WO2000020611A1 - Transformation amelioree des plastides - Google Patents

Transformation amelioree des plastides Download PDF

Info

Publication number
WO2000020611A1
WO2000020611A1 PCT/EP1999/007227 EP9907227W WO0020611A1 WO 2000020611 A1 WO2000020611 A1 WO 2000020611A1 EP 9907227 W EP9907227 W EP 9907227W WO 0020611 A1 WO0020611 A1 WO 0020611A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
interest
dna
dna molecule
plant
Prior art date
Application number
PCT/EP1999/007227
Other languages
English (en)
Inventor
Roland Bilang
Yakandawala L. Nandadeva
Ingo Potrykus
Claudio Gianpiero Lupi
Original Assignee
Eidgenössische Technische Hochschule Zürich
Novartis-Erfindungen Verwaltungsgesellschaft M.B.H.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eidgenössische Technische Hochschule Zürich, Novartis-Erfindungen Verwaltungsgesellschaft M.B.H. filed Critical Eidgenössische Technische Hochschule Zürich
Priority to AU60882/99A priority Critical patent/AU6088299A/en
Publication of WO2000020611A1 publication Critical patent/WO2000020611A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8214—Plastid transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers

Definitions

  • This invention relates to methods and compositions for the select, stable transformation of plant organelles having circular DNA molecules and, in particular, to the select, stable transformation of plastids and the transgenic plants obtainable by said method.
  • Stable transformation of plant organelles having circular DNA molecules is a major goal in the area of agricultural biotechnology. Transformation of plant cells with DNA molecules preferentially expressed in organelles having circular DNA offers several advantages over nuclear transformation. Some of these advantages are precise integration of the transgene via homologous recombination, high expression levels of the transgene as several hundred up to thousand copies of the transgene are present in each cell and, for most crop species, elimination of undesired spread of the transgene via pollen since in most of these species the transgene is strictly maternally inherited.
  • the invention thus provides:
  • a method as mentioned before further comprising identifying cells expressing the gene of interest, preferentially by positive or negative selection or a combination thereof, and regenerating said cells to plants.
  • a method for the production of plants having stably transformed" circular DNA molecules localized in cellular organelles comprising transforming plant cells with a DNA molecule comprising a gene of interest that is designed such that it is preferentially expressed in plant organelles having circular DNA molecules and is flanked by DNA sequences that are sufficiently identical to parts of the organelle genome to allow integration of the transforming DNA molecule into the organelle genome, identifying plant cells expressing the gene of interest, regenerating the cells expressing the gene of interest to plants, and optionally, selecting for plants wherein all said cellular organelles are genetically identical.
  • the present invention provides DNA molecules that are specifically designed such that they can be suitably used within the methods of the invention.
  • the gene of interest is designed such that it is expressed from a prokaryotic-type transcription/translation machinery operating in an eukaryotic cell
  • the gene of interest comprises a translatable intron
  • each flanking sequence is at least 100 bp in length, particularly about 1000 bp in length, and more particularly about 2000 bp in length
  • the DNA sequence of the flanking region is at least 70%, particularly at least 80%, more particularly at least 90% and most particularly 100% identical to aligned sequences of the circular DNA molecule of the organelle
  • the gene of interest is a marker gene encoding a selectable or screenable trait
  • the marker gene is a np.ll gene or an aminoglycoside-3'-adenylyltransferase gene
  • the marker gene is a herbicide resistance gene
  • the marker gene is a hygromycin resistance gene
  • the marker gene is selected from the group consisting of phosphinothricin acetyltransferase, mutant EPSP synthase, mutant acetolactate synthase, mutant psbA, and mutant protoporphyrinogen oxidase genes
  • the DNA molecule additionally comprises a gene of interest encoding a desirable phenotypic trait
  • the gene of interest is a selectable marker gene
  • the gene of interest is a herbicide resistance gene
  • the transformation is done by electroporation or particle bombardment the transformation is done with protoplasts
  • the transformation is done with embryogenic cells
  • the plant is a monocot the plant belongs to the Poaceae the plant is rice, wheat, maize, Sorghum bicolor, orchardgrass or soybean
  • the invention further provides transgenic plants that are obtainable by the method mentioned hereinbefore.
  • the invention provides: - Plants produced by a method as mentioned hereinbefore, wherein
  • the plant is rice, wheat, maize, Sorghum bicolor, orchardgrass or soybean
  • Expression refers to the transcription and/or translation of an endogenous gene or a transgene in plants.
  • expression may refer to the transcription of the antisense DNA only.
  • preferably expressed means that the extent of expression of the DNA molecule from the nuclear genome and from the genome of a cellular organelle having circular DNA is sufficiently different so that plants having stably transformed circular DNA molecules are readily selected for.
  • Gene refers to a coding sequence and associated regulatory sequences wherein the coding sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA.
  • regulatory sequences are promoter sequences, 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
  • Gene of interest refers to any gene which, when transferred to a plant, confers upon the plant a desired characteristic such as antibiotic resistance, virus resistance, insect resistance, disease resistance, or resistance to other pests, herbicide tolerance, improved nutritional value, improved performance in an industrial process or altered reproductive capability.
  • the "gene of interest” may also be one that is transferred to plants for the production of commercially valuable enzymes or metabolites in the plant.
  • Heterolo ⁇ ous as used herein means "of different natural or of synthetic origin". For example, if a host cell is transformed with a nucleic acid sequence that does not occur in the untransformed host cell, that nucleic acid sequence is said to be heterologous with respect to the host cell.
  • the transforming nucleic acid may comprise a heterologous promoter, heterologous coding sequence, or heterologous termination sequence.
  • the transforming nucleic acid may be completely heterologous or may comprise any possible combination of heterologous and endogenous nucleic acid sequences.
  • Homoplasmic refers to a plant or to plant cells in which all plastids are genetically identical.
  • Marker gene a gene encoding a selectable or screenable trait.
  • a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a protein if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence.
  • Phenotypic trait a detectable property resulting from the expression of one or more genes.
  • Plant refers to any plant, particularly to seed plants.
  • Plant cell a structural and physiological unit of the plant, comprising a protoplast and a cell wall.
  • the plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, a plant tissue, or a plant organ.
  • Plant material refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, pollen tubes, ovules, embryo sacs, egg cells, zygotes, embryos, seeds, plastids, mitochondria, cuttings, cell or tissue cultures, or any other part or product of a plant.
  • Promoter a DNA sequence that initiates transcription of an associated DNA sequence.
  • the promoter region may also include elements that act as regulators of gene expression such as activators, enhancers, and/or repressors.
  • Protoplast isolated plant cell where the cell wall has been totally pr partially removed.
  • Recombinant DNA molecule a combination of DNA sequences that are joined together using recombinant DNA technology.
  • Screenable marker gene a gene whose expression does not confer a selective advantage to a transformed cell, but whose expression makes the transformed cell phenotypically distinct from untransformed cells.
  • Selectable marker gene a gene whose expression in a plant cell gives the cell a selective advantage.
  • the selective advantage possessed by the cells transformed with the selectable marker gene may be due to their ability to grow in the presence of a negative selective agent, such as an antibiotic or a herbicide, compared to the growth of non-transformed cells.
  • the selective advantage possessed by the transformed cells, compared to non- transformed cells may also be due to their enhanced or novel capacity to utilize an added compound as a nutrient, growth factor or energy source.
  • Selectable marker gene also refers to a gene or a combination of genes whose expression in a plant cell gives the cell both, a negative and a positive selective advantage.
  • Transformation Introduction of a nucleic acid into a cell.
  • the stable integration of a DNA molecule into the genome of an organism of interest is particularly useful.
  • the present invention relates to methods for the production of transgenic plants expressing a gene of interest from a select cellular organelle.
  • the method relates to the stable transformation of plant organelles having circular DNA molecules.
  • the cellular organelles to be transformed are plastids.
  • Currently available methods to express a gene of interest in transgenic plants suffer from the lack of predictability as to whether the transgene is expressed from the nuclear genome or from the genome of an organelle having autonomously replicating circular DNA.
  • the present method solves this problem and provides for reproducible and efficient expression of a gene of interest from the genome of a plant organelle having circular DNA.
  • a DNA molecule comprising a gene of interest, which preferably is a marker gene, that is designed such that it is preferentially expressed in said organelles.
  • Said gene is preferably flanked by DNA sequences that are sufficiently identical to parts of the organelle genome to allow integration of the transforming DNA molecule into the circular DNA of the organelle by homologous recombination.
  • Cells expressing the gene of interest are then identified and regenerated to plants.
  • plants wherein all said cellular organelles are genetically identical are selected for.
  • Select expression of the gene of interest is achieved by transforming cells with DNA molecules whose expression makes use of the prokaryotic-type transcription/translation machinery operating in eukaryotic cells.
  • This can be accomplished, for example, (a) by designing the gene of interest such that it comprises a prokaryotic consensus sequence, such as, for example, the Shine-Dalgarno consensus sequence that is necessary for binding of the mRNA to the prokaryotic 30S ribosomal subunit, (b) by inserting a translatable intron into the gene of interest, (c) by translating the gene of interest from a GTG instead of a ATG start codon, or (d) by a combination of one or more of these measures.
  • a prokaryotic consensus sequence such as, for example, the Shine-Dalgarno consensus sequence that is necessary for binding of the mRNA to the prokaryotic 30S ribosomal subunit
  • the regulatory up- and downstream elements necessary for proper expression of the gene of interest are of prokaryotic-type origin. They can be located on the transforming DNA molecule or on the genome to be transformed. If the regulatory sequences are located on the genome to be transformed, the complete gene of interest including regulatory sequences is formed upon integration of the transforming DNA into the organelle genome.
  • the efficiency of the method according to the invention may further be improved by adapting the overall codon usage of the transgene to that preferentially used in prokaryotes.
  • the gene of interest may be a marker gene encoding a selectable or screenable trait such as an antibiotic resistance gene or a herbicide resistance gene. Examples of marker genes are described below. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the np ⁇ gene which confers resistance to kanamycin, paromomycin, geneticin and related antibiotics (Vieira and Messing, 1982; Bevan et al., 1983) the bacterial aadA gene (Goldschmidt-Clermont, 1991 ), encoding aminoglycoside 3'-adenylyltransferase and conferring resistance to streptomycin or spectinomycin, the hph gene which confers resistance to the antibiotic hygromycin (Blochlinger and Diggelmann, 1984), and the dhfr gene, which confers resistance to methotrexate (Bourouis and Jarry, 1983).
  • markers to be used include a phosphinothricin acetyltransferase gene, which confers resistance to the herbicide phosphinothricin (White et al., 1990; Spencer et al. 1990), a mutant EPSP synthase gene encoding glyphosate resistance (Hinchee et al., 1988), a mutant acetolactate synthase (ALS) gene which confers imidazolione or sulfonylurea resistance (Lee et al., 1988), a mutant psbA gene conferring resistance to atrazine (Smeda et al., 1993), a mutant protoporphyrinogen oxidase gene as described in EP 0 769 059, or the Erwinia phytoene desaturase gene c ⁇ 7 that, when expressed in plastids, confers multiple resistance to herbicides interfering with carotenoid biosynthesis (Misawa et al., 1994).
  • Selection markers resulting in positive selection may also be used in the method according to the present invention either alone or in combination with one or more of the above mentioned antibiotic and herbicide resistance genes.
  • Identification of transformed cells may also be accomplished through expression of screenable marker genes such as genes coding for chloramphenicol acetyl transferase (CAT), ⁇ -glucuronidase (GUS), luciferase, and green fluorescent protein (GFP) or any other protein that confers a phenotypically distinct trait to the transformed cell.
  • the marker genes of the present invention can be removed from the plastid genome using methods as described by Fischer et al. (1996).
  • the invention further teaches a method in which the transforming DNA comprises a second gene of interest encoding a desirable phenotypic trait.
  • the invention also provides a plant having stably transformed circular DNA molecules localized in cellular organelles obtainable by a method of the present invention.
  • Circular DNA molecules are found in mitochondria and plastids. Both of these organelles are of prokaryotic origin and have their own genetic material which is inherited independently from the DNA in the cell nucleus.
  • a method for the production of plants having stably transformed plastids is provided. In the following, a detailed description will be given as to how to design DNA constructs that are preferentially expressed in plastids and how to select for plants with stably transformed plastids.
  • Mitochondria are present in animals, plants and fungi, whereas plastids are a group of organelles specifically found in plants.
  • the most common types of plastids are chloroplasts, chromoplasts, leucoplasts and amyloplasts. While different types of plastids have different functions, all plastids from the same plant have the same genetic content and are believed to be derived from a common precursor, known as a proplastid.
  • the plastid genome of higher plants varies among species from about 120 kb to 200 kb.
  • a single cell usually contains several plastids per cell with each plastid containing multiple copies of the organelle DNA molecule. This is of great advantage when high expression levels of the transgene are desired. Furthermore, the poiycistronic nature of plastidic RNAs provides for the coordinate expression of a group of genes. This can be of particular importance for the expression of valuable agronomic traits which may require the expression of more than one transgene.
  • flanking sequences encompassing the DNA to be integrated that are sufficiently identical to parts of the organelle genome to allow integration of the transforming DNA molecule into the circular genome of the organelle.
  • the flanking sequences are chosen based on sequence information of the plastid genome. In plant species where the plastid genome has not yet been sequenced, primers can be designed that are complementary to conserved regions in the plastid genome. The resulting PCR products can be cloned and sequenced to serve as basis for selection of the flanking sequences.
  • flanking sequences are at least 70%, particularly at least 80%, more particularly at least 90% and most particularly 100% identical to sequences of the circular genome of the organelle.
  • the percentage of sequence identity is determined using computer programs that are based on dynamic programming algorithms.
