WO2000023621A2 - Visualisation d'arn dans des cellules vivantes - Google Patents

Visualisation d'arn dans des cellules vivantes Download PDF

Info

Publication number
WO2000023621A2
WO2000023621A2 PCT/US1999/022786 US9922786W WO0023621A2 WO 2000023621 A2 WO2000023621 A2 WO 2000023621A2 US 9922786 W US9922786 W US 9922786W WO 0023621 A2 WO0023621 A2 WO 0023621A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
protein
domain
fusion protein
binding site
Prior art date
Application number
PCT/US1999/022786
Other languages
English (en)
Other versions
WO2000023621A3 (fr
Inventor
Robert H. Singer
Edouard Bertrand
Original Assignee
Singer Robert H
Edouard Bertrand
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Singer Robert H, Edouard Bertrand filed Critical Singer Robert H
Priority to JP2000577328A priority Critical patent/JP2002527117A/ja
Priority to EP99970691A priority patent/EP1131469A2/fr
Publication of WO2000023621A2 publication Critical patent/WO2000023621A2/fr
Publication of WO2000023621A3 publication Critical patent/WO2000023621A3/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5035—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on sub-cellular localization
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/42—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a HA(hemagglutinin)-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/18011—Details ssRNA Bacteriophages positive-sense
    • C12N2795/18111—Leviviridae
    • C12N2795/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation

Definitions

  • the invention relates to cell biology, genetics, recombinant DNA technology, fluorescence microscopy, and videography.
  • RNA localization is a well-documented phenomenon and provides a mechanism by which to generate cell assymetry (St. Johnston, Cell 81:161-170 (1995); Glotzer et al . , Cell Dev. Biol . 7:357-365 (1996); Steward et al., in mRNA Metabolism and Posttranscriptional Gene Regulation, Wiley-Liss, New York, 127-146) .
  • Messenger RNA localization has been studied by fluorescence in si tu hybridization (FISH) (Long et al . , RNA 1:1071-1078 (1995).
  • FISH si tu hybridization
  • si tu hybridization and other methods that require fixation of cells, offer good spatial resolution, but are severely limited in temporal resolution. Thus, while these techniques are well-suited for determining where RNA goes in living cells, they are unsuited for determining how quickly, or by what route, the RNA travels to its destination.
  • FISH fixation kills cells. Therefore, those methods are incompatible with cell selection, where cells must be kept alive to initiate a new cell line.
  • the method includes the following steps: (a) providing a DNA encoding the RNA, which RNA includes a protein-binding site; (b) providing a nucleic acid encoding a fusion protein that includes a fluorescent domain and an RNA-binding domain that binds to the protein-binding site in the RNA; (c) introducing the DNA encoding the RNA, and the nucleic acid encoding the fusion protein, into a eukaryotic cell so that the DNA encoding the RNA and the nucleic acid encoding the fusion protein are expressed in the cell; and (d) detecting fluorescence in the cell, the fluorescence being from the fusion protein bound to the RNA.
  • the RNA includes a multiplicity of protein-binding sites located in the 3' untranslated region (3'UTR) of the RNA.
  • the RNA-binding domain can be derived from a bacteriophage MS2 protein, and the protein-binding site can be a bacteriophage MS2 binding site.
  • the fluorescent domain is derived from green fluorescent protein (GFP) .
  • the fusion protein includes an intracellular localization domain, e.g., a nuclear localization signal (NLS) domain or a nuclear export signal (NES) domain. When the fusion protein contains an NLS domain, fluorescence from the fusion protein bound to the RNA is detected outside the nucleus.
  • NLS nuclear localization signal
  • NES nuclear export signal
  • the DNA encoding the RNA, and the nucleic acid encoding the fusion protein can be provided on a single vector or on separate vectors.
  • the cell is a yeast cell.
  • the cell can contain one or more RNA localization factors, e.g., she gene products in a yeast cell.
  • the invention also provides a method for screening a DNA library to detect a DNA encoding an RNA containing a protein-binding site.
  • the method includes providing a eukaryotic test cell.
  • the test cell expresses a fusion protein containing a fluorescent domain and an
  • the method further includes transforming the test cell with a candidate DNA from the DNA library; and detecting the fusion protein bound to an RNA containing the protein-binding site, if present, by measuring fluorescence .
  • the fusion protein includes an intracellular localization domain, e.g., a nuclear localization signal (NLS) domain or a nuclear export signal (NES) domain.
  • the test cell does not express an endogenous protein that binds to the protein- binding site.
  • the invention also provides a nucleic acid encoding a fusion protein.
  • the fusion protein encoded contains a fluorescent domain and an RNA-binding domain.
  • the fluorescent domain can be derived from GFP or a GFP variant, e.g., blue fluorescent protein (BFP) , yellow fluorescent protein (YFP) , or cyan fluorescent protein (CFP) .
  • the binding domain can be derived from a bacteriophage MS2 binding protein.
  • the fusion protein includes an intracellular localization domain, e.g., a nuclear localization signal (NLS) domain or a nuclear export signal (NES) domain.
  • the invention also includes a vector containing the nucleic acid encoding the fusion protein, and a cell transformed with the vector containing the nucleic acid encoding the fusion protein.
  • the invention also includes a screening method for identifying a compound that inhibits nuclear RNA export or import.
  • the method includes providing a eukaryotic test cell that expresses a DNA encoding an RNA, which RNA includes a protein-binding site; and expresses a fusion protein.
  • the fusion protein includes a fluorescent domain and an RNA-binding domain that binds to the protein-binding site in the RNA.
  • the method further includes contacting the test cell with a candidate compound, and then detecting a candidate compound-related reduction of nuclear RNA export or import, if present.
  • the RNA-binding domain of the fusion protein and the protein-binding site in the RNA are derived from viral sequences .
  • the invention also includes a method for detecting, in real-time, the transcription of a specific gene.
  • the method includes providing a eukaryotic cell that contains: a DNA encoding an RNA that includes a protein-binding site, and a nucleic acid encoding a fusion protein.
  • the fusion protein includes a fluorescent domain and an RNA- binding domain that binds to the protein-binding site.
  • the method further includes detecting a focus of fluorescence, the focus being from a multiplicity nascent RNA molecules, each nascent RNA molecule being bound to one or more fusion protein molecules .
  • the fusion protein includes a nuclear export signal domain.
  • the nucleic acid encoding the fusion protein can be transiently expressed from a vector introduced into the cell.
  • Fig. 1A is a schematic diagram of the NLS-MS2-GFP fusion protein.
  • Fig. IB is a schematic diagram of the nucleic acid construct used for expression of an NLS-MS2- GFP fusion protein and an ASH1 lacZ reporter mRNA in a yeast system.
  • Fig. 1C is a schematic diagram of the nucleic acid construct used for expression of an NLS-MS2- GFP fusion protein and an ADHII lacZ reporter mRNA in a yeast system.
  • a lacZ-ASHl reporter RNA was used to demonstrate RNA movement/localization in living cells.
  • a lacZ-ADHII reporter RNA was used as a negative control for rapid movement and localization.
  • the reporter mRNAs contain six binding sites for the coat protein of the bacterial phage MS2.
  • the 3'UTRs were either from the ASH1 gene, to induce mRNA localization at the yeast bud tip, or, from the ADHII gene, as a negative control.
  • a nuclear localization signal (NLS) followed by an HA tag was introduced at the N-terminus of the fusion protein, so that that only the fusion protein bound to its target, the reporter RNA, would appear in the cytoplasm.
  • NLS nuclear localization signal
  • Fig. 3 is a color schematic diagram tracing the path of an RNA-containing particle in a yeast mother cell and bud (43 ⁇ m per 240 seconds) . Particle movement was analyzed in a wildtype yeast strain (K699) expressing both the lacZ-ASHl reporter RNA and the NLS-MS2-GFP fusion protein. Observation was conducted using epifluorescence and bright field microscopy. A cell with minimal nuclear signal was chosen so as not to obscure the particle.
  • Movement of the particle was recorded with a video camera linked to a VCR. During the period of observation, the 30-second intervals are represented beginning with the coolest colors (purple) and proceeding to the hottest colors (red) .
  • the particle spent 180 out of 240 seconds in the bud, and about 60 seconds localized at or near the bud tip.
  • a DNA encoding the visualized RNA can be obtained readily from any suitable source using conventional recombinant DNA technology as necessary.
  • the examples provided below involve visualizing RNA molecules engineered to include a lacZ coding region and a yeast ASH1 3' UTR containing intracellular localization signals.
  • the RNA molecules are visualized in yeast cells. It will be appreciated, however, that the methods of this invention are generally applicable to different RNAs and different eukaryotic cells .
  • the invention can be used to visualize RNAs whose movement depends on particle formation and RNAs that move without particle formation. Moreover, the invention is useful for visualizing non-localized RNAs, as well as localized RNAs.
  • the RNA to be visualized encodes a separately detectable polypeptide, e.g., /3-galactosidase . Choosing or designing an RNA suitable for visualization according to this invention, and obtaining a DNA encoding the chosen RNA is within ordinary skill in the art.
  • RNA localization may be partially or completely dependent upon transacting localization factors. Therefore, in some embodiments of the invention, localization factors are present in the living cells in which the RNA is visualized. Localization factors are exemplified by the products of the she genes in yeast. These are cytoplasmic factors. Nuclear factors exporting the RNA are present in all eukaryotic cells.
  • the RNA to be visualized contains at least one, and preferably a multiplicity of protein-binding sites. In some embodiments of the invention, from 5 to 10 sites are suitable. In other embodiments, from 10 to 50 binding sites will be suitable. In yet other embodiments, more than 50 binding sites, i.e., up to several hundred, may be desirable. In general, increasing the number of binding sites in the RNA increases fluorescence signal strength due to an increased number of fluorescent domains bound per RNA molecule. Some RNAs already contain suitable protein- binding sites. DNAs encoding such RNAs can be used in this invention without incorporation of an exogenous protein-binding site.
  • RNA to be visualized does not already contain a suitable protein-binding site
  • a suitable exogenous protein-binding site is incorporated into a DNA encoding the RNA.
  • the protein-binding site is a nucleotide sequence.
  • a single protein-binding site consists of a single, contiguous region of RNA, e.g., a stem-loop structure.
  • the length of the single, contiguous region of RNA is less than 100 nucleotides, more preferably it is less than 50 nucleotides, and most preferably, it is between 15 and 25 nucleotides.
  • the binding interaction between the protein- binding site and the binding domain displays high specificity, which results in a high signal-to-noise ratio.
  • a preferred protein-binding site is the bacteriophage MS2 binding site.
  • Complete MS2 nucleotide sequence information can be found in Fiers et al . , Nature 260:500-507 (1976). Additional information concerning the MS2 sequence-specific protein-R ⁇ A binding interaction appears in Valegard et al . , J. Mol . Biol . 270:724-738 (1997); Fouts et al . , Nucleic Acids Res . 25:4464-4473 (1997); and Sengupta et al . , Proc . Natl . Acad. Sci . USA 93 :8496-8501 (1996) .
  • binding site/binding domain pairs can be used instead of the MS2 -derived pair.
  • a second useful binding site/binding domain pair is the hairpin II of the Ul small nuclear R ⁇ A and the R ⁇ A-binding domain of the U1A spliceosomal protein (Oubridge et al . , Nature 372:432-438 (1994).
  • a third useful alternative binding site/binding domain pair is the protein IRP1 and its R ⁇ A target, the IRE (Klausner et al . , Cell 72:19-28 (1993); Melefors et al . , Bioessays 15:85-90 (1993).
  • the IRE is a stem-loop structure found in the untranslated regions of mR ⁇ As encoding certain proteins involved in iron utilization, and it binds specifically to IRP1.
  • a fourth useful alternative binding site/binding domain pair is HIV REV and RRF .
  • a fifth useful alternative binding site/binding domain pair is a zipcode binding protein and a zipcode R ⁇ A element (Steward et al , supra) .
  • a sixth useful alternative binding site/binding domain pair is a box C/D motif and box C/D snoR ⁇ A family-specific binding protein (Samarsky et al . , EMBO J. 17:3747-3757 (1998).
  • the protein-binding site can be an aptamer produced by in vi tro selection.
  • An aptamer that binds to a protein (or binding domain) of choice can be produced using conventional techniques, without undue experimentation.
  • Examples of publications containing useful information on in vi tro selection of aptamers include the following: Klug et al . , Mol . Biol . Reports 20:97-107 (1994); Wallis et al . , Chem . Biol . 2:543-552 (1995); Ellington, Curr. Biol . 4:427-429 (1994); Lato et al., Chew . Biol . 2:291-303 (1995); Conrad et al . , Mol . Div. 1:69-78 (1995); and Uphoff et al . , Curr. Opin . Struct . Biol . 6:281-287 (1996).
  • the protein- binding site(s) is (are) located in the 3'UTR of the RNA to be visualized.
  • the location of the protein- binding site(s) can be elsewhere in the RNA molecule.
  • the RNA can contain other genetic elements, e.g., one or more introns, stop codons, and transcription terminators.
  • the DNA encoding the RNA contains a promoter operably linked to the transcribed region.
  • the invention utilizes a fusion protein that includes at least two domains.
  • One domain is a fluorescent domain.
  • a preferred fluorescent domain is derived from a GFP.
  • Naturally-occurring GFPs cause bioluminescence, e.g., in the jellyfish Aequorea victoria .
  • fluorescence is produced by the interaction of modified amino acids in the GFP polypeptide chain. Formation of the GFP fluorophore is species independent, but GFPs can be modified through mutagenesis to optimize their function in different species. See, e . g. , Cubitt et al . , "Understanding, improving and using green fluorescent proteins," Trends . Biochem . Sci . 20:488-455 (1995).
  • GFP domain of the fusion protein is encoded by a yeast- optimized version of a GFP cDNA.
  • GFP blue fluorescent protein
  • YFP yellow fluorescent protein
  • CFP cyan fluorescent protein
  • the second domain of the fusion protein is an RNA- binding domain.
  • This domain recognizes and interacts with the protein-binding site (in the RNA discussed above) in a specific binding interaction, under physiological conditions.
  • a preferred RNA-binding domain is derived from the bacteriophage MS2 coat protein (capsid) , which binds with high specificity to a unique site on MS2 RNA. See Fiers et al . ( supra) , Valegard et al . ( supra) , Fouts et al . ( supra) ; and Sengupta et al . , ( supra) . Other proteins containing RNA-binding domains are discussed above.
  • the fusion protein includes a third domain that causes intracellular localization of the fusion protein when the fusion protein is not bound to its RNA target.
  • intracellular localization domains include nuclear localization signal (NLS) domains, nuclear export signal (NES) domains, and nucleolar targetting domains.
  • NLS nuclear localization signal
  • NES nuclear export signal
  • nucleolar targetting domains include nucleolar targetting domains.
  • NLS sequences are known in the art, any of which can be used in the invention.
  • a preferred NLS is derived from SV40, a well- known simian virus .
  • a useful NES can be derived from human immunodeficiency virus (HIV) REV sequences.
  • fusion protein contains an NES domain
  • fluorescence is detected inside the nucleus where the protein is bound to its target RNA.
  • the fluorescence is most intense at the transcription site.
  • a fusion protein containing an REV-derived NES can be used as a tool to evaluate therapeutic agents that interdict HIV export. To do so, one measures flow of the REV-derived NES-containing fusion protein out of the nucleus, in the presence of a reporter RNA containing the protein-binding site known as "RRE" (REV-Responsive Element) .
  • RRE reporter RNA containing the protein-binding site
  • the fusion protein does not include an intracellular localization domain, or if it contains an NLS, binding of the fusion protein to its RNA target can be indicated by a low fluorescence level in the nucleus (relative to the fluorescence level in the cytoplasm) , when the RNA is in excess. In this situation, decreased nuclear fluorescence results from the fusion protein being dragged out of the nucleus by exiting RNA to which the protein is bound. Decreased nuclear or cytoplasmic fluorescence may be advantageous when the fusion protein is employed in cells subjected to flow sorting.
  • the RNA and fusion protein can be used in assays to screen for drugs that affect intranuclear targeting or nucleolar function.
  • DNAs useful to encode and express the reporter RNA (containing one or more protein-binding sites) and the fusion protein are constructed using conventional recombinant DNA techniques. Such techniques are well known in the art, and can be found in standard references such as the following: Sambrook et al . , Molecular Cloning - A Laboratory Manual (2nd Ed.), Cold Spring
  • RNA to be visualized can be incorporated into a single vector.
  • the sequences are incorporated into two separate vectors.
  • Vectors used in the invention are selected for compatibility with the cells in which they will be used.
  • Expression vectors designed for use in particular cell types, with convenient restriction sites to facilitate the cloning of inserts, are commercially available and can be used in the invention.
  • the promoters used to drive expression of the RNA and the fusion protein are chosen so that the RNA expressed is in excess relative to the fusion protein.
  • fluorescence microscopy image acquisition and processing can be carried out using conventional optical systems, computer hardware, and software.
  • Image acquisition systems for use in the invention can be devised by the skilled person or obtained commercially.
  • Suitable image capture software includes CellSCANTM software (Scanalytics, Fairfax, VA) .
  • video data capture and processing can be carried out using convention hardware and software.
  • Software useful with video data includes NIH Image (National Institutes of Health, Bethesda, MD) . It is envisioned that automated scanning procedures can be used with this invention, including microwell plate readers and flow cytometers . Automation, however, is not required. Microscopic visual analyses will always be feasible .
  • RNA-protein complex such as those involved in RNA processing, nuclear export, or intranuclear targeting.
  • a GFP cDNA sequence was fused to coding sequences for the single- stranded RNA phage capsid protein MS2 (Fouts et al . , supra) .
  • a nuclear-localization signal was engineered into the fusion protein (Fig. 1A) . This caused the fusion protein to be restricted to the nucleus if not complexed to RNA.
  • the fusion protein was expressed from the strong constitutive GPD promoter (Schena et al . , "Guide to yeast genetics and molecular biology, " in Methods in Enzymology, Gutherie et al . , eds . , Academic Press, New York (1991) , pp. 389-398) .
  • the second plasmid encoded a reporter RNA containing an ASH1 mRNA 3'UTR fused to a lacZ coding region (Long et al , Science 277:383-387 (1997)).
  • Six MS2 binding sites each consisting of a 19 nucleotide RNA stem-loop (Valegard et al , supra) were inserted downstream of the lacZ coding region (Fig. IB) .
  • the cluster of MS2 binding sites provided for amplification of the GFP fluorescence signal due to binding of up to six fusion proteins, each containing a GFP domain.
  • RNA Transcription of the reporter RNA was under control of a galactose inducible promoter, as described in Long et al., RNA 1:1071-1078 (1995)).
  • Yeast cells expressing both the GFP-MS2 chimera and the ASHl reporter contained a single, bright "particle" that was usually localized at the bud tip (Fig. 2) .
  • the ADHII 3'UTR was substituted in place of the ASHl 3'UTR. It was known that the ADHJI 3'UTR sequence was unable to localize a reporter RNA to the bud tip.
  • GFP fluorescence was diffuse, throughout the cytoplasm.
  • endogenous yeast ASHl mRNA localized in a number of spots forming a crescent at the bud tip (detected by in si tu hybridization) .
  • dim GFP signals were seen occasionaly. These dim signals were not scored as particles because of their relative dimness, and because they never localized in the bud. The fluorescence intensity of the dim signals was approximately an order of magnitude below that of the particles formed in the presence of the ASHl 3'UTR. These dim signals may have represented aggregation of the fusion protein, even though we used a mutant version of MS2 reported to be deficient in self-assembly (Lim et al., Nucl . Acids Res . 22:3748-3752 (1994)).
  • Yeast she mutants were known to be defective in ASHl RNA localization (Long et al . , 1997, supra; Takizawa et al . , Nature 389:90-93 (1997)). Therefore, we tested she mutants for particle localization.
  • the number of particles was significantly decreased compared to the wild-type. The relatively few particles that formed failed to localize.
  • the particle stayed at the bud neck.
  • the single, bright particles dispersed into many smaller particles, none of which localized.
  • particles which formed stayed in the mother.
  • particles were almost completely absent. This confirmed that particle observation was a surrogate assay for RNA localization.
  • the particles were localized at or near the bud tip, they were occasionally observed moving from the mother cell to the bud. This movement sometimes occurrd bidirectionally, with the particle reversing toward (but not into) the mother, and then back to the bud tip. In the mother cell, sometimes the particle moved around randomly and then accelerated through the bud neck, where velocity was the highest (net displacement per unit of time) . Once in the bud, the particle moved in the distal region and occasionally stalled at the bud tip for periods exceeding one minute.
  • Movement of one of the wildtype particles traveling from mother cell to bud was analyzed in detail.
  • the movement was generally directional, but the particle wandered over a path five times longer than the shortest possible distance to the bud tip. This travel path is shown in Fig. 3.
  • the particle moved at velocities varying between 200 and 440 nm/sec (averaged over a moving window of 3 seconds) .
  • the localization time (mother to bud tip) for the particle was 128 seconds.
  • RNA transport occurred via a macromolecular complex, a particle.
  • a second insight was that the speed of movement of the RNA-containing particle was such that it moved to its destination within a few minutes.
  • a third insight was that genes required for localization appear to interact with the RNA via the particle.
  • the transport of the reporter could be visualized because of the formation of a particle. Because the particle formation was dependent on specific sequences in the ASHl 3'UTR sufficient for directing a LacZ reporter RNA to the bud, and because it could not localize in she mutant strains, the particle served as a reporter for localization. She proteins and sequences from the ASHl mRNA 3'UTR participated in particle formation. The particle may have been directly associated with myosin, possibly through She3p.
  • yeast genotypes were used in the experiments described here.
  • wild type k699 genotype: (Mata, his3-ll , leu2- 3,ade2-l, trpl-1, ura3 , ho; canl-100) shel : K5209 genotype (Mat ⁇ ;, his3 , leu2 , ade2 , trpl, ura3, canl-100, shel::URA3)
  • the PCR product was digested with BamHI and
  • the plasmids pXR55 (ASHl 3'UTR) and pXR2 (ADHII 3'UTR) were generated (respectively) by subcloning the lacZ-ASHl 3'UTR and the lacZ -ADHII reporter constructs into the yeast vector YEplacl95 (Gietz et al . , Gene 74:527-534 (1988) ) as a Pstl/EcoRI restriction fragment generated by PCR and DNA restriction digests.
  • the lacZ-ASHl 3'UTR cassette originated from plasmid pXMRS25.
  • the lacZ-ADHII cassette originated from plasmid pHZ18-polyA (Long et al., RNA 1:1071-1078 (1995); Long et al . , 1997 ( supra) .
  • Both pXR55 and pXR2 contained the URA3 selectable marker and the 2 micron origin of replication, and expressed the reporter mRNAs from a galactose inducible promoter.
  • Plasmid pSL-MS2-6 was digested by Mscl and EcoRV, and cloned at the Kpnl site of pXR55, to give pGal-lacZ-MS2- ASH1/URA.
  • a yeast-optimized version of the GFP cDNA was amplified by PCR with the following oligonucleotide primers: 5' GTATCAGCGGCCGCTTCTAAAGGTGAAGAATTA (SEQ ID NO: 3) (yGFP/5' ) , and
  • the resulting PCR product was then digested with BamHI and Sail, and ligated into the corresponding site of the LEU2 selectable, 2 micron pG14 plasmid (Lesser et al . , Genetics 133:851-863 (1993); gift of J. Warner) to give pGFP-MS2/LEU. Fusion protein expression
  • the strain K699 (Mata, trpl -1 , leu2-3 , his3 - ll , ura3 , ade2-l , ho, canl -100) was transformed with various combinations of the episomal vectors described above and below, and selected on the appropriate selection media to maintain the plasmids.
  • Yeast cells were then grown to mid-log phase in sythetic media containing 2% raffinose. Cells were subsequently induced with 3% galactose for 3 hours or the indicated times, to induce expression of the reporter mRNA. Due to the variable expression levels of the two plasmids, some cells had particles without much GFP nuclear signal, while other cells had strong GFP signal v/ithout visible particles.
  • Yeast cells were processed for in si tu hybridization essentially as described in Long et al . ,
  • Cells were prepared for immunofluorescence as for in si tu hybridization. After permeabilization overnight in 70% ethanol, the cells were rehydrated in antibody buffer (2X SSC, 8% formamide) for 10 minutes at room temperature, and then incubated in antibody buffer containing 0.2% RNAse DNAse free BSA and an anti-myc antibody (gift from K. Nasmyth) diluted 1:5, for 1 hour at 37°C. Cells were then washed for 30 minutes at room temperature in antibody buffer, and further incubated for 1 hour at 37°C with a Cy3 conjugated anti-mouse secondary antibody diluted 1:700, in antibody buffer. Cells were mounted in mounting media as described in Long et al . ,
  • Images were captured using CellSCAN software (Scanalytics, Fairfax, VA) on an Optiplex GXpro computer (Dell, Austin, TX) with a CH-250 16-bit, cooled CCD camera (Photometries, Tuscon, AZ) mounted on a Provis AX70 fluorescence microscope (Olympus, Melville, NY) with a PlanApo 60x, 1.4 NA objective (Olympus) and HiQ bandpass filters (Chroma Technology, Brattleboro, VT) .
  • the fluorescence illumination was controlled by the software using a Uniblitz VS25 shutter (Vincent Associates, Rochester, NY) .
  • the PSF is a data set, composed of 40- 50 images separated by 200nm in the axial direction, of a fluorescent microsphere (Molecular Probes, Eugene, OR) that was 200nm in diameter. A single median plane was recorded for blue filtered images.
  • SHE genes were isolated from yeast genomic DNA
  • SHE9 strain K699 by PCR. Primers were designed to obtain a PCR fragment of the respective SHE gene to include 1 kb of the promoter as well as 1Kb of the 3'-UTR region.
  • the cloned SHE genes were subcloned into YEplacll2 and YCplac22 and transformed into yeast strains disrupted for the respective gene and tested for functionality by rescue of ASHl mRNA localization as determined using fluorescence in si tu hybridization. A unique restriction site was introduced after the corresponding start codon or in front of the respective stop codon for each of the SHE genes (except SHE1) using a splicing through overlap extension strategy. Four primers were designed for each SHE gene.
  • Myc epitopes were introduced in these uniques sites using BamHI (in the case c: SHE3) or Xbal ( SHE2) fragments of a Myc epitope cassette (from plasmid pC3003, gift from K. Nasmyth) .
  • SHE1/MY04 a C-terminal Spel site (25 amino acids upstream from the stop codon) was used to subclone a Spel fragment of a c- Myc epitope cassette (from plasmid pC3390, gift from K.Nasmyth) containing nine Myc epitopes. Expression of the Myc-epitope tagged proteins was also shown by Western blots.
  • SHE-myc plasmids were transformed into K699, containing a wildtype locus for each SHE gene with the GFP-reporter plasmids for colocalization studies.
  • Live cells were mounted between two coverslips and visualized on an inverted microscope (Nikon, Melville, NY) with a PlanApo 60x, 1.4 NA, Ph4 objective (Nikon) using simultaneous brightfield and epifluorescence illumination. Live video was captured using a C2400
  • Silicon Intensified Tube Camera (Hamamatsu, Oakbrook, IL) with a 2x eyepiece and recorded on video tape in S-VHS format .
  • Appropriate sequences from the tape were digitized at a rate of one frame per second using NIH Image software (NIH, Bethesda, MD) with a frame size of 640x480 pixels on a Power Macintosh 7600 computer (Apple, Cupertino, CA) with S-Video interface.
  • NIH Image NIH, Bethesda, MD
  • Power Macintosh 7600 computer Apple, Cupertino, CA
  • S-Video interface S-Video interface
  • RNA not incorporated into particles The bright particle observed in yeast may not be present in cells other than yeast cell, e.g., in vertibrate cells.
  • RNA not incorporated into particles is visualized as follows. Forty-eight MS2 binding sites are incorporated into an actin mRNA. When all the MS2 binding sites are loaded with, i.e., bound to, a fusion protein containing a GFP domain and an MS2 binding domain, a single mRNA molecule is visually detectable by GFP fluorescence, using techniques such as those described in Femino et al . , Science 280:585-590 (1998)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne une technique de visualisation, en temps réel, de l'emplacement et du mouvement d'un ARN d'intérêt spécifique dans une cellule vivante. La technique consiste à: (a) fournir un ADN codant l'ARN, lequel ARN contient un site de liaison de protéine; (b) fournir un acide nucléique codant une protéine de fusion, laquelle protéine de fusion comporte un domaine fluorescent et un domaine de liaison d'ARN; (c) introduire l'ADN codant l'ARN et l'acide nucléique codant la protéine de fusion dans une cellule eucaryote de façon que l'ADN codant l'ARN et l'acide nucléique codant la protéine de fusion soient exprimés dans la cellule; et (d) détecter la fluorescence à l'extérieur, ou à l'intérieur, du noyau de la cellule, la fluorescence provenant de la protéine de fusion étant liée à l'ARN. Dans certains modes de réalisation, la protéine de fusion comprend également un domaine de localisation intracellulaire.
PCT/US1999/022786 1998-10-22 1999-09-30 Visualisation d'arn dans des cellules vivantes WO2000023621A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2000577328A JP2002527117A (ja) 1998-10-22 1999-09-30 生きた細胞におけるｒｎａの可視化
EP99970691A EP1131469A2 (fr) 1998-10-22 1999-09-30 Visualisation d'arn dans des cellules vivantes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/177,268 US6203986B1 (en) 1998-10-22 1998-10-22 Visualization of RNA in living cells
US09/177,268 1998-10-22

Publications (2)

Publication Number Publication Date
WO2000023621A2 true WO2000023621A2 (fr) 2000-04-27
WO2000023621A3 WO2000023621A3 (fr) 2000-11-16

Family

ID=22647919

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/022786 WO2000023621A2 (fr) 1998-10-22 1999-09-30 Visualisation d'arn dans des cellules vivantes

Country Status (4)

Country Link
US (2) US6203986B1 (fr)
EP (1) EP1131469A2 (fr)
JP (1) JP2002527117A (fr)
WO (1) WO2000023621A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6171705B1 (en) 1997-02-10 2001-01-09 Dofasco, Inc. Structural panel and method of manufacture
WO2002027031A2 (fr) * 2000-09-28 2002-04-04 Cellomics, Inc. Procedes et reactifs de quantification de l'expression de genes par des cellules vivantes
WO2004033718A2 (fr) * 2002-10-11 2004-04-22 Krause Henry M Marquage trap: nouveau procede d'identification et de purification de complexes arn-proteines
EP1499885A2 (fr) * 2001-08-01 2005-01-26 Cellomics, Inc. Nouvelles proteines de fusion et analyses de detection de liaisons moleculaires
EP1601576A2 (fr) * 2003-03-03 2005-12-07 The Trustees of Columbia University in the City of New York Systemes de biomarquage ligand/partenaire de liaison
EP2036989A1 (fr) * 2007-09-12 2009-03-18 Institut Pasteur Essai indicateur basé sur une seule cellule pour la surveillance des motifs d'expression des gènes à haute résolution spatio-temporelle

Families Citing this family (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USRE45842E1 (en) * 1999-02-17 2016-01-12 Ronald Redline Method for enhancing the solderability of a surface
DE60014987T2 (de) * 1999-02-22 2005-11-10 Matsushita Electric Industrial Co., Ltd., Kadoma Verfahren zum Nachweis von Bakterien
US6673554B1 (en) * 1999-06-14 2004-01-06 Trellie Bioinformatics, Inc. Protein localization assays for toxicity and antidotes thereto
US6692965B1 (en) * 1999-11-23 2004-02-17 Chromocell Corporation Isolation of living cells and preparation of cell lines based on detection and quantification of preselected cellular ribonucleic acid sequences
US20030198973A1 (en) * 2002-04-23 2003-10-23 The Molecular Sciences Institute, Inc. Chimeric fusion molecule for analyte detection and quantitation
US20060073481A1 (en) * 2002-04-23 2006-04-06 The Molecular Sciences Institute Formation and use of site specific nucleic acid coupled binding polypeptides
EP2163614B1 (fr) 2002-08-21 2016-10-12 Revivicor, Inc. Porcs déficient pour l'expression de l'alpha 1,3 galactosyl transférase
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
KR20150005720A (ko) * 2004-02-18 2015-01-14 크로모셀 코포레이션 신호 프로브를 이용하는 방법 및 물질
EP1774017B1 (fr) 2004-07-26 2013-05-15 Pfenex Inc. Procede permettant d'ameliorer l'expression d'une proteine par mise au point d'une souche par genie genetique
US8772254B2 (en) 2004-10-25 2014-07-08 Devgen N.V. Method and constructs for delivering double stranded RNA to pest organisms
EP2711434B1 (fr) * 2005-06-20 2016-09-14 Advanced Cell Diagnostics, Inc. Détection multiplex d'acides nucléiques
NZ565711A (en) 2005-08-09 2011-10-28 Revivicor Inc Transgenic ungulates expressing a porcine CTLA4 peptide fused to an immunoglobulin
WO2007038757A2 (fr) * 2005-09-28 2007-04-05 Attagene Inc. Procedes et compositions d'evaluation non invasive d'une expression genique
EP2066808A4 (fr) * 2006-09-28 2010-01-27 Yeda Res & Dev Polynucleotides isoles, constructions d'acides nucleiques, procedes et trousses de localisation d'arn et/ou de polypeptides dans des cellules vivantes
FR2910492B1 (fr) * 2006-12-20 2013-02-15 Bio Modeling Systems Ou Bmsystems Procede de preparation de bacteriophages modifies par insertion de sequences aleatoires dans les proteines de ciblage desdits bacteriophages
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9394571B2 (en) 2007-04-27 2016-07-19 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
EP3133170B1 (fr) * 2008-09-10 2020-03-18 Rutgers, the State University of New Jersey Imagerie de molécules d'arnm individuelles utilisant des sondes multiples à marquage unique
CA2895155C (fr) 2012-12-17 2021-07-06 President And Fellows Of Harvard College Manipulation du genome humain guidee par l'arn
WO2015006294A2 (fr) 2013-07-10 2015-01-15 President And Fellows Of Harvard College Protéines cas9 orthogonales pour la régulation et l'édition de gènes avec arn guide
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
WO2015134812A1 (fr) 2014-03-05 2015-09-11 Editas Medicine, Inc. Méthodes et compositions liées à crispr/cas et destinées à traiter le syndrome de usher et la rétinite pigmentaire
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
EP3981876A1 (fr) 2014-03-26 2022-04-13 Editas Medicine, Inc. Méthodes liées à crispr/cas et compositions pour le traitement de la drépanocytose
CN107690480B (zh) 2015-04-24 2022-03-22 爱迪塔斯医药公司 Cas9分子/指导rna分子复合物的评价
CA3035810A1 (fr) * 2015-09-02 2017-03-09 University Of Massachusetts Detection de loci de genes comprenant des repetitions matricielles de crispr et/ou des acides ribonucleiques mono-guides polychromatiques
WO2017066211A1 (fr) 2015-10-12 2017-04-20 Advanced Cell Diagnostics, Inc. Détection in situ de variants nucléotidiques dans des échantillons de bruit élevé et compositions et procédés associés
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
BR112019001887A2 (pt) 2016-08-02 2019-07-09 Editas Medicine Inc composições e métodos para o tratamento de doença associada a cep290
WO2018170184A1 (fr) 2017-03-14 2018-09-20 Editas Medicine, Inc. Systèmes et méthodes pour le traitement d'hémoglobinopathies
WO2018195254A1 (fr) * 2017-04-19 2018-10-25 Albert Einstein College Of Medicine, Inc. Système de marquage d'arn pour la visualisation de molécules d'arnm uniques
WO2018195402A1 (fr) 2017-04-20 2018-10-25 Egenesis, Inc. Procédés de production d'animaux génétiquement modifiés
EP3622070A2 (fr) 2017-05-10 2020-03-18 Editas Medicine, Inc. Crispr/arn-guidé systèmes et procédés nucléases transgéniques
WO2019136421A1 (fr) * 2018-01-08 2019-07-11 Lucidicor Inc. Biocapteur de protéine fluorescente pour la détection de l'activité kinase
SG11202008956XA (en) 2018-03-14 2020-10-29 Editas Medicine Inc Systems and methods for the treatment of hemoglobinopathies
CN112816395B (zh) * 2020-12-30 2022-05-10 北京大学 一种rna标记物及包含该标记物的活细胞标记方法和应用
WO2023023529A1 (fr) * 2021-08-17 2023-02-23 California Institute Of Technology Rapporteurs d'arn exportés pour la mesure de cellules vivantes

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996036692A1 (fr) * 1995-05-17 1996-11-21 The Regents Of The University Of California Selection in vivo de peptides pouvant se lier a un arn
WO1999037807A1 (fr) * 1998-01-26 1999-07-29 European Molecular Biology Laboratory Procede permettant d'isoler des composes qui se lient a l'arn

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH11502717A (ja) * 1995-04-11 1999-03-09 ザ ジェネラル ホスピタル コーポレーション 逆ツーハイブリッドシステム
US6027881A (en) * 1996-05-08 2000-02-22 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Mutant Aequorea victoria fluorescent proteins having increased cellular fluorescence

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996036692A1 (fr) * 1995-05-17 1996-11-21 The Regents Of The University Of California Selection in vivo de peptides pouvant se lier a un arn
WO1999037807A1 (fr) * 1998-01-26 1999-07-29 European Molecular Biology Laboratory Procede permettant d'isoler des composes qui se lient a l'arn

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
CUBITT A B ET AL: "UNDERSTANDING, IMPROVING AND USING GREEN FLUORESCENT PROTEINS" TIBS TRENDS IN BIOCHEMICAL SCIENCES,EN,ELSEVIER PUBLICATION, CAMBRIDGE, vol. 20, 1 November 1995 (1995-11-01), pages 448-455, XP000606919 ISSN: 0968-0004 cited in the application *
FISCHER U ET AL: "THE HIV-1 REV ACTIVATION DOMAIN IS A NUCLEAR EXPORT SIGNAL THAT ACCESSES AN EXPORT PATHWAY USED BY SPECIFIC CELLULAR RNAS" CELL,US,CELL PRESS, CAMBRIDGE, NA, vol. 82, no. 3, 11 August 1995 (1995-08-11), pages 475-483, XP002055418 ISSN: 0092-8674 *
FOUTS D E ET AL.: "Functional recognition of fragmented operator sites by R17/MS2 coat protein, a translational repressor" NUCLEIC ACIDS RESEARCH, vol. 25, no. 22, 1997, pages 4464-4473, XP002146303 cited in the application *
LONG R M ET AL.: "Spatial consequences of defective processing of specific yeast mRNAs revealed by fluorescent in situ hybridization" RNA, vol. 1, 1995, pages 1071-1078, XP000861885 *
PRIEVE M G ET AL.: "Differential importin-alpha recognition and nuclear transport by nuclear localization signals within the high-mobility group DNA binding domains of lymphoid enhancer factor 1 and T-cell factor 1" MOLECULAR AND CELLULAR BIOLOGY, vol. 18, no. 8, 1998, pages 4819-4832, XP000911843 *
PTUSHKINA M ET AL: "Intracellular targeting and mRNA interactions of the eukaryotic translation initiation factor eIF4E in the yeast Saccharomyces cerevisiae" BIOCHIMICA ET BIOPHYSICA ACTA,NL,AMSTERDAM, XP002076911 ISSN: 0006-3002 *
SENGUPTA D J ET AL: "A THREE-HYBRID SYSTEM TO DETECT RNA-PROTEIN INTERACTIONS IN VIVO" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,US,NATIONAL ACADEMY OF SCIENCE. WASHINGTON, vol. 93, 1 August 1996 (1996-08-01), pages 8496-8501, XP002038710 ISSN: 0027-8424 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6171705B1 (en) 1997-02-10 2001-01-09 Dofasco, Inc. Structural panel and method of manufacture
WO2002027031A2 (fr) * 2000-09-28 2002-04-04 Cellomics, Inc. Procedes et reactifs de quantification de l'expression de genes par des cellules vivantes
WO2002027031A3 (fr) * 2000-09-28 2003-11-06 Cellomics Inc Procedes et reactifs de quantification de l'expression de genes par des cellules vivantes
US7244614B2 (en) 2001-08-01 2007-07-17 Cellomics, Inc. Fusion proteins and assays for molecular binding
EP1499885A2 (fr) * 2001-08-01 2005-01-26 Cellomics, Inc. Nouvelles proteines de fusion et analyses de detection de liaisons moleculaires
EP1499885A4 (fr) * 2001-08-01 2005-11-16 Cellomics Inc Nouvelles proteines de fusion et analyses de detection de liaisons moleculaires
AU2002337664B2 (en) * 2001-08-01 2007-01-25 Cellomics, Inc. Novel fusion proteins and assays for molecular binding
WO2004033718A2 (fr) * 2002-10-11 2004-04-22 Krause Henry M Marquage trap: nouveau procede d'identification et de purification de complexes arn-proteines
WO2004033718A3 (fr) * 2002-10-11 2004-07-22 Henry M Krause Marquage trap: nouveau procede d'identification et de purification de complexes arn-proteines
GB2409274A (en) * 2002-10-11 2005-06-22 Henry M Krause Trap-tagging: a novel method for the identification and purification of RNA-protein complexes
GB2409274B (en) * 2002-10-11 2007-05-02 Henry M Krause Trap-tagging: a novel method for the identification and purification of RNA-protein complexes
EP1601576A2 (fr) * 2003-03-03 2005-12-07 The Trustees of Columbia University in the City of New York Systemes de biomarquage ligand/partenaire de liaison
EP1601576A4 (fr) * 2003-03-03 2007-12-05 Univ Columbia Systemes de biomarquage ligand/partenaire de liaison
US7575866B2 (en) 2003-03-03 2009-08-18 Virginia Cornish Ligand/binding partner bio-labeling systems
EP2036989A1 (fr) * 2007-09-12 2009-03-18 Institut Pasteur Essai indicateur basé sur une seule cellule pour la surveillance des motifs d'expression des gènes à haute résolution spatio-temporelle
WO2009065635A1 (fr) * 2007-09-12 2009-05-28 Institut Pasteur Essai reporter basé sur des cellules individuelles pour contrôler des profils d'expression génique avec une résolution spatio-temporelle élevée
US9663833B2 (en) 2007-09-12 2017-05-30 Institut Pasteur Single cell based reporter assay to monitor gene expression patterns with high spatio-temporal resolution

Also Published As

Publication number Publication date
US6586240B1 (en) 2003-07-01
EP1131469A2 (fr) 2001-09-12
WO2000023621A3 (fr) 2000-11-16
US6203986B1 (en) 2001-03-20
JP2002527117A (ja) 2002-08-27

Similar Documents

Publication Publication Date Title
US6586240B1 (en) Visualization of RNA in living cells
Bertrand et al. Localization of ASH1 mRNA particles in living yeast
Cockell et al. The carboxy termini of Sir4 and Rap1 affect Sir3 localization: evidence for a multicomponent complex required for yeast telomeric silencing.
Tang et al. Kinetic principles underlying pioneer function of GAGA transcription factor in live cells
JP5436736B2 (ja) タンパク質の酵母細胞表面ディスプレイおよびその使用
Long et al. An exclusively nuclear RNA-binding protein affects asymmetric localization of ASH1 mRNA and Ash1p in yeast
Lowell et al. A variant histone H3 is enriched at telomeres in Trypanosoma brucei
Cheeseman et al. Mitotic spindle integrity and kinetochore function linked by the Duo1p/Dam1p complex
Belgareh et al. Functional characterization of a Nup159p-containing nuclear pore subcomplex
JP3537141B2 (ja) 新種蛋白質分離のための相互作用を用いる補捉システム
Straube et al. Conventional kinesin mediates microtubule-microtubule interactions in vivo
JP2005504541A (ja) 多重鎖真核ディスプレイベクターとその使用
Rivero et al. Interaptin, an actin-binding protein of the α-actinin superfamily in Dictyostelium discoideum, is developmentally and cAMP-regulated and associates with intracellular membrane compartments
US8877446B2 (en) Method for detecting protein-protein interactions in cells
Li et al. Candida albicans hyphal morphogenesis occurs in Sec3p-independent and Sec3p-dependent phases separated by septin ring formation
JP2009513141A5 (fr)
Zhou et al. Cytoplasmic transport machinery of the SPF27 homologue Num1 in Ustilago maydis
Lee et al. Extranuclear structural components that mediate dynamic chromosome movements in yeast meiosis
AU2005263993A1 (en) Cell cycle reporting cell line
Corrales et al. The kinesin of the flagellum attachment zone in Leishmania is required for cell morphogenesis, cell division and virulence in the mammalian host
Bouchut et al. Vesicles bearing Toxoplasma apicoplast membrane proteins persist following loss of the relict plastid or Golgi body disruption
Gwóźdź et al. EcR and Usp, components of the ecdysteroid nuclear receptor complex, exhibit differential distribution of molecular determinants directing subcellular trafficking
WO2000049183A1 (fr) Detection de la camp dans des cellules vivantes par transfert d'energie de resonance de la fluorescence a l'aide de variants de la proteine gfp
Snippe et al. The use of fluorescence microscopy to visualise homotypic interactions of tomato spotted wilt virus nucleocapsid protein in living cells
JP4287633B2 (ja) オルガネラ局在タンパク質の解析方法と解析材料

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 577328

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1999970691

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999970691

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999970691

Country of ref document: EP