WO2000014256A1

WO2000014256A1 - Gene therapy for treatment of cancer

Info

Publication number: WO2000014256A1
Application number: PCT/US1999/018834
Authority: WO
Inventors: Mitchell S. Steiner; Yi Lu
Original assignee: Genotherapeutics, Inc.
Priority date: 1998-09-04
Filing date: 1999-09-03
Publication date: 2000-03-16
Also published as: AU5778399A

Abstract

This invention provides a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the E1 and E3 region of the genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450, cytochrome 3A4 p450, or NADPH cytochrome p450 reductase under the control of a Rous Sarcoma Virus promoter. This invention provides a method of inducing chemotoxicity of a tumor cell comprising, transfecting the tumor cell with the replication-deficient adenovirus type 5 expression vectors and therafter a prodrug, whereby the cells are selectively killed, thereby inducing chemotoxicity of the tumor cell. This invention provides a method of treating a subject with cancer comprising administering to the subject a therapeutically effective amount of: a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vectors; and a prodrug, or a vector comprising a nucleic acid encoding a prodrug, and suitable carrier or diluent, whereby tumor cells of the subject are selectively killed, thereby treating the subject with cancer.

Description

GENE THERAPY FOR TREATMENT OF CANCER

FIELD OF ΪNVENTΪON This invention provides a method for treating a subject with cancer and a method of inducing chemotoxicity of a tumor cell using adenovirus expression vectors comprising nucleic acid encoding cytochrome 2C9 ρ450, and nucleic acid encoding NADPH cytochrome p450 reductase m combination with a prodrug; or adenovirus expression vectors comprising nucleic acid encoding cytochrome 3 A4 p450, nucleic acid encoding NADPH cytochrome p450 reductase in combmation with a prodrug, under the control of a Rous Sarcoma Virus promoter, so as to selectively kill the cells.

BACKGROUND OF THE INVENTION

An estimated 317,000 new cases of prostate cancer will be diagnosed and over 45,000 prostate cancer deaths will occur this year in the United Stales making it the most frequently diagnosed and second leading cause of cancer mortality in men Deaths from prostate cancer are increasing every year by 2%-3% because fewer men are dying from cardiovascular disease (Walsh, 1 94). Unfortunately, the age-specific mortality rate for prostate cancer continues to rise in spite of earlier detection by serum PSA or current prostate cancer treatment modalities. Moreover, at the time of diagnosis the majority of men will have prostate cancer for which there is no cure and the prognosis is dismal. The standard method of treatment for the past 50 years has been castration, surgical or chemical, but the pαostate cancer eventually becomes androgen-independent, resumes growth, and kills the patient (Walsh. 1994; Carter et al., 1990). Clearly, better androgen blockade is not the answer for treating prostate cancer. Rather, treatment efforts should focus on novel therapeutic strategies against prostate cancer

Currently there is no effective chemotherapeutic agent against advanced prostate cancer.

It is not that chemotherapy drugs themselves cannot kill prostate cancel- cells as cancer cells in culture can be completely eliminated if the drug concentration is high enough. The problem is that tire dose necessary to achieve cell death in culture is usually not attainable in the patient without unacceptable toxicity and even death

Cyclophosphamide (CPA) is a cell cycle independent alleviating agent and is widely used in the clinical management of avariety of human malignancies (Moore. 1991). CPAis a therapeutically inactive prodrug that must first be activated by liver cytochrome P450 (CYP) to achieve thei apeutic effects cancer patients (Figure 1 ) . The primary 4-hydroxy metabo hte is formed in the liver and equilibrates with the ring-opened aldophosphamide. This intermediate spontaneously decomposes to yield acrolein and the electrophilic phosphoramide mustaid, which exhibits the DNA cross-linking and cytotoxic effects associated with the parent drug (Sladek, 1988). The specific CYP enzymes designated CYP2B6. CYP3A4 (Chang et al. 1993), CYP2C9 and CYP2C18 (Chang et al, 1997) contribute to the metabolism of CPA m human liver. P450 CYP2C9 and CYP3A4 axe liver-specific enzymes which can also activate ifosfamide (IFA) and methylpropylchloronitrosourea (MPCNU) into active cytotoxic metabolites. More specifically, CPA and IFA are catalyzed by CYP2C9 and CYP3 A4 through hydroxylation into phosphoramide mustard, (Webei et al., 1993) an effective DNA alkylatmg agent capable of killing the dividing cells by terminating the DNA synthesis. MPCNU is also catalyzed by CYP2C9 through N-demethylation into propylchloroethyhiitrosourea. an active anti-cancer nitrosourea.

SUMMARY OF THE INVENTION

This invention provides a replication-deficient adenovirus expression vector which comprises an adenovirus genome having at least a deletion in an El and E3 region of the genome and an insertion within the region of a nuclei c acid encoding a cytochrome 2C9 p450 under the control of a Rous Sarcoma Virus promotei

This invention provides a replication-deficient adenovirus expression vector which comprises an adenovirus genome having at least a deletion in an El and E3 region of the genome and an msertion withm the region of a nucleic acid encoding a cytochrome 3 A4 p450 under the contiol of a Rous Sarcoma Virus promoter. This invention provides a rephcation-deficient adenovirus expression vector which comprises an adenovirus genome having at least a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a Rous Sarcoma Virus promoter.

This invention provides a method of inducing chemotoxicity of a tumor cell comprising the steps of, introducing to the cell ^■ 1 ) rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion m an El and E3 region of the genome and ∑in insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a promoter: and 2) a rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion in an El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter_, whereby the cell become selectively sensitized to a prodrug; and introducing a prodrug, which selectively kills the cell.

Tins invention provides a method of inducing chemotoxicity of a tumor cell comprising the steps of, introducing into the cell: 1) rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion m the El an E3 region of the genome and an insertion withm the region of a nucleic acid encoding a cytochrome 3A4 p450 under the control of a promoter, and 2) a replication-deficient adenovirus type 5 expression vectoi which comprises <m adenovirus genome having at least a deletion in the El and E3 region of the genome and an insertion withm the region of a nucleic acid encoding a NADPH cytochrome p450 reductase tinder the control of a promoter_, whereby the cell become selectively sensitized to a prodmg; and introducing a prodrug, which selectively kills the cell.

This invention provides a method of treating a subject with cancer comprising, administering to the subject a therapeutically effective amount of: 1) a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion m the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a promoter, and suitable earner or diluent; and 2) a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, and suitable carrier or diluent, whereby the cell become selectively sensitized to a prodrug; and administering to the subject a phaimaceutical composition comprising a therapeutically effective amount of a prodrug, or a vector comprising a nucleic acid encoding a prodrug, and suitable carrier oi diluent, which selectively kills the cells, thereby treating the subj ect with cancer.

This invention provides a method Of treating a subject with cancer comprising, administering to the subject a therapeutically effective amount of: 1) a phannaceutical composition comprising a replication-deficient adenovirus ty e 5 expression vector which comprises an adenovirus genome having at least a deletion in the El and E3 region of the genome and an msertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 under the control of a promoter, and suitable carrier or diluent; and 2) a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vectoi which comprises an adenovirus genome having at least a deleti on in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome ρ450 reductase undei the control of a promoter, and suitable carrier or diluent, whereby the cell become selectively sensitized to a prodrug; and administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a prodrug, or a vector comprising a nucleic acid encoding a prodmg, and suitable carrier or diluent, whereby tumor cells of the subject are selectively killed, thereby treating the subject with cancer

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Pathways of cytochrome P450-catalyzed cyclophosphamlde (CPA) metabolism.

Figures 2A-2G.

Schematic representation of adenoviral vectors: Ad5RSV-2C9, Ad5RSV-3 A4, and Ad5RS V-RED. The nucleic acid sequence of region A is set forth in Figure 11 A-l lC.

Figure 3. Northern blot analysis of PPC-1 cells transduced by Ad5RSV-2C9.

Figure 4. Cytotoxicity assay of PPC-1 cells transfected with Ad5RSV-2C9.

Figure 5. Cytotoxicity of cyclophosphamlde (CPA) in human lymplioblastoid cell line (AHH-1) and derivative cell line (H2C9) expressing CYP2C9.

The effect of CPA on cell survival was expressed as survival fraction, i.e. cell number in plates containing drug as a percentage of the drug free control. 0.1 mM sulfaphenazole (SPZ). CYP2C9 specific inhibitor, can completely block the cytotoxicity of CPA. ICD₅₀ for AHH-1 cell line is

3.92 mM, IC _JO for H2C9 cell line is 0 81 mM. All experiments were performed in triplicate.

Figure 6. Cytotoxicity of cyclophosphamide (CPA) in human lymplioblastoid cell line (AHH-1) in the absence or presence of 10 μM alpha- naphthoilavone (NP), a potent inhibitor of CYPlAl. The effect of CPA on cell survival was expressed as survival fraction, i.e. cell number in plates containing drug as a percentage of the drug free control. All experiments were performed in duplicate. Figure 7. CYP2C9 expressing cells (H2C9) mediate a bystander effect towards CYP2C9 negative cells (PPC-1) in the presence of CPA. PPC-1 cells were treated with CPA in the absence or presence of H2C9 cells. After 2 days co-mcubation, H2C9 cells were removed and PPC-1 cell survival was counted. All experiments were performed in triplicate.

Figure 8. 4'-hydroxydiclofenac formation in H2C9 cells. 4'-hydroxydiclofenac formation was measured at different concentration of diclofenac in the presence of 1 X 10⁶ H2C9 whole cells. Km and Vmax were analyzed by nonlinear regression using NONLIN program. Km is 6.16 μM and Vmax is 0.622 pmol/min/lO⁰ cell. AU experiments were performed four times.

Figure 9. The expression of CYP3A4 and RED in PPC-1 cells enhances cytotoxicity to CPA.

Figure 10. Nucleic acid sequence of Ad5RSV as shown in Figure 1.

Figures 11A-HC.

Figure 11A. Nucleic acid sequence of Ad5RSV2C9: Figure 1 IB Nucleic acid sequence of Ad5RSV3 A4;

Figure 1 lC. Nucleic acid sequence of AdSRSNRed.

DETAILED DESCRIPTION OF THE INVENTION

This invention provides a method of treating a subject with cancer and a method of inducing chemotoxicity of a tumor cell using adenovirus expression vectors encoding a cytochrome 2C9 p450, NADPH cytochrome p450 reductase and a prodrug; or adenovirus expression vectors encoding a cytochrome 3A4 p450, NADPH cytochrome p450 reductase and a prodrug, under the control of a Rous Sarcoma Virus promoter, whereby the cells are selectively killed. Also, this invention provides adenovirus expression vectors, or pharmaceutical compositions comprising the adenovirus expression vectors, encoding a cytochrome 2C9 p450, cytochrome 3A4 p450, or NADPH cytochrome p450 reductase under the control of a Rous Sarcoma Virus promoter.

An attractive concept for increasing the local concentration and improving the selectivity of cancer chemotherapy is tumor-specific activation of noncytotoxic prodrugs to active anticancer drugs by either endogenous 01 specifically introduced exogenous enzymes

(Anderson, 1994). Gene-directed enzyme prodrug therapy (GDEPT) is one such therapeutically attractive strategy, (Huber at al., 1991; Moolten, 1994) where a drug susceptibility gene or "suicide gene" is transferred to the tumor. This gene encodes an enzyme that can activate a nontoxic prodrug intratumorally, the released drug can then kill the tumor cells containing the drug susceptibility enzyme, together with cells in the surrounding vicinity, a process often referred to as a "bystander effect" (Kolberg, 1992)

Several methods for delivery of genes to the target tumor have been propose^ including retrovimses, adenoviruses, adeno-associated viruses, and physical methods such as posomes (Brenner. 1996).

The concept to use a cytochrome p450 2B1 enzyme to enhance cell kill by cyclophosphamlde (CPA) was first described by Chang et al. in 1993 In these experiments, they established that liver microsomal CYP2B 1 and CYP3A enzymes have the ab_ility to preferentially catalyze CPA and IFA suggesting that liver microsomal p450 inducing agents that target these enzymes might be used cancer to enhance drug activation and therapeutic efficacy (Chang et al., 1993). The human CYP2C subfamily comprises foui known members, CYP2C8, CYP2C9. CYP2C18, and CYP2C19. but CYP2C9 had the best activity profile to activate both CPA and IFA. CYP2C9 also accounts for a significant portion (-10%) of the total P450 content in human livei (Guengerich 1996). In fact, die low Km characteristics of CYP2C9 indicates that this particular cytochrome ρ450 enzyme may play tire primary role in the liver activation of CPA and IFA as plasma concentrations of 0.1-0.7 mM for CPA (Schulcr et al, 1991) and 0.2-1.2mM forIFA (Lewis et l , 1990; Benvenuto et al, 1992) are typically achieved for anticancei therapy. Hence, CYP2C9 can catalyze CPA oxidation at low Km value, compared to CYP2A6, 2B6, and 3A4, which are high Km forms (Chang et al, 1997). With low Km value, CYP2C9 will have hi gher catalytic activity when CPA concentration ^"~ is low. The more CPA is activated, the more cells will be killed. However, Chang et al. recently showed that, [9] CYP2C9 was showed to be a low V ax/low Km enzyme in catalyzing CPA, and CYP2C18 was found to be a high Vmax/higliKmcyclophosphamide 4-hydroxylase. CYP2C18 was most efficient in activating CPA among the four CYP2C subfamily members, as judged by the in vitro intrinsic clearance values calculated from Vmax/Km ratios. Nevertheless, if the availability of CPA at the tumor site is considered, CYP2C9, which has the low Km vaiue, may be still the first choice for GDEPT system. The ability of CYP2C9 to promote tumor cell death in these experiments corroborates this hypothesis.

In 1 94, Wei et al. reported using CYP2B1, a rat cytochrome p450 enzyme, for gene therapy of glioma (brain tumor gene therapy), and also have suggested that this approach may be used for other tumors as well. (Wei et al . 1994) In this study, rat C6 glioma cells, stably transfected by CYP2B 1 , became sensitive to the cytotoxic effects of CPA both in vitro and in vivo. The combination of CYP2B1 retro irus expressing producer cells (VPC) and CPA administered mtrathecally or intratumorally produces glioma tumor regression in murine brains (Wei et al, 1994). Wei et al. (1994) also remarked that the CYP2BI gene could be used as a conditional killing gene in cancer gene therapy by enhancmg the therapeutic effectiveness of CPA By this strategy, high levels of the cytotoxic metabolites would be generated withm the tumor itself with minimal levels of these toxic metabolites within other cells, hi another study, the 9L gliosarcoma cells were treated by ex vivo infection of CYP2B, .and these cells were subsequently inoculated subcutaneously into animals to produce tumors in vzvo. The tumors partially regressed following intrapeπtoneal injection of CPA (Chen et al., 1 95) Further work on 9L glios-arcoma cells demonstrated that CPA- nediated toxicity did not require cell to cell contact, thus, the activated drug can distribute the active drug metabolite to a wide area of the solid tumor (Chen et al. 1995). Chen et al. have suggested that tumor selection could be done with specific DNA regulatory sequences to direct expression CYP2B1 prodrug activity enzyme with tumor cells of specific tissue type (Chen 1995) Mano e et al. (1996) have employed both replication incompetent retroviral and adenoviral vectors contaming CYP2B1 gene together with CPA to treat malignant g omas. The retrovirus treatment with either construct ρMV7-p450 or virus producing cells pMV7-p450 (multiple mtratumoral injections with virus producing cells) followed by CPA treatment increased the survival of animals by approximately 5 days (Manome et al., 1996) The adenoviral vector used is Ad CMV-2B 1 virus with cytochrome CYP2B 1 driven by the CMV promoter cloned into El deleted portion of virus In vitro, a cytopathic effect is seen in 9L glioma cells only when an MOI of 500 is achieved with tumors shrinking to 85% of control at 100 M CPA and 5% of control at 1000 M CPA At an MOI of 100, tumor regression is only 85% of control at 700 M CPA and 55% of control at 1000 M CPA. Treatment of intracerebral 9L tumors with Ad.CMV-2B 1 m rats with 10^s pfu on day 4 and CPA on day 6 incieased median survival of rats to 23 days compared to 17 days for AdCMVβGal and 19 days for AdCMVβGal + CPA treated animals. A higher admimstered dose of 10° pfu does not result in any greater survival Manome et al. speculated that perhaps multiple or combined treatment with other genes like HSVt/tmay increase efficacy (Manome et al, 1 96)

Chen et al. (1996) have demonstrated that transduction of human breast cancer cells, MCF-7, with Ad.CMV-2Bl is feasible and renders MCF-7 cells sensitive to oxazaphosphoπne toxicity. In this study. MCF-7 cells aie mfected by Ad.CMV-2B 1 ex vivo, are inoculated into the subcutaneously into the flank, and are grown in nude mice Nude mice be∑mng Ad CMV-2B1 heated MCF-7 uimors had a 15 fold higher cytotoxicity following CPA treatment. Chen et al. (1996) also used tins same adenovirus construct to infect a panel of human cancer cells in vitro to show that the CPA/p4502B 1 gene therapy strategy may be applicable to other cancer cell lines MD A-MB2 1 , poorly differentiated breast cancer cell line (MOI 50; ImM CPA) had a S5% reduction; T98G, ghoblastoma cell line (MOI 50, ImM CPA) had a 25% reduction; and DU145 , prostate cancer cell line (MOI 50, ImM CPA) had a 90% reduction in cell number by 7 days in culture. These data suggest that Ad.CMV-2Bl may be widely useful as therapeutic vector for transfer of drug activating cytochrome p450 genes (Chen et al., 1996) Chen et al (1 96) also hypothesize that other cytochrome p450 genes may be used like CYP2B6. but whether it will present therapeutic benefit beyond CYP2B1 was not known.

One problem with CYP2B1 gene therapy is the lack of the necessary RED required for optimal cytochrome ρ450 activity. Chen et al (1 97) have shown that Ad.CMV-2Bl treatment of rat 9L gliosarcoma cells that have been stably transfected with RED have a greater sensitivity to CPA cytotoxicity than those cells that do were express RED. In vitro, stable coexpressionofRED and CYP2B1 followed by ImM CPA treatment results in a cell number reduction to 15% of control In contrast, those cells expressing CYP2B1 only treated with ImM CPA have only a 20-40% decrease in cell number relative to controls Ad.CMV-2Bl treatment of 9L gliosarcoma cells overexpressmg RED has a greater kill following CPA than in 9L gliosarcoma cells not overexpressmg RED (9L-R cells at MOI=200 followed by ImM CPA are 5% of control Vs 9L cells at MOI=200 followed by ImM CPA are 8% of controls). In vivo, 9L CYP2B1 cells or 9L CYP2B1 cells -i- RED overexpression were grown subcut,aneou$ly m Fischer 344 rats and treated with CPA The tumors were then excised from the animals 24 hours after CPA treatment, dispersed to give single cell suspensions, and plated on culture dishes. The analysis of the number of surviving tumor cells that formed colonies showed that CPA (100 mg/kg body weight) had induced up to a 5-10 fold greater killing of 9L CYP2B1 * RED tumor cells compared to 9L CYP2B 1 tumor cells

Chang et al. (1993) make an important point that not .all cytochrome p450 enzyme genes may be effective in gene therapy These enzymes have characteristically different Vmaxs and Kms which means the appropriate ρ450 for a particular cancer type may not be obvious. For example, one would expect CYP3A4 to preferentially catalyze IFA over CPA. CYP3A4 has a low Km of <1 and a high Km of 18. whereas CYP2B6 has a low Km of 88 and abighKm of 94 pmol pro uct/min/ g of prote (Chang et al., 1993). Yet in the model system. CYP3 A4 is effective in sensitizing prostate cancer cells to cell kill by CPA. Based on the enzyme characteristics of CYP3A4, this would not have been anticipated. Thus, the true abihty of a particulai p450 enzyme to sensitize the cell to cytotoxicity by CPA, IFA, or any prodrug is not obvious and requires experimental validation by both in vitro and in vivo testing. Thus, the advantage of transferring either ^~ CYP2C9 or CYP3A4 genes into cancer cells is that it can confer chemotoxicity to three prodrugs through two different cell-killing mechanisms. This strategy not only increases the efficiency and effectiveness of cytotoxicity rendered by one cytoablativc transgene, but it also reduces the chance of chemoresistance in tumor cells (since it is very unlikely that tumors resistant to nitrosoureas are also cross resistant to mtro en-mustard).

This invention provides a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a Rous Sarcoma Virus promoter.

The nucleic acid encoding cytochrome 2C9 p450, includes RNA cDNA. genomic DNA, fragments, isoenzymes, variants, mutants, alleles, synthetic forms, and mixed polymers. both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled m the art In one embodiment cytochrome 2C9 p450 nucleic acid sequence is set forth within Figure 11 A. The replication-deficient adenovirus type 5 expression vector which comprises cytochrome 2C9 p450 is designated as Ad5RSV2C9 and was deposited on August 27, 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd., Manassas \ A 20110 having ATCC Accession Number VR-2628.

This invention provides areplication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome havmg at least a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a cytochrome 3 A4 p450 under the control of a Rous Sarcoma Virus promoter

The nucleic acid encoding cytochrome 3 A4 p450. includes RNA, cDNA, genomic DNA, fragments, isoenzymes, variants, mutants, allcles, synthetic forms, and mixed polymers, both sense and antisense strands, and may bε chemically oi biochemically modified or may contain non-natural or deπvatized nucleotide bases, as will be 1 eadily appreciated by ^~ those skilled the ait. In one embodiment cytochrome 3A4p450 nucleic acid sequence is set forth within Figure 1 IB. The replication-deficient adenovirus type 5 expression vector which comprises cytochrome 3A4 p450 is designated as Ad5RSV3A4 and was deposited on August 27, 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd , Manassas VA 20110 having ATCC Accession Number VR-2629

Tins invention provides a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having at least a deletion m the El and E3 region of the genome and an msertion withm the region of a nucleic acid encoding a NADPH cytochiome p450 reductase undei the contiol of a Rous Sarcoma Virus promoter

The nucleic acid encoding cytochrome NADPH p450. includes RNA. cDNA, genomic DNA, fragments, isoenzymes. variants, mutants, alleles. synthetic forms, and mixed polymers, both sense and annsense strands, and may be chemically or biochemically modified or may contain non-natural or denvatized nucleotide bases, as will be readily appreciated by those skilled m the art. In one embodiment cytochrome NADPH p450 nucleic acid sequence is set forth within Figure 11C The replication-deficient adenovirus type 5 expression vector which comprises cytochrome NADPH ρ450 is designated as AdSRSVRed and was deposited on August 27. 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd Manassas VA 20110 havmg ATCC Accession Numb ei VR-2630

To obtam adenovirus: 15 cm plates with 293 cells were set up wich used 30 15 cm plates per production When the cells are 70-80% confluent they are ready to be mfected with adenovirus The infection media is D2 (DMEM with 2% heat inactivated fetal calf serum). Generally , 1 μl of adenovirus stock per 15 cm plate was used The virus is generally at a titrc of 10¹⁰ p.f.u /ml while there are approximately 10⁷ p.f.u /plate Therefore, the M.O.I. (multiplicity of infection) is 1. Thaw the adenovirus immediately before use and dilute such that there is lμl of the adenovirus preparation per 5 ml of D2. Remove the media from the plates and add 5 mis of infection media containing the adenovirus. Incubate ^~ plates in a humidified atmosphere for 1 5 hours at 37 °C, 5% C0₂. Plates should be very slowly and gently rocked every 15 min so that the media covers all parts of the plate. After 90 min. add 20 ml of D10 (DMEM with 10% heat inactivated fetal calf serum, 2mM glutamine) to each plate and mcubate at 37°C. The cells are ready to harvest when they show cytopathic effect (CPE has a rounded appearance) and start to detach from the plate. The cells will also appear as "grape-hke clusters". This rounding of cells begins after approximately 24 hours of infection and is fully developed after 36-48 hours, depending upon the initial amount of virus added. Within this time range, the cells should be harvested. If CPE is evident before 24 hours, the CPE could be due to the effect of viral proteins. Detach the cells by pipetting fluid and cells up and down using a 25 ml pipet (collect all cells because virus is mostly intracellular) and collect m 50 ml disposable polypropylene tubes. The cells are collected by centrifugation (table top centrifuge) at 1.500 rpm for 10 min at 4°C. Resuspend the pelleted cells m a total of 5 ml of the supernatant for every 20 plates and transfer the resuspended cells to 2059 Falcon tubes. Treat the remaining supernatant with Clorox before discarding down tire sink as it is a biohazard. Freeze/thaw the cells 5X in order to lyse the cells and release the virus, vortexing between each freeze/thaw cycle. Use dry ice and a 37 °C water-bath to cycle through freezing and thawing. Remove cell debus from crude viral lysate by centrifugation using either of the two procedures indicated below: 2059 Falcon tubes can be cenlnfuged. using adapters, at 7.000 rpm in a Sorvall HS4 rotor at 4 °C for 5 min or (b) If you have a Beckman SW40 ultracentrifuge lotor. Spin at 7,000 rpm at 4°C for 5 min. Recover the viral supernatant and bring the volume to 5.0 ml ( for SW 41) or 5.2 ml (foi SW 40) with sterile phosphate buffered saline (PBS). To purify the virus, prepare ultra- clear SW 40 or SW41 tubes (Beclσnan) by soalαng the tubes in 95% ETOH followed by sterile H₂0 or PBS and remove all the liquid. The first ultracentrifugation will involve pelleting of the adenovirus onto a CsCl cushion Depending on the rotor used, the cushions are to be made as indicated below. The different density CsCl solutions can be made using PBS It is easier to use ultra-clear tubes for the remaining centrifugation steps, as it is easier to view the adenoviral band Component SW41 SW40 —

SW28

CsCl (density 1.25g/ml) 2 5ml 3.0ml 9.0ml

CsCl (density 1 40g/ml) 2.5ml 3.0ml 9 0ml

Viral lysate 4.25ml 5.0ml 15ml

The CsCl cushions are made by placing the lower density CsCl solution (density of 1.25g/ml) in the centrifuge tube first, then the higher density and finally the viral lysate which sits on top The CsCl solutions are made in 1 O M TRIS-HCL pH 7.4, 1 mM MgCl₂ or PBS as follows:

Densitv Amount of solid CsCl Volume of solution

1.25 27 g 73 ml

1.33 34 g 66 ml

1.40 39 g 61 ml

The density can be checked by weighing 1 ml of the CsCl solution.

Overlay the cleared viral lysate from step 12 using a sterile 2.5 ml pipet. This is accurate enough to ensure that the tubes are balanced. Alternatively, the weight of each tube can be detemiined and the tubes can be balanced. The tubes are then ccntrifuged as follows depending upon the rotor that is used:

SW41 rotor - 35,000 rpm for 60 min at 20°C (accelerationl/deceleration 4) SW40 rotor - 35,000 rpm for 60 mm at 20°C (brake off) SW28 rotoi - 25,000 rpm for 60 mm at 20^fiC

Collect the lower opalescent band (infectious adenovirus) with 3 ml syringe and 21 needle by side puncture. Clean tube with 95% ETOH prior to collection. It is sometimes easier to remove the empty capsid band first when this band is close to the infectious virus band. The second ultracentrifugatioπ step is a CsCl solution (density 1.33 g/ml). In a sterile washed centrifuge tube, add 8 ml of CsCl solution (density 1.33 g/ml) and overlay with the solution (band of infectious virus in 1 ml) fio the previous centrifugation step. Centrifuge as above except that the duration of time will be overnight. Balance carefully ^~ by weighing tubes. Recover the opsdescent adenoviral band as before. From this point forward, keep the solution at 4 ° C . Dialyze the adenoviral solution against 1 OrnM Tris pH 7.4, ImM MgC 10% (v/v) glycerol. The solution should be autoclaved prior to use to ensure sterility. The dialysis solution should be changed 3 times during the day after which time the adenovirus solution should be kept at -70 ° C (freeze on dry ice first). 50 μl and 100 μl aliquots are convenient for storage and subsequent use The number of viral particles can be estimated as follows: 1 A_M0 unit - 10¹² particles/ml. Generally, the ratio of particles to infectious units (pfu) is 100: 1.

293 cells is a human embryonic kidney cell line which has been transformed by DNA from adenovirus type 5; they can be obtained from ATCC (ATCC #crl573). The cells are grown in D10 (DMEM 10% heat inactivated fetal calf serum, 2mM glutamine, 4.5 g/L glucose. 50 units/ml penicillin and 50 μg/ml streptomycin). 293 cells must be handled carefully as they are sensitive and quite fragile: Avoid drying - aspirate media only when ready to immediately proceed to infection. Avoid cold temperatures - always use room temperature or 37 °C media Avoid excessive mechanical manipulation - 293 cells detach easily from the dish. Hence, to avoid loosening the cell monolayer, always add media to the side of a tilted dish. Avoid prolonged time out of the incubator - cells are quite sensitive to changes uipH. Use trypsin/vcrsene from Biowhittaker (cat. No 17-161E) as the cells are sensitive to the concentration of EDTA which differs from company to company. Do not allow cells to become overconfluent as they lift easily from the plate. Do not split cells to far ( no more than 1 :4). Avoid passaging cells loo many times as they will begin to behave abnormally.

To purify adenovirus from high titre vims : Thaw virus and dilute by Vi with TE (use same batch of TE for entire procedure: lOmM Tris-HCl, ImM EDTA pH 7.4). Add SDS to final concentration of 0 5% (w/v). [0.5% x sample vol. (μl)]/20% = vol of 20% SDS to add (μl). Ad proteinase K to 500 μg/ml final concentration [500 μg/ml x sample vol (μl)] / 10,000 μg/ml *= vol of 10 mg/ml Protemase K to add (μl). Incubate 37°C for 2 hours to overnight (O/N). Phenol extract with buffer saturated phenol (pH 8 ,0) to remove SDS and protein. Keep top phase (aqueous). Phenol/chloroform isoamyl alcohol (24:24:1) ^~ extract (buffer saturated, pH 8.0) Keep aqueous phase Chloroform/isoamyl alcohol (24:1) extract. Keep aqueous phase. Ether extract ( water saturated petroleum ether). Discard top phase (ether). Leave open tube in 37°C heating block for 30 min to allow evaporation of ether. Purify DNA by ultracentrifugation m a Centπcon 30 unit. Assemble unit as described in manual. Load DNA into upper chamber, fill tube to 2 ml with TE and centrifuge in fixed angle rotor at 3000 x g, RT, 30 mm ( 5000 rpm m SS34 or JA20 rotors). Fill to 2 ml with TE and repeat procedure Recover DNA by inverting upper collection chamber, inserting into collection cup and centrifugation m table top centrifuge (RT, 3000 rpm, and 2 mm) Measure volume and increase to at least 100 μl with TE. Check optical Density at 260, 280 rrm (2 μl) and calculate concentr tion. Store DNA at 4°C

This invention provides a replication-deficient adenov s type 5 expression vector which comprises an adenovirus genome havmg at least a deletion in the El and E3 region of the genome and an insei tion withm the region of a nucleic acid encoding a cytochrome 2C9 p450 and anucleic acid encoding aNADPH cytochiome p450 reductase under the control of a Rous S.arcoma virus promoter

This invention provides a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome havmg a deletion in the El andE3 region of the genome and an insertion within the region of anucleic acid encoding a cytochrome 3A4 p450 and a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a Rous Sarcoma virus promoter.

h another embodiment the Rous Sarcoma Virus promoter is a sequence of 395 nucleic acids which is set forth m SEQ ID NO: 1. As defined herein the 395 nucleic acid Rous Sarcoma Virus promoter" has a nucleic acid sequence as follows: CGATGTACGGGCCAGATATACGCGTATCTGAGGGGACTAGGGTGTGTTTAGG CGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCC TCAGGATATAGTAGTTTCGC TTTTGCATAGCCAGGGGGAAATGTAGTCTTATGCAATACACTTGTAGTCTTGCAACATGGT AACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGG ^"~

TGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACAGGTCTGACATGGA

TTGGACGAACCACTGAATTCCGCATTGCAGAGATAATTGTATTTAAGTGCCTAGCTCGAT

ACAATAAACG CCATTTGACCATTCACCACA TTGGTGTGCA CCTCC (SEQ ID NO :1 ).

The nucleic acid may be cDNA or genomic DNA. Further the vector may comprise a polyadenylation signal, such as an S V40 polyadenyl tion signal. In another embodiment the vector may comprise a selectable marker. Examples of selectable markers include but are not limited to beta galactosidase or beta lactamase.

Such modifications of cytochrome p450 2C9, cytochrome ρ450 3A4, cytochrome NADPH reductase include, for example, labels, ethylation. substitution of one or more of the naturally occurring nucleotides wit an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates. phosphotriesters,phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorofhioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g , acridine, psoralen, etc.), chelators, alleviators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).

Also included are synthetic molecules that mimic nucleotides m their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such mol ecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages hi the backbone of the molecule, substantially homologous to primary structural sequence but which include, e.g.. in vivo or in vitro chemical and biochemical modifications or which uicorporate unusual ammo acids. The nucleic acid may be modified. Such modifications include, for example, acetylation, carboxylation, phosphorylation. glycosylation, ubiqmtmation. labeling, e.g., with radionuclides. and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as sup ^3JP. hgands which bind to labeled ntiligands (e.g., antibodies), fluorophores, chemilumiiiescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled Ugand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available ^"~ instrumentation. Besides substantially full-length cytochrome 2C9 p450, cytochrome 3A4 p450 or NADPH p450 reductase, the present invention provides for biologically active fragments of the cytochrome 2C9 ρ450 and NADPH p450 reductase or cytochrome 3A4 ρ450 and NADPH p450 reductase which are known to those skilled in the art-

A "nucleic acid" refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridin or cytidrne; "RNA molecules") or deoxyribonucleosides (deoxy adenosine, deoxy guanosine, deoxythymidine, or deoxycytidine; "DNA molecules") in either single stranded form, or a double-stranded helix Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i. e. , the strand having a sequence homologous to the mRNA) . A "recombinant DNA" is a DNA that has undergone a molecular biological manipulation.

Mutations can be made in anucleic acid encoding cytochrome 2C9 p450. cytochrome 3A4 p450 and NADPH p450 reductase such that a nucleotide is changed which maintains tumor suppressor function but changes the sequence. Such a mutation is generally made by making the fewest nucleotide changes possible A substitution mutation of this sort can be made to change an ammo acid m the resulting protein in a non-conservative manner (i.e., by changing the codon fiom an ammo acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (i.e.. by changing die codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping). Such a conservative change generally leads to less ^~ change in the structure and function of the resulting protein. A non-conservative change is more likely to alter the structure, activity or function of the resulting protein. The present invention should be considered to include sequences containing conservative changes winch do not significantly alter the activity or binding characteristics of the resulting protein.

Synthetic DNA sequences allow convenient construction of genes which will express analogs or "muteins" . A general method for site-specific incorporation of unnatural amino acids into proteins is described in Noren, et al. Science, 244: 182-188 (April 1989). This method may be used to create analogs with unnatural amino acids.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill ofthe art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R M., ed. (1994)]; "Cell Biology. A Laboratory Handbook" Volumes I-III [J. E. Celis. ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (MJ. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgms eds. (1985)]: "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds (1984)]; ".Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]: B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

This invention provides for a replicable vector comprising the isolated nucleic acid molecule ofthe RNA or DNA virus. The vector includes, but is not limited to: aplasmid. cosmid, λ phage or yeast artificial chromosome (YAC) which contains at least a portion ofthe isolated nucleic acid molecule As an example to obtain these vectors, insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then ligated together with DNA ligase. Alternatively, linkers can be ligated to the insert DNA which correspond to a restriction site in the vector DNA. which is then digested with the restriction enzyme ^~ which cuts at that site. Other means are also available and known to an ordinary skilled practitioner.

Regulatory elements i equired for expression include promoter or enhancer sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter and for transcription initiation the Shine-Dalgamo sequence and the start codon AUG. Similaily. a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylati on signal, the start codon AUG. and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or assembled from the sequences described by methods well- known in the art. for example the methods described above for constructing vectors in geneial. Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in class) c studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.

The term "vector" , refers to viral expression systems, autonomous self-rephcating circular DNA (plasmids), and includes both expression and nonexpression plasmids Where a recombinant microorganism or cell culture is described as hosting an "expression vector." this includes both extrachromosomal circular DNA and DNA thai has been incorporated into the host chromosome(s). Where a vector is being maintained by a host cell, the vector may cither be stably replicated by the cells during mitosis as an autonomous structure, or is incorporated withm the host's genome

Expression vectors which can be used other than adenovirus include, but are not limited to the following vectors or their derivatives, human or animal viruses such as vaccinia virus or swinepox virus, pox virus, herpes simplex virus, baculovirus. adeno-associated virus, retrovirus, cytomegalovirus, mouse mammary tumor virus (MMTN), lentivirus, ^~~ Moloney murine leukemia virus and plasmid and cosmid DΝA vectors, 3 dimensional DΝA structures which case the p450 genes to name but a few.

Vectors are introduced into the desired host cells by methods known in the art, e.g. , ex vivo viral vectors, particularly retroviral vectors, in vivo viral vectors, particularly defective viral vectors or adeno-associated virus vectors, transfection. electroporation, micromjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DΝA vector transporter (see, e.g. , U.S. Patent No. 5,580,859, which is incorporated by reference and Wu et al., 1992. J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624; Hartmut et al, Canadian Patent Application No. 2,012,311, filed March 15, 1990). Such vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (HSV), papillomavfrus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses. which entirely or almost entirely lack viral genes, are preferred Defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Thus, a solid tumor can be specifically targeted. Examples of particular vectors include, but are not limited to, a defective herpes virus 1 (HSVl) vector (Kaplitt et al., 1991, Molec. Cell. Neurosci. 2:320-330), an attenuated adenovirus vector, such as the vector described by Siratford-Pemcaudet et al. (1992, J. Clin. Invest. 90:626-630). and a defective adeno-associated virus vector (Samulski et al, 1987. J. Virol. 61:3096-3101; Samulski et al., 1989, J. Virol. 63:3822-3828).

In another embodiment the gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346: Mann et al., 1983, Cell 33:153; Temin et al , U.S. Patent No. 4,650,764, Temin et al., U.S. Patent No. 4,980,289: Markowitz et al., 1988, J. Virol 62:1120: Temin et al., U.S. Patent No. 5,124,263; International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al.; and Kuo etal., 1993, Blood 8 :845. Retroviral vectors are especially attractive for transfecting solid tumors, since the cells of the rumor are replicating.

Alternatively, the vector can be introduced in vitro or in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner, et. al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417; see Mackey, et al., 1988, Proc. Natl Acad. Sci. U.S.A. 85:8027-8031)). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Feigner andRingold, 1 89, Science 337:387- 388). The use of lipofection to introduce exogenous genes into the specific organs in vivo has cerrain practical advantages. Molecular targeting of liposomes to specific cells, in tins instance tumor cells, e.g., via tumor-specific cell surface receptors, represents one area of benefit. Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey, et. al. , 1988, supra). Targeted peptides, e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically .

It is also possible to introduce the vector ex vivo or in vivo as a naked DNA plasmid.

Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, micromjection, transductioii, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, U.S. Patent No. 5,580,859, the contents of which are hereby incorporated by reference and e.g. , Wu et al., 1992, J.

Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621-14624;

Hartmut et al., Canadian Patent Application No. 2,012.311, filed March 15, 1990). The term "pi asinid" refers to an autonomous circular DNA molecule capable of replication in a cell, and includes both the expression and nonexpression types . Where a recombinant microorganism or cell culture is described as hosting an "expression plasmid", this includes latent vnal DNA integrated into the host chromosome(s). Where a plasmid is being maintained by a host cell, the plasmid is either being stably replicated by the cells during mitosis as an autonomous structure or is incorporated withm the host's genome.

"Substantial identity" or "substantial sequence identity" mean that two sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap which share at least 65-99 percent sequence identity, share at least 75 percent sequence identity, share at least 80 percent sequence identity, share at least 90 percent sequence identity, preferably at least 95 percent sequence identity, more preferably at least 99 percent sequence identity or more. This invention contemplates a nucleic acid which has substantial sequence identity to a nucleic acid encoding cytochrome 2C9 p450 and NADPH p450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase.

The phrase "nucleic acid molecule encoding" refers to a nucleic acid molecule which directs the expression of a specific protein or peptide . The nucleic acid sequences include both the DNA strand sequence that is transcribed into R A and the RNA sequence that is translated into protein. The nucleic acid molecule include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons ofthe native sequence or sequences which may be introduced to provide codon preference in a specific host cell.

Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence m a host cell.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For pui"poses of defining the present invention, the promoter sequence is bounded at its 3' ^~~ tenrdnus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease Si), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dai arno sequences in addition to the -10 and -35 consensus sequences. Promoters which maybe employed in this mvention include but are not limited to: Mouse Mammary Tumor Virus (MMTV), Rous Sarcoma Vims (RSV). Prostate Specific Antigen (PSA), Prostate Specific Membrane Antigen (PSMA), and Probasm. The preferred embodiment is a Rous Sarcoma

promoter..

An "expression control sequence" is a DNA sequence that controls and regulates the transcripti on and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences m a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhanceis lack these specificities Promoters and enhancers are often overlapping and continguous . often seeming to have a very simdar modular organizauon.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and continguous, often seeming to have a very similar modular organization.

Below is a list of viral promoters, cellular enhancers and inducible enhancers that may be used in combination methods of treating a subject with cancer with the nucleic acid operatively linked to a a promoter. Enhancers, include but are not limited to the following: Immunoglobulin Heavy Chain, Immunoglobulin Light Chain, T-Cell Receptor, HLA DQ α and Dqβ, β-Interferon, Interleukin-2, lnterleukin-2 Receptor, MHC Class π 5κ^κ- MHC Class II HLA-DRα, Aciin, Muscle Creatine Kinase, Proalbumin (Transthyretin), Elastase I, Metallothionein, Collagenase. Albumin Gene, α-Fetoprotein, τ-Globin, c-fos. c-Ha-ras, Insulin, Neural Cell Adhesion Molecule (NCAM), αl-antirypole, 2B (TH2B) Histone, Muse or Type I Collagen, Glucose- Regulated Proteins (GRP94 and GRP78), Rat Growth Hormone, Human Serum Amyloid A (SAA), Troponin I (TN I), Platelet-Derived Growth Factor, Duchenne Muscular Dystrophy, SV40, Polyo a, Retroviruses, Papilloma Virus, Hepatitis B Virs, Human Immunodeficiency Virus. Cytomegalovirus, or Gibbon Ape Leukemia Virus.

Generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a unique helper cell tine, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham, et al., 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the E3 or both regions (Grahm and Prevec. 1991). In nature, adenovirus can package approximately 105% ofthe wild-type genome (Ghosh-Choudhury, et al. 1987), providing capacity for about 2 estra kB of DNA. Combined with die approximately 5.5 kB, or about 15% of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vectors backbone and is the source of vector-borne cytotoxicity. Also, the replication deficiency of the El deleted virus is incomplete. For example, leakage of virus gene expression has been observed with the currently available adenovirus vectors at high multiplicities of infection (Mulligan, 1993).

Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus Such cells include, e.g.. Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the preferred helper cell line is 293.

Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F, Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the method of the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is know, and it has historically been used for most constructions employing adenovirus as a vector. As contemplated buy this invention the adenovirus vector is replication defective and will not have an adenovirus El region. Thus, it will be most convenient to introduce the nucleic acid at the position from which the El coding sequences have been removed. In another embodiment, the nucleic acid encoding a transcription unit also may be inserted in lieu of the deleted E2, E2a. E2b, E3 region in E3 replacement vectors, or in the E4 region where a helper cell line or helper virus complements the E4 defect.

The phrase "therapeutically effective amount" is used herein to mean an amount equivalent to one (1) or greater oi (1 copy of cyctochrome 2C9 p450. cytochrome 3A4 p450, and NADPH cytochrome p450 reductase). A therapeutically effective amount of prodrug is in the range of 1 microgram to 10 grams per day In another embodiment die range is 10 micrograms - 5 grams pei day. In another embodiment the range is 1 milligram - 500 milligrams per day.

A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence The term "operatively linked" includes having an appropriate start signal (e.g., ATG) m front of the DNA sequence to be expressed and amtaining the correct reading frame to permit expression of the DNA sequence under the control of the expression contiol sequence and production ofthe desired product encoded by the DNA sequence. If a gene that one desires to insert into a reeombm.ant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front ofthe gene.

This invention provides a pharmaceutical composition which comprises the adenovirus vectors as heremabove described and a suitable earner or diluent

hi one embodiment the prodrug is cyclophosphamlde, isoenzymes. analogs and derivatives thereof. In another embodiment the prodrug is ifosfamide, isoenzymes, variants, analogs and derivatives thereof. In another embodiment the prodrug is methylpropylchloronitrosourea, isoenzymes, variants, analogs and derivatives thereof.

As used herein, the term "tumor cell" means a tissue that grows by cellular proliferation more rapidly than normal, e.g. , more lapidly than adjoining cells, or other cells in the tissue. Neoplastic cells continue to grow aftei growth stimuli cease. Generally, tumors represent or form a distinct mass of tissue The present invention relates to both types of tumors but is particularly valuable in the treatment of cancers.

In one embodiment the tumor cells arc selected from a group consisting of: melanoma, lymphoma; leukemia, and prostate, colorectal. pancreatic, breast brain, or gastric carcmoma Examples of tumois include but are not limited to- include sarcomas and carcinomas such as, but not limited to. ftbrosarcoma. myxosarcoma, lφosarcoma. chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothehosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothehoma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma. colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland c^cinoma. papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcmoma. renal cell carcmoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcmoma, Wilms' mmor, cervical cancer, germ mmor, non-small cell lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, brain, glioma, astrocytoma, medulloblastoma, craniopharyngio a, ependymoma, pmealoma. hemangioblastoma. acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma. In a preferred embodiment the tumor is a prostate.

This invention provides amethod of inducing chemotoxicity of a cell by: 1) introducing into the cell a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 ρ450 and a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter; wherein expression of said cytochiome 2C9 ρ450 and NADPH cytochrome ρ450 reductase by the cell activates cytotoxic metabolites, whereby the cell become selectively sensitized to a prodrug; and 2) contacting said tumor cells with the prodrug, whereby the cells are selectively killed, thereby inducing chemotoxicity ofthe cell.

This invention provides a metliod of mducing chemotoxicity of a cell by: 1) introducing into the cell a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region o the genome and an insertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 and a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter: wherein expression of said cytochrome 3 A4 p450 and NADPH cytochrome p450 reductase by the cell activates cytotoxic metabolites, whereby the cell become selectively sensitized to a prodrug; and 2) contacting said tumor cells with the prodrug. whereby the cells ate selectively killed, thereby inducing chemotoxicity ofthe cell.

As defined herein "inducing chemotoxicity" means that the prodrug enzyme itself activates _the prodrug into a cancer killing agent. The cell that made the prodrug enzyme and activated the prodrug into a toxic prodrug now dies, thus the combination prodrug enzyme and prodrug have induced chemotoxicity in a tumor cell that by itself would not be killed by either the prodrug enzyme or prodrug alone.

As defined herein "selective sensitivity" means that only those cells that make the prodrug enzyme have the capability to activate the prodmg and are consequently sensitized to the prodrug.

As defined herein "selectively killed" means that only the cells that make the prodrug enzyme and their neighboring cells that are close enough to come into contact with the activated prodrug will be killed when the prodrug is activated and liberated locally. Cells that do not come into contact with the activated prodrug because they are not located in _the vicinity ofthe cell that has the gene to make the prodrug enzyme will not be killed, thus the systemic effects of die activated prodrug are minimized.

This invention provides a method of inhibiting the growth of prostate cancer cells, comprising contacting the cells with an adenovirus vectors designated as Ad5RSV cytochrome 2C9 p450 and NADPH p450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase as hereinabove described.

This invention provides a method of mducing chem otoxicity of a tumor cell comprising the steps of, introducing into the cell a: replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a promoter; and a replication-deficient adenovirus type 5 expression vector which comprises an adenovmis genome having a deletion in the E 1 and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, whereby the cell become selectively sensitized to a prodmg, and a prodrug, whereby the cells are selectively killed, thereby inducing chemotoxicity ofthe tumor cell.

This invention provides a method of inducing chemotoxicity of a tumor cell comprising the steps of, introducing into the cell a: replication-deficient adenovirus type 5 expression vector winch comprises an adenovirus genome having a deletion m the El and E3 region o the genome and an insertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 t der the control of a promoter; and a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome ρ450 reductase under the control of a promoter, whereby the cell become selectively sensitized to a prodrug; and a prodrug, whereby the cells are selectively killed, thereby inducing chemotoxicity of the tumor cell.

The vector can be transcribed or introduced into the prostate cell in vitro by well-known methods, e.g., by injection (see. Kubo et al., 1988). or the vectors can be introduced directly into host cells by methods well known the art, which vaiy depending on the type of cellular host, including clectioporation; transduction, infection, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran. or other substances; microprojectile bombardment, lipofection. Other methods of introducing the vectors into die cell, such as transduction and infecting_, are known to those skilled m the art and are contemplated by this invention.

As demonstrated herein, CYP2C9 gene tiansfcr sensitizes cells to CPA toxicity. Colony forming assay of PPC-1 cells transiently transfected with Ad5RSV-2C9. To determine whether prostate cancer cells expressing CYP2C9 are sensitized to CPA cytotoxicity, PPC-1 cells were transiently transfected with CYP2C9 (Ad5RSV-2C9). Forty eight hours after transfection, the transfected and untiansfected control PPC-1 cells were incubated with CPA at various concentrations of CPA ranging from 0-2mM for 8 days. Figure 4 shows that with less than 1/1000 PPC-1 cells tr.ansfected. which would be equivalent to an MOI-0.001, PPC-1/ Ad5RSV-2C9 cells were 5% of control at 1.5mM and 2% of control at 2mM CPA. Interestingly, this degree of cytotoxicity cannot be accounted for by the transfection of 1/1000 cells with the CYP2C9 gene, thus, the bystander effect following transfection with Ad5RSV-2C9 was dramatic.

In certain embodiments, gene transfer may more easily be performed under ex vivo conditions. Ex vivo gene therapy refers to the isolation of cells from an .animal, the delivery of a nucleic acid into the cells, in vitro, and then the return ofthe modified cells backinto an animal. This may involve the surgical removal of tissue/organs from an animal or the pπmary culture of cells and tissues Anderson et al, U S. Pat. No. 5,399,346, and incorporated herein in its entirety, disclose ex vivo therapeutic methods

This invention provides a method of treating a subject with cancer comprising the following steps, administering to the subject a therapeutically effective amount of: a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome havmg a deletion in the E 1 and E3 region ofthe genome and .an insertion within the region of a nucleic acid encoding a cytoclrrome 2C9 ρ450 under the control of a promoter, and suitable carrier or diluent; and pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion withm the region of a nucleic acid encoding a NADPH cytochrome ρ450 reductase under the control of a promoter, and suitable carrier or diluent, whereby the cellbecome selectively sensitized to aprodnig; and administering to the subject apharmaceutical composition comprising a therapeutically effective amount of a prodrug, or a vector comprising a nucleic acid encoding a prodrug, and suitable earner or diluent, whereby tumor cells of the subject are selectively lulled, thereby treating the subject with cancer.

This invention provides a method of treating a subject with cancer comprising the following steps, administeπng to the subject a therapeutically effective amount of. a pharmaceutical composition comprising a replication-deficient adenovirus type 5 ^~ expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 under the contiol of a promoter, and suitable carrier or diluent, and a pharmaceutical composition comprismg a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an msertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, and suitable carrier or diluent, whereby the cell become selectively sensitized to a prodrug; and adinmistering to the subj ect a pharmaceutica composition comprising a therapeutically effective amount of a prodrug, or a vector comprismg a nucleic acid encoding a prodrug. and suitable earner or diluent, whereby tumor cells of the subject are selectively lulled, thereby treating the subject with cancer.

This invention provides a method of treating a subj ect with prostate cancer, compnεing: 1 ) administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising: A) a rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an msertion within the region of a nucleic acid encoding a nucleic acid encoding a cytochrome 2C9 p450 and a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of apromoter: wherein expression of said cytochrome 2C9 p450 and NADPH cytochrome p450 reductase by the cell activates cytotoxic metabolites, whereby the cell become selectively sensitized to a prodrug; andB) a suitable carrier or diluent, and 2) administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a prodaig or a vector comprismg a nucleic acid encoding a prodrug, whereby the cells are selectively killed, thereby treating the subject with prostate cancel".

This invention provides a metho d of treating a subj ect with pro state cancer, comprising: 1 ) admhiistering to the subject a therapeutically effective amount of a phamiaceutical composition comprising: A) a rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the E 1 and E3 region of the ^~ genome and an insertion within the region of a nucleic acid encoding a nucleic acid encoding a cytochrome 3A4 p450 and a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter; wherein expression of said cytochrome 3A4 p450 and NADPH cytochrome p450 reductase by the cell activates cytotoxic metabolites, whereby the cell become selectively sensitized to a prodrug; and B) a suitable carrier or diluent, and 2) administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a prodrug or a vector comprising a nucleic acid encoding aprodrug, whereby the cells are selectively killed, thereby treating the subj ect with prostate cancer.

The nucleic acid encoding cytochrome 2C9 p450, cytochrome 3A4 p450. or NADPH p450 reductase includes RNA, cDNA, genomic DNA, fragments, isoenzymes, variants, mutants, alleles, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. In one embodiment cytochrome 2C9 p450 nucleic acid sequence is set forth within Figure 11 A The replication-deficient adenovirus type 5 expression vector which comprises cytochrome 2C9 ρ450 is designated as Ad5RSV2C9 and was deposited on August 20, 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd., Manassas VA 20110. In one embodiment cytochrome 3A4 p450 nucleic acid sequence is set forth within Figure 11B. The replication-deficient adenovirus type 5 expression vector which comprises cytochrome 3A4 p4 0 is designated as Ad5RSV3A4 and was deposited on August 20, 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd.. Manassas VA 20110. In one embodiment cytochrome NADPH p450 nucleic acid sequence is set forth withm Figure llC. The replication-deficient adenovirus type 5 expression vector which comprises cytochrome NADPH ρ450 is designated as Ad5RSVRed and was deposited on August 20, 1998 with the American Type Culture Collection (ATCC) located at 10801 University Blvd , Manassas VA 20110. In one embodiment the prodrug is cyclophosphamide, isoenzymes , variants, analogs and ^"~ derivatives thereof. In another embodiment the prodrug is ifosfamide, isoenzymes, variants, analogs and derivatives thereof. In another embodiment the prodrug is methylpropylchlotonitrosourea. isoenzymes, variants, analogs and derivatives thereof.

As demonstrated herein, cytotoxicity of CPA in human lymphoblastoid cell line (AHH- 1 ) and derivative cell line (H2C9) expressing CYP2C : CYP2C9 positive (H2C9) and CYP2C9 negative (AHH-1) cells were cultured with various concentrations of CPA. Growth of H2C9 cells was inhibited in a concentration-dependent manner by CPA with an ICD₅₀ of 0.81 ( 0.02 mM) (Figure 5). CPA was significantly less cytotoxic to the non- CYP2C9 expressing parental control cells AHH-1 (ICD_S0 of 3.92 at 0.32 mM CPA). This finding is consistent with the requirement of P-450 metabolism to convert CPA to cytotoxic metabolites. The CYP dependent nature of this cytotoxicity was confirmed in experiments using the CYP2C9 specific inhibitor sulfaphenazole (SPZ), which fully blocked the cytotoxicity of CPA tow∑irds H2C9 cells (Figure 5) . In control experiments, sulfaphenazole has no effect on the cytotoxicity CPA to p arental AHH- 1 cells. The abihty of SPZ to protect H2C9 cells from CPA cytotoxicity demonstrated that the presence of a eatalytically active CYP2C9 enzyme could be used to elicit CPA chemosensitivity. However. Tienihc acid, a mechanism based inhibitor of CYP2C9. (Lopez-Garcia et al., 1994) had no influence on the cytotoxicity of CPA. High CPA concentrations led to decreased cell survival uiboth AHH-1 and H2C9 cells The fact that this cytotoxicity occurred in non-CYP2C9 expressing AHH-1 cells and could not be completed blocked by SPZ suggested that other oxidative enzymes were contributing to CPA cytotoxicity in these cells.

Both AHH-1 andH2C9 cells express CYPlAl (Crespi et al.. 1984: Crespi et al. 1985). AHH-1 cells were treated with CPA in the absence or presence of 10 μM alpha- naphthoflavone, a potent inhibitor of CYPlAl. As shown in Figure 6, alpha