  • Computer programs that are preferred within the scope of the present invention include the BLAST (Basic Local Alignment Search Tool) search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. Version BLAST 2.0 (Gapped BLAST) of this search tool has been made publicly available on the Internet (currently http://www.ncbi.nlm.nih.gov/BLAST/).
  • the left and right flanking sequences are at least 100 bp in length, particularly about 1000 bp in length, and more particularly about 2000 bp in length or more.
  • the flanking sequences are located in intergenic regions to avoid disruption of functional genes. There may be circumstances, however, where it is desirable to have the gene of interest integrate into a functional gene thus disrupting the function of said gene.
  • the left and right flanking sequences may span a consecutive stretch of DNA which becomes interrupted upon insertion of the transforming DNA. Alternatively, they may border a piece of DNA that is deleted upon insertion of the transforming DNA.
  • expression of the gene of interest is controlled by regulatory up- and downstream elements functional in plant organelles having circular DNA but not, or to a lesser extent, in the nucleus. More precisely, the gene is expressed under the control of regulatory sequences known to be functional in plastids. Essentially, any up- or downstream element functional in plastids can be used. Expression of the gene can be controlled by regulatory elements present on the transforming DNA. Alternatively, expression can be controlled by regulatory up- and downstream elements present in the organelle genome but not on the DNA molecule transformed. If the gene of interest is expressed from regulatory elements present in the plastid DNA the inserting DNA, which itself lacks regulatory up- and downstream elements, should be designed such that it does not integrate into a gene with an essential function.
  • Preferred up- and downstream regulatory elements include, but are not limited to the promoter of the rice ribosomal 16S rDNA operon, the rpf ⁇ , rps19, clpP, psbA, and the rbcL promoters, the psbA 3' RNA termination signal from the rice psbA gene, and the rbcL 3' termination signal from the rice rbcL gene.
  • the gene of interest to be expressed in the plant organelle preferably is a marker gene encoding a selectable or screenable trait.
  • the transforming DNA may comprise an additional gene of interest encoding a desirable phenotypic trait.
  • Especially suitable for use in the process according to the invention are all those structural genes which upon expression lead to a protective effect in the transformed plant cells, also in the tissues developing therefrom and especially in the regenerated plants.
  • genes that confer increased resistance to pathogens such as phytopathogenic fungi, bacteria, viruses, etc.
  • genes that confer increased resistance to chemicals such as herbicides including triazines, sulfonylureas, imidazolinones, triazole pyrimidines, bialaphos, glyphosate, etc., insecticides or other biocides
  • genes that confer increased resistance to adverse environmental factors such as heat, cold, wind, adverse soil conditions, moisture, dryness, etc.
  • genes encoding proteins conferring resistance to insects and/or their larvae such as the crystalline protein of Bacillus thuringiensis or protease inhibitors such as the trypsin inhibitor from cowpea as described in Hilder et al. (1987)
  • genes encoding proteins attacking the structural component chitin found in the majority of insects and fungi such as chitinase genes — ⁇ -1 ,3-glucanase genes alone or in combination with chitinase genes to protect plants against a fungal attack
  • genes coding for so-called antimicrobial peptides such as defensins, cecropins, thionins, mellitins, magainins, attacins, dipterins, sapecins, caerulins and xenopsins (see for example WO 89/11291 ; WO 86/04356; WO 88/05826; US 4 810 777; WO 89/04371 ; WO 93/05153) which, in the broadest sense of the term are also to be understood as being compounds whose ability to penetrate, lyse or damage cell membranes is based on enzymatic activity, for example lysozymes and phospholipases
  • PRPs pathogenesis-related proteins
  • PRPs pathogenesis-related proteins
  • the DNA sequence according to the invention can also be used for the production of desirable and useful compounds in the plant cell as such or as part of a unit of higher organization, for example a tissue, callus, organ, embryo or a whole plant.
  • Genes that may also be used within the scope of the present invention include, for example, those which lead to increased or decreased formation of reserve or stored substances in leaves, seeds, tubers, roots, stems, etc. or in the protein bodies of seeds.
  • the desirable substances that can be produced by transgenic plants include, for example, proteins, carbohydrates, amino acids, vitamins, alkaloids, flavins, perfumes, colorings, fats, etc.
  • genes that code for pharmaceutically acceptable active substances for example hormones, immunomodulators and other physiologically active substances.
  • the genes that can come into consideration within the scope of this invention therefore include, for example, plant-specific genes, such as the zein gene from maize, the avenin gene from oats, the glutelin gene from rice, etc., mammal-specific genes, such as the insulin gene, the somatostatin gene, the interleukin genes, the t-PA gene, etc., or genes of microbial origin, such as the nptM gene, etc. and synthetic genes, such as the insulin gene, etc.
  • genes that code for a useful and desirable property within the scope of this invention it is also possible to use genes that have been modified previously in a specific manner using chemical or genetic engineering methods. Furthermore, the broad concept of the present invention also includes genes that are produced entirely or partially by chemical synthesis.
  • the present invention utilizes distinct structural features allowing the select expression of a gene of interest from the plastid genome. These structural features rely especially on the prokaryotic-type transcription/translation machinery that operates in the plastid compartment, but not in the nucleo/cytoplasmic compartment.
  • the gene of interest comprises a translatable intron.
  • the translatable intron bears features of common nuclear introns and is thus recognized by the nuclear splicing machinery and correctly spliced in the nucleo-cytoplasmic compartment. Splicing of TRIN results in a frame shift in the coding region of interest leading to the production of a non-functional expression product.
  • TRIN can be placed at any location of the gene of interest translated from a monocistronic or polycistronic RNA, where translation of TRIN does not affect the biological activity of the gene of interest, but where splicing of TRIN leads to a nonfunctional expression product.
  • TRIN is inserted into the 5' region of the coding sequence of the gene of interest downstream of the translation initiation codon.
  • TRIN is part of a polycistronic RNA and the translatable intron precedes the gene of interest.
  • the translatable intron can comprise the recognition sequence for a protease, which removes the translated intron sequence from the expressed protein.
  • the gene of interest is a marker gene
  • the splicing of the translatable intron leads to impairing of marker gene function and hence loss of selective advantage for nuclear transformants.
  • the gene of interest preferably has an enriched adenine and thymine content of greater than 50%, as described in US patent 5 545 817. Growth of tissue in the presence of a selective agent leads to the specific amplification of cells with transformed plastids.
  • Introns described by Goodali and Filipowicz (1989) such as syn17 and syn7 having a high splicing efficieny can also be used to construct pTRIN- type transforming DNA molecules.
  • the gene of interest is cloned to be part of a monocistronic or polycistronic RNA which is translated from a GTG start codon.
  • GTG is not recognized as translation initiation codon. Consequently, translation of the gene of interest is avoided. Plastids however, are able to initiate translation from a GTG start codon which results in the production of a functional protein.
  • the gene of interest is a marker gene, growth of tissue in the presence of a selective agent leads to the specific amplification of cells with transformed plastids. Details on the construction of pGTG-type transforming DNA molecules are given in the examples.
  • the transforming DNA molecule comprises between the two flanking regions a marker gene encoding a selectable or screenable trait, wherein the 5' end of the coding region of the marker gene is adjacent to a promoter capable of directing expression of the marker gene in plastids, and the 3' end of the coding region operably linked to termination signals functional in said organelle.
  • Plants transformed in accordance with the present invention may be monocots or dicots and include, but are not limited to, rice, maize, wheat, barley, rye, sweet potato, sweet corn, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, hemp, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugar-beet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, potato, eggplant, cucumber, Arabidopsis thaliana, and woody plants such as coniferous and deciduous trees.
  • Preferred plants to be transformed are rice, maize, wheat, barley, cabbage, cauliflower, pepper, squash, melon, soybean, tomato, sugar-beet, sunflower or cotton, but especially rice, maize, wheat, Sorghum bicolor, orchardgrass, sugar beet or soybean.
  • a desired DNA sequence may be propagated in that species or moved into other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques.
  • the recombinant DNA sequences can be introduced into the plant cell in a number of well known ways. Those skilled in the art will appreciate that the choice of method might depend on the type of plant, i.e. monocot or dicot, targeted for transformation.
  • Suitable methods of transforming plant cells include microinjection (Crossway et al., 1986), electroporation (Riggs and Bates, 1986), Agrobacterium-med ⁇ a ⁇ ed transformation (Hinchee et al., 1988; EP 0 853 675), direct gene transfer (Paszkowski et al., 1984), and ballistic particle acceleration using, for example, devices available from Agracetus, Inc., Madison, Wisconsin and Dupont, Inc., Wilmington, Delaware (see, for example, US patent 4 945 050 and McCabe et al., 1988).
  • the cells to be transformed may be differentiated leaf cells, embryogenic cells, or any other type of cell.
  • the uptake of exogenous genetic material into a protoplast may be enhanced by use of a chemical agent or electric field.
  • the exogenous material may then be integrated into the nuclear genome.
  • the early work was conducted in the dicot tobacco where it was shown that the foreign DNA was incorporated and transmitted to progeny plants (Paszkowski et al., 1984; Potrykus et al., 1985).
  • Monocot protoplasts have also been transformed by this procedure in, for example, Triticum monococcum, Lolium multiflorum (Italian rye grass), maize, and Black Mexican sweet corn.
  • An additional preferred embodiment is the protoplast transformation method for maize as disclosed in EP 0 292 435, as well as in EP 0 846 771.
  • Transformation of rice can be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment.
  • Protoplast-mediated transformation has been described for apon/ ' ca-types and /nd/ca-types (Zhang et al., 1988;
  • Patent application EP 0 332 581 describes techniques for the generation, transformation and regeneration of Pooideae protoplasts. These techniques allow the transformation of all
  • Pooideae plants including Dactylis and wheat. Furthermore, wheat transformation has been described in patent application EP 0 674 715 and by Weeks et al. (1993).
  • Example 1 Construction of a pTRIN-type DNA molecule pTRIN-type DNA molecules are characterized by the insertion into the marker gene (here: npfll) of a translatable intron (TRIN) sequence bearing features of common nuclear introns. TRIN is correctly spliced in the nucieo-cytoplasmic compartment. This leads to impairing of npfll gene function and hence loss of selective advantage for nuclear transformants. In contrast, expression of pTRIN-type DNA molecules in the plastidic compartment results in non-spliced mRNA and a functional NPTII protein. Growth of tissue in the presence of paromomycin leads to selective amplification of cells with transformed plastids.
  • the marker gene here: npfll
  • TNN translatable intron
  • a rice plastid DNA (Ospt DNA) fragment spanning from position 103615 to 105621 of the small single copy region of the rice plastid genome (containing ORF63 and trnL; see Hiratsuka et al., 1989 and GenBank accession number X15901 ) is PCR amplified as two subfragments in a 50 ⁇ l reaction volume containing 1 ⁇ M each of forward and reverse primers (Table 1 ), 50 ⁇ M of each dNTP, 5 ⁇ l of pfu reaction buffer (Stratagene), 250 ng of total genomic rice DNA, and 5 units of pfu (exo + ) polymerase (Stratagene) using the following thermal program: 1 x (94°C 5 min.); 25 x (94°C for 60 sec, 57°C for 60 sec, 72°C for 128 sec); 1 x (72°C for 3 min).
  • Reverse primer for fragment 1 atatatcagagaggtttgttc 2 104682-104662
  • the 931 bp-iong PCR fragment 1 is cloned into the EcoRV site of pBluescript I SK(-), Stratagene, (pBSKI(-)), yielding pNAN13. Correct insert-orientation (position 103615 towards p ⁇ l site) of fragment 1 is confirmed by an Sspl digest of pNAN13, yielding fragments of 553 bp, 283 bp, 728 bp, and 2183 bp.
  • the 1067 bp-long PCR fragment 2 is cloned into the EcoRV site of pBSK(-) resulting in pNAN14. Correct insert-orientation of fragment 2 (i.e. with the restored EcoRV-site oriented towards the Sad site of pBSKI(-)) yields fragments of 542 bp, 382 bp, and 2933 bp upon ⁇ /col plus Spel-digestion of pNAN14.
  • pNAN14 is opened with /-//ndlll-/4sp718 and religated after filling-in the single-stranded termini using dNTPs and the Klenow fragment of E. coli DNA polymerase I, producing pNAN15.
  • Ospt DNA fragment 1 is released from pNAN13 as a Psfl-H/ndlll fragment, blunt-ended with Klenow fragment of E. coli DNA polymerase I, and inserted into the blunt-ended Ssfl site of pNAN15. Correct orientation is confirmed by an Sspl digest of pNAN15, providing fragments of 1 13 bp, 328 bp, 553 bp, 728 bp, 800 bp, and 2402 bp.
  • the 16r promoter was amplified from Ospt DNA as a 1076 bp fragment (fragment 3) using PCR conditions as mentioned above and the following thermal program and primers (Table 2): 1 x (94°C for 5 min); 25 x (94°C for 60 sec, 58°C for 60 sec, 72°C for 175 sec); 1 x (72°C for 5 min.)
  • the reverse primer introduces a Shine-Dalgamo (SD) sequence (ggagg; in italics) 29 bp downstream of the 16r transcription start site.
  • the reverse PCR primer also carries SamHI and ⁇ /col recognition sequences (underlined) downstream of the SD sequence, which is used for the fusion of protein encoding genes.
  • a fragment containing the 3'-end of npfll is PCR amplified from vector pPZP111 with the above conditions and the following primers (Table 4). The resulting product is cut with Cla ⁇ and Spnl (inside npfll open reading frame).
  • Example 2 Construction of a pGTG-type DNA molecule
  • pGTG-type DNA molecules are plastidic gene replacement vectors.
  • the respective marker genes here the npfll or the aadA gene, are cloned to be part of a plastidic polycistronic RNA.
  • the pGTG DNA molecule comprises an additional selectable marker gene encoding resistance to the herbicide atrazine. Expression of the antibiotic resistance gene of the pGTG vectors is controlled by endogenous up- and downstream plastome elements not present on the transformation vector.
  • rps19 encodes a protein of the small ribosomal subunit. As part of a housekeeping operon it is expressed in pro-plastids as well as chloroplasts.
  • Two copies of rpsl 9 are each located at the very edge of the plastome inverted repeats, i.e., at the junction between inverted repeats and large single-copy region. This results in the targeted disruption of only one copy of rps19, the other one remains functional.
  • the plastidic psbA gene which is part of the flanking region of this pGTG-type transformation vector is further modified by substituting the Serine residue at position 254 by a Threonine (S254T). This confers atrazine-resistance to the encoded D1 protein, and an additional physical marker is introduced at this position (Psp1406l site).
  • PCR is performed in a Techne Progene thermal cycler (Witek AG, Switzerland) under the following conditions: 1 x (94°C for 5 min); 25 x (94°C for 60 se , 55°C for 60 sec, 72°C for 120 sec); 1 x (72°C for 5 min), in 50 ⁇ l reaction volume containing 1 ⁇ M each of forward and reverse primers (Table 5), 50 ⁇ M of each dNTP, 5 ⁇ l of pfu reaction buffer (Stratagene), 250 ng of total genomic rice DNA, and 5 units of pfu (exo + ) polymerase (Stratagene).
  • Reverse primer for fragment 4 and forward primer for fragment 5 introduce a mutation to the psbA gene which results in a S264T substitution in the psbA-encoded D1 protein, conferring resistance to atrazine.
  • a physical marker, Psp1406l recognition site, is also introduced by the same mutation.
