollen, other animal and other plant allergens.
  • Preferred antigens include, but are not limited to, a calicivirus antigen, a coronavirus antigen, a herpesvirus antigen, an immunodeficiency virus antigen, an infectious peritonitis virus antigen, a leukemia virus antigen, a panleukopenia virus antigen, a parvovirus antigen, a rabies virus antigen, a Bartonella antigen, a Yersinia antigen, a Dirofilaria antigen, a Toxoplasma antigen, a tumor antigen, a flea antigen, a flea allergen, a midge antigen, a midge allergen, a mite antigen, a mite allergen, a ragweed allergen, a ryegrass allergen, a cat allergen, a dog allergen, a Bermuda grass allergen, a Johnson grass allergen, or a Japanese cedar pollen allergen.
  • antigens include a rabies virus glycoprotein G antigen; heartworm PLA2, P39, P4, P22U, Gp29, astacin, cysteine protease, macrophage migration inhibitory factor, venom allergen, TPX-1, TPX-2, transglutaminase, ankyrin, asparaginase, calreticulin, cuticulin, and aromatic amino aid decarboxylase antigens; flea serine protease, cysteine protease, aminopeptidase, serpin, carboxylesterase, juvenile hormone esterase, chitinase, epoxide hydrolase, ecdysone, ecdysone receptor, and ultraspiracle protein antigens; flea salivary antigens; Yersinia FI and V antigens; and Toxoplasma gondii antigens such as those disclosed in PCT Patent Publication No.
  • One embodiment of the present invention is a composition comprising a nucleic acid molecule-cationic lipid complex that further comprises a heterologous nucleic acid molecule encoding an immunomodulator.
  • an immunomodulator-encoding nucleic acid molecule can be contained within the same nucleic acid molecule encoding the antigen of the present invention, or can exist as a separate nucleic acid molecule, which can be on the same or separate plasmid or viral genome.
  • the present invention also includes Suitable immunomodulators include compounds that enhance certain immune responses as well as compounds that suppress certain immune responses. Compounds that enhance the immune response include compounds that preferentially enhance humoral immunity as well as compounds that preferentially enhance cell-mediated immunity. Suitable compounds can be selected depending on the desired outcome.
  • Suitable immunomodulators include, but are not limited to, cytokines, chemokines, superantigens, co-stimulatory molecules, adhesion molecules, and other immunomodulators as well as compounds that induce the production of such immunomodulators.
  • examples of such compounds include, but are not limited to, granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), macrophage colony stimulating factor (M-CSF), colony stimulating factor (CSF), erythropoietin (EPO), interleukin 2 (EL-2), interleukin 3 (IL-3), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8), interleukin 10 (IL-10), interleukin 12 (IL-12), interleukin 13 (IL- 13), interleukin 18 (IL-18), interferon gamma, interferon gamma in
  • a composition of the present invention includes a cationic lipid complexed with a nucleic acid molecule encoding an antigen in order to elicit or enhance an immune response to the antigen.
  • a cationic lipid is a lipid which has a cationic, or positive, charge at physiologic pH.
  • Cationic lipids can have a variety of forms, including liposomes or micelles. Whether a cationic lipid occurs primarily as a liposome or a micelle can be manipulated by methods known in the art; for example, a freezing and thawing of cationic lipids in aqueous solution will encourage formation of liposomes, rather than micelles.
  • a nucleic acid molecule complexed with a cationic lipid may also be referred to as a nucleic acid molecule-cationic lipid complex, a lipoplex or a complex of the present invention.
  • a complex of the present invention that elicits an immune response is a complex of a nucleic acid molecule which encodes an antigen with a cationic lipid.
  • the term complexed with which is equivalent to complexed to, refers to any method by which a nucleic acid molecule interacts (e.g.
  • cationic lipids binds, comes into contact with a cationic lipid.
  • Such an interaction can include, but is not limited to encapsulation of a nucleic acid molecule into a cationic liposome, association of a nucleic acid molecule and cationic lipid characterized by non- covalent, ionic charge interactions, and other types of associations between nucleic acid molecules and cationic lipids known by those skilled in the art.
  • cationic lipids have a cationic group, such as a quaternary amine group, and one or more lipophilic groups, such as saturated or unsaturated alkyl groups having from about 6 to 30 carbon atoms.
  • Cationic lipid compositions suitable for use in the present invention include lipid compositions comprised of one type of lipid, or lipid compositions comprised of more than one type of lipid. If there is more than one type of lipid present in a lipid composition, it is necessary that the overall net charge of the lipid composition is cationic, i.e. positive; however, as long as the overall net charge of the lipid composition is cationic, individual lipid types may be neutral or even anionic in charge.
  • a composition of the present invention includes a cationic lipid that is suitable in accordance with the present invention.
  • Cationic lipids suitable for use in the present invention include commercially available cationic lipids, for example DOTMA, available under the trademark name of LIPOFECTIN®, available from Life Technologies Inc., (LTI), Gaithersburg, MD and DDAB, available from Boehringer- Mannheim, Indianapolis, IN.
  • DOTMA commercially available cationic lipids
  • LIPOFECTIN® available from Life Technologies Inc., (LTI)
  • Gaithersburg, MD and DDAB available from Boehringer- Mannheim, Indianapolis, IN.
  • suitable cationic lipids can be synthesized as described in the literature; see, for example, Feigner et al, 1987, PNAS 84 7413-7417 regarding the preparation of DOTAP; Douar et al, 1996, Gene Ther 3(9), 789-796 regarding the preparation of Lipid 67; Wheeler et al., 1996, Biochim Biophys Acta 1280(1), 1-11 regarding the preparation of DMRIE; McLean et al., 1997 Am J Physiol 273, H387-404 regarding the preparation of DOTEVI; and Hofland et al., 1997, Pharm Res 14(6), 742-749 regarding the preparation of DOSPA.
  • Other suitable cationic lipid compounds are described in the literature.
  • Preferred cationic lipids include the class of lipids known as tetramethyltetraalkyl spermine analogs, described by McCluskey et al., (1998), Antisense and Nucleic Acid Drug Development, vol. 8, pp 401-414. Lipids of this type include tetramethyltetralaurylspermine, tetramethyltetramyristylsperrnine, tetramethyltetrapalmitoylspermine, and tetramethyltetraoleoylspermine.
  • lipids obtained from LTI are of the tetramethyltetraalkyl spermine class, with the alkyl groups containing fatty acid chains of length longer than oleic acid. These lipids are denoted as LTI lipids 4251-781-1, 4251-106-3, 4518-52, D304-200, 4521-52-3, 4251-106-4, 4251-781-2, 4518-53, 4518-31, 4519-30, 4519-34, and 2518-11 1.
  • Preferred cationic lipids include LTI lipid 4251-781-1, LTI lipid 4251-106-3, and LTI lipid 4518-52.
  • tetramethyltetraalkyl spermine lipids are formulated with a neutral lipid, such as dioleylphosphatidyl-ethanolamine (DOPE).
  • DOPE dioleylphosphatidyl-ethanolamine
  • a nucleic acid molecule-cationic lipid complex can be formed by using techniques known to those skilled in the art, examples of which are described in the Examples section.
  • a complex can be formed, for example, by adding a cationic lipid solution to a nucleic acid molecule, preferably an endotoxin-free nucleic acid molecule, at concentrations appropriate for the present invention, and mixing, for example by pipetting.
  • Preferable nucleic acid molecule-to-cationic lipid ratios are from about 10:1 weight nucleic acid molecule: weight cationic lipid, (e.g. microgram ( ⁇ g) nucleic acid molecule to ⁇ g cationic lipid) to about 1 :10 weight nucleic acid molecule: weight cationic lipid.
  • nucleic acid molecule-cationic lipid complex is incubated at room temperature for about 30 minutes before administration.
  • a nucleic acid molecule- cationic lipid complex can be dehydrated and rehydrated using techniques known to those skilled in the art; for example, the complex can be frozen in liquid nitrogen and lyophilized at 150 milliTorr, then reconstituted in solution for injection.
  • a dose of a nucleic acid molecule-cationic lipid complex to administer to a cat can be reported as the amount of nucleic acid molecule administered to a cat.
  • a preferred dose of a nucleic acid molecule-cationic lipid complex to administer to a cat includes from at least one nanogram (ng) of nucleic acid to about 10 milligram (mg) of nucleic acid molecule. More preferred is a dose range that includes from about 1 ⁇ g nucleic acid molecule to about 1 mg of nucleic acid molecule. Particularly preferred is a dose ranging from about 75 ⁇ g of a nucleic acid molecule to about 300 ⁇ g of a nucleic acid molecule.
  • a nucleic acid molecule-cationic lipid complex composition of the present invention can be formulated in an excipient that the animal to be treated can tolerate.
  • the present invention includes administration of a composition comprising a nucleic acid molecule-cationic lipid complex, wherein the composition further comprises an excipient.
  • excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions.
  • Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, mannitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability.
  • buffers examples include phosphate buffer, bicarbonate buffer and Tris buffer.
  • Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection.
  • the excipient can comprise dextrose, human serum albumin, preservatives, etc., to which sterile water or saline can be added prior to administration.
  • the nucleic acid molecule-cationic lipid complex can also include an adjuvant and/or a carrier.
  • an adjuvants and carriers are not required to produce a composition that administration thereof will elicit an immune response.
  • adjuvants are typically substances that generally enhance the immune response of an animal to a specific antigen. Suitable adjuvants include, but are not limited to, other bacterial cell wall components; aluminum-based salts; calcium- based salts; silica; polynucleotides; toxins, such as cholera toxin; toxoids, such as cholera toxoid; serum proteins; other viral coat proteins; other bacterial-derived preparations; block copolymer adjuvants, such as Hunter's TitermaxTM adjuvant (VaxcelTM, Inc.
  • Carriers are typically compounds that increase the half-life of a therapeutic composition in the treated animal. Suitable carriers include, but are not limited to, polymeric controlled release formulations, biodegradable implants, liposomes, bacteria, viruses, oils, esters, and glycols.
  • An immune response to an antigen includes a humoral, i.e. antibody, response to that antigen and/or a cell-mediated response to that antigen.
  • a humoral, i.e. antibody response to that antigen and/or a cell-mediated response to that antigen.
  • Methods to measure an immune response are known to those skilled in the art; examples of such methods are disclosed herein. If one or both types of immune response are present, they may protect the felid from disease caused, for example, by the agent from which the antigen was derived.
  • the ability of an antigen derived from a disease-causing agent to protect an animal from a disease caused by that disease- causing agent or a cross-reactive agent refers to the ability of a nucleic acid molecule- cationic lipid complex of the present invention to treat, ameliorate and/or prevent disease caused by the disease-causing agent or cross-reactive agent, preferably by eliciting an immune response against the antigen derived from the disease-causing agent. It is to be noted that an animal may be protected by a composition of the present invention even without the detection of a humoral or cell-mediated response to the antigen.
  • Protection can be measured by methods known to those skilled in the art, such as by challenging an animal with the agent against which the animal has mounted a putative immune response.
  • the antibody titer of an animal can be used to demonstrate protection. For example, it is known that animals that elicit an antibody response against a rabies glycoprotein G antigen are protected if their sera exhibits a rapid focus fluorescent inhibition test (RFFIT) titer of rabies virus neutralizing antibodies of greater than 1:5.
  • RFFIT rapid focus fluorescent inhibition test
  • an animal that elicits an immune response to an antigen is an animal that has been immunized with that antigen.
  • nucleic acid molecule-cationic lipid complex composition of the present invention The biological mechanism for eliciting and/or enhancing an immune response by the use of a nucleic acid molecule-cationic lipid complex composition of the present invention has not been elucidated, but, without being bound by theory, the inventors believe that the mechanism is likely related to the ability of these compositions to protect DNA from nuclease attack, to facilitate the transfection of both muscle cells and professional antigen presenting cells (APC) in vivo, to increase levels of expression in transfected cells, and or to distribute DNA to lymphoid organs.
  • APC professional antigen presenting cells
  • a felid is a member of the family Felidae.
  • felids include domestic cats, wild cats, and zoo cats.
  • cats include, but are not limited to, domestic cats, lions, tigers, leopards, panthers, cougars, bobcats, lynx, jaguars, cheetahs, and servals.
  • a preferred cat to immunize is a domestic cat.
  • the term cat(s) and felid(s) are used interchangeably herein.
  • parenteral administration means administration not through the alimentary canal (e.g. oral administration), but rather by injection through some other route, including but not limited to routes such as subcutaneous, intramuscular (I.M.), intravenous (IN.), intraperitoneal (IP.), intradermal (ID.), intraorbital, intracapsular, intraspinal, and intrasternal.
  • Parenteral administration includes, but is not limited to, administration by any route that includes use of a needle to insert material into the body.
  • Parenteral administration also includes uses of devices other than a syringe and needle to insert material through the skin and or mucosal surfaces into the body, including but not limited to the BIOJECTOR®, POWDERJECT, and MEDIJECT® needleless injection systems.
  • a preferred route of administration includes intramuscular administration using a needle and syringe.
  • Acceptable protocols to administer therapeutic compositions in an effective manner include individual dose size, number of doses, and frequency of dose administration.
  • the first administration of a composition intended to elicit an immune response is called the primary (or prime) administration, also known as the pre- boost.
  • Additional administrations intended to "boost" or increase an immune response to an antigen are termed booster administrations.
  • Determination of a protocol to elicit an immune response in a cat using a nucleic acid molecule-cationic lipid complex of the present invention can be accomplished by those skilled in the art.
  • a nucleic acid molecule encoding a desired antigen complexed with cationic lipid need only be administered once by a route appropriate to the present invention (e.g. parenteral) to stimulate an immune response against the antigen.
  • such an administration protects the felid from the agent from which the antigen was derived or from an agent against which the immune response is cross-protective.
  • administration of a complex of the present invention to a felid in order to elicit an immune response actually enhances the immune response generated by the felid as compared to the immune response generated upon administration of a naked DNA vaccine to a felid, wherein the naked DNA vaccine consists essentially of a naked DNA molecule; i.e., a DNA molecule that is not complexed with lipids.
  • enhancement of the immune response can include increasing the amount, or titer, of antibody elicited by a complex of the present invention that encodes an antigen to the desired antigen and/or agent from which the antigen was derived as compared to the titer of antibody generated by a naked DNA vaccine that encodes the same antigen.
  • an enhancement can be induction of no antibody titer with a naked DNA vaccine to induction of a protective antibody titer with a complex of the present invention.
  • Enhancement of an immune response can also refer to augmentation of the cell- mediated response to the antigen and/or agent encoded by a complex of the present invention as compared to the response generated by a naked DNA vaccine encoding the same antigen.
  • Enhancement of immune response can also include conferring or augmenting protection from disease by a complex of the present invention compared to the protection, if any, conferred by a naked DNA vaccine encoding the same antigen.
  • enhancement of the immune response includes increasing the likelihood of a cat seroconverting in response to antigen encoded by a complex of the present invention in comparison to the likelihood of the cat responding to the same antigen encoded by a naked DNA vaccine. In other words, in a group of cats being vaccinated with a complex of the present invention, a greater number of cats will seroconvert in response to antigen encoded by the complex rather than to the same antigen encoded by a naked DNA vaccine.
  • the likelihood that a cat will seroconvert when administered a single dose of a complex of the present invention that encodes an antigen is at least about 50%, preferably at least about 75%, more preferably at least about 90% and even more preferably at least about 100%.
  • the likelihood that a cat will seroconvert is preferably at least about 75%, more preferably at least about 90%, and even more preferably at least about 100%.
  • the present invention includes a method to administer a nucleic acid molecule to a felid.
  • the method includes the step of parenterally administering a composition comprising said nucleic acid molecule complexed with a cationic lipid.
  • a nucleic acid molecule can encode either a protein or a RNA molecule.
  • the nucleic acid molecule encodes a protein or RNA molecule that, when expressed at an appropriate level, has a protective effect upon the cat.
  • a protein refers to a full-length protein or any portion thereof that is at least about 5 amino acids in length and has a useful function, including, but not limited to, ability to elicit an immune response, elicit an immunomodulatory effect (e.g., an immunomodulator that stimulates or reduces the immune response), effect gene therapy, effect enzyme activity, or otherwise effect cell division, differentiation, development and cell death.
  • an immunomodulatory effect e.g., an immunomodulator that stimulates or reduces the immune response
  • effect gene therapy e.g., an immunomodulator that stimulates or reduces the immune response
  • effect enzyme activity e.g., an immunomodulator that stimulates or reduces the immune response
  • a RNA molecule refers to any RNA species that can be encoded by a nucleic acid molecule, including, but not limited to antisense RNA, a molecule capable of triple helix formation, a ribozyme, or other nucleic acid-based drug compound.
  • any protein or RNA molecule that can be expressed at an appropriate level in a cat, which protects a cat from disease would be included in this invention.
  • Diseases from which to protect a felid include, but are not limited to, infectious diseases, genetic diseases, oncological diseases, and other metabolic diseases, including diseases that lead to abnormal cell growth, degenerative processes, and immunological defects.
  • compositions of the present invention can protect animals from a variety of diseases including, but not limited to, allergies, arthritic diseases, autoimmune diseases, cancers, cardiovascular diseases, graft rejection, hematopoietic disorders, immunodeficiency diseases, immunoproliferative diseases, immunosuppressive disorders, infectious diseases, inflammatory diseases, jaundice, septic shock, and other immunological defects, as well as other genetic or metabolic defects.
  • diseases including, but not limited to, allergies, arthritic diseases, autoimmune diseases, cancers, cardiovascular diseases, graft rejection, hematopoietic disorders, immunodeficiency diseases, immunoproliferative diseases, immunosuppressive disorders, infectious diseases, inflammatory diseases, jaundice, septic shock, and other immunological defects, as well as other genetic or metabolic defects.
  • Methods to produce and use a composition comprising any nucleic acid molecule of the present invention complexed with any cationic lipid of the present invention are as described herein. The following examples are provided for the purposes of illustration and are
  • This Example demonstrates the production of a nucleic acid molecule of the present invention.
  • a nucleic acid molecule encoding human growth hormone (hGH) was constructed using plasmid pHGH107 (available from American Type Culture Collection, Manassis, VA), which encodes hGH amino-acids 1-191, as a polymerase chain reaction (PCR) template.
  • the hGH open reading frame was amplified by PCR using Pfu DNA polymerase (available from Stratagene, La Jolla, CA) and the following forward and reverse primers: 5' TTCCCAACTATACCACTATCTCGTCTA 3 * (SEQ ID NOJ) and 5' CTAGAAGCCACAGCTGCCCTCCACAGAG 3' (SEQ ED NO:2).
  • the PCR product containing the sequence encoding the mature hGH product was ligated into the N ⁇ el site of a plasmid containing the human cytomegalovirus immediate early promoter, a translation control sequence, a sequence encoding the signal peptide coding sequence from human tissue plasminogen activator, and a bovine growth hormone poly A sequence.
  • the expression of hGH from this plasmid was confirmed following transfection of cells in vitro and was detected using a chemiluminescence assay kit (available from Nichols Institute Diagnostics, San Juan Capistrano, CA).
  • Example 2 This Example describes the production of a nucleic acid molecule-cationic lipid complex of the present invention.
  • Endotoxin-free nucleic acid molecules encoding hGH or rabies glycoprotein G were prepared using a commercial kit (Qiagen, Inc., Valencia, CA) and the resulting nucleic acid molecules were dissolved in endotoxin-free 10 mM Tris-HCl, pH 7.5, 1 inM EDTA at 2 mg per milliliter (ml) to form a hGH nucleic acid molecule solution and a rabies gG nucleic acid molecule solution, respectively.
  • Cationic lipids 4251-106-3 (also known as 106-3), 4251-781-1 (also known as 781-1), and 4518-52 were obtained from Life Technologies, Inc. (LTI), Gaithersburg, MD.
  • a nucleic acid molecule-cationic lipid complex was formed by adding 250 ⁇ l of the respective cationic lipid solution to 250 ⁇ l of the respective nucleic acid molecule solution, followed by immediate mixing by pipetting.
  • the concentrations of the cationic lipid solutions and of the nucleic acid molecule solutions used were adjusted to give the desired amounts and ratios of nucleic acid molecules to cationic lipids described elsewhere in the Examples.
  • the mixture was incubated at room temperature for 30 minutes before administration.
  • the complex was frozen in liquid nitrogen and lyophilized at 150 mTorr, then reconstituted in the original volume of sterile water for injection.
  • This Example describes a method for administering a nucleic acid molecule- cationic lipid complex of the present invention to a felid.
  • Primary and booster administrations of nucleic acid molecule-cationic lipid complexes prepared as described in Example 2 were injected intramuscularly into the semitendinosus or semimembranosus muscle of domestic cats. Each dose was divided into two equal portions and administered bilaterally into each leg. Sera samples were collected every 10 days for antibody determination.
  • This Example describes methods to measure immune responses generated in response to the administration of nucleic acid molecule-cationic lipid complexes of the present invention.
  • Antibody responses specific for hGH were determined by ELISA. Briefly, ELISA plate wells were coated with 0.4 micrograms ( ⁇ g) hGH protein per well (hGH protein available from Genzyme Diagnostics, San Carlos, CA) and incubated overnight at 4°C. Unbound antigen was aspirated and the plate was blocked with 2% skimmed milk for 1 hour at 37 °C . ELISA plates were washed 3 times with TBS-Tween (150 milliMolar (mM) NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% TWEEN-20) and serially diluted sera samples from vaccinated cats were added and incubated at 37 °C for 1 hour.
  • TBS-Tween 150 milliMolar (mM) NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% TWEEN-20
  • Rabies virus-specific neutralizing antibody response were determined using the Rapid Fluorescent Focus Inhibition test (RFFIT) at the Department of Veterinary Diagnostics, Kansas State University.
  • RFFIT Rapid Fluorescent Focus Inhibition test
  • T cell proliferation assays were carried out in the following manner. Heparinized blood samples were collected from cats a week after administration of a booster injection as described in Example 5. The lymphocytes were isolated from the blood samples using a percoll gradient (Sigma Chemicals, St Louis, MO).
  • the isolated lymphocytes were resuspended in RPMI 1640 (Sigma Chemical) containing 5% normal cat serum, 2 mM L-glutamine (Life Technologies, Bethesda, MD), 1 mM sodium pyruvate (Life Technologies), 50 ⁇ M 2-mercaptoethanol (Life Technologies), 5 ⁇ g/mL gentamycin (Sigma Chemical), 0.1 mM MEM non-essential amino acids (Life Technologies), and 1% essential amino acids (Life Technologies) plated at a density of 2 X 10 5 cells/well and treated with various concentrations of recombinant human growth hormone (hGH) (Genzyme Diagnostics, Boston, MA) for a total of 3 or 5 days.
  • hGH human growth hormone
  • Each group of cell samples contained a negative control (media alone) and a positive control (Concanavalin A, Sigma Chemicals).
  • Cells were pulsed at time of measurement with 0.5 ⁇ Curie of tritiated thymidine (ICN Pharmaceuticals) per well.
  • the amount of incorporated tritium was counted 16 to 18 hours post-pulse in a scintillation counter. Data was reported as the stimulation index, which was derived by dividing the counts per minute obtained from the samples divided by the counts per minute obtained from the negative control.
  • Example 5 This Example compares the immune response elicited using a nucleic acid molecule encoding hGH complexed with either LTI lipid 781-1 or LTI lipid 106-3 to the immune response elicited using a naked DNA vaccine encoding hGH in cats.
  • the hGH nucleic acid molecule was complexed with LTI lipid 781-1 at a lipid- to-DNA ratio ( ⁇ g: ⁇ g) of 0.5:1.0, and formulated with LTI lipid 106-3 at a lipid-to-DNA ratio of 1 : 1, as described in Example 2.
  • the naked DNA vaccine consisted of the hGH nucleic acid molecule prepared as described in Example 2 dissolved in saline. A total of 12 cats were divided into three vaccine groups as follows:
  • Group 1 naked DNA: Two injections, spaced 8 weeks apart, of 300 ⁇ g of naked hGH nucleic acid molecule in 500 ⁇ l saline.
  • Group 2 (LTI lipid 781-1): Two injections, spaced 8 weeks apart, of
  • Group 3 (LTI lipid 106-3): Two injections, spaced 8 weeks apart, of 300 ⁇ g hGH nucleic acid molecule complexed with 300 ⁇ g cationic lipid.
  • This Example compares immune responses elicited using a nucleic acid molecule encoding rabies glycoprotein G complexed with several cationic lipids of the present invention to the immune response elicited using a naked DNA vaccine encoding rabies glycoprotein G in cats.
  • This example compared the abilities of the following compositions to elicit an immune response against rabies glycoprotein G (rabies G) in cats: a naked DNA vaccine consisting of the rabies G nucleic acid molecule; and complexes between the rabies G nucleic acid molecule and one of the following cationic lipids: LTI lipid 106-3, LTI lipid 781-1, or LTI lipid 4518-52, each at a variety of DNA:lipid ratios. Also tested was a complex that had been dehydrated by lyophilization and rehydrated prior to administration. Each of the compositions was produced as described in Example 2. All cats received two intramuscular injections as described in Example 3, spaced four weeks apart. The following groups of 4 cats each were tested:
  • Group 1 Naked DNA, 300 ⁇ g rabies G vector
  • Group 2 300 ⁇ g lipid 781-1 + 300 ⁇ g rabies G vector
  • Group 3 150 ⁇ g lipid 781-1 + 300 ⁇ g rabies
  • Group 4 75 ⁇ g lipid 781-1 + 300 ⁇ g rabies G vector
  • Group 5 600 ⁇ g lipid 106-3 + 300 ⁇ g rabies G vector
  • Group 6 300 ⁇ g lipid 106-3 + 300 ⁇ g rabies G vector
  • Group 7 150 ⁇ g lipid 106-3 + 300 ⁇ g rabies G vector
  • Group 8 300 ⁇ g lipid 4518-52 + 300 ⁇ g rabies G vector
  • Group 9 300 ⁇ g lipid 106-3 + 300 ⁇ g rabies G vector (lyophilized and rehydrated)
  • Group 10 75 ⁇ g lipid 106-3 + 75 ⁇ g rabies G vector.
  • Group 1 served as a control group to demonstrate immunogenicity of the naked DNA vaccine.
  • Groups 2-4 were designed to determine if differences in the lipid-to- DNA ratio were important for lipid 781-1.
  • groups 5-7 were designed to determine if differences in the lipid-to-DNA ratio were important for lipid 106-3.
  • Group 8 was included to examine the efficacy of LTI lipid 4518-52.
  • Group 9 was included to determine if lyophilization and rehydration of lipid:DNA complexes would improve cationic lipid vaccine efficacy in cats as previously demonstrated in mice by Gregoriadis, ibid.
  • group 10 was included to determine is less than 300 ⁇ g of DNA could be used without affecting the ability of lipid 106-3 to enhance the ability of cats to elicit an immune response.
  • Rabies virus-specific neutralizing antibody activity was measured in the sera of all cats before and after the booster administration by RFFIT. Sera dilutions tested ranged from 1:5 to 1 : 174,693. Negative responses are listed as a titer of ⁇ 1 :5 while responses that are stronger than the final dilution tested are indicated by the ">" sign. Injections were made intramuscularly. It is known to those skilled in the art that an anti- rabies G antibody titer of 1:5 or greater, as measured by RFFIT, is protective. Results from these studies are shown in Table 2.
  • Muscle and lymph node tissues were dissected and removed from the thigh of a sacrificed cat, see Example 3.
  • the tissues were quick frozen on dry ice, and ground to a powder in liquid nitrogen.
  • Ground frozen tissue was resuspended in IX cell culture lysate reagent (25 mM Tris-Phosphate, pH 7.8, 2 mM DTT, 2 mM 1 ,2 diaminocyclohexane-N,N,N',N'-tetraacetic acid, 10% glycerol, 1% Triton X- 100). After lysis, the cell debris was removed by centrifugation and supernatant was used in the following assay.
  • Example 8 Comparison of expression of a DNA plasmid, formulated with and without LTI lipid 106-3, in the cat muscle.
  • evidence for increased antigen expression in the muscle upon formulation with lipid 106-3 was observed in an experiment in which 300 ⁇ g of a plasmid vector encoding luciferase was injected into each semimembranosus muscle (inner thigh) of a cat, one muscle receiving DNA complexed with lipid, and one muscle receiving naked DNA.
  • 300 ⁇ g of DNA was formulated with 300 ⁇ g of lipid 106-3.
  • the right thigh of the cat was injected with DNA alone; the left thigh was injected with DNA formulated with lipid 106-3.
  • This example demonstrates that formulation of DNA vaccines with cationic lipids does not enhance nucleic acid efficacy in mice, in contrast to the enhancement of nucleic acid efficacy seen in cats treated with cationic lipid DNA formulations.
  • Three different nucleic acid molecules, encoding rabies glycoprotein G were prepared as described in Example 2. The first, pMV 5044, contains the CMV intron A promoter, the rabies glycoprotein G coding sequence, and the rabbit beta globin polyadenylation sequence. The second, pMV 5045, contains the CMV intron A promoter, the rabies glycoprotein G coding sequence, and the bovine growth hormone polyadenylation sequence. The third, pMV 5046, contains the CMV promoter, the rabies glycoprotein G coding sequence, and the bovine growth hormone polyadenylation sequence.
  • the three nucleic acid molecules encoding rabies glycoprotein G were complexed with LTI lipid 106-3 at a lipid to DNA ratio ( ⁇ g: ⁇ g) of 1 : 1 as described in Example 2.
  • the corresponding "naked" DNA vaccines were prepared by dissolving the plasmids in saline.
  • mice A total of 30 mice were divided into six vaccine groups as follows: Group 1 (pMV 5044, 50 ⁇ g + lipid): One injection, intramuscular. Antibody titers determined at four weeks post injection. Group 2 (pMV 5044, 100 ⁇ g alone): One injection, intramuscular. Antibody titers determined at four weeks post injection.
  • Group 3 (pMV 5045, 50 ⁇ g + lipid): One injection, intramuscular. Antibody titers determined at four weeks post injection.
  • Group 4 (pMV 5045, 100 ⁇ g alone): One injection, intramuscular. Antibody titers determined at four weeks post injection.
  • Group 5 (pMV 5046, 50 ⁇ g + lipid): One injection, intramuscular. Antibody titers determined at four weeks post injection.
  • Group 6 (pMV 5046, 100 ⁇ g alone): One injection, intramuscular. Antibody titers determined at four weeks post injection. O 00/24428
  • Rabies-virus specific neutralizing antibody activity was measured by RFFIT in the sera of all mice four weeks after injection with three different nucleic acid molecules containing Rabies glycoprotein G.
  • the data presented in Table 5 indicate that cationic lipid formulation of a DNA vaccine does not enhance vaccine efficacy, as measured by humoral (antibody) response, in mice. These data are in contrast to results obtained in cats, where vaccine efficacy is enhanced by formulation with cationic lipids.
  • formulation with lipid actually appears to slightly reduce DNA vaccine efficacy for mice, with the geometric means (of the five mice per group) declining from 294 with DNA alone to 66 with DNA/lipid complex.
  • mice Results from the other two constructs in mice also showed no increase in efficacy; the geometric means were as follows: for pMV5045, 69.4 for DNA alone and 70.7 with DNA/lipid complex; and for pMV5046, 2.3 for DNA alone and 4.5 for DNA/lipid complex.
  • Example 10 Administration of a DNA plasmid, formulated with and without LTI lipid 106-3, to cats.
  • This example demonstrates the local immune response at the site of injection of DNA plasmids formulated with or without LTI lipid 106-3.
  • Each of four cats was administered each of the following formulations to each of the following sites on the ventral side: (a) saline (i.e., vehicle alone) to the right arm; (b) 300 ⁇ g of lipid 106-3 (lipid alone) to the left arm; (c) 300 ⁇ g of a naked plasmid vector encoding rabies glycoprotein G (naked rabies G vector) to the upper right foot; (d) 300 ⁇ g of a naked plasmid vector encoding luciferase (naked luciferase vector) to the lower right foot; (e) 300 ⁇ g of rabies G vector formulated with 300 ⁇ g of lipid 106-3 to the upper left foot; and (f) 300 ⁇ g of luciferase vector formulated with 300 ⁇ g of lipid 106-3 to the lower left foot.
  • Muscle samples were sectioned using a cryostat and the sections were stained using hematoxylin and eosin to analyze the population of cells infiltrating the sites of injection. Muscle samples were also stained with antibodies specific for B-cells (anti-CD79a antibodies) using techniques known to those skilled in the art.
  • nucleic acid molecules complexed with cationic lipids to cats leads to enhanced expression of the protein encoded by the nucleic acid molecule and infiltration of lymphocytes to the injection site which apparently does not occur when naked nucleic acid molecules are administered in a similar manner. Without being bound by theory, it is believed that this infiltration of lymphocytes might explain the enhanced immune response seen with nucleic acid molecule-cationic lipid complexes of the present invention.

Abstract

L'invention concerne une technique qui consiste à administrer à un félidé une molécule d'acide nucléique par l'administration d'une composition contenant un complexe acide nucléique-lipide cationique. La technique consiste à administrer au félidé, par voie parentérale, un complexe acide nucléique-lipide cationique pour déclencher ou renforcer une réponse immunitaire. Dans un mode de réalisation, ladite technique renforce la réponse immunitaire chez un félidé par rapport à une technique qui consiste à lui administrer un vaccin d'ADN nu. Cette technique consiste à administrer au félidé, de manière parentérale, une composition qui comprend une molécule d'acide nucléique formant un complexe avec un lipide cationique.
PCT/US1999/024769 1998-10-23 1999-10-22 Renforcement de l'immunisation de chats par l'acide nucleique induite par des lipides cationiques WO2000024428A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU11312/00A AU1131200A (en) 1998-10-23 1999-10-22 Cationic lipid-mediated enhancement of nucleic acid immunization of cats
US09/830,221 US6770282B1 (en) 1998-10-23 1999-10-22 Cationic lipid-mediated enhancement of nucleic acid immunization of cats
US10/864,903 US7314627B2 (en) 1998-10-23 2004-06-09 Cationic lipid-mediated enhancement of nucleic acid immunization of cats
US11/866,558 US8029776B2 (en) 1998-10-23 2007-10-03 Cationic lipid-mediated enhancement of nucleic acid immunization of cats

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US10546998P 1998-10-23 1998-10-23
US60/105,469 1998-10-23
US12244699P 1999-03-02 1999-03-02
US60/122,446 1999-03-02

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09830221 A-371-Of-International 1999-10-22
US10/864,903 Continuation US7314627B2 (en) 1998-10-23 2004-06-09 Cationic lipid-mediated enhancement of nucleic acid immunization of cats

Publications (2)

Publication Number Publication Date
WO2000024428A2 true WO2000024428A2 (fr) 2000-05-04
WO2000024428A3 WO2000024428A3 (fr) 2000-07-06

Family

ID=26802619

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/024769 WO2000024428A2 (fr) 1998-10-23 1999-10-22 Renforcement de l'immunisation de chats par l'acide nucleique induite par des lipides cationiques

Country Status (2)

Country Link
AU (1) AU1131200A (fr)
WO (1) WO2000024428A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000077043A2 (fr) * 1999-06-10 2000-12-21 Merial Vaccins adn pour animaux de compagnie et de sport
US6852705B2 (en) 2000-01-21 2005-02-08 Merial DNA vaccines for farm animals, in particular bovines and porcines
US6943152B1 (en) 1999-06-10 2005-09-13 Merial DNA vaccine-PCV
US7078388B2 (en) 2000-01-21 2006-07-18 Merial DNA vaccines for farm animals, in particular bovines and porcines
US7390494B2 (en) 1997-12-05 2008-06-24 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US9987348B2 (en) 2013-09-25 2018-06-05 Zoetis Services Llc PCV2B divergent vaccine composition and methods of use

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4726946A (en) * 1980-07-30 1988-02-23 Norden Laboratories, Inc. Inactivated rabies vaccine for veterinary use
WO1995030019A1 (fr) * 1994-04-29 1995-11-09 Pharmacia & Upjohn Company Vaccin contre le virus de l'immunodeficience feline
WO1999066879A2 (fr) * 1998-06-25 1999-12-29 National Jewish Medical And Research Center Procede d'activation d'immunisation systemique faisant appel a des complexes acide-lipide

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4726946A (en) * 1980-07-30 1988-02-23 Norden Laboratories, Inc. Inactivated rabies vaccine for veterinary use
WO1995030019A1 (fr) * 1994-04-29 1995-11-09 Pharmacia & Upjohn Company Vaccin contre le virus de l'immunodeficience feline
WO1999066879A2 (fr) * 1998-06-25 1999-12-29 National Jewish Medical And Research Center Procede d'activation d'immunisation systemique faisant appel a des complexes acide-lipide

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NORMAN J ET AL: "Development of improved vectors for DNA-based immunization and other gene therapy applications." VACCINE, vol. 15, no. 8, June 1997 (1997-06), pages 801-3, XP002135482 *
OSORIO J ET AL: "Immunization of gogs and cats with a DNA vaccine against rabies virus." VACCINE, vol. 17, no. 9-10, 5 March 1999 (1999-03-05), pages 1109-16, XP002135483 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7604808B2 (en) 1997-12-05 2009-10-20 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7425444B2 (en) 1997-12-05 2008-09-16 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US10052375B2 (en) 1997-12-05 2018-08-21 Zoetics Services LLC Circovirus sequences associated with piglet weight loss disease (PWD)
US9717784B2 (en) 1997-12-05 2017-08-01 Zoetis Services Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US7407803B2 (en) 1997-12-05 2008-08-05 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7390494B2 (en) 1997-12-05 2008-06-24 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US9700613B2 (en) 1997-12-05 2017-07-11 Zoetis Services Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US7405075B2 (en) 1997-12-05 2008-07-29 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
WO2000077043A3 (fr) * 1999-06-10 2001-07-19 Merial Sas Vaccins adn pour animaux de compagnie et de sport
WO2000077043A2 (fr) * 1999-06-10 2000-12-21 Merial Vaccins adn pour animaux de compagnie et de sport
US6943152B1 (en) 1999-06-10 2005-09-13 Merial DNA vaccine-PCV
US7078388B2 (en) 2000-01-21 2006-07-18 Merial DNA vaccines for farm animals, in particular bovines and porcines
US6852705B2 (en) 2000-01-21 2005-02-08 Merial DNA vaccines for farm animals, in particular bovines and porcines
US9987348B2 (en) 2013-09-25 2018-06-05 Zoetis Services Llc PCV2B divergent vaccine composition and methods of use

Also Published As

Publication number Publication date
WO2000024428A3 (fr) 2000-07-06
AU1131200A (en) 2000-05-15

Similar Documents

Publication Publication Date Title
US8029776B2 (en) Cationic lipid-mediated enhancement of nucleic acid immunization of cats
EP1165140B1 (fr) Compositions d'adjuvant permettant d'accentuer les reponses immunitaires a des vaccins a base de polynucleotides
JP7232225B2 (ja) 口蹄疫ワクチン
JP2024001076A (ja) 狂犬病ウイルスワクチン
AU2018358077A1 (en) Feline leukemia virus vaccine
US7105574B1 (en) Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
WO2000024428A2 (fr) Renforcement de l'immunisation de chats par l'acide nucleique induite par des lipides cationiques
US9060984B2 (en) Recombinant HIV-1 envelope proteins comprising stabilizing two-cysteine mini-domains in gp41
US20220211839A1 (en) Feline leukemia virus vaccine
US6106841A (en) Delivery method for recombinant raccoon poxvirus
US20140271708A1 (en) Novel methods for providing long-term protective immunity against rabies in animals, based upon administration of replication-deficient flavivirus expressing rabies G
US9060973B2 (en) Vaccine for enveloped viruses
Lundstrom COVID-19 Vaccine Development and Cancer
EP1459766B1 (fr) Compositions d'adjuvant permettant d'accentuer les réponses immunitaires à des vaccins à base de polynucléotides
WO2013138776A1 (fr) Nouveaux procédés pour fournir une immunité de protection à long terme contre la rage chez des animaux, basés sur l'administration d'un flavivirus défectueux en termes de réplication, exprimant la rage g

Legal Events

Date Code Title Description
ENP Entry into the national phase in:

Ref country code: AU

Ref document number: 2000 11312

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 09830221

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase