WO2000015800A2

WO2000015800A2 - Rac-like genes and methods of use

Info

Publication number: WO2000015800A2
Application number: PCT/US1999/020922
Authority: WO
Inventors: Jonathan P. Duvick; Yogesh Kumar Sharma; Pascal J. Goldschmidt-Clermont; Hamdy H. Hassanain
Original assignee: Pioneer Hi-Bred International, Inc.; The Ohio State University
Priority date: 1998-09-14
Filing date: 1999-09-10
Publication date: 2000-03-23
Also published as: WO2000015800A3; AU6387699A

Abstract

The present invention provides methods and compositions for introducing plant Rac polypeptides and polynucleotides into animal cells. The invention provides methods for treating patients with infections, preventing reperfusion injuries and preventing blood vessel damage by introduction of plant Rac polypeptides and polynucleotides.

Description

RAC-LIKE GENES AND METHODS OF USE

TECHNICAL FIELD The present invention relates generally to molecular biology. More specifically, it relates to nucleic acids and methods for expressing them in animals cells to treat patients.

BACKGROUND OF THE INVENTION Rho, rac, and cdc42 are members of a family of small GTP (guanosine triphosphate) binding proteins, that function as molecular switches in regulating a variety of cellular processes in both plants and animals. One such process is the regulation of NADPH oxidase and the oxidative burst response which are involved in the defense response to pathogens of both plants and animals (Kwong, et al, Journal of Biol Chem, 270, No. 34: 19868-19872 (1995); Dusi, et al, Biochem J, 314: 409-412 (1996); Diekmann, et al, Science 265: 531-533 (1994); Purgin, et al, The Plant Cell 9: 2077- 2091 (1997); Kleinberg, et al, Biochemistry 33: 2490-2495 (1994); Prigmore, et al, Journal of Biol Chem 27, No. 18: 10717-10722 (1995); Irani, et al, Science 275: 1649- 1652 (1997); Low, et al, Advances in Molecular Genetics of Plant-Microbe Interactions 3: 361-369 (1994) eds. M.J. Daniels, Kluwer Academic Publishers, Netherlands; Mehdy, et al, Plant Physiol. 105: 467-472 (1994); Sundaresan, et al, Biochem J 318: 379-382 (1996)). The GTP binding proteins also function in altering the cytoskeleton and in cell transformation (for a review see Symon, M. , TIBS 21 : 178-181 (1996)). In plants, a Rho-like GTPase has been found to control pollen tube growth (Lin et al, The Plant Cell 9: 1647-1659 (1997). Additionally, the GTP-binding proteins have been found to be regulators of transcriptional activation (Hill, et al, Cell 81: 1159-1170 (1995); Chandra, et al, Proc. Natl. Acad. Sci. USA 93: 13393-13397 (1996)). Recently, it has been shown in mice that Rac proteins are involved in the growth and death of mammalian T cells (Lores, et al, Oncogene 15: 601-605 (1997)). Clearly, this family of GTP binding proteins control multiple functions in a plant or animal cell and are integral in the cellular defense against pathogens. In plants, the Rho family is restricted to one large family of Rac-like proteins

(Winge, et al , Plant Molec Biology, 35: 483-495 (1997)). Recently, it has been proposed that these proteins be given their own Rho subfamily designation, Rop (Lin. et al., supra). The plant Rac proteins are small, approximately 200 amino acid, soluble and show sequence homology. Plant Racs are activated by the binding of GTP and also have GTPase activity that allows them to cycle off to the inactive state. Various effector proteins can either increase or decrease the level of activation of Rac by promoting or inhibiting GTPase activity. In addition, single amino acid changes in Rac itself can alter the ability of Rac to cycle between active and inactive states. A change of glycine to valine at residue 12 in the highly conserved mammalian Racs results in total loss of GTPase activity, so that when the mutant Rac binds GTP it stays activated permanently, in other words a "dominant positive Rac is formed" . Conversely, changing residue 18 from threonine to alanine causes loss of ability to bind GTP and causing permanent inactivation of Rac, in other words a "dominant negative Rac is formed" . (See for example, Xuemi, et al, Biochemistry, 36: 626-632 (1997).)

The Rac proteins from plants show sequence homology with other Rac family members. In Arabidopsis thaliana, five Rac cDNAs have been cloned and sequenced. The Rac proteins in A. thaliana are all highly conserved, and the N-terminal portion, including the effector domain, share considerable homology to the animal Rac proteins (Winge, et al, supra). In plants the Rac proteins seem to be involved in the oxidative burst observed when plants are infected by a pathogen or an avirulent strain of a pathogen, inducing the disease response pathway, sometimes including the hypersensitivity response (HR). In the hypersensitivity response, cells contacted by the pathogen, and often neighboring cells, rapidly collapse and dry in a necrotic fleck.

Infections in humans continue to be a problem, especially in patients undergoing bone marrow transplantation. In fact the incidences of colonization, invasive infection and systemic sepsis caused by pathogenic fungi have all increased recently. New ways to combat infections are needed to decrease morbidity and mortality of patients suffering from invasive fungal pathogens. In cardiovascular diseases, plant Rac polynucleotides could be used to protect tissues from reperfusion injuries, without blocking other potentially important functions, such as repair, of mammalian Racl . Additionally, plant Rac polynucleotides could be used to prevent blood vessel damage resulting from Fas/Fas-ligand interaction. Also, plant Rac polynucleotides could be used in treatment of Adult Respiratory Syndrome (ARS), to prevent injury to the lungs by oxidants.

The dominant positive form of the plant Rac polynucleotides triggers an even greater production of superoxide in mammalian cells than the mammalian dominant positive form of Racl . One of the side effects of expression of the mammalian dominant positive form of Racl in mammalian cells is the unchecked proliferation of the overexpressing cells. In contrast, overexpression of the dominant positive form of the plant Rac genes does not induce apoptosis or the unchecked proliferation of the overexpression cells. Plant Rac polynucleotides provide a clear advantage over mammalian Rac polynucleotides.

SUMMARY OF THE INVENTION

Generally, it is an object of the present invention to provide an animal with a protein by introducing cells, capable of expressing therapeutically effective amounts of a plant Rac protein, into the animal. The animal cells are preferably mouse or human.

The Rac proteins could be unaltered Rac protein or mutated forms, which are dominant positive or dominant negative.

Further, the invention provides methods for treating patients for infections, preventing reperfusion injuries, or preventing blood vessel damage. One of the embodiments for treating or preventing infections in a patient, is transfecting Rac polynucleotides into a bone marrow sample and then re-introducing the bone marrow into the patient. To prevent reperfusion injuries or blood vessel damage, Rac polynucleotides are transfected or otherwise introduced into tissue at the site of injury. The Rac polynucleotides can be an unaltered form of Rac or mutated forms, which are dominant positive or dominant negative.

DETAILED DESCRIPTION OF THE INVENTION

Overview

The present invention provides utility in such exemplary applications as to provide an animal with a protein by introducing cells, capable of expressing therapeutically effective amounts of a plant Rac protein, into the animal. The animal cells are preferably mouse or human. The Rac proteins could be unaltered Rac protein or mutated forms, which are dominant positive or dominant negative.

Further, the invention provides methods for treating patients for infections, preventing reperfusion injuries, or preventing blood vessel damage. For treating or preventing infections in a patient, Rac polynucleotides are transfected into a bone marrow sample and then re-introduced into the patient. To prevent reperfusion injuries or blood vessel damage, Rac polynucleotides are introduced into tissue at the site of injury. The Rac polynucleotides can be an unaltered form of Rac or mutated forms, which are dominant positive or dominant negative.

Definitions

Units, prefixes, and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges are inclusive of the numbers defining the range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. The terms defined below are more fully defined by reference to the specification as a whole.

By "amplified" is meant the construction of multiple copies of a nucleic acid sequence or multiple copies complementary to the nucleic acid sequence using at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario), Q-Beta Replicase systems, transcription-based amplification system (TAS), and strand displacement amplification (SDA). See, e.g., Diagnostic Molecular Microbiology: Principles and Applications, D. H. Persing et al. , Ed., American Society for Microbiology, Washington, D.C. (1993). The product of amplification is termed an amplicon.

The term "antibody" includes reference to antigen binding forms of antibodies (e.g., Fab, F(ab)₂). The term "antibody" frequently refers to a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which specifically bind and recognize an analyte (antigen). However, while various antibody fragments can be defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments such as single chain Fv, chimeric antibodies (i.e., comprising constant and variable regions from different species), humanized antibodies (i.e., comprising a complementarity determining region (CDR) from a non-human source) and heteroconjugate antibodies (e.g. , bispecific antibodies).

The term "antigen" includes reference to a substance to which an antibody can be generated and/or to which the antibody is specifically immunoreactive. The specific immunoreactive sites within the antigen are known as epitopes or antigenic determinants. These epitopes can be a linear array of monomers in a polymeric composition - such as amino acids in a protein - or consist of or comprise a more complex secondary or tertiary structure. Those of skill will recognize that all immunogens (i.e. , substance capable of eliciting an immune response) are antigens; however some antigens, such as haptens, are not immunogens but may be made immunogenic by coupling to a carrier molecule. An antibody immunologically reactive with a particular antigen can be generated in vivo or by recombinant methods such as selection of libraries of recombinant antibodies in phage or similar vectors. See, e.g., Huse et al, Science 246: 1275-1281 (1989); and Ward, et al., Nature 341 : 544-546 (1989); and Vaughan et al., Nature Biotech 14: 309-314 (1996).

As used herein, "antisense orientation" includes reference to a duplex polynucleotide sequence, which is operably linked to a promoter in an orientation where the antisense strand is transcribed. The antisense strand is sufficiently complementary to an endogenous transcription product such that translation of the endogenous transcription product is often inhibited.

By "encoding" or "encoded" , with respect to a specified nucleic acid, is meant comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g. , introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code. However, variants of the universal code, such as is present in some plant, animal, and fungal mitochondria, the bacterium Mycoplasma capricolum (Proc. Natl. Acad. Sci. (USA), 82: 2306-2309 (1985)), or the ciliate Macronucleus , may be used when the nucleic acid is expressed using these organisms. When the nucleic acid is prepared or altered synthetically, advantage can be taken of known codon preferences of the intended host where the nucleic acid is to be expressed. For example, although nucleic acid sequences of the present invention may be expressed in both plant species or animal species, sequences can be modified to account for the specific codon preferences and GC content preferences of particular species as these preferences have been shown to differ (see e.g., Murray et al. Nucl. Acids Res. 17: 477-498 (1989) or Zhang, et al, Biochem and Biophy Res Comm 227(3):707-711 (1996)). As used herein "full-length sequence" in reference to a specified polynucleotide or its encoded protein means having the entire amino acid sequence of, a native (non-synthetic), endogenous, catalytically active form of the specified protein. A full-length sequence can be determined by size comparison relative to a control, which is a native (non-synthetic) endogenous cellular form of the specified nucleic acid or protein. Methods to determine whether a sequence is full-length are well known in the art including such exemplary techniques as northern or western blots, primer extension, SI protection, and ribonuclease protection. See, e.g. , Plant Molecular Biology: A Laboratory Manual, Clark, Ed. , Springer- Verlag, Berlin (1997). Comparison to known full-length homologous (orthologous and/or paralogous) sequences can also be used to identify full-length sequences of the present invention. Additionally, consensus sequences typically present at the 5' and 3' untranslated regions of mRNA aid in the identification of a polynucleotide as full-length. For example, the consensus sequence ANNNNAUGG, where the underlined codon represents the N-terminal methionine, aids in determining whether the polynucleotide has a complete 5' end. Consensus sequences at the 3' end, such as polyadenylation sequences, aid in determining whether the polynucleotide has a complete 3' end. As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention. By "host cell" is meant a cell, which contains a vector and supports the replication and/or expression of the expression vector. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect, amphibian, or mammalian cells. The term "hybridization complex" includes reference to a duplex nucleic acid structure formed by two single-stranded nucleic acid sequences selectively hybridized with each other.

By "immunologically reactive conditions" or "immunoreactive conditions" is meant conditions which allow an antibody, generated to a particular epitope, to bind to that epitope to a detectably greater degree (e.g. , at least 2-fold over background) than the antibody binds to substantially all other epitopes in a reaction mixture comprising the particular epitope. Immunologically reactive conditions are dependent upon the format of the antibody binding reaction and typically are those utilized in immunoassay protocols. See Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions. The term "introduced" in the context of inserting a nucleic acid into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell (e.g. , chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replica, or transiently expressed (e.g. , transfected mRNA).

The terms "isolated" refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components, which normally accompany or interact with it as found in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment; or (2) if the material is in its natural environment, the material has been synthetically (non- naturally) altered by deliberate human intervention to a composition and/or placed at a locus in the cell (e.g. , genome or subcellular organelle) not native to a material found in that environment. The alteration to yield the synthetic material can be performed on the material within or removed from its natural state. For example, a naturally occurring nucleic acid becomes an isolated nucleic acid if it is altered, or if it is transcribed from DNA, which has been altered, by non-natural, synthetic (i.e. , "man-made") methods performed within the cell from which it originates. See, e.g. , Compounds and Methods for Site Directed Mutagenesis in Eukaryotic Cells, Kmiec, and U.S. Patent No. 5,565,350; In Vivo Homologous Sequence Targeting in Eukaryotic Cells; Zarling et al. , PCT/US93/03868. Likewise, a naturally occurring nucleic acid (e.g., a promoter) becomes isolated if it is introduced by non-naturally occurring means to a locus of the genome not native to that nucleic acid. Nucleic acids, which are "isolated" , as defined herein, are also referred to as "heterologous" nucleic acids.

Unless otherwise stated, the term " Rac nucleic acid" means a nucleic acid comprising a polynucleotide ("Rac polynucleotide") encoding a Rac polypeptide. A "Rac gene" refers to a non-heterologous genomic form of a full-length Rac polynucleotide.

As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g. , peptide nucleic acids).

By "nucleic acid library" is meant a collection of isolated DNA or RNA molecules, which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, Inc., San Diego, CA (Berger); Sambrook et al., Molecular Cloning - A Laboratory Manual, 2nd ed. , Vol. 1-3 (1989); and Current Protocols in Molecular Biology, F.M. Ausubel et al , Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994 Supplement).

As used herein "operably linked" includes reference to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. As used herein, "polynucleotide" includes reference to a deoxyribopolynucleotide, ribopolynucleotide, or analogs thereof, that have the essential nature of a natural ribonucleotide in that they hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including ter alia, simple and complex cells.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The essential nature of such analogues of naturally occurring amino acids is that, when incoφorated into a protein, that protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids. The terms "polypeptide" , "peptide" and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. Exemplary modifications are described in most basic texts, such as, Proteins - Structure and Molecular Properties, 2nd ed., T. E. Creighton, W. H. Freeman and Company, New York (1993). Many detailed reviews are available on this subject, such as, for example, those provided by Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pp. 1-12 in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York (1983); Seifter et al. , Meth Enzymol 182: 626-646 (1990) and Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann. N. Y. Acad. Sci. 663: 48-62 (1992). It will be appreciated, as is well known and as noted above, those polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non- translation natural process and by entirely synthetic methods, as well. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side- chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For instance, the amino terminal residue of polypeptides made in E. coli or other cells, prior to proteolytic processing, almost invariably will be N-formylmethionine. During post-translational modification of the peptide, a methionine residue at the NH₂-terminus may be deleted. Accordingly, this invention contemplates the use of both the methionine containing and the methionineless amino terminal variants of the protein of the invention. In general, as used herein, the term polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.

As used herein "promoter" includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.

The term "Rac polypeptide" refers to one or more amino acid sequences, in glycosylated or non-glycosylated form. The term is also inclusive of fragments, variants, homologs, alleles or precursors (e.g., preproproteins or proproteins) thereof. A "Rac protein" comprises a Rac polypeptide.

As used herein "recombinant" includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all as a result of deliberate human intervention. The term "recombinant" as used herein does not encompass the alteration of the cell or vector by naturally occurring events (e.g. , spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.

As used herein, a "recombinant expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements, which permit transcription of a particular nucleic acid in a target cell. The recombinant expression cassette can be incoφorated into a plasmid, chromosome, mitochondrial DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid to be transcribed, and a promoter. The term "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incoφorated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.

The term "selectively hybridizes" includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity, preferably 90% sequence identity, and most preferably 100% sequence identity (i.e., complementary) with each other.

The term "specifically reactive", includes reference to a binding reaction between an antibody and a protein having an epitope recognized by the antigen binding site of the antibody. This binding reaction is determinative of the presence of a protein having the recognized epitope amongst the presence of a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to an analyte having the recognized epitope to a substantially greater degree (e.g., at least 2-fold over background) than to substantially all other analytes lacking the epitope which are present in the sample.

Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to the polypeptides of the present invention can be selected from to obtain antibodies specifically reactive with polypeptides of the present invention. The proteins used as immunogens can be in native conformation or denatured so as to provide a linear epitope.

A variety of immunoassay formats may be used to select antibodies specifically reactive with a particular protein (or other analyte). For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York (1988), for a description of immunoassay formats and conditions that can be used to determine selective reactivity. The terms " stringent conditions" or "stringent hybridization conditions" include reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g. , at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide or Denhardt's. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35 % formamide, 1 M NaCl, 1 % SDS (sodium dodecyl sulphate) at 37 °C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55 °C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1 % SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1 % SDS at 37 °C, and a wash in 0.1X SSC at 60 to 65°C. Unless otherwise stated, in the present application high stringency is defined as hybridization in 4X SSC, 5X Denhardt's (5g Ficoll, 5g polyvinypyrrolidone, 5 g bovine serum albumin in 500ml of water), 0.1 mg/ml boiled salmon sperm DNA, and 25 mM Na phosphate at 65 °C, and a wash in 0.1 X SSC, 0.1 % SDS at 65 °C.

Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA- DNA hybrids, the T_m can be approximated from the equation of Meinkoth and Wahl, Anal Biochem, 138:267-284 (1984): T_m = 81.5 °C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T_m is reduced by about 1 °C for each 1 % of mismatching; thus, T_m, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with J> 90% identity are sought, the T_m can be decreased 10 °C. Generally, stringent conditions are selected to be about 5 °C lower than the thermal melting point (T_m) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 °C lower than the thermal melting point (T_m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 °C lower than the thermal melting point (T_m); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20 °C lower than the thermal melting point (TJ. Using the equation, hybridization and wash compositions, and desired T_m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T_m of less than 45 °C (aqueous solution) or 32 °C (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al. , Eds., Greene Publishing and Wiley- Interscience, New York (1995). As used herein, "transgenic cell" includes reference to a cell that comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, tissue, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. As used herein, "vector" includes reference to a nucleic acid used in transfection of a host cell and into which can be inserted a polynucleotide. Vectors are often replicons. Expression vectors permit transcription of a nucleic acid inserted therein.

The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence" , (b) "comparison window" , (c) " sequence identity" , and (d) "percentage of sequence identity.

(a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. (b) As used herein, "comparison window" means includes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e. , gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv Appl Math 2: 482 (1981); by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. 85: 2444 (1988); by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, California, GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr. , Madison, Wisconsin, USA; the CLUSTAL program is well described by Higgins and Shaφ, Gene 73: 237-244 (1988); Higgins and Shaφ, CABIOS 5: 151-153 (1989); Coφet, et al., Nucleic Acids Research 16: 10881-90 (1988); Huang, et al., Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, et al., Methods in Molecular Biology 24: 307-331 (1994). The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley -Interscience, New York (1995).

GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48: 443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package are 8 and 2, respectively, for protein sequences. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 100. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, or greater.

Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using the BLAST 2.0 suite of programs using default parameters (Altschul et al, Nucleic Acid Res 25:3389-3402 (1997)) or GAP version 10 of Wisconsin Genetic Software Package using default parameters.

(c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences, which are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences, which differ by such conservative substitutions, are said to have " sequence similarity" or "similarity" . Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, Computer Applic Biol Sci, A: 11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).

(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e. , gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

Nucleic Acids

The present invention provides, ter alia, isolated nucleic acids of RNA, DNA, and analogs and/or chimeras thereof, comprising a Rac polynucleotide encoding such enzymes as:

(a) a polynucleotide encoding a Rac polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32 and 34, and conservatively modified and polymoφhic variants thereof, including exemplary polynucleotides of SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21 , 23, 25, 27, 29, 31, and 33 ;

(b) a polynucleotide which selectively hybridizes to a polynucleotide of (a);

(c) a polynucleotide having at least 64 % sequence identity with polynucleotides of (a) or (b);

(d) a polynucleotide encoding a protein having a specified number of contiguous amino acids from a prototype polypeptide;

(e) complementary sequences of polynucleotides of (a), (b), (c), or (d); and

(f) a polynucleotide comprising at least 25 contiguous nucleotides from a polynucleotide of (a), (b), (c), (d), or (e).

Plasmids containing the polynucleotide sequences of the invention were deposited with American Type Culture Collection (ATCC), Manassas, Virginia, and assigned Accession Nos. 98796, 98797, 98798, 98799, and 98800. These deposits will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφoses of Patent Procedure. These deposits were made merely as a convenience for those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. § 112.

A. Polynucleotides Encoding A Polypeptide of the Present Invention or Conservatively Modified or Polymorphic Variants Thereof

As indicated in (a), supra, the present invention provides isolated heterologous nucleic acids comprising a Rac polynucleotide, wherein the polynucleotide encodes a Rac polypeptide, disclosed herein in SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34, or conservatively modified or polymoφhic variants thereof. Those of skill in the art will recognize that the degeneracy of the genetic code allows for a plurality of polynucleotides to encode for the identical amino acid sequence. Such "silent variations" can be used, for example, to selectively hybridize and detect allelic variants of polynucleotides of the present invention. Accordingly, the present invention includes polynucleotides of SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29,

31, and 33, and silent variations of polynucleotides encoding a polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. The present invention further provides isolated nucleic acids comprising polynucleotides encoding conservatively modified variants of a polypeptide of SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. Conservatively modified variants can be used to generate or select antibodies immunoreactive to the non-variant polypeptide. Additionally, the present invention further provides isolated nucleic acids comprising polynucleotides encoding one or more polymoφhic (allelic) variants of polypeptides/polynucleotides.

B. Polynucleotides Amplified from a Zea mays Nucleic Acid Library

As indicated, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotides are amplified from a Zeα mays nucleic acid library. Zea mays lines B73, PHREl, A632, BMS-P2#10, W23, and Mol7 are known and publicly available. Other publicly known and available maize lines can be obtained from the Maize Genetics Cooperation (Urbana, IL). The nucleic acid library may be a cDNA library, a genomic library, or a library generally constructed from nuclear transcripts at any stage of intron processing. Generally, a cDNA nucleic acid library will be constructed to comprise a majority of full-length cDNAs. Often, cDNA libraries will be normalized to increase the representation of relatively rare cDNAs. In preferred embodiments, the cDNA library is constructed using a full-length cDNA synthesis method. Examples of such methods include Oligo-Capping (Maruyama, et al, Gene, 138: 171-174 (1994)), Biotinylated CAP Trapper (Carninci, et al, Genomics, 37: 327- 336 (1996), and CAP Retention Procedure (Edery, et al., Molec and Cellular Bio 15: 3363-3371 (1995). cDNA synthesis is preferably catalyzed at 50-55 degree Celsius to prevent formation of RNA secondary structure. Examples of reverse transcriptases that relatively stable at these temperatures are Superscript II Reverse Transcriptase (Life Technologies, Inc.), AMV Reverse Transcriptase (Boehringer Mannheim) and Retro Amp Reverse Transcriptase (Epicentre). Rapidly growing tissues, or rapidly dividing cells are preferably used as sources.

The present invention also provides subsequences of full-length nucleic acids. Any number of subsequences can be obtained by reference to SEQ ID NOS: 1 , 3, 5, 7, and 9, and using primers which selectively amplify, under stringent conditions to: at least two sites to the polynucleotides of the present invention, or to two sites within the nucleic acid which flank and comprise a polynucleotide of the present invention, or to a site within a polynucleotide of the present invention and a site within the nucleic acid which comprises it. A variety of methods for obtaining 5' and/or 3' ends is well known in the art. See, e.g. , RACE (Rapid Amplification of Complementary Ends) as described in Frohman, M. A. , in PCR Protocols: A Guide to Methods and Applications, M. A. Innis, D. H. Gelfand, J. J. Sninsky, T. J. White, Eds. (Academic Press, Inc. , San Diego, 1990), pp. 28-38.); see also, U.S. Pat. No. 5,470,722, and Current Protocols in Molecular Biology, Unit 15.6, Ausubel, et al. , Eds., Greene Publishing and Wiley- Interscience, New York (1995). Thus the present invention provides Rac polynucleotides having the sequence of the Rac gene, nuclear transcript, cDNA, or complementary sequences and/or subsequences thereof.

Primer sequences can be obtained by reference to a contiguous subsequence of a polynucleotide of the present invention. Primers are chosen to selectively hybridize, under PCR amplification conditions, to a polynucleotide of the present invention in an amplification mixture comprising a genomic and/or cDNA library from the same species. Generally, the primers are complementary to a subsequence of the amplicon they yield. In some embodiments, the primers will be constructed to anneal at their 5' terminal end's to the codon encoding the carboxy or amino terminal amino acid residue (or the complements thereof) of the polynucleotides of the present invention. The primer length in nucleotides is selected from the group of integers consisting of from at least 15 to 50. Thus, the primers can be at least 15, 18, 20, 25, 30, 40, or 50 nucleotides in length. A non-annealing sequence at the 5'end of the primer (a "tail") can be added, for example, to introduce a cloning site at the terminal ends of the amplicon.

The amplification primers may optionally be elongated in the 3' direction with additional contiguous nucleotides from the polynucleotide sequences, such as SEQ ID NOS: 1, 3, 5, 7, and 9, from which they are derived. The number of nucleotides by which the primers can be elongated is selected from the group of integers consisting of from at least 1 to 25. Thus, for example, the primers can be elongated with an additional 1, 5, 10, or 15 nucleotides. Those of skill will recognize that a lengthened primer sequence can be employed to increase specificity of binding (i.e., annealing) to a target sequence.

The amplification products can be translated using expression systems well known to those of skill in the art and as discussed, infra. The resulting translation products can be confirmed as polypeptides of the present invention by, for example, assaying for the appropriate catalytic activity (e.g., specific activity and/or substrate specificity), or verifying the presence of one or more linear epitopes, which are specific to a polypeptide of the present invention. Methods for protein synthesis from PCR derived templates are known in the art and available commercially. See, e.g., Amersham Life Sciences, Inc, Catalog 1997, p.354.

C. Polynucleotides Which Selectively Hybridize to a Polynucleotide of (A) or (B)

As indicated in (c), supra, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotides selectively hybridize, under selective hybridization conditions, to a polynucleotide of paragraphs (A) or (B) as discussed, supra. Thus, the polynucleotides of this embodiment can be used for isolating, detecting, and/ or quantifying nucleic acids comprising the polynucleotides of (A) or (B). For example, polynucleotides of the present invention can be used to identify, isolate, or amplify partial or full-length clones in a deposited library. In some embodiments, the polynucleotides are genomic or cDNA sequences isolated from a Zea mays nucleic acid library. Preferably, the cDNA library comprises at least 80% full- length sequences, preferably at least 85% or 90% full-length sequences, and more preferably at least 95% full-length sequences. The cDNA libraries can be normalized to increase the representation of rare sequences. Low stringency hybridization conditions are typically, but not exclusively, employed with sequences having a reduced sequence identity relative to complementary sequences. Moderate and high stringency conditions can optionally be employed for sequences of greater identity. Low stringency conditions allow selective hybridization of sequences having about 70% sequence identity and can be employed to identify orthologous or paralogous sequences. D. Polynucleotides Having at Least 60% Sequence Identity with the Polynucleotides of (A), (B) or (C)

As indicated in (d), supra, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotides have a specified identity at the nucleotide level to a polynucleotide as disclosed above in paragraphs (A), (B), or (C). The percentage of identity to a reference sequence is at least 60% and, rounded upwards to the nearest integer, can be expressed as an integer selected from the group of integers consisting of from 60 to 99. Thus, for example, the percentage of identity to a reference sequence can be at least 70% , 75 % , 80% , 85 % , 90% , or 95 % . Optionally, the polynucleotides of this embodiment will share an epitope with a polypeptide encoded by the polynucleotides of (A), (B), or (C). Thus, these polynucleotides encode a first polypeptide, which elicits production of antisera comprising antibodies, which are specifically reactive to a second polypeptide encoded by a polynucleotide of (A), (B), or (C). However, the first polypeptide does not bind to antisera raised against itself when the antisera has been fully immunosorbed with the first polypeptide. Hence, the polynucleotides of this embodiment can be used to generate antibodies for use in, for example, the screening of expression libraries for nucleic acids comprising polynucleotides of (A), (B), or (C), or for purification of, or in immunoassays for, polypeptides encoded by the polynucleotides of (A), (B), or (C). The polynucleotides of this embodiment embrace nucleic acid sequences, which can be employed for selective hybridization to a polynucleotide encoding a polypeptide of the present invention.

Screening polypeptides for specific binding to antisera can be conveniently achieved using peptide display libraries. This method involves the screening of large collections of peptides for individual members having the desired function or structure. Antibody screening of peptide display libraries is well known in the art. The displayed peptide sequences can be from 3 to 5000 or more amino acids in length, frequently from 5-100 amino acids long, and often from about 8 to 15 amino acids long. In addition to direct chemical synthetic methods for generating peptide libraries, several recombinant DNA methods have been described. One type involves the display of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence encoding the particular displayed peptide sequence. Such methods are described in PCT patent publication Nos. 91/17271, 91/18980, 91/19818, and 93/08278. Other systems for generating libraries of peptides have aspects of both in vitro chemical synthesis and recombinant methods. See, PCT Patent publication Nos. 92/05258, 92/14843, and 96/19256. See also, U.S. Patent Nos. 5,658,754; and 5,643,768. Peptide display libraries, vectors, and screening kits are commercially available from such suppliers as Invitrogen (Carlsbad, CA).

E. Polynucleotides Encoding a Protein Having a Subsequence from a Prototype Polypeptide and is Cross-Reactive to the Prototype Polypeptide

As indicated in (e), supra, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotides encode a protein having a subsequence of contiguous amino acids from a prototype Rac polypeptide. Exemplary prototype Rac polypeptides are provided in SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22,

24, 26, 28, 30, 32, and 34. The length of contiguous amino acids from the prototype polypeptide is selected from the group of integers consisting of from at least 10 to the number of amino acids within the prototype sequence. Thus, for example, the polynucleotide can encode a polypeptide having a subsequence having at least 10, 15, 20,

25, 30, 35, 40, 45, or 50, contiguous amino acids from the prototype polypeptide. Further, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100, or 200 nucleotides.

The proteins encoded by polynucleotides of this embodiment, when presented as an immunogen, elicit the production of polyclonal antibodies which specifically bind to a prototype polypeptide such as, but not limited to, a polypeptide encoded by the polynucleotide of (b), supra, or exemplary polypeptides of SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. Generally, however, a protein encoded by a polynucleotide of this embodiment does not bind to antisera raised against the prototype polypeptide when the antisera has been fully immunosorbed with the prototype polypeptide. Methods of making and assaying for antibody binding specificity/affinity are well known in the art. Exemplary immunoassay formats include ELISA, competitive immunoassay s, radioimmunoassay s, Western blots, indirect immunofluorescent assays and the like. F. Polynucleotides Complementary to the Polynucleotides of (A)-(E)

As indicated in (f), supra, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotides are complementary to the polynucleotides of paragraphs A-E, above. As those of skill in the art will recognize, complementary sequences base pair throughout the entirety of their length with the polynucleotides of (A)-(E) (i.e., have 100% sequence identity over their entire length). Complementary bases associate through hydrogen bonding in double stranded nucleic acids. For example, the following base pairs are complementary: guanine and cytosine; adenine and thymine; and adenine and uracil.

G. Polynucleotides that are Subsequences of the Polynucleotides of (A)-(F)

As indicated in (g), supra, the present invention provides isolated nucleic acids comprising Rac polynucleotides, wherein the polynucleotide comprises at least 25 contiguous bases from the polynucleotides of (A) through (F) as discussed above. The length of the polynucleotide is given as an integer selected from the group consisting of from at least 15 to the length of the nucleic acid sequence from which the polynucleotide is a subsequence of. Thus, for example, polynucleotides of the present invention are inclusive of polynucleotides comprising at least 15, 20, 25, 30, 40, 50, 60, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or up to the full length of a maize Rac polynucleotide of contiguous nucleotides in length from the polynucleotides of (A)-(F). Optionally, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100, or 200 nucleotides.

The subsequences of the present invention can comprise structural characteristics of the sequence from which it is derived. Alternatively, the subsequences can lack certain structural characteristics of the larger sequence from which it is derived. For example, a subsequence from a polynucleotide encoding a polypeptide having at least one linear epitope in common with a prototype sequence, such as SEQ ID NOS: 2, 4, 6, 8 and 10, may encode an epitope in common with the prototype sequence. Alternatively, the subsequence may not encode an epitope in common with the prototype sequence but can be used to isolate the larger sequence by, for example, nucleic acid hybridization with the sequence from which it's derived. Subsequences can be used to modulate or detect gene expression by introducing into the subsequences compounds which bind, intercalate, cleave and/or crosslink to nucleic acids. Exemplary compounds include acridine, psoralen, phenanthroline, naphthoquinone, daunomycin or chloroethylaminoaryl conjugates.

Construction of Nucleic Acids

The isolated nucleic acids of the present invention can be made using (a) standard recombinant methods, (b) synthetic techniques, or combinations thereof. In some embodiments, the polynucleotides of the present invention will be cloned, amplified, or otherwise constructed from a monocot. In preferred embodiments the monocot is Zea mays. Particularly preferred is the use of Zea mays tissue.

The nucleic acids may conveniently comprise sequences in addition to a polynucleotide of the present invention. For example, a multi-cloning site comprising one or more endonuclease restriction sites may be inserted into the nucleic acid to aid in isolation of the polynucleotide. Also, translatable sequences may be inserted to aid in the isolation of the translated polynucleotide of the present invention. For example, a hexa-histidine marker sequence provides a convenient means to purify the proteins of the present invention. The nucleic acid of the present invention - excluding the polynucleotide sequence - is generally a vector, adapter, or linker for cloning and/or expression of a polynucleotide of the present invention. Use of cloning vectors, expression vectors, adapters, and linkers is well known in the art. Exemplary nucleic acids include such vectors as: M13, lambda ZAP Express, lambda ZAP II, lambda gtlO, lambda gtll , pBK-CMV, pBK-RSV, pBluescript II, lambda DASH II, lambda EMBL 3, lambda EMBL 4, pWE15, SuperCos 1, SurfZap, Uni-ZAP, pBC, pBS+/-, pSG5, pBK, pCR-Script, pET, pSPUTK, p3'SS, pOPRSVI CAT, pOPI3 CAT, pXTl, pSG5, pPbac, pMbac, pMClneo, pOG44, pOG45, pFRTβGAL, pNEOβGAL, pRS403, pRS404, pRS405, pRS406, pRS413, pRS414, pRS415, pRS416, pGEX, lambda MOSSlox, and lambda MOSElox. For a description of various nucleic acids see, for example, Stratagene Cloning Systems, Catalogs 1995, 1996, 1997 (La Jolla. CA); and, Amersham Life Sciences, Inc, Catalog '97 (Arlington Heights, IL). A. Recombinant Methods for Constructing Nucleic Acids

The isolated nucleic acid compositions of this invention, such as RNA, cDNA, genomic DNA, or a hybrid thereof, can be obtained from plant biological sources using any number of cloning methodologies known to those of skill in the art. In some embodiments, oligonucleotide probes that selectively hybridize, under stringent conditions, to the polynucleotides of the present invention are used to identify the desired sequence in a cDNA or genomic DNA library. While isolation of RNA, and construction of cDNA and genomic libraries is well known to those of ordinary skill in the art, the following highlights some of the methods employed.

Al. mRNA Isolation and Purification

Total RNA from plant cells comprises such nucleic acids as mitochondrial RNA, chloroplastic RNA, rRNA, tRNA, hnRNA and mRNA. Total RNA preparation typically involves lysis of cells and removal of proteins, followed by precipitation of nucleic acids. Extraction of total RNA from plant cells can be accomplished by a variety of means. Frequently, extraction buffers include a strong detergent such as SDS and an organic denaturant such as guanidinium isothiocyanate, guanidine hydrochloride or phenol. Following total RNA isolation, poly(A)⁺ mRNA is typically purified from the remainder RNA using oligo(dT) cellulose. Exemplary total RNA and mRNA isolation protocols are described in Plant Molecular Biology: A Laboratory Manual, Clark, Ed. , Springer- Verlag, Berlin (1997); and, Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). Total RNA and mRNA isolation kits are commercially available from vendors such as Stratagene (La Jolla, CA), Clontech (Palo Alto, CA), Pharmacia (Piscataway, NJ), and 5'-3' (Paoli, PA). See also, U.S. Patent Nos. 5,614,391; and, 5,459,253. The mRNA can be fractionated into populations with size ranges of about 0.5, 1.0, 1.5, 2.0, 2.5 or 3.0 kb. The cDNA synthesized for each of these fractions can be size selected to the same size range as its mRNA prior to vector insertion. This method helps eliminate truncated cDNA formed by incompletely reverse transcribed mRNA.

B. Synthetic Methods for Constructing Nucleic Acids

The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by methods such as the phosphotriester method of Narang et al, Meth Enzymol 68: 90-99 (1979); the phosphodiester method of Brown et al, Meth Enzymol 68: 109-151 (1979); the diethylphosphoramidite method of Beaucage et al, Tetra Lett 22: 1859-1862 (1981); the solid phase phosphoramidite triester method described by Beaucage and Caruthers, Tetra Letts 22(20): 1859-1862 (1981), e.g., using an automated synthesizer, e.g., as described in Needham-VanDevanter et al, Nucleic Acids Res, 12: 6159-6168 (1984); and, the solid support method of U.S. Patent No. 4,458,066. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template. One of skill will recognize that while chemical synthesis of DNA is limited to sequences of about 100 bases, longer sequences may be obtained by the ligation of shorter sequences.

Recombinant Expression Cassettes The present invention further provides recombinant expression cassettes comprising a nucleic acid of the present invention. A nucleic acid sequence coding for the desired polynucleotide of the present invention, for example a cDNA or a genomic sequence encoding a full length polypeptide of the present invention, can be used to construct a recombinant expression cassette which can be introduced into the desired host cell. A recombinant expression cassette will typically comprise a polynucleotide of the present invention operably linked to transcriptional initiation regulatory sequences, which will direct the transcription of the polynucleotide in the intended host cell.

A promoter fragment can be employed which will direct expression of a polynucleotide of the present invention in all tissues. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation.

Alternatively, the promoter can direct expression of a polynucleotide of the present invention in a specific tissue or may be otherwise under more precise environmental or developmental control. Such promoters are referred to here as "inducible" promoters. Examples of promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues. The operation of a promoter may also vary depending on its location in the genome. Thus, an inducible promoter may become fully or partially constitutive in certain locations. Both heterologous and non-heterologous (i.e. , endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention. These promoters can also be used, for example, in recombinant expression cassettes to drive expression of antisense nucleic acids to reduce, increase, or alter Rac content and/or composition in a desired tissue. Thus, in some embodiments, the nucleic acid construct will comprise a promoter functional in a cell, operably linked to a polynucleotide of the present invention. Promoters useful in these embodiments include the endogenous promoters driving expression of a polypeptide of the present invention.

An intron sequence can be added to the 5' untranslated region or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchman and Berg, Mol. Cell Biol. 8: 4395-4405 (1988); Callis et al., Genes Dev. 1: 1183-1200 (1987). Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit.

The vector comprising the sequences from a polynucleotide of the present invention will typically comprise a marker gene, which confers a selectable phenotype on cells. Useful selectable marker genes are well known in the transfection/transformation art.

A polynucleotide of the present invention can be expressed in either sense or anti- sense orientation as desired. It will be appreciated that control of gene expression in either sense or anti-sense orientation can have a direct impact on the observable characteristics. Antisense technology can be conveniently used to alter gene expression in cells. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the anti-sense strand of RNA will be transcribed. The construct is then transformed or transfected into cells and the antisense strand of RNA is produced. In plant cells, it has been shown that antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the enzyme of interest, see, e.g., Sheehy et al., Proc Natl Acad Sci (USA) 85: 8805-8809 (1988); and Hiatt et al. , U.S. Patent No. 4,801,340.

Another method of suppression is sense suppression. Introduction of nucleic acid configured in the sense orientation has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli et al. , The Plant Cell 2: 279-289 (1990) and US Patent No. 5,034,323.

Catalytic RNA molecules or ribozymes can also be used to inhibit expression of genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA- cleaving activity upon them, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff et al. , Nature 334: 585-591 (1988).

Proteins The isolated proteins of the present invention comprise a polypeptide having at least 10 amino acids encoded by any one of the polynucleotides of the present invention as discussed more fully, supra, or polypeptides, which are conservatively modified variants thereof. Exemplary polypeptide sequences are provided in SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. The proteins of the present invention or variants thereof can comprise any number of contiguous amino acid residues from a polypeptide of the present invention, wherein that number is selected from the group of integers consisting of from 10 to the number of residues in a full-length Rac polypeptide. Optionally, this subsequence of contiguous amino acids is at least 15, 20, 25, 30, 35, or 40 amino acids in length, often at least 50, 60, 70, 80, or 90 amino acids in length. Further, the number of such subsequences can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4, or 5.

As those of skill will appreciate, the present invention includes catalytically active polypeptides of the present invention (i.e., enzymes). Catalytically active polypeptides have a specific activity at least 20% , 30% , or 40% , and preferably at least 50% , 60% , or 70% , and most preferably at least 80% , 90% , or 95% that of the native (non- synthetic), endogenous polypeptide. Further, the substrate specificity (k_cat/K_m) is optionally substantially similar to the native (non- synthetic), endogenous polypeptide. Typically, the K^ will be at least 30% , 40%, or 50% , that of the native (non-synthetic), endogenous polypeptide; and more preferably at least 60% , 70% , 80% , or 90% . Methods of assaying and quantifying measures of enzymatic activity and substrate specificity (k_cat/K_m), are well known to those of skill in the art.

Generally, the proteins of the present invention will, when presented as an immunogen, elicit production of an antibody specifically reactive to a polypeptide of the present invention encoded by a polynucleotide of the present invention as described, supra. Exemplary polypeptides include those which are full-length, such as those disclosed in SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 20, 22, 24, 26, 28, 30, 32, and 34. Further, the proteins of the present invention will not bind to antisera raised against a polypeptide of the present invention, which has been fully immunosorbed with the same polypeptide. Immunoassays for determining binding are well known to those of skill in the art. A preferred immunoassay is a competitive immunoassay as discussed, infra. Thus, the proteins of the present invention can be employed as immunogens for constructing antibodies immunoreactive to a protein of the present invention for such exemplary utilities as immunoassays or protein purification techniques (see for example, SEQ ID NOS: 11-14).

Expression of Proteins in Host Cells

Using the nucleic acids of the present invention, one may express a protein of the present invention in a recombinantly engineered cell such as bacteria, yeast, insect, plant, or preferably mammalian cells. The cells produce the protein in a non-natural condition (e.g., in quantity, composition, location, and/or time), because they have been genetically altered through human intervention to do so.

It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for expression of a nucleic acid encoding a protein of the present invention. No attempt to describe in detail the various methods known for the expression of proteins in prokaryotes or eukaryotes will be made.

In brief summary, the expression of isolated nucleic acids encoding a protein of the present invention will typically be achieved by operably linking, for example, the DNA or cDNA to a promoter (which is either constitutive or inducible), followed by incoφoration into an expression vector. The vectors can be suitable for replication and integration in either prokaryotes or eukaryotes. Typical expression vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the DNA encoding a protein of the present invention. To obtain high level expression of a cloned gene, it is desirable to construct expression vectors which contain, at the minimum, a strong promoter to direct transcription, a ribosome binding site for translational initiation, and a transcription translation terminator. One of skill would recognize that modifications could be made to a protein of the present invention without diminishing its biological activity. Some modifications may be made to facilitate the cloning, expression, or incoφoration of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g., poly His) placed on either terminus to create conveniently located restriction sites or termination codons or purification sequences .

A. Expression in Prokaryotes Prokaryotic cells may be used as hosts for expression. Prokaryotes most frequently are represented by various strains of E. coli; however, other microbial strains may also be used. Commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along with ribosome binding site sequences, include such commonly used promoters as the beta lactamase (penicillinase) and lactose (lac) promoter systems (Chang et al., Nature 198: 1056 (1977)), the tryptophan (tφ) promoter system (Goeddel et al. , Nucleic Acids Res. 8:4057 (1980)) and the lambda derived P L promoter and N-gene ribosome binding site (Shimatake et al., Nature 292: 128 (1981)). The inclusion of selection markers in DNA vectors transfected in E. coli is also useful. Examples of such markers include genes specifying resistance to ampicillin, tetracycline, or chloramphenicol.

The vector is selected to allow introduction into the appropriate host cell. Bacterial vectors are typically of plasmid or phage origin. Appropriate bacterial cells are infected with phage vector particles or transfected with naked phage vector DNA. If a plasmid vector is used, the bacterial cells are transfected with the plasmid vector DNA. Expression systems for expressing a protein of the present invention are available using Bacillus sp. and Salmonella (Palva, et al. , Gene 22: 229-235 (1983); Mosbach, et al., Nature 302: 543-545 (1983)). B. Expression in Eukaryotes

A variety of eukaryotic expression systems such as yeast, insect cell lines, plant and mammalian cells, are known to those of skill in the art. As explained briefly below, the polynucleotides of the present invention can be expressed in these eukaryotic systems. In some embodiments, transformed/transfected plant cells, as discussed infra, are employed as expression systems for production of the proteins of the instant invention.

Synthesis of heterologous proteins in yeast is well known. Sherman, F., et al , Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1982) is a well recognized work describing the various methods available to produce the protein in yeast. Suitable vectors usually have expression control sequences, such as promoters, including 3- phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences and the like as desired. For instance, suitable vectors are described in the literature (Botstein, et al , Gene 8: 17-24 (1979); Broach, et al. , Gene 8: 121-133 (1979)).

A protein of the present invention, once expressed, can be isolated from yeast by lysing the cells and applying standard protein isolation techniques to the lysates. The monitoring of the purification process can be accomplished by using Western blot techniques or radioimmunoassay of other standard immunoassay techniques. The sequences encoding proteins of the present invention can also be ligated to various expression vectors for use in transfecting cell cultures of, for instance, mammalian, insect, or plant origin. Illustrative of cell cultures useful for the production of the peptides are mammalian cells. Mammalian cell systems often will be in the form of monolayers of cells although mammalian cell suspensions may also be used. A number of suitable host cell lines capable of expressing intact proteins have been developed in the art, and include the HEK293, BHK21 , and CHO cell lines. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter (e.g. , the CMV promoter, a HSV tk promoter or pgk (phosphoglycerate kinase) promoter), an enhancer (Queen et al, Immunol Rev 89: 49 (1986)), and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites (e.g. , an SV40 large T Ag poly A addition site), and transcriptional terminator sequences. Other animal cells useful for production of proteins of the present invention are available, for instance, from the American Type Culture Collection Catalogue of Cell Lines and Hybridomas (7th edition, 1992).

Appropriate vectors for expressing proteins of the present invention in insect cells are usually derived from the SF9 baculovirus. Suitable insect cell lines include mosquito larvae, silkworm, army worm, moth and Drosophila cell lines such as a Schneider cell line (See Schneider, J. Embryol Exp Morphol 27: 353-365 (1987).

As with yeast, when higher animal or plant host cells are employed, polyadenlyation or transcription terminator sequences are typically incoφorated into the vector. An example of a terminator sequence is the polyadenlyation sequence from the bovine growth hormone gene. Sequences for accurate splicing of the transcript may also be included. An example of a splicing sequence is the VP1 intron from SV40 (Sprague, et al. , J. Virol. 45: 773-781 (1983)). Additionally, gene sequences to control replication in the host cell may be incoφorated into the vector such as those found in bovine papilloma virus type-vectors. Saveria-Campo, M., Bovine Papilloma Virus DNA a Eukaryotic Cloning Vector in DN Cloning Vol. II a Practical Approach, D.M. Glover, Ed., IRL Press, Arlington, Virginia pp. 213-238 (1985).

Transfection/Transformation of Cells

The method of transformation/transfection is not critical to the instant invention; various methods of transformation or transfection are currently available. As newer methods are available to host cells they may be directly applied. Accordingly, a wide variety of methods have been developed to insert a DΝA sequence into the genome of a host cell to obtain the transcription and/or translation of the sequence to effect phenotypic changes in the organism. Thus, any method, which provides for efficient transformation/transfection may be employed.

Animal and lower eukaryotic (e.g. , yeast) host cells are competent or rendered competent for transfection by various means. There are several well-known methods of introducing DΝA into animal cells. These include: calcium phosphate precipitation, fusion of the recipient cells with bacterial protoplasts containing the DΝA, treatment of the recipient cells with liposomes containing the DΝA, DEAE dextran, electroporation, biolistics, and micro-injection of the DΝA directly into the cells. The transfected cells are cultured by means well known in the art. (Kuchler, R.J., Biochemical Methods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc. (1977)). Possible transfection vectors for human cells include: Retroviruses— Defective retroviruses are the best characterized system and so far the only one approved for use in human gene therapy (Miller, A. D. , Blood 76:271 (1990)).

Adeno-Associated Virus— (AAV) is a naturally occurring defective virus that requires other viruses such as adenoviruses or heφes viruses as helper viruses (Muzyczka, N. in Current Topics in Microbiology and Immunology 158:97 (1992)). It is also one of the few viruses that may integrate its DNA into non-dividing cells. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb CFTR DNA may be towards the upper limit of packaging.

Plasmid DNA— Naked plasmid can be introduced into muscle cells by injection into the tissue. Expression can extend over many months but the number of positive cells is low (Wolff, J. et al. Science 247: 1465 (1989)). Cationic lipids aid introduction of DNA into some cells in culture (Feigner, P. and Ringold, G. M. , Nature 337:387 (1989)). Injection of cationic lipid plasmid DNA complexes into the circulation of mice has been shown to result in expression of the DNA in lung (Brigham, K. et al., Am. J. Med. Sci. 298:278 (1989), Debs and Zhu WO 93/24640 published in 1993, Mannio et al, BioTechniques 6(7):682-691, Rose US patent no. 5,279,833; Brigham, WO 91/06309 published 1991; Feigner et al., Proc. Natl Acad. Sci. USA 84:7413-7414 (1987); Budker et al., Nature Biotech, 14(6):760-764 (1996)). Instillation of cationic lipid plasmid DNA into lung also leads to expression in epithelial cells (Hazinski, T. A. et al., Am. J. Respir. , Cell Mol. Biol. 4:206 (1991)). Plasmid DNA can be introduced into non-replicating cells

Receptor Mediated Entry— In an effort to improve the efficiency of plasmid DNA uptake, attempts have been made to utilize receptor-mediated endocytosis as an entry mechanisms and to protect DNA in complexes with polylysine (Wu, G. and Wu, C. H. J. , Biol. Chem. 263:14621 (1988)). One potential problem with this approach is that the incoming plasmid DNA enters the pathway leading from endosome to lysosome, where much incoming material is degraded. One solution to this problem is the use of transferrin DNA-polylysine complexes linked to adenovirus capsids (Curiel, D. T. et al, Proc. Natl Acad. Sci. USA 88:8850 (1991)). The latter enter efficiently but have the added advantage of naturally disrupting the endosome thereby avoiding shuttling to the lysosome. Adenovirus— Defective adenoviruses at present appear to be a promising approach to gene therapy (Berkner, K. L. , BioTechniques 6:616 (1988); Miller et al., Mol Cell Biol 10:4239 (1990); Kolberg, J NIH Res A: A3 (1992); Cornetta, Hum Gene Ther 2:215 (1991)). Adenovirus can be manipulated such that it encodes and expresses the desired gene product, (e.g., Rac), and at the same time is inactivated in terms of its ability to replicate in a normal lyric viral life cycle. In addition, adenovirus has a natural tropism for airway epithelia. The viruses are able to infect quiescent cells as are found in the airways, offering a major advantage over retroviruses. Adenovirus expression is achieved without integration of the viral DNA into the host cell chromosome, thereby alleviating concerns about insertional mutagenesis. Furthermore, adenoviruses have been used as live enteric vaccines for many years with an excellent safety profile (Schwartz, A. R. et al, Am Rev Respir Dis 109:233-238 (1974)). Finally, adenovirus mediated gene transfer has been demonstrated in a number of instances including transfer of alpha- 1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld, M. A. et al. , Science 252:431-434 (1991); Rosenfeld et al. , Cell 68: 143-155 (1992)). Furthermore, extensive studies to attempt to establish adenovirus as a causative agent in human cancer were uniformly negative (Green, M. et al., Proc. Natl. Acad. Sci. USA 76:6606 (1979)).

Other widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof. See for example, Buchscher et al., J Virol 66(5):2731-2739 (1992); Johann et al., J Virol 66(5): 1635-1640; Sommer et al., Virol 176:58-59 (1990); Wilson et al, J Virol 63:2374-2378 (1989); Miller et al., J Virol 65:2220-2224 (1991); Rosenburg and Fauci in Fundamental Immunology, Third Edition Paul (ed), Raven Press, Ltd., New York (1993) and Yu et al., Gene Therapy 1(1): 13-26 (1994).

There are several methods of bone marrow or peripheral blood transformation. Essentially all methods comprise the following steps in various orders: obtaining bone marrow or blood cells containing hematopoietic stem cells, expanding the cells in culture, transfecting the cells, and either returning them to the donor or cryopreserving the cells for later use. See for example, PCT patent application, WO 97/24144, published July 10, 1997. Hematopoietic stem cells are primitive, uncommitted progenitor cells that give rise to the lymphoid, myeloid, and erythroid lineages of cells in the blood. The stem cell population constitutes only a small proportion of the total cells in bone marrow and represents even a far more minuscule proportion of the cells in peripheral blood. Peripheralizing hematopoietic stem cells is known in the art. See for example, PCT patent application, WO 94/11027, published May 26, 1994. Optionally the cells can be enriched for stem cells, by CD34 affinity chromatography such as immunoadsoφtion using anti-CD34 antibodies. Such stem cell enrichment is known in the art and has been described, for example, by Bereson, Transplantation Proceedings 24:3032-3034 (1992). The enriched stem cells can also be expanded ex vivo by culturing them in the presence of agents that stimulate proliferation of stem cells. This ex vivo expansion can be carried out using, alone or in combination, proliferation stimulating agents. Such ex vivo expansion of hematopoietic stem cells is known in the art and has been described, for example, by Bruggar, et al, Blood 81 :2579-2584 (1993). The enriched and optionally expanded stem cells are then infected with an amphotrophic retroviral vector, or other appropriate vector, which expresses a Rac polynucleotide, including a dominant positive or dominant negative form of the Rac polynucleotide. The vector may also carry an expressed selectable marker, in which case successfully transduced cells may be selected for the presence of the selectable marker. The transduced and optionally selected stem cells are then returned to the donor's circulating blood and allowed to engraft themselves into the bone marrow. The usefulness of approaches to using stem cells for retroviral-mediated gene transfer and subsequent transplantation into the donor is recognized in the art and has been described, for example, by Bragni, et al, Transplantation Proceedings 24:3032-3034 (1992).

Exogenously synthesized Rac polypeptides may be added directly to the cell or cell-free system comprising regulatory RNA, or may be synthesized de novo within the cell from a nucleic acid encoding the Rac polypeptide. Methods for introducing peptides into cells are well known in the art and include the use of colloidal carriers such as proteinoids, micoremulsions, and liposomes. See, for example, WO 90/03164; WO 91/14454; WO 92/18147; US Patent Nos. 4,957,735; 4,235, 871 ; 4,501, 728; 4, 837,028; 5, 004, 697; 5, 055, 303; 5, 514, 670; 5,413,797; 5, 268,164; 5,004,697; 4,902,505; 5,506,206; 5,271,961; 5,254,342; and 5,534,496. Other types of microparticulate drug delivery systems are known such as microspheres (WO 93/00077), lipospheres (US Patent No. 5,188,837), microcapsules (EP 442671), or other lipid vesicles (Yoshida et al, EPA 140,085). Surfactants of many types have been utilized as promoters of peptide absoφtion (EP 115627; GB 2,127,689; and US Patent No. 4,548,922).

Therapeutic Compositions and Pharmacological Applications The therapeutic agents of this invention are believed to be desirable for treatment of infections, prevention of reperfusion injuries, prevent damage to blood vessels from Fas/Fas-ligand interaction, and ARS, for from about 2 days to about 3 weeks, or as needed. For example, longer treatments may be desirable when treating seasonal diseases or the like. The dose and duration of treatment relates to the relative duration of the molecules of the present invention in the human circulation, and can be adjusted by one of skill in the art depending upon the condition being treated and the general health of the patient.

The mode of administration of the therapeutic agent of the invention may be any suitable route that delivers the agent to the host. The peptides, polynucleotides, and fragments thereof, and pharmaceutical compositions of the invention are particularly useful for parenteral administration, i.e. , subcutaneously, intramuscularly, intravenously, or intranasally.

Therapeutic agents of the invention may be prepared as pharmaceutical compositions containing an effective amount of the peptides of the invention as an active ingredient in a pharmaceutically acceptable carrier. In the prophylactic agent of the invention, an aqueous suspension or solution containing the peptide, preferably buffered at physiological pH, in a form ready for injection is preferred. The compositions for parenteral administration will commonly comprise a solution of the peptide of the invention or a cocktail thereof dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be employed, e.g. , 0.4% saline, 0.3 % glycine, and the like. These solutions are sterile and generally free of particulate matter. These solutions may be sterilized by conventional, well known sterilization techniques (e.g. , filtration). The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, etc. The concentration of the peptide of the invention in such pharmaceutical formulation can vary widely, i.e., from less than about 0.5 %, usually at or at least about 1 % to as much as 15 or 20% by weight and will be selected primarily based on fluid volumes, viscosities, etc., according to the particular mode of administration selected _f

Thus, a pharmaceutical composition of the invention for intramuscular injection could be prepared to contain 1 ml sterile buffered water, and between about 1 ng to about 100 mg, e.g. about 50 ng to about 30 mg or more preferably, about 5 mg to about 25 mg, of a polypeptide of the invention. Similarly, a pharmaceutical composition of the invention for intravenous infusion could be made up to contain about 250 ml of sterile Ringer's solution, and about 1 to about 30 and preferably 5 mg to about 25 mg of a polypeptide of the invention. Actual methods for preparing parenterally administrable compositions are well known or will be apparent to those skilled in the art and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pennsylvania.

It is preferred that the therapeutic agent of the invention, when in a pharmaceutical preparation, be present in unit dose forms. The appropriate therapeutically effective dose can be determined readily by those of skill in the art.

The invention also encompasses the administration of the peptide-fusion proteins of this invention concurrently or sequentially with other pharmaceutical activities compatible with the peptide binding ability of the fusion proteins of this invention. Such other activities are available commercially or can be designed in a manner similar to that described herein.

The fusion proteins and peptides of this invention may also be used in diagnostic regimens, such as for the determination of peptide mediated disorders or tracking progress of treatment of such disorders. As diagnostic reagents, these fusion proteins may be conventionally labeled for use in ELISA 's and other conventional assay formats for the measurement of peptide levels in serum, plasma or other appropriate tissue. The nature of the assay in which the fusion proteins are used are conventional and do not limit this disclosure.

The peptides, fusion-proteins and fragments thereof described herein can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with conventional immunoglobulins and art-known lyophilization and reconstitution techniques can be employed. Synthesis of Proteins

The proteins of the present invention can be constructed using non-cellular synthetic methods. Solid phase synthesis of proteins of less than about 50 amino acids in length may be accomplished by attaching the C-terminal amino acid of the sequence to an insoluble support followed by sequential addition of the remaining amino acids in the sequence. Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis, pp. 3-284 in The Peptides: Analysis, Synthesis, Biology. Vol. 2: Special Methods in Peptide Synthesis, Part A. ; Merrifield, et al., J. Am. Chem. Soc. 85: 2149-2156 (1963), and Stewart et al, Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co. , Rockford, 111. (1984). Proteins of greater length may be synthesized by condensation of the amino and carboxy termini of shorter fragments. Methods of forming peptide bonds by activation of a carboxy terminal end (e.g. , by the use of the coupling reagent N,N'-dicycylohexylcarbodiimide)) is known to those of skill.

Purification of Proteins

The proteins of the present invention may be purified by standard techniques well known to those of skill in the art. Recombinantly produced proteins of the present invention can be directly expressed or expressed as a fusion protein. The recombinant protein is purified by a combination of cell lysis (e.g., sonication, French press) and affinity chromatography. For fusion products, subsequent digestion of the fusion protein with an appropriate proteolytic enzyme releases the desired recombinant protein.

The proteins of this invention, recombinant or synthetic, may be purified to substantial purity by standard techniques well known in the art, including selective precipitation with such substances as ammonium sulfate, column chromatography, immunopurification methods, and others. See, for instance, R. Scopes, Protein Purification: Principles and Practice, Springer- Verlag: New York (1982); Deutscher, Guide to Protein Purification, Academic Press (1990). For example, antibodies may be raised to the proteins as described herein. Purification from E. coli can be achieved following procedures described in U.S. Patent No. 4,511,503. The protein may then be isolated from cells expressing the protein and further purified by standard protein chemistry techniques as described herein. Detection of the expressed protein is achieved by methods known in the art and includes, for example, radioimmunoassay s, Western blotting techniques or immunoprecipitation. UTR's and Codon Preference

In general, translational efficiency has been found to be regulated by specific sequence elements in the 5' non-coding or untranslated region (5' UTR) of the RNA. Positive sequence motifs include translational initiation consensus sequences (Kozak, Nucleic Acids Res.15:8125 (1987)) and the 5 < G> 7 methyl GpppG cap structure (Drummond et al, Nucleic Acids Res. 13:7375 (1985)). Negative elements include stable intramolecular 5' UTR stem-loop structures (Muesing et al., Cell 48:691 (1987)) and AUG sequences or short open reading frames preceded by an appropriate AUG in the 5' UTR (Kozak, supra, Rao et al., Mol and Cell Biol 8:284 (1988)). Accordingly, the present invention provides 5' and/or 3' UTR regions for modulation of translation of heterologous coding sequences.

Further, the polypeptide-encoding segments of the polynucleotides of the present invention can be modified to alter codon usage. Altered codon usage can be employed to alter translational efficiency and/or to optimize the coding sequence for expression in a desired host or to optimize the codon usage in a heterologous sequence for expression in cells. Codon usage in the coding regions of the polynucleotides of the present invention can be analyzed statistically using commercially available software packages such as "Codon Preference" available from the University of Wisconsin Genetics Computer Group (see Devereaux et al, Nucleic Acids Res. 12: 387-395 (1984)) or MacVector 4.1 (Eastman Kodak Co. , New Haven, Conn.). Thus, the present invention provides a codon usage frequency characteristic of the coding region of at least one of the polynucleotides of the present invention. The number of polynucleotides that can be used to determine a codon usage frequency can be any integer from 1 to the number of polynucleotides of the present invention as provided herein. Optionally, the polynucleotides will be full-length sequences. An exemplary number of sequences for statistical analysis can be at least 1 , 5, 10, 20, 50, or 100.

Sequence Shuffling The present invention provides methods for sequence shuffling using polynucleotides of the present invention, and compositions resulting therefrom. Sequence shuffling is described in PCT publication No. 96/19256. See also. Zhang, J.- H., et al. Proc. Natl. Acad. Sci. USA 94:4504-4509 (1997) and Zhao, et al, Nature Biotech 16:258-261 (1998). Generally, sequence shuffling provides a means for generating libraries of polynucleotides having a desired characteristic, which can be selected or screened for. Libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides , which comprise sequence regions, which have substantial sequence identity and can be homologously recombined in vitro or in vivo. The population of sequence-recombined polynucleotides comprises a subpopulation of polynucleotides which possess desired or advantageous characteristics and which can be selected by a suitable selection or screening method. The characteristics can be any property or attribute capable of being selected for or detected in a screening system, and may include properties of: an encoded protein, a transcriptional element, a sequence controlling transcription, RNA processing, RNA stability, chromatin conformation, translation, or other expression property of a gene or transgene, a replicative element, a protein-binding element, or the like, such as any feature which confers a selectable or detectable property. In some embodiments, the selected characteristic will be a change in K,- and/or K_cat over the wild-type protein as provided herein. In other embodiments, a protein or polynucleotide generated from sequence shuffling will have a ligand binding affinity greater than the non-shuffled wild- type polynucleotide. The increase in such properties can be at least 110% , 120% , 130% , 140% or 150% of the wild-type value.

Antibodies to Proteins

Antibodies can be raised to a protein of the present invention, including individual, allelic, strain, or species variants, and fragments thereof, both in their naturally occurring (full-length) forms and in recombinant forms. Additionally, antibodies are raised to these proteins in either their native configurations or in non- native configurations. Anti-idiotypic antibodies can also be generated. Many methods of making antibodies are known to persons of skill. The following discussion is presented as a general overview of the techniques available; however, one of skill will recognize that many variations upon the following methods are known. A number of immunogens are used to produce antibodies specifically reactive with a protein of the present invention. An isolated recombinant, synthetic, or native Rac protein of 5 amino acids in length or greater and selected from a protein encoded by a polynucleotide of the present invention, such as exemplary sequences of SEQ ID NOS: 2, 4, 6, 8, and 10, are the preferred immunogens (antigen) for the production of monoclonal or polyclonal antibodies, even more preferred are SEQ ID NOS: 11-14. Those of skill will readily understand that the proteins of the present invention are typically denatured, and optionally reduced, prior to formation of antibodies for screening expression libraries or other assays in which a putative protein of the present invention is expressed or denatured in a non-native secondary, tertiary, or quartenary structure. Naturally occurring Rac polypeptides can be used either in pure or impure form.

The protein of the present invention is then injected into an animal capable of producing antibodies. Either monoclonal or polyclonal antibodies can be generated for subsequent use in immunoassays to measure the presence and quantity of the protein of the present invention. Methods of producing polyclonal antibodies are known to those of skill in the art. In brief, an immunogen (antigen), preferably a purified protein, a protein coupled to an appropriate carrier (e.g., GST, keyhole limpet hemanocyanin, etc.), or a protein incoφorated into an immunization vector such as a recombinant vaccinia virus (see, U.S. Patent No. 4,722,848) is mixed with an adjuvant and animals are immunized with the mixture. The animal's immune response to the immunogen preparation is monitored by taking test bleeds and determining the titer of reactivity to the protein of interest. When appropriately high titers of antibody to the immunogen are obtained, blood is collected from the animal and antisera are prepared. Further fractionation of the antisera to enrich for antibodies reactive to the protein is performed where desired (See, e.g., Coligan, Current Protocols in Immunology, Wiley/Greene, NY (1991); and Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press, NY (1989)).

Antibodies, including binding fragments and single chain recombinant versions thereof, against predetermined fragments of a protein of the present invention are raised by immunizing animals, e.g., with conjugates of the fragments with carrier proteins as described above. Typically, the immunogen of interest is a protein of at least about 5 amino acids, more typically the protein is 10 amino acids in length, preferably, 15 amino acids in length and more preferably the protein is 20 amino acids in length or greater. The peptides are typically coupled to a carrier protein (e.g., as a fusion protein), or are recombinantly expressed in an immunization vector. Antigenic determinants on peptides to which antibodies bind are typically 3 to 10 amino acids in length. Monoclonal antibodies are prepared from cells secreting the desired antibody. Monoclonal antibodies are screened for binding to a protein from which the immunogen was derived. Specific monoclonal and polyclonal antibodies will usually have an antibody binding site with an affinity constant for its cognate monovalent antigen at least between 10⁶-10⁷, usually at least 10⁸, preferably at least 10°, more preferably at least 10¹⁰, and most preferably at least 10" liters/mole.

In some instances, it is desirable to prepare monoclonal antibodies from various mammalian hosts, such as mice, rodents, primates, humans, etc. Description of techniques for preparing such monoclonal antibodies are found in, e.g. , Basic and Clinical Immunology, 4th ed., Stites et al. , Eds., Lange Medical Publications, Los Altos, CA, and references cited therein; Harlow and Lane, Supra; Goding, Monoclonal Antibodies: Principles and Practice, 2nd ed., Academic Press, New York, NY (1986); and Kohler and Milstein, Nature 256: 495-497 (1975). Summarized briefly, this method proceeds by injecting an animal with an immunogen comprising a protein of the present invention. The animal is then sacrificed and cells taken from its spleen, which are fused with myeloma cells. The result is a hybrid cell or "hybridoma" that is capable of reproducing in vitro. The population of hybridomas is then screened to isolate individual clones, each of which secrete a single antibody species to the immunogen. In this manner, the individual antibody species obtained are the products of immortalized and cloned single B cells from the immune animal generated in response to a specific site recognized on the immunogenic substance.

Other suitable techniques involve selection of libraries of recombinant antibodies in phage or similar vectors (see, e.g., Huse et al. , Science 246: 1275-1281 (1989); and Ward, et al. , Nature 341 : 544-546 (1989); and Vaughan et al. , Nature Biotechnology, 14: 309-314 (1996)). Alternatively, high avidity human monoclonal antibodies can be obtained from transgenic mice comprising fragments of the unrearranged human heavy and light chain Ig loci (i.e., minilocus transgenic mice). Fishwild et al , Nature Biotech. , 14: 845-851 (1996). Also, recombinant immunoglobulins may be produced. See, Cabilly, U.S. Patent No. 4,816,567; and Queen et al , Proc Natl Acad Sci 86: 10029-10033 (1989).

The antibodies of this invention are also used for affinity chromatography in isolating proteins of the present invention. Columns are prepared, e.g., with the antibodies linked to a solid support, e.g. , particles, such as agarose, Sephadex, or the like, where a cell lysate is passed through the column, washed, and treated with increasing concentrations of a mild denaturant, whereby purified protein are released.

The antibodies can be used to screen expression libraries for particular expression products such as normal or abnormal protein. Usually the antibodies in such a procedure are labeled with a moiety allowing easy detection of presence of antigen by antibody binding.

Antibodies raised against a protein of the present invention can also be used to raise anti-idiotypic antibodies. These are useful for detecting or diagnosing various pathological conditions related to the presence of the respective antigens. Frequently, the proteins and antibodies of the present invention will be labeled by joining, either covalently or non-covalently, a substance, which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in both the scientific and patent literature. Suitable labels include radionucleotides, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like.

Protein Immunoassays

Means of detecting the proteins of the present invention are not critical aspects of the present invention. In a preferred embodiment, the proteins are detected and/or quantified using any of a number of well recognized immunological binding assays (see, e.g., U.S. Patents 4,366,241; 4,376,110; 4,517,288; and 4,837,168). For a review of the general immunoassays, see also Methods in Cell Biology, Vol. 37: Antibodies in Cell Biology, Asai, Ed., Academic Press, Inc. New York (1993); Basic and Clinical Immunology 7th Edition, Stites & Terr, Eds. (1991). Moreover, the immunoassays of the present invention can be performed in any of several configurations, e.g., those reviewed in Enzyme Immunoassay, Maggio, Ed., CRC Press, Boca Raton, Florida (1980); Tijan, Practice and Theory of Enzyme Immunoassays, Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers BV, Amsterdam (1985); Harlow and Lane, supra; Immunoassay: A Practical Guide, Chan, Ed., Academic Press, Orlando, FL (1987); Principles and Practice of Immunoassays, Price and Newman Eds. , Stockton Press, NY (1991); and Non-isotopic Immunoassays, Ngo, Ed. , Plenum Press, NY (1988). Immunological binding assays (or immunoassays) typically utilize a "capture agent" to specifically bind to and often immobilize the analyte (in this case, a protein of the present invention). The capture agent is a moiety that specifically binds to the analyte. In a preferred embodiment, the capture agent is an antibody that specifically binds a protein(s) of the present invention. The antibody may be produced by any of a number of means known to those of skill in the art as described herein.

A. Non-Competitive Assay Formats

Immunoassays for detecting proteins of the present invention include competitive and noncompetitive formats. Noncompetitive immunoassays are assays in which the amount of captured analyte (i.e. , a protein of the present invention) is directly measured. In one preferred "sandwich" assay, for example, the capture agent (e.g., an antibody specifically reactive, under immunoreactive conditions, to a protein of the present invention) can be bound directly to a solid substrate where they are immobilized. These immobilized antibodies then capture the protein present in the test sample. The protein thus immobilized is then bound by a labeling agent, such as a second antibody bearing a label. Alternatively, the second antibody may lack a label, but it may, in turn, be bound by a labeled third antibody specific to antibodies of the species from which the second antibody is derived. The second can be modified with a detectable moiety, such as biotin, to which a third labeled molecule can specifically bind, such as enzyme-labeled streptavidin.

B. Competitive Assay Formats

In competitive assays, the amount of analyte present in the sample is measured indirectly by measuring the amount of an added (exogenous) analyte (e.g. , a protein of the present invention) displaced (or competed away) from a capture agent (e.g. , an antibody specifically reactive, under immunoreactive conditions, to the protein) by the analyte present in the sample. In one competitive assay, a known amount of analyte is added to the sample and the sample is then contacted with a capture agent that specifically binds a protein of the present invention. The amount of protein bound to the capture agent is inversely proportional to the concentration of analyte present in the sample.

In a particularly preferred embodiment, the antibody is immobilized on a solid substrate. The amount of protein bound to the antibody may be determined either by measuring the amount of protein present in a protein/antibody complex, or alternatively by measuring the amount of remaining uncomplexed protein. The amount of protein may be detected by providing a labeled protein.

A hapten inhibition assay is another preferred competitive assay. In this assay a known analyte, (such as a protein of the present invention) is immobilized on a solid substrate. A known amount of antibody specifically reactive, under immunoreactive conditions, to the protein is added to the sample, and the sample is then contacted with the immobilized protein. In this case, the amount of antibody bound to the immobilized protein is inversely proportional to the amount of protein present in the sample. Again, the amount of immobilized antibody may be detected by detecting either the immobilized fraction of antibody or the fraction of the antibody that remains in solution. Detection may be direct where the antibody is labeled or indirect by the subsequent addition of a labeled moiety that specifically binds to the antibody as described above.

Regulating programmed cell death

Programmed cell death is an integral step during development and in response to environmental stress conditions. It has been shown that overexpression of dominant positive Rac proteins in transgenic mice results in cell death in a tissue-specific manner (Lores, et al, Oncogene, 15: 601-605 (1997)). The sequences of the invention are also useful for genetically targeted cell ablations. In this manner, dominant negative nucleotide sequences can be utilized for cell ablation by expressing such negative nucleotide sequences with specific tissue promoters. In this manner, very specific or general patterns of cell ablations can be created. Additionally, to provide specific cell ablation, antisense ohgonucleotides for Rac or other genes of the invention can be expressed in target cells disrupting the translation, which produces the cell death suppressor proteins.

Regulation of cytoskeleton reorganization

Rac proteins are known to control cytoskeleton organization in diverse organisms. Furthermore, in plants, Rac-related proteins have been co-localized with actin distribution during pollen tube growth (Lin et al, Plant Cell 9: 1647-1659 (1997)).

Expression of another Rac-related gene (cdc42) was shown to be essential for cytoskeleton reorganization and defense against bacterial attack (Dutartre, et al, J of Cell Science 109: 367-377 (1996); Nobles, et al, Cell 81 : 53-62 (1995)). These results strongly suggest that Rac proteins play a very important role in regulating cytoskeleton organization during development and under stress conditions.

Use of plant Rac polynucleotides in animals

Infections, especially fungal infections are the primary cause of death in children and adult post-bone marrow transplantation. Incidences of colonization, invasive infection, and systemic sepsis caused by pathogenic fungi are increasing (Slotman, J of Critical Illness 12(l l):691-696 (1997)). Thus, new methods for killing pathogenic fungi and preventing other types of infections would significantly improve survival after bone marrow transplantation. Transfection of hemapoietic stem cells from either bone marrow or peripheral blood is described earlier (See the section entitled " Transfection/Transformation of Cells"). Once the Rac-transfected stem cells are infused into a patient, generation of superoxide would prevent opportunistic infections. In cardiovascular disease, dominant negative Racs could be used to protect tissues from reperfusion injuries, without blocking potentially important functions, such as repair, of mammalian Racl . In a recent article, Kim et al. show that by inhibiting rac- dependent pathways, tissue is protected from reoxygenation-induced cell death (Kim et al., JCI, 1010:1821-1826 (1998)). Optionally, adeno-associated vectors could be used to transfect tissue, as described in the section entitled "Transfection of Prokaryotes, Lower Eukaryotes, and Animal Cells", during cardiac surgery, causing constitutive expression of dominant negative plant Rac polynucleotides. Another alternative is the use of naked plasmid DNA containing the Rac polynucleotide in the traumatized area. One skilled in the art will recognize various ways to transfect tissue at the site of injury during cardiac surgery.

Another possible use of the polynucleotides of the present invention is in the treatment of patients with Adult Respiratory Syndrome (ARS). ARS causes damage to lung tissue and increases the susceptibility of lung tissue to oxidants. By transfecting lung tissue using previously described methods, with the polynucleotides of the present invention, further lung damage could be prevented. Expression of a dominant negative Rac polynucleotide would block production of harmful oxygen radicals.

Similarly, transfection of tissue with the dominant negative form of the polynucleotides of the present invention could prevent blood vessel damage resulting from Fas/Fas-ligand interaction. Reactive oxygen species is generated upon ligand binding in non-phagocytic cells. Preventing the formation of reactive oxygen species, by expression of the dominant negative form of Rac, would decrease blood vessel damage. Although the present invention has been described in some detail by way of illustration and example for puφoses of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

EXAMPLE 1 This example describes the construction cDNA libraries.

Total RNA Isolation

Total RNA was isolated from maize tissues with TRIzol Reagent (Life Technology Inc. Gaithersburg, MD) using a modification of the guanidine isothiocyanate/acid-phenol procedure described by Chomczynski and Sacchi [Chomczynski, P., and Sacchi, N. Anal Biochem 162, 156 (1987)]. In brief, plant tissue samples were pulverized in liquid nitrogen before the addition of the TRIzol Reagent, and then were further homogenized with a mortar and pestle. Addition of chloroform followed by centrifugation was conducted for separation of an aqueous phase and an organic phase. The total RNA was recovered by precipitation with isopropyl alcohol from the aqueous phase.

Poly(A) + RNA Isolation

The selection of poly(A) + RNA from total RNA was performed using PolyATact system (Promega Coφoration, Madison, WI). In brief, biofinylated oligo(dT) primers were used to hybridize to the 3' poly (A) tails on mRNA. The hybrids were captured using streptavidin coupled to paramagnetic particles and a magnetic separation stand. The mRNA was washed at high stringent condition and eluted by RNase-free deionized water.

cDNA Library Construction cDNA synthesis was performed and unidirectional cDNA libraries were constructed using the Superscript Plasmid System (Life Technology Inc. Gaithersburg, MD). The first stand of cDNA was synthesized by priming an oligo(dT) primer containing a Not I site. The reaction was catalyzed by Superscript Reverse Transcriptase II at 45°C. The second strand of cDNA was labeled with alpha-³²P-dCTP and a portion of the reaction was analyzed by agarose gel electrophoresis to determine cDNA sizes. cDNA molecules smaller than 500 base pairs and unligated adapters were removed by Sephacryl-S400 chromatography. The selected cDNA molecules were ligated into pSPORTl vector in between of Not I and Sal I sites.

EXAMPLE 2 This example describes cDNA sequencing and library subtraction.

Sequencing Template Preparation

Individual colonies were picked and DNA was prepared either by PCR with M13 forward primers and M13 reverse primers, or by plasmid isolation. All the cDNA clones were sequenced using Ml 3 reverse primers.

Q-bot Subtraction Procedure cDNA libraries subjected to the subtraction procedure were plated out on 22 x 22 cm² agar plate at density of about 3,000 colonies per plate. The plates were incubated in a 37°C incubator for 12-24 hours. Colonies were picked into 384- well plates by a robot colony picker, Q-bot (GENETIX Limited). These plates were incubated overnight at 37°C.

Once sufficient colonies were picked, they were pinned onto 22 x 22 cm² nylon membranes using Q-bot. Each membrane contained 9,216 colonies or 36,864 colonies. These membranes were placed onto agar plate with appropriate antibiotic. The plates were incubated at 37°C for overnight.

After colonies were recovered on the second day, these filters were placed on filter paper prewetted with denaturing solution for four minutes, then were incubated on top of a boiling water bath for additional four minutes. The filters were then placed on filter paper prewetted with neutralizing solution for four minutes. After excess solution was removed by placing the filters on dry filter papers for one minute, the colony side of the filters were place into Proteinase K solution, incubated at 37°C for 40-50 minutes. The filters were placed on dry filter papers to dry overnight. DNA was then cross- linked to nylon membrane by UV light treatment.

Colony hybridization was conducted as described by Sambrook, et al., [in Molecular Cloning: A laboratory Manual, 2^nd Edition). The following probes were used in colony hybridization:

1. First strand cDNA from the same tissue as the library was made from to remove the most redundant clones.

2. 48-192 most redundant cDNA clones from the same library based on previous sequencing data. 3. 192 most redundant cDNA clones in the entire corn EST database.

4. A Sal-A20 oligo nucleotide: TCG ACC CAC GCG TCC GAA AAA AAA AAA AAA AAA AAA (SEQ ID NO: 51 ) removes clones containing a poly A tail but no cDNA.

5. cDNA clones derived from rRNA. The image of the autoradiography was scanned into computer and the signal intensity and cold colony addresses of each colony was analyzed. Re-arraying of cold-colonies from 384 well plates to 96 well plates was conducted using Q-bot.

EXAMPLE 3 Identification and sequencing of Maize Rac cDNAs (A to E):

Five Rac homologues, designated RacA-E (SEQ ID NOS: 1 , 3, 5, 7, and 9), were identified from the maize genomics database described above, based on their sequence homology to known Rac genes in other organisms. These cDNAs were completely sequenced on both strands by automated sequencing methods. Internal primers were designed and synthesized to walk through the cDNA sequences.

A GCG software package, containing GAP, under default settings, was used to align the amino acid sequences of the four maize Rac proteins with Rac/Rho related proteins sequences in the public databases from other organisms including plants. The percent identity and similarity of the maize Rac A-E protein sequences compared to the Human Rac2 protein sequence can be found in Table 1. A comparison of the maize Racs A-E protein sequences with each other can be found in Table 2. TABLE 1 BestFit "Similarity" and "Identity" Scores Between Human Rac2 and Maize

RacA-E

%Similarity %Identity

RacA 69.78 59.34

RacB 70.33 63.187

RacC 69.23 60.989

RacD 69.23 62.637

RacE 68.16 60.335

TABLE 2 Similarity and Identity between Maize Rac proteins

ZmRacA ZmRacB ZmRacC ZmRacD ZmRacΞ

ZmRacA 100 88.78 82.72 88.27 84.73

(82.65) * (76.96)* (80.61) * (77.34) *

ZmRacB 100 82.61 92.39 84.29

(75.00) * (90.36) * (77.49)*

ZmRacC 100 82. 20 87.44 (74.34) * (83.58)*

ZmRacD 100 87.03 (80.54)*

'Identity Scores in parenthesis

Motifs were found that defined the positions of Gl-elements GXXXXGKS/T, G3- elements IWDTAGQ, G4-elements NKXD, G5 elements EXSA, and putative G2/effector regions.

From Table 1, it is clear that the maize Rac polypeptides at best have only 63.187% identity to the Human Rac2 gene. In comparing the maize Rac polypeptides, RacB and RacD showed the highest similarity (92.39%) and RacC and RacD show the lowest similarity (82.20%).

It has been shown that all regions known to be involved in GTP/GDP binding are conserved between plant Rac proteins and mammalian Ras proteins. In addition, it seems that the 3-dimensional structure of both Ras and Rac/Rho proteins is similar. The predicted secondary structures of plant Rac proteins and mammalian Ras proteins are also very similar. The primary structures of plant and mammalian Rac proteins exhibit a high level of similarity throughout the amino acid sequence, with loop 1 , loop 4, loop 8, the effector region, the a - ,α₂- helix, β₃-, β₅- sheet, as the most conserved regions (Winge, et al, supra). The deduced amino acid sequence of maize Rac proteins also revealed the presence of four sequence motifs GI , G3, G4 and G5 that are found to be conserved in the small GTP binding (SMG) protein superfamily (Borg, et al., The Plant J, 11(2): 237-250 (1997)). These motifs together are responsible for nucleotide binding and GTP hydrolysis. The maize Rac proteins also contain the characteristic G2 effector region, which is fairly conserved within each subfamily, but less so between different subfamilies. The C-terminus region of these proteins contains the most varied sequence. The CXXL motif at the C-terminus, was present in RacA, B, C and D, however only two amino acids were found to be present after a Cys residue in RacE. The CXXL motif is known to be required for isoprenylation and geranygeranylation of the C-terminal Cys residue. These modifications of the C-termini of Rac proteins are important for membrane localization. Rac proteins also contain a stretch of 6-8 amino acids just upstream of the CXXL motif, which is highly basic and consists of lysine and arginine residues. This basic region at the C-terminus is also found in human Ki-Ras proteins and is reported to facilitate membrane anchoring (Winge, et al., supra)

EXAMPLE 4

Site-directed mutagenesis and cloning of the mutated Rac:

As discussed earlier, a single amino acid change in the Rac amino acid sequence can alter the ability of Rac to cycle between active and inactive states. A change of glycine to valine at residue 12 in the highly conserved mammalian Racs results in total loss of GTPase activity, so that when the mutant Rac binds GTP it stays activated permanently, in other words a dominant positive form of Rac. Conversely, changing residue 18 from threonine to alanine causes loss of ability to bind GTP and hence causes permanent inactivation of Rac, in other words a dominant negative form of Rac.

Transformer™ Site-Directed Mutagenesis Kit from Clontech was used to generate dominant positive (G to V) and dominant negative versions (T to N) of the RacA-D cDNAs.

The primers used to generate the dominant positive and dominant negative versions of RacA-D were: RacA

CBPBE14RB_u5, to generate G to V mutation TCACGGTCGGCGACGTGGCCGTGGGCAAG (SEQ ID NO: 35) CBPBE14RB_u6, to generate T to N mutation GCCGTGGGCAAGAACTGTATGCTCATC (SEQ ID NO: 36) CBPBE14C_u7, for PCR cloning in P7770

GAATTCGGATCCACACGACACCATGGCGTCCAGCGCCTCTCGGTTC (SEQ ID NO: 37) CBPBE14C_d5, for PCR cloning in P7770 TCTAGAGTTAACACGACACTCAGGACTTGAAGCATAGCATTTTTC (SEQ ID NO: 38)

RacB

CRCBS75Ru3, to generate G to V mutation

TCACGGTCGGGGACGTCGCCGTCGGCAAG (SEQ ID NO: 39)

CRCBS75Ru4, to generate T to N mutation GCCGTCGGCAAGAACTGCATGCTCATC (SEQ ID NO: 40)

CRCBS75RC_u5, for PCR cloning in P7770

GAATTCGGATCCACACGACACCATGAGCGCGTCCAGGTTCATAAAG (SEQ ID NO: 41)

CRCBS75C_dl, for PCR cloning in P7770

TCTAGAGTTAACACGACACTCACAAAATGGAGCACGCCCCCCTCTG (SEQ ID NO: 42)

RacC

CGEVL32RB_ul , to generate G to V mutation

CACGGTCGGCGATGTGGCCGTCGGGAAGAC (SEQ ID NO: 43)

CGEVL32RB_u2, to generate T to N mutation GCCGTCGGGAAGAACTGCATGCTCATCTGC (SEQ ID NO: 44)

CGEVL32C_u3, for PCR cloning in P7770

GAATTCGGATCCACACGACACCATGAGCGCGGCGGCAGCGGCGGCG (SEQ ID NO: 45)

CGEVL32C_dl , for PCR cloning in P7770

TCTAGAGTTAACACGACACTTACGATGTGAAACATCCGCTTCCACAG (SEQ ID NO: 46)

RacD

CBlFL19RB_u5, to generate G to V mutation

GTCACCGTGGGGGACGTGGCCGTCGGAAAGAC (SEQ ID NO: 47)

CBlFL19RB_u6, to generate T to N mutation GCCGTCGGAAAGAACTGCATGCTCATCTC (SEQ ID NO: 48)

CBlFL19C_u7, for PCR cloning in P7770

GAATTCGGATCCACACGACACCATGAGCGCGTCTCGGTTCATCAAG (SEQ ID NO: 49) CBlFL19C_d5, for PCR cloning in P7770

TCTAGAGTTAACACGACACTTACAAAATGGTGCATCCCTTCTGCAC (SEQ ID NO: 50)

The mutated Racs were then cloned in a P7770 transformation vector containing the ubiquitin promoter (U.S. Patent No. 5,683,439) operably linked to the Rac polynucleotide of interest and followed by a Pinll terminator. Primers were designed to introduce BamHl and Hpal sites at the 5' and 3' end of the open reading frames of the mutated Rac cDNAs. Subsequently, these were cloned in the BamHI-Hpal site of the plasmid P7770. This allowed the placement of mutant Rac ORFs under the control of the ubiquitin promoter.

EXAMPLE 5 ROS measurements in mammalian cells:

The mammalian NIH 3T3 cells were seeded on 35 mm plates at the density 0.3X10⁶/ plate (12-24 hours before transfection). Transient transfection was performed using the cationic-liposome-mediated transfection (1-9) (DOTAP Liposomal Transfection Reagent from Boehringer Mannheim, Cat. # 1202 375). Four Rac-dominant positives [Rac A (G→V), Rac B (G→V), Rac C (G→V) and Rac D (G→V)] and their dominant negative counterparts [Rac A (T→N), Rac B(T→N), Rac C (T→N) and Rac D (T→N)] were subcloned in the mammalian expression vector pZeoSv2 (+/-) (Invitrogen) containing the SV40 promoter and transiently transfected into NIH 3T3 cells.

Five μg of the plasmid-containing Rac or mutated Racs was transfected/ 35mm plate. The 5 μg of DNA was diluted to the concentration of 0.1 μg/μl (50 μl) with Hepes buffer (20 mM, pH 7.4) in a sterile reaction tube. In a separate sterile reaction tube, 30 μl DOTAP was mixed with Hepes buffer to the final volume of 100 μl. The nucleic acid solution (50 μl) was transferred to the reaction tube already containing the DOTAP in Hepes buffer (100 μl) and mixed with the transfection mixture by gently pipetting the mixture several times. The transfection mixture was then incubated for 15 min at room temp then mixed with the DOTAP/nucleic acid mixture with 1.5 ml DMEM medium (Dulbecco's Modified Eagle Medium, GIBCO-BRL # 10569-010) containing 10% Fetal Bovine Serum. The old culture medium was removed from the plate and new culture medium containing the DOTAP/nucleic acid mixture was added. The cells were incubated overnight (about 20 hours). On the second day, the media containing the mixture was removed and replaced by fresh culture medium and incubated for an additional 20-24 hours. On the third day, the culture medium was removed and replaced with culture medium containing 0.5% serum and incubated overnight (15-20 hours) for EPR spectroscopy assay. For the EPR assay, the medium was removed and the cells were washed with IX

PBS (Phosphate Buffered Saline, GIBCO BRL # 14200-075) treated with chelating agent (Chelex 100 Resin, from Bio-Rad Cat # 142-2822) to remove metal ions that may give false signals. The cells were collected using plastic scrapers in the presence of 1 ml of IX PBS buffer and spun down at 1200 rpm, then resuspended in 250 μl of IX PBS buffer. About 25-50 μl of the cell suspension was used for the EPR assay. The volume was brought up to 200 μl with IX PBS buffer and the spin trap, DEPMPO [5- (diethoxyphosphory)-5-methyl-l-pyrroline N-oxide), was added to the final concentration, 100 mM (10) at 0.0 time. The samples were assayed in EPR spectroscopy at different time points (i.e. 2, 15, 30 and 60 minutes) upon the addition of the DEPMPO.

Previous studies showed that NIH 3T3 cells stably transformed with a constitutively active isoform of p21Ras (H-Ras ^V12), produced large amounts of reactive oxygen species (Irani, et al. Science. 275: 1649-1652). Superoxide dismutase (SOD) quenched the observed signals, whereas catalase had no effect. This result suggested that the observed signals were attributable to .0₂ trapping rather than to .OH derived from H₂O₂ Production of .0₂ by NIH 3T3 stably transformed with H-Ras ^V12 (A6 cells) was confirmed by a Lucigenin-enhanced chemiluminescence (LUCL) assay, which has specificity for .0₂ (Gyllenhammar. J. Immunol Methods. 97(2):209-213, 1987) This .0₂ production was suppressed by the expression of dominant negative isoforms of Ras or Racl as well as by treatment with farnesyl protein transferase (FPTase), which inhibits Ras-dependent transformation and results in morphological reversion of Ras-transformed cells (Kohl, et al. Science 260:1934-1937 (1993), This observation showed that .0₂ in A6 cells is dependent on oncogenic Ras. The results also showed, Ras-transformed cells have the ability to progress through the cell cycle even under conditions of confluence and growth factors deprivation and these cells displayed a greater rate of DNA synthesis than the controls (Irani, supra). Treating cells with the antioxidant N-acetyl-L-cysteine (NAC) which inhibits DNA synthesis inhibited the Ras-induced mitogenic response of A6 cells. Furthermore, the mitogenic-activated protein kinase (MAPK) activity was decreased and c-Jun N-terminal kinase (JNK) was not activated in H-Ras-transformed cells. In conclusion, these results indicate that H-Ras ^V12 -induced transformation can lead to the production of .0₂ through one or more pathways involving Racl . The implication of a reactive oxygen species, probably .0₂, as a mediator of Ras-induced cell cycle progression independent of MAPK and JNK (perhaps JAK/STAT pathway) suggests a possible mechanism for the effects of antioxidants against Ras-induced cellular transformation.

The transient expression of a constitutively active mutant of Racl (Racl ^V12) in

NIH 3T3 cells leads to a significant increase in ROS as detected by electron paramagnetic resonance (EPR) spectroscopy and the spin trapping DEMPMPO [5-

(diethoxyphosophory)-5 -methyl- 1-pyrroline N-oxide] (Farnsworth, et al. Mol. Cell.

Biol. 11 :4822-4829, 1991) however, the expression of a dominant-negative Racl mutant

(Racl^N17) inhibits the production of ROS in HIH 3T3 cells induced to produce ROS because Rac ^N17 could act as a dominant inhibitor of endogenous Rac function. By analogy to N17 H-ras mutant, it is probably that Rac ^N17 in its inactive conformation competitively inhibits the interaction of the normal endogenous counterparts with a guanine nucleotide exchange factor (15,16).

Using EPR, NIH 3T3 cells transiently transfected with the dominant positive plant Rac isoforms markedly increased the level of ROS production and that levels were much higher in Rac A and Rac D than Rac B. However, cells transfected with the matching dominant-negative isoforms had no detectable level of ROS as shown by EPR spectroscopy. These results suggest that the Rac gene has been conserved throughout evolution, such that the molecule would regulate the production of ROS in most cells and can transduce its signal pathway in mammals as well as in plants.

EXAMPLE 6

Production of Antibodies to the Rac genes:

Immugen for antibody production was a MAP synthesized peptide as seen below.

The immugen was injected into rabbits using standard techniques. The antibodies produced can be used for a variety of assays including for an Elisa (see Butler (ed.),

Immuno chemistry of Solid-Phase Immunoassay, CRC Press, (1991), and hereby incoφorated by reference) and Western blotting. Zea mays Rac peptides for making antibodies .

RacA (SEQ ID NO 11) SRKGCSMMNIFGGRKM

RacB (SEQ ID NO 12) KAKKKKKVQRGACSIL

RacC (SEQ ID NO 13) MKTSSNQS RRYLCGSGC

RacD (SEQ ID NO 14) KQKKRKKKVQKGCTI

EXAMPLE 7 Defining the ROS signal produced by overexpression of Zea maize (ZM) dominant positive Rac isoforms The mammalian NIH 3T3 cells will be seeded on 35 mm plates at the density

0.3X10⁶/plate (12-24 hours before transfection). Transient transfection will be done according to the manufacturer's recommendations (BOEHRINGER MANNHEIM) using 30 μl DOTAP (the cationic-liposome-mediated transfection reagent) and 5 μg DNA per 35 mm plate. In order to define the ROS signal, cells will be treated with either Cu-Zn SOD or catalase (Sigma) for 20 min before obtaining EPR spectra as described in Irani, supra. In the meantime, the effect of SOD and catalase will be tested in vitro as well by co-transfected the cells with expression plasmids containing SOD or catalase cDNA. Cells transfected with the dominant-negative isoforms or the empty pZeoV2 vector alone will be served as controls. The transfection efficiency will be assessed by labeling only 10% of the transfected DNA with either fluorescein or Rhodamine (PanVera Corp). Fluorescein can be excited at the light wavelength of 490 nm and yields bright green fluorescence, while Rhodamine gave a red fluorescence at 530 nm. Alternatively, cells can be co-transfected with 1 μg of GFP cDNA construct that encode a fluorescence protein. The GFP gene was isolated from jellyfish Aequorea victoria (Prasher, et al. Gene. 111:229-233, 1992). When the GFP protein illuminated by blue or UV light, it yields bright green fluorescence (Ward, et al. Photochem Photobiol 31 :611-615, 1980).

Cells will be incubated in the culture medium (DMEM) containing the DOTAP/nucleic acid mixture for 20 hours. In the second day, the media is removed and replaced by fresh culture medium and incubated for additional 24 hours. In the third day, the culture medium is removed and replaced with culture medium containing 0.5 % serum and incubated overnight (15-20 hours) until EPR spectroscopy assay. For the EPR assay, the medium is removed and the cells are washed with IX PBS (GIBCO-BRL) treated with chelating agent (Chelex 100 Resin, from Bio-Rad Cat # 142-2822) to remove metal ions that may give false signals. The cells are collected using plastic scrapers in presence of 1 ml of IX PBS buffer and spun down at 1200 rpm, then resuspended in 250 μl of IX PBS buffer. About 25-50 μl of the cell suspension is used for the EPR assay, the volume is brought up to 200 μl with IX PBS and the spin trap, DEPMPO, is added to final concentration 100 mM at 0.0 time (Frejaville, et al. J. Med Chem. 38: 258-265, 1995). The samples are assayed in EPR spectroscopy at different time points (i.e. 2, 15, 30 and 60 minutes) upon the addition of the DEPMPO. EPR assay is conducted first on controls, such as Chelex-treated buffer or on untransfected NIH 3T3 cells in order to minimize artifacts.

EXAMPLE 8 The mitogenic effect of ZM-Rac isoform overexpression

NIH 3T3 cells will be transiently transfected with the dominant-positive ZM-Rac isoforms as well as their dominant negative counterparts as mentioned before, in the presence or absence of SOD and catalase expression vectors (Irani, supra). The effect of ROS production by overexpression of Rac clones (dominant positive isoforms) on cell division and the progression through the cell cycle will be assessed using Bromodeoxyuridine (BrdU) and [³H] thymidine incorporation. Bromodeoxy-uridine is a uridine derivative that can be incorporated into DNA in place of thymidine in those cells synthesizing DNA. Anti-Brdu monoclonal antibody (Becton Dickinson

Immunocytometry System) will be used to identify cells that undergo DNA synthesis. The proportion of cells in S-phase of the cell cycle can be determined either by fluorescence microscopy or by flow cytometric analysis according to the manufacturer's protocols. Relative [³H] thymidine incorporation in the transiently -transfected cells will be assessed as well, serum-starved cells will be incubated with [³H] thymidine (1 μCi/ml) for 4 hours then lysed with trichloroacetic acid (TCA) and TCA-precipitable materials are measured as mentioned in Irani, supra.

EXAMPLE 9

The effect of the expression of ZM-Rac isoforms on apoptosis There is increasing evidence that vascular smooth muscle cell (VSMC) apoptosis is involved in the pathogenesis of atherosclerosis and restenosis (Bennett, et al. , J. Clin. Invest. 95:2266-2274, 1995; Inser, et al , Circulation 91 , 2703-2711 ; Geng, et al , Am. J. Pathol. 147: 251-266, 1995; and Han, et. al , Am. J. Pathol 147:267-277, 1995). In a present study by Von Harsdorf (Li, et al , FEBS. Lett. 404: 249-252, 1997), they examined the role of ROS in the induction of VSMC apoptosis. They employed Go/G, an enzymatic system that produces H₂O₂ (Kwak_j et al. Proc. Natl. Acad. Sci. USA 92:4582-4586, 1995) to treat cultured rat VSMCs and DEM that leads to the accumulation of ROS in the cell by reducing intracellular glutathione (Hug, et al. FEBS Lett. 351 :311-313, 1994). The results showed that Go/G and DEM led to VSMC death. Administration of catalase, superoxide dismutase and deferoxamine revealed that H₂O₂ exerted its effect by formation of hydroxyl radical (.OH).

To study the effect of ROS production by overexpression of Rac isoforms (dominant-positive) on apoptosis NIH 3T3 cells will be transiently transfected with dominant positive or dominant negative Rac isoforms. Cells that will have the active Rac isoforms will be cotransfected with SOD or Catalaze expression vectors to see if that blocks or heightens the apoptosis process. While not to limited by any single theory, it is suggested that superoxide dismutase and catalase promote proliferation and growth, while .OH could increase apoptosis. Transfectants will be checked for apoptosis using DNA laddering-fragmentation assay, TUNEL assay and Annexin V staining (Guido, et al , Am J. Pathol. 146:3-8, 1995; Gorczyca, et al , Cancer Res. 53: 1945-1951, 1993; Martin, et al. Exp. Med. 182:1545-1556, 1995). The cleavage of the nuclear protein poly(ADP) polymerase, gelsolin and lamin that are responsible for the morphological changes in cells will be checked as well (Sakahira, et al , Nature. 391 :96-99, 1998, Kothakota, et al , Science. 278:294-298, 1997).

EXAMPLE 10

The Affect of Rac Expression on the Reorganization of the Actin Cytoskeleton

Microinjection of Racl^V12 into fibroblasts induces membrane ruffling activity, a process that requires the reorganization of the actin cytoskeleton. (Ridley et al, Cell 70, 401-410 (1992)) Therefore, the experiment was performed to find out whether activated ZmRac could induce a similar response in Swiss 3T3 cells. Cells were transfected with ZmRacs (dominate -positive) or Racl^vι2 and stained with FITC-phalloidin, in order to study actin organization. FITC-phalloidin assay: Cells were fixed with 4% formaldehyde in PBS for 10 min, permeabilized with 0.1 % Triton X-100 in PBS for 10 min, stained with 0.66 μM FITC-Phalloidin (Molecular Probes, Eugene, OR), rinsed with PBS, mounted, and examined with a Nikon Eclipse 800 fluorescence microscope, at an excitation of 580 nm. (Crawford, et al. , J. Biol. Chem. 271, 26863-26867 (1996), and herein incorporated by reference).

Racl ^V12, and ZmRac B, C, and D, all induced membrane ruffles. ZmRac A (dominate-positive) had no detectable effect on membrane ruffling.

Ruffle formation results from both de novo polymerization of actin filaments and reorganization of existing filaments at the cell edge, resulting in liquid phase pinocytosis. The Alexa-568-labeled actin incorporation into cells transfected with the plasmids encoding Racl or its maize homologues was measured using a flow cytometry assay. Actin turnover assay: Cells were rinsed with buffer (20mM HEPES, pH 7.5, 138 mM KCl, 4mM MgCl₂, 3 mM EGTA), then incubated with the same buffer supplemented with 0.2% saponin and 1 μM Alexa-568-Actin (Molecular Probes, Eugene, OR), for 5 min, at room temperature ( Symons, et al, J. Cell Biol. 114, 503-513 (1991), and herein incorporated by reference). Then cells were gently rinsed with HEPES, treated with 0.25% Trypsin-EDTA for 3 min, then Trypsin Inhibiting Solution (Clonetics, San Diego, CA) was added in amounts sufficient to block Trypsin activity. The resuspended cells were analyzed in FACS Calibur flow cytometer (Beckton Dickinson Immunocytometry Systems, San Jose, CA).

It was found that Rac ^VI2 and activated ZmRac B, C, and D induced G-actin incorporation, while ZmRac A (dominant-positive) had no detectable effect on actin incorporation. The dominant negative isoforms of ZmRacs and Racl^N17 had no significant effect on actin uptake or ruffle formation. Lack of effect of ZmRac A (dominate-positive) on actin incorporation was consistent with its inability to induce membrane ruffling which requires actin re-organization.

Swiss 3T3 transiently transfected with the activated ZmRac isoforms, as well as their dominant negative counterparts, showed no significant differences in [³H] thymidine incorporation. The rate of apoptosis of cells transfected with ZmRacs was not altered either, as assessed by TUNEL assay and Annexin V staining. (Guido, et al. , Am J Pathol 146: 3-8, 1995 (1995), Gorczyca, et al. Cancer Res. 53, 1945-1951 (1993), Martin, et al , J. Exp. Med. 182, 1545-1556 (1995)). Although not intending to be limited by theory, the results suggest that activated ZmRac A and ZmRac D can be used as strong activators of the oxidative burst and to promote the defense response of cells against infectious agents. Furthermore, the structure of the Rac gene has been highly conserved throughout evolution, such that a maize Rac gene product is capable of regulating the generation of superoxide in mammalian cells. This effect of Rac seems remarkably conserved, and suggests that the Rac binding domain of superoxide generating enzyme complex must be also highly conserved. Other functions of Racs, such as the regulation of the actin cytoskeleton appear more selective. The results also support that the G2 region (amino acids 26-45), which is highly conserved between plants and animals, could be essential for ROS production. In contrast it was not found that the insert region (amino acids 124-135) was needed for ROS generation, nor actin regulation. This region is not conserved in plant Racs, and therefore, does not seem to be required for ROS production. This observation confirms data obtained with a reconstituted system in vitro, where the insert region was found to be expandable for ROS production. However, other domains of Rac, and in particular the positively charged amino acids, Histidine 103 and Lysine 166, shown to be important for NADPH oxidase activation in vitro, are conserved in Racl and ZmRacs, although, Histidine 103 of ZmRac C is replaced with the positively charged amino acid Arginine. These conserved amino acids appeared to have a synergistic effect with the G2 region for ROS production. (Martin, et al, Biochemistry 37, 7147-7156 (1998)).

The above examples are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims. All publications, patents, and patent applications cited herein are indicative of the level of those skilled in the art to which this invention pertains. All publications, patents, and patent applications are hereby incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

Claims

WHAT IS CLAIMED IS:

1. A method of providing an animal with a protein comprising: introducing animal cells into an animal, said cells having been treated in vitro to insert therein a plant Rac polynucleotide, said cells expressing in vivo in said animal a therapeutically effective amount of said Rac protein.

2. The method of claim 1, wherein the animal is a mouse.

3. The method of claim 1, wherein the animal is a human.

4. The method of claim 1 , wherein the polynucleotide is selected from:

(a) a polynucleotide encoding a polypeptide selected from SEQ ID NOS: 2, 4, 6, 8, 10, 16, 18, 29, 22, 24, 26, 28, 30, 32, and 34;

(b) a polynucleotide having at least 64% identity to a polynucleotide selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(c) a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having the sequence selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(d) a polynucleotide amplified from a Zea mays nucleic acid library using primers which selectively hybridize, under stringent hybridization conditions, to loci within a polynucleotide selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33; (e) a polynucleotide selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19,

21, 23, 25, 27, 29, 31, and 33;

(f) a polynucleotide encoding a maize Rac polypeptide; and (h) a polynucleotide which is complementary to a polynucleotide of (a) through (g).

5. The method of claim 1 , wherein the Rac polynucleotide is in the dominant positive form.

6. The method of claim 5, wherein the Rac polynucleotide is selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23.

7. A method of treating a patient to prevent infection comprising the steps of: a) obtaining a bone marrow sample; b) transforming the bone marrow sample with a plant Rac polynucleotide; c) administering by intravenous infusion to said patient an amount of said bone marrow sample effective to treat the infection 8. The method of claim 7, wherein the Rac polynucleotide is selected from:

(a) a polynucleotide encoding a polypeptide selected from SEQ ID NOS: 2, 4, 6,

8, 10, 16, 18, 29, 22, 24, 26, 28, 30, 32, and 34;

(c) a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having the sequence selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(d) a polynucleotide amplified from a Zea mays nucleic acid library using primers which selectively hybridize, under stringent hybridization conditions, to loci within a polynucleotide selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31 , and 33; (e) a polynucleotide selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19,

21 , 23, 25, 27, 29, 31, and 33;

(f) a polynucleotide encoding a maize Rac polypeptide; and

(g) a polynucleotide which is complementary to a polynucleotide of (a) through (f).

9. The method of claim 7, wherein the Rac polynucleotide is in the dominant positive form.

10. The method of claim 9, wherein the Rac polynucleotide is selected from the group consisting of SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23.

11. A method for preventing reperfusion injuries, said method comprising transfecting tissue at the site of injury with a Rac polynucleotide and inducing expression of said Rac polynucleotide for a time sufficient to prevent reperfusion injuries.

12. The method of claim 11 , wherein the Rac polynucleotide is selected from

(b) a polynucleotide having at least 64% identity to a polynucleotide selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19. 21, 23, 25, 27, 29, 31, and 33; (c) a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having the sequence selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(d) a polynucleotide amplified from a Zea mays nucleic acid library using primers which selectively hybridize, under stringent hybridization conditions, to loci within a polynucleotide selected from SEQ ID NOS: 1 , 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(e) a polynucleotide selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33; (f) a polynucleotide encoding a maize Rac polypeptide; and

13. The method of claim 11 , wherein the Rac polynucleotide is in the dominant negative form.

14. The method of claim 5, wherein the Rac polynucleotide is selected from

SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33.

15. A method of preventing blood vessel damage said method comprising transfecting tissue at the site of injury with a Rac polynucleotide and inducing expression of said Rac polynucleotide for a time sufficient to prevent blood vessel damage.

16. The method of claim 15, wherein the Rac polynucleotide is selected from

(d) a polynucleotide amplified from a Zea mays nucleic acid library using primers which selectively hybridize, under stringent hybridization conditions, to loci within a polynucleotide selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33; (e) a polynucleotide selected from SEQ ID NOS: 1, 3, 5, 7, 9, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33;

(f) a polynucleotide encoding a maize Rac polypeptide; and

17. The method of claim 15, wherein the Rac polynucleotide is in the dominant negative form.

18. The method of claim 17, wherein the Rac polynucleotide is selected from SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33.