  • Fragment 4 and fragment 5 are incubated with H/ndlll plus Psp1406l and Sa l plus
  • a 835 bp long fragment 6 is PCR-amplified from pNAN1 using the above reaction conditions and the following PCR program and primers (Table 6): 1 x (94°C for 5 min.); 25 x
  • the PCR amplified fragment 6 is treated with H/ndlll and S al and fused to H/ ' ndlll plus Smal-linearized pBSKI(-) to yield pNAN2.
  • a Sad-H/ncll fragment is released from pNAN1 , treated with Klenow fragment of DNA polymerase I, and fused to H/ncll-linearized pBSKI(-) to yield pNAN3.
  • the correct orientation of the fragment yields an Xbal fragment of approx. 200 bp.
  • a 203 bp-long fragment 7 containing the 3'-end region of rbcL is amplified from Ospt DNA using the above reaction conditions and the following thermal program and primers (Table 7): 1 x (94°C for 5 min.); 25 x (94°C for 30 sec, 55°C for 30 sec, 72°C for 15 sec); 1 x (72°C for 5 min.).
  • Table 7 PCR primers amplifying fragment 7 from Ospt DNA
  • PCR-amplified fragment 7 is treated with H/ndlll and Xbal and fused to H/ndlll plus Xbal- linearized pBSKI(-), resulting in pNAN4.
  • a 188 bp-fragment containing the 5'-end of the npfll coding region, but lacking the first 12 bp of the wild-type npfll sequence (Beck et al., 1982), is amplified from pHP28 (Paszkowski et al., 1988) using the above PCR conditions and the primers shown in Table 8. The resulting fragment is treated with SamHI and Pst ⁇ . The 3'-part of npfll is isolated from pHP28 on a 635 bp Pst ⁇ - H/ndlll fragment. pBSKI(-) is linearized with SamHI and Xbal, the
  • Table 8 PCR primers amplifying a 5'-end fragment of the npfll gene
  • pNAN5 The coding region of npfll is mobilized on a SamHI-Xbal-fragment from pBSKNPTII, and the rbcL 3' end on a Xbal-H/ncll fragment from pNAN4. These fragments are triple-ligated into pNAN3 linearized with H/ncll and SamHI. This yields pNAN5, containing the ATG-free npfll coding region fused to rbd_3'-end and an Ospt DNA segment termed "right flanking region".
  • ⁇ /col-Xbal-fragment from pBSKAAD (containing the aadA coding region) and the 238 bp Xnol- ⁇ /col fragment of pNAN7 containing the 16r promoter region and SD sequence are triple-ligated into Xbal-Xnol linearized pMCS5, resulting in vector pNAN17A.
  • a 1080 bp Pvt/I- H/ndlll fragment containing rps19 leader sequence, npfll coding region and rbd_3' is isolated from pGTGNPT.
  • the Pvu ⁇ terminal is blunt-ended with Klenow fragment of DNA polymerase I.
  • the fragment is then inserted downstream of the aadA coding region into Xbal (blunt-ended) plus H/ndlll linearized pNAN17A, yielding pNAN18A.
  • pAADNPT the concept of using a polycistronic mRNA to express a marker gene illustrated by vector pGTGNPT is further developed.
  • the expression cassette consists of two exogenous genes, and it can be mobilized to other sites in the plastid genome.
  • nucleotide sequence of the PCR-amplified fragments used for the construction of pGTGNPT, pTRINPT, or pAADNPT can be analyzed by commercially available sequencing systems, e.g. Perkin Elmer 373.
  • Milligram amounts of pTRINPT, pGTGNPT or pAADNPT are prepared by a commercially available kit (e.g., Jetstar, Genomed) and dissolved in sterile TE at 1 ⁇ g/ ⁇ l.
  • Example 4 Initiation and maintenance of a rice embryogenic cell suspension
  • Immature spikelets with milky endosperm of the Japonica rice variety "Taipei 309" are dehulled and surface sterilized with 70% (v/v) ethanol for 1 min and 6% calcium hypochlorite for 20 min, followed by three washes with sterile distilled water.
  • the isolated immature embryos are cultured at 28°C on 0.35% agarose-solidified MS- medium (Murashige and Skoog, 1962) containing 3% sucrose, 2 mg/l 2,4- dichiorophenoxyacetic acid (2,4-D), pH 5.8. After one week, callus material produced from the scutella is divided and cultured by weekly transfers onto fresh medium.
  • Two- to 3-month-old suspension cultures that have been subcultured 3 to 4 days in advance serve as target cells for the bombardments.
  • Four hours before particle bombardment approx. 500 mg of cells are spread as a single layer of 2 cm in diameter on 0.35% agarose-solidified plasmolysis medium (R2 salts and vitamins, 1 mg/l 2,4-D, 3% sucrose, 0.5 M sucrose, pH 5.8) contained in a 5.5-cm petri dish.
  • a particle inflow gun (Finer et al., 1992) is used to deliver DNA-coated gold particles (Aldrich Cat. # 32,658-5, spherical gold powder 1.5-3.0 ⁇ m) into the embryogenic suspension cells.
  • Particle coating is essentially performed as described by Vain et al. (1993): 5 ⁇ l aliquots of the plasmid solution are distributed into 0.5 ml-reaction tubes and placed on ice. Particles are suspended in 96% ethanol at 100 mg/ml and vortexed for 2 min. Ethanol is replaced by an equal volume of sterile ddH 2 O and the suspension vortexed for 1 min. This washing step has to be repeated once. The particles are finally resuspended in sterile ddH 2 O at 100 mg/ml.
  • 25 ⁇ l of the particle suspension are added to each of the DNA aliquots and the tubes vortexed for 1 min, followed by immediate addition of 25 ⁇ l of sterile, ice-cold CaCI 2 (2.5 M in ddH 2 O) and further vortexing for 1 min. 10 ⁇ l of sterile spermidine (0.1 M in ddH 2 O) are added, the suspension vortexed again and placed on ice for 5 min during which the particles sediment. 50 ⁇ l of the particle-free supernatant are removed and the remaining suspension (15 ⁇ l) used for 5 bombardments. Prior to each bombardment, the particles need to be resuspended by intense pipetting.
  • the cells are covered with a 500 ⁇ m mesh baffle and positioned at 14 cm below the filter unit containing the particles. Particles are released by a single 8-bar-pressure pulse of 50 msec in partial vacuum (2 x 10 4 Pa).
  • the cells are transferred onto 0.3% agarose-solidified, selective callus increasing medium R2I (R2 salts, 1 mg/l 2,4-D, 1 mg/l thiamine-HCI, 500 mg/l MES, 6% sucrose, pH 5.8) containing 30 mg/l paromomycin, and maintained at 28°C in darkness for 3 weeks until the paromomycin- resistant (Pam R ) colonies become visible under the stereo microscope.
  • Pam R colonies are transferred onto fresh R2I medium containing 40 mg/l paromomycin and cultured in darkness (weekly subculture).
  • the cells are transferred onto 0.3% agarose- solidified, selective callus increasing medium R2I containing 500 mg/l streptomycin sulfate, and maintained at 28°C in darkness for 1 week.
  • the developing colonies are then transferred to 0.5% agarose-solidified R2R plates containing 500 mg/l streptomycin and cultured for 3 weeks (weekly subculture) in darkness until the streptomycin-resistant (Str R ) colonies become visible.
  • Str R colonies are transferred onto fresh R2R medium containing 500 mg/l streptomycin, and cultured in light until shoot formation. Green shoots are used for further analysis.
  • callus material is maintained on R2I medium with 500 mg/l streptomycin in order to obtain homoplasmic cell lines.
  • a preferred technique for wheat transformation involves particle bombardment of immature wheat embryos and includes either a high sucrose or a high maltose step prior to gene delivery.
  • any number of embryos (0.75-1 mm in length) are plated onto MS medium with 3% sucrose (Murashige and Skoog, 1962) and 3 mg/l 2,4-D for induction of somatic embryos which is allowed to proceed in the dark.
  • MS medium with 3% sucrose (Murashige and Skoog, 1962) and 3 mg/l 2,4-D for induction of somatic embryos which is allowed to proceed in the dark.
  • embryos are removed from the induction medium and placed onto the osmoticum (i.e. induction medium with sucrose or maltose added at the desired concentration, typically 15%). The embryos are allowed to plasmolyze for 2-3 h and are then bombarded.
  • Twenty embryos per target plate is typical, although not critical.
  • An appropriate gene-carrying plasmid is precipitated onto micrometer size gold particles using standard procedures.
  • Each plate of embryos is shot with the DuPont Biolistics helium device using a burst pressure of -1000 psi and using a standard 80 mesh screen. After bombardment, the embryos are placed back into the dark to recover for about 24 h (still on osmoticum). After 24 hrs, the embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration. Approximately one month later the embryo explants with developing embryogenic callus are transferred to regeneration medium (MS + 1 mg/liter NAA, 5 mg/liter GA), further containing the appropriate selection agent.
  • GA7s which contained half-strength MS, 2% sucrose, and the same concentration of selection agent.
  • the stable transformation of wheat is described in detail in patent application EP 0 674 715.
  • Example 8 Preparation of a special type of callus of Zea mays, elite inbred line Funk 2717
  • Zea mays plants of the inbred line Funk 2717 are grown to flowering in the greenhouse, and self pollinated. Immature ears containing embryos about 2 to 2.5 mm in length are removed from the plants and sterilized in 10% Chlorox solution for 20 minutes. Embryos are aseptically removed from the kernels and plated with the embryo axis downwards on OMS medium containing 0.1 mg/l 2,4-D, 6% sucrose and 25 mM L-proline solidified with 0.24% Gelrite (initiation medium).
  • the callus developing on the scutellum is removed from the embryo and plated on B5 medium (Gamborg et al., 1968) containing 0.5 mg/l 2,4-D and solidified with 0.24% Gelrite.
  • B5 medium Gibborg et al., 1968
  • the callus is subcultured every two weeks to fresh medium.
  • the special type of callus is identified by its characteristic morphology. This callus is subcultured further on the same medium.
  • the callus is transferred to, and serially subcultured on, N6 medium containing 2 mg/l 2,4-D and solidified with Gelrite.
  • Example 9 Preparation of a suspension culture of Zea mays elite inbred line Funk 2717
  • the callus described above is subcultured for a total of at least six months.
  • the type of callus chosen for subculture is relatively non-mucilaginous, granular and very friable, such that it separates into small individual cell aggregates upon placing into liquid medium. Cultures containing aggregates with large, expanded cells are not retained. Approximately 500 mg aliquots of the special callus of Zea mays elite inbred Funk 2717 are placed into 30 ml of N6 medium containing 2 mg/l 2,4-D in 125 ml Delong flasks. After one week of culture at 26°C in the dark on a gyratory shaker (130 rpm, 2.5 cm throw), the medium is replaced with fresh medium. The suspensions are again subcultured in this way after another week.
  • the cultures are inspected, and those which do not show large numbers of expanded cells are retained. Suspension cultures containing aggregates with large, expanded cells are discarded.
  • the preferred tissue consists of densely cytoplasmic dividing cell aggregates which have a characteristically smoother surface than the usual type of cell aggregates.
  • the cultures retained have at least 50% of the cells represented in these small aggregates. This is the desired morphology.
  • These suspensions also have a rapid growth rate, with a doubling time of less than one week.
  • the suspension cultures are subcultured weekly by transferring 0.5 ml PCV into 25 ml of fresh medium. After four to six weeks of subculture in this fashion, the cultures increase two- to three-fold per weekly subculture.
  • 1 to 1.5 ml PCV of the suspension culture cells from above are incubated in 10 to 15 ml of a filter-sterilized mixture consisting of 4% cellulase RS with 1% Rhozyme in KMC (8.65 g/l KCI, 16.47 g/l MgCI 2 x 6 H 2 O and 12.5 g/l CaCI 2 x 2 H 2 O, 5 g/l MES, pH 5.6) salt solution.
  • Digestion is carried out at 30°C on a slow rocking table for a period of 3 to 4 hours. The preparation is monitored under an inverted microscope for protoplast release.
  • the protoplasts which are released are collected as follows: The preparation is filtered through a 100 ⁇ m mesh sieve, followed by a 50 ⁇ m mesh sieve. The protoplasts are washed through the sieves with a volume of KMC salt solution equal to the original volume of enzyme solution. 10 ml of the protoplast preparation is placed in each of several disposable plastic centrifuge tubes, and 1.5 to 2 ml of 0.6 M sucrose solution (buffered to pH 5.6 with 0.1 % MES and KOH) layered underneath. The tube is centrifuged at 60 to 100 x g for 10 minutes, and the protoplasts banding at the interface collected using a pipette and placed in a fresh tube.
  • the protoplast preparation is resuspended in 10 ml of fresh KMC salt solution, and centrifuged for five minutes at 60 to 100 x g. The supernatant is removed and discarded, and the protoplasts resuspended gently in the drop remaining, and then 10 ml of a 13/14 strength KMC solution gradually added. After centrifuging again for five minutes, the supernatant is again removed and the protoplasts resuspended in a 6/7 strength KMC solution. An aliquot is taken for counting, and the protoplasts again sedimented by centrifugation.
  • the protoplasts are resuspended at 10 7 per ml in KM-8p medium or in 0.5 M mannitol containing 6 mM MgCI 2 or other suitable medium for use in transformation as described in the following examples.
  • This protoplast suspension is used for transformation and is cultured as described below.
  • the protoplasts are cultured as follows. The samples are plated in 6 cm petri dishes at room temperature. After a further 5 to 15 minutes, 3 ml of KM-8p medium containing 1.2% SeaPlaque agarose and 1 mg/l 2,4-D are added. The agarose and protoplasts are mixed well and the medium allowed to gel.
  • the PEG used is PEG with a MW of 4000.
  • the protoplasts are plated after the electroporation in dishes, placed on a plate cooled to a temperature of 16°C.
  • the protoplasts are placed in tubes after the electroporation step, washed with 10 ml of 6/7 strength KMC solution or with W5 solution (comprised of 380 mg/l KCI, 18.375 g/l CaCI 2 x 2 H 2 O, 9 g/l NaCI; 9 g/l glucose, pH 6.0), then collected by centrifugation at 60 x g for 10 minutes, resuspended in 0.3 ml of KM medium, and plated as in A. (7) The calf thymus carrier DNA is not added.
  • the protoplasts are resuspended at the last step of above in a 0.5 M mannitol solution containing 12 to 30 mM MgCI 2 .
  • a heat shock of 45°C for five minutes is given as described.
  • the protoplasts are distributed in aliquots for transformation in centrifuge tubes, 0.3 ml of suspended protoplasts per tube.
  • DNA and PEG solution MW 6000, 40% containing 0.1 M Ca(NO 3 ) 2 and 0.4 M mannitol; pH 8 to 9 with KOH
  • the aliquots are incubated for 30 minutes with occasional gentle shaking, and then the protoplasts are placed in petri dishes (0.3 ml original protoplast suspension per 6 cm diameter dish) and cultured as described.
  • the plates containing the protoplasts in agarose are placed in the dark at 26°C. After 14 days, colonies arise from the protoplasts.
  • the agarose containing the colonies is transferred to the surface of a 9 cm diameter petri dish containing 30 ml of N6 medium containing 2 mg/l 2,4-D, solidified with 0.24% Gelrite. This medium is referred to as 2N6.
  • the callus is cultured further in the dark at 26°C and callus pieces subcultured every two weeks onto fresh solid 2N6 medium.
  • Callus growing on ON6 and N61 media is grown in the light (16 hours/day light of 840 to 8400 Ix from white fluorescent lamps).
  • Callus growing on N61 medium is transferred to ON6 medium after two weeks, as prolonged time on N61 medium is detrimental.
  • the callus is subcultured every two weeks even if the callus is to be transferred again on the same medium formulation. Plantlets appear in about four to eight weeks. Once the plantlets are at least 2 cm tall, they are transferred to ON6 medium in GA7 containers.
  • Protoplasts of sorghum suspension FS 562 are prepared essentially as described for Zea mays above, and resuspended following the last wash at a density of 10 7 per ml in the following solution: 0.2 M mannitol, 0.1 % MES, 72 mM NaCI, 70 mM CaCI 2 , 2.5 mM KCI, 2.5 mM glucose, pH to 5.8 with KOH, at a density of 1.6 to 2 x 10 6 per ml.
  • the protoplast suspension is distributed as 1 ml aliquots into plastic disposable cuvettes and 10 ⁇ g of DNA added as described.
  • the resistance of the solution at this point when measured between the electrodes of the 471 electrode set of the electroporation apparatus described below is in the range of 6.
  • the DNA is added in 10 ⁇ l sterile distilled water, sterilized as described by Paszkowski et al. (1984). The solution is mixed gently and then subjected at room temperature (24 to 28°C) to a pulse of 400 Vcm "1 with an exponential decay constant of 10 ms from a BTX-Transfector 300 electroporation apparatus using the 471 electrode assembly. B. The above is repeated with one or more of the following modifications:
  • the voltage used is 200 Vcm “1 , or between 100 Vcm '1 and 800 Vcm “1 .
  • the exponential decay constant is 5 ms, 15 ms or 20 ms.
  • the plasmid DNA is linearized before use by treatment with an appropriate restriction enzyme (e.g. BamHI).
  • an appropriate restriction enzyme e.g. BamHI
  • the protoplasts are cultured following transformation at a density of 2 x 10 6 per mi in KM-8p medium, with no solidifying agent added.
  • Protoplasts of Glycine max are prepared by the methods as described by Tricoli et al. (1986), or Chowhury and Widholm (1985), or Klein et al. (1981 ). DNA is introduced into these protoplasts essentially as described above. The protoplasts are cultured as described in Klein et al. (1981 ), Chowhury and Widholm (1986) or Tricoli et al. (1986) without the addition of aiginate to solidify the medium.
  • Embryogenic callus is initiated from basal sections of the youngest leaves of greenhouse-grown orchardgrass plants (Dactylis glomerata L.) as described by Hanning and Conger (1982). The leaves are surface sterilized by immersion in a 1 :10 dilution of Chlorox solution (5.25% sodium hypochlorite; The Clorox Company, Oakland, Ca.) for about 10 minutes and then cut aseptically into small segments of 1 to 5 mm in length or in diameter. These segments are plated on sterile SH-30 medium containing 0.8% agarose as a gelling agent. Callus and/or embryogenic structures appear within 2 to 6 weeks after plating, upon culture at about 25°C. Embryogenic callus is maintained by subculturing onto fresh SH-30 medium every 2 to 4 weeks and culturing in the dark at 25°C.
  • Embryogenic suspension cultures are initiated by placing about 0.5 g fresh weight of embryogenic callus into 50 ml of liquid medium described by Gray and Conger (1985) containing 45 ⁇ M dicamba and 4 g/liter casein hydrolysate.
  • the suspension cultures are grown at 27°C under a 16 hours light (3300 Ix), 8 hours dark photoperiod on a gyratory shaker at about 130 rpm in 125 ml Delong flasks sealed with a metal cap and parafiim. After about four weeks the large clumps are allowed to settle for about 30 seconds and 10 ml aliquots of the supernatant medium containing small cell clusters are removed and transferred to 50 ml of fresh medium.
  • Protoplasts are prepared from embryogenic suspension cultures of above by aseptically filtering the cells on a Nalgene 0.2 ⁇ m filter unit and then adding 0.5 g fresh weight cells to each 12.5 ml of protoplast enzyme mixture in a petri dish.
  • the enzyme mixture consists of 2% Cellulase RS, 7 mM CaCI 2 x H 2 O, 0.7 mM NaH 2 PO 4 x H 2 O, 3 mM MES (pH 5.6), glucose (550 mOs/kg H 2 O of pH 5.6), and is filter sterilized.
  • the mixture is swirled on an orbital shaker at about 50 rpm in dim ( ⁇ 420 Ix) light for about 4 to 5 hours.
  • the digest is then sieved through a stainless steel sieve (100 ⁇ m mesh size) and distributed into 12 ml centrifuge tubes which are centrifuged at about 60 to 100 x g for about 5 minutes.
  • the protoplast-containing sediment is then washed three times with protoplast culture medium KM-8p adjusted to 550 mOs/kg H 2 O with glucose.
  • a flotation step may be included for further purification of the protoplasts.
  • the washed protoplasts are layered atop 10 ml of KM-8p culture medium adjusted to 700 mOs/kg H 2 O with sucrose.
  • protoplasts banding at the interface are collected using a fine pipette. Finally, the protoplasts are resuspended in 1 to 2 ml KM-8p culture medium and sieved through a stainless mesh screen (20 ⁇ m mesh size). The protoplasts released are collected and washed and resuspended in KM-8p medium for culture or in osmotically adjusted medium suitable for transformation according to the examples below.
  • Example 20 Dactylis glomerata protoplast culture and growth of callus A.
  • the purified protoplasts are plated at a density of about 5 x 10 5 protoplasts per ml in KM- 8p culture medium containing 1.3% SeaPlaque agarose (FMC Corp., Marine Colloids Division, Rockland, Maine, USA) and 30 to 40% of conditioned medium (obtained from 3 to 4 week-old Dactylis glomerata embryogenic suspension cultures by filtering the medium through a sterile Nalgene 0.2 ⁇ m filter, making the medium 550 mOs/kg H 2 O by addition of glucose, and again filter sterilizing). The plates are then placed in the dark at a constant temperature of 28°C.
  • the agarose is cut into wedges and placed into 'bead culture' as described by Shillito et al. (1983) using 20 ml SH-45 suspension culture medium with 3 % sucrose per 3 mi original agarose embedded culture.
  • the plates are put on a platform shaker and agitated at about 50 rpm in light at 670 Ix. New suspension cultures are formed as the colonies grow out of the agarose and release cells into the liquid medium.
  • the resultant suspension cultured cells are plated onto agar-solidified SH-30 medium and placed in the dark at 25°C until callus is formed.
  • Protoplasts are cultured as described above except that the culture media contains no conditioned medium.
  • PEG mediated direct gene transfer is performed according to Negrutiu et al. (1987).
  • the DNA used is linearized plasmid.
  • the protoplasts are suspended following the last wash in 0.5 M mannitol containing 15 mM MgCI 2 at a density of about 2 x 10 6 per ml.
  • the protoplast suspension is distributed as 1 ml aliquots into 10 ml plastic centrifuge tubes.
  • the DNA is added as described above, and then 0.5 ml of the PEG solution added (40% PEG 4000 in 0.4 M mannitol, 0.1 M Ca(NO 3 ) 2 , pH 7.0).
  • the solutions are mixed gently and incubated for 30 minutes at room temperature (about 24°C) for 30 minutes with occasional shaking.
  • 1.4 ml of the wash solution is then added, and the contents of the tube gently mixed.
  • the wash solution consists of 87 mM mannitol, 115 mM CaCI 2 , 27 mM MgCI 2 , 39 mM KCI, 7 mM Tris-HCI and 1.7 g/l myo-inositol, pH 9.0.
  • Four further 1.4 ml aliquots of wash solution are added at 4 minute intervals, with mixing after each addition.
  • the tube is then centrifuged at about 60 x g for about 10 minutes, and the supernatant discarded.
  • the sedimented protoplasts are taken up in 1 ml KM-8p culture medium, and placed in a 10 cm petri dish. 10 ml of KM-8p medium containing 1.2% SeaPlaque agarose is added. The protoplasts are evenly distributed throughout the medium, and the agarose allowed to gel.
  • the PEG used is PEG of MW 6000, PEG of MW 2000 or PEG of MW 8000.
  • the wash medium consists of 154 mM NaCI, 125 mM CaCI , 5 mM KCI, 5 mM glucose, pH to 6.0 with KOH, of 0.2 M CaCI 2 , 0.1% MES, pH 6.0 with KOH, or of 0.2 M CaCI 2 , 7 mM Tris/HCI, pH 9.0 with KOH.
  • Example 23 Transformation of Dactylis glomerata protoplasts by electroporation or PEG treatment
  • Transformation is carried out as described above except that the protoplasts are treated at 45°C for about 5 minutes prior to distribution of the aliquots into tubes for transformation or after distribution of the aliquots, and before addition of the PEG.
  • the culture plates (petri dishes) containing the protoplasts are incubated for 10 days in the dark at about 25°C and then cut into 5 equal slices for 'bead cultures' (Shillito et al.,
  • the new suspensions are subcultured every 1 to 3 weeks using SH-45 medium containing 4 g/l casein hydrolysate and 20 ⁇ g/ml hygromycin B.
  • Cells from these suspensions are also plated on solidified SH-30 medium containing 20 ⁇ g/ml hygromycin B and incubated at about 25°C in the dark. Calli grown from the plated cells are subcultured every two weeks onto fresh medium. The cells which grow in the presence of hygromycin B are presumed to be transformants.
  • Example 25 Regeneration of transformed Dactylis glomerata plants
  • SH-0 germination medium
  • Small Dactylis glomerata plantlets are placed on OMS medium solidified with 0.8% agar in the light to form root systems. They are moved to the greenhouse at the six to twelve leaf stage, and hardened off gradually.
  • Total genomic DNA is isolated from lyophilized resistant calli or leaflets with Nucleon Phytopure plant DNA extraction kit (Scotlab Bioscience, UK) according to the manufacturers instructions.
  • a digoxigenin-labelled (Boehringer Mannheim GmbH, Germany) probe specific for the rice Ospt DNA region (nucleotide positions 923 to 1481 ) adjacent to the predicted integration site 2 is PCR-amplified from total genomic rice DNA using the primers 5'- ccgtaaagtaaagaaccagaaacag-3' and 5'-gcaatgaaaatgcaagcac-3'. PCR is performed according to the manufacturers instructions in a 50 ⁇ l reaction volume containing 1 ⁇ M of each primer and, 200 ng total genomic rice template DNA and 2.5 units of Eurobiotaq polymerase (Eurobio, France).
  • PCR is performed according to the manufacturers instructions in a 50 ⁇ l reaction volume containing 1 ⁇ M of each primer and, 200 ng total genomic rice template DNA and 2.5 units of Eurobiotaq polymerase (Eurobio, France). Thermal cycling is performed in a Techne
  • the digested DNA is electrophoresed through a 0.8% agarose gel at

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur des procédés et compositions permettant la transformation sélective et stable d'organelles végétales à molécules d'ADN circulaires, et en particulier la transformation sélective et stable de plastides. L'invention porte en outre sur des plantes transgéniques pouvant être obtenues par lesdits procédés.
PCT/EP1999/007227 1998-10-01 1999-09-29 Transformation amelioree des plastides WO2000020611A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU60882/99A AU6088299A (en) 1998-10-01 1999-09-29 Improved transformation of plastids

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9821303.6 1998-10-01
GBGB9821303.6A GB9821303D0 (en) 1998-10-01 1998-10-01 Organic compounds

Publications (1)

Publication Number Publication Date
WO2000020611A1 true WO2000020611A1 (fr) 2000-04-13

Family

ID=10839752

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1999/007227 WO2000020611A1 (fr) 1998-10-01 1999-09-29 Transformation amelioree des plastides

Country Status (3)

Country Link
AU (1) AU6088299A (fr)
GB (1) GB9821303D0 (fr)
WO (1) WO2000020611A1 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1245149A1 (fr) * 2001-03-29 2002-10-02 greenovation Biotech GmbH Transformation de plastides chez Lycopersicon
WO2002055651A3 (fr) * 2001-01-12 2003-02-20 Icon Genetics Ag Procedes et vecteurs de transformation de plastes
US7193131B2 (en) 2001-01-19 2007-03-20 Icon Genetics Ag Processes and vectors for plastid transformation of higher plants
US7371923B2 (en) 2001-07-06 2008-05-13 Icon Genetics Ag Process of generating transplastomic plants or plant cells devoid of a selection marker
US7462758B2 (en) 2001-12-20 2008-12-09 Sungene Gmbh & Co. Kgaa Methods for the transformation of vegetal plastids
US7652194B2 (en) 2000-12-08 2010-01-26 Icon Genetics Gmbh Processes and vectors for producing transgenic plants
US7667092B2 (en) 2001-04-30 2010-02-23 Icon Genetics Gmbh Processes and vectors for amplification or expression of nucleic acid sequences of interest in plants
US7667091B2 (en) 2001-03-29 2010-02-23 Icon Genetics Gmbh Method of encoding information in nucleic acids of a genetically engineered organism
WO2010061186A2 (fr) 2008-11-25 2010-06-03 Algentech Sas Procédé de transformation de plastide de plante
US7763458B2 (en) 2000-10-06 2010-07-27 Icon Genetics Gmbh Vector system for plants
US8058506B2 (en) 2001-03-23 2011-11-15 Icon Genetics Gmbh Site-targeted transformation using amplification vectors
US8192984B2 (en) 2001-09-04 2012-06-05 Icon Genetics, Inc. Creation of artificial internal ribosome entry site (IRES) elements
US8257945B2 (en) 2001-09-04 2012-09-04 Icon Genetics, Inc. Identification of eukaryotic internal ribosome entry site (IRES) elements
EP3260542A1 (fr) 2016-06-20 2017-12-27 Algentech Production de protéine dans des cellules végétales
CN113462633A (zh) * 2021-08-16 2021-10-01 广西大学 甘蔗幼叶不同发育时期原生质体分离及提取方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5451513A (en) * 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
US5693507A (en) * 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
WO1999010513A1 (fr) * 1997-08-07 1999-03-04 Auburn University Vecteurs universels d'integration et d'expression de chloroplastes, plantes transformees et produits obtenus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5693507A (en) * 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
US5451513A (en) * 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
WO1999010513A1 (fr) * 1997-08-07 1999-03-04 Auburn University Vecteurs universels d'integration et d'expression de chloroplastes, plantes transformees et produits obtenus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BILANG R ET AL: "Plastid engineering in crop plants.", 28TH ANNUAL MEETING OF THE SWISS SOCIETIES FOR EXPERIMENTAL BIOLOGY;ZUERICH-IRCHEL, SWITZERLAND; MARCH 27-29, 1996, vol. 52, no. ABSTR., 1996, Experientia (Basel) 1996, pages A21, XP000877282, ISSN: 0014-4754 *
DANIELL ET AL: "containment of herbicide resistance through genetic engineering of the chloroplast genome", NATURE BIOTECHNOLOGY,US,NATURE PUBLISHING, vol. 16, 1 April 1998 (1998-04-01), pages 345 - 348, XP002090409, ISSN: 1087-0156 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7763458B2 (en) 2000-10-06 2010-07-27 Icon Genetics Gmbh Vector system for plants
US7652194B2 (en) 2000-12-08 2010-01-26 Icon Genetics Gmbh Processes and vectors for producing transgenic plants
WO2002055651A3 (fr) * 2001-01-12 2003-02-20 Icon Genetics Ag Procedes et vecteurs de transformation de plastes
US7193131B2 (en) 2001-01-19 2007-03-20 Icon Genetics Ag Processes and vectors for plastid transformation of higher plants
US8058506B2 (en) 2001-03-23 2011-11-15 Icon Genetics Gmbh Site-targeted transformation using amplification vectors
WO2002078429A1 (fr) * 2001-03-29 2002-10-10 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Transformation plastidiale de vegetaux de lycopersicon
EP1245149A1 (fr) * 2001-03-29 2002-10-02 greenovation Biotech GmbH Transformation de plastides chez Lycopersicon
US7667091B2 (en) 2001-03-29 2010-02-23 Icon Genetics Gmbh Method of encoding information in nucleic acids of a genetically engineered organism
US7667092B2 (en) 2001-04-30 2010-02-23 Icon Genetics Gmbh Processes and vectors for amplification or expression of nucleic acid sequences of interest in plants
US7371923B2 (en) 2001-07-06 2008-05-13 Icon Genetics Ag Process of generating transplastomic plants or plant cells devoid of a selection marker
US8192984B2 (en) 2001-09-04 2012-06-05 Icon Genetics, Inc. Creation of artificial internal ribosome entry site (IRES) elements
US8257945B2 (en) 2001-09-04 2012-09-04 Icon Genetics, Inc. Identification of eukaryotic internal ribosome entry site (IRES) elements
US7462758B2 (en) 2001-12-20 2008-12-09 Sungene Gmbh & Co. Kgaa Methods for the transformation of vegetal plastids
WO2010061186A2 (fr) 2008-11-25 2010-06-03 Algentech Sas Procédé de transformation de plastide de plante
EP3260542A1 (fr) 2016-06-20 2017-12-27 Algentech Production de protéine dans des cellules végétales
WO2017220539A1 (fr) 2016-06-20 2017-12-28 Algentech Production de protéines dans des cellules végétales
CN113462633A (zh) * 2021-08-16 2021-10-01 广西大学 甘蔗幼叶不同发育时期原生质体分离及提取方法

Also Published As

Publication number Publication date
GB9821303D0 (en) 1998-11-25
AU6088299A (en) 2000-04-26

Similar Documents

Publication Publication Date Title
AU2005210493B2 (en) AP2 domain transcription factor ODP2 (ovule development protein 2) and methods of use
US8378173B2 (en) Transcription factor gene OsNACx from rice and use thereof for improving plant tolerance to drought and salt
EP2441841B1 (fr) Taille de graines et nombre de graines accrus par la surexpression transgénique d'un gène lie à la croissance et/ou au développement lors du développement embryonnaire précoce
US7256322B2 (en) Wuschel (WUS) Gene Homologs
US8252552B2 (en) Methods and constructs for producing transgenic plants and methods of recovering expressed proteins
US20110271405A1 (en) Compositions and methods for increasing seed size and/or yield by expressing a modified transgene encoding a growth and/or development related protein
US20070271628A1 (en) Wuschel (WUS) Gene Homologs
JP2011101653A (ja) 植物において導入遺伝子を発現するための方法および組成物
WO2000020611A1 (fr) Transformation amelioree des plastides
US7052871B2 (en) Methods of improving transformation efficiency of plants with auxin responsive promoter sequences
US7816139B2 (en) Compositions and method for modulation of plant cell division
EP2397031A1 (fr) Compositions et procédés pour la modulation de division cellulaire d'une plante
US7250296B2 (en) Nucleotide sequences of 2S albumin gene and its promoter from grape and uses thereof
Zhang et al. Parameters influencing transient and stable transformation of barley (Hordeum vulgare L.) protoplasts
WO1999046976A1 (fr) Sequences promotrices de plantes et leurs methodes d'utilisation
EP1228216A2 (fr) Plantes a fleurs et a graines a croissance modifiee
EP1268829B1 (fr) Promoteurs de gene atrsp
WO2022055751A1 (fr) Transformation de plastes par complémentation de mutations nucléaires
CA2808845A1 (fr) Promoteurs et procedes de transformation de tubercules et tubercules transformes
Wasley Tools and Methodologies for Manipulation of the Nuclear and Plastid Genome of Lolium perenne L.
AU2008212072A1 (en) Regulatory element from a sugarcane proline rich protein and uses thereof
MXPA00009202A (en) Plant promoter sequences and methods of use thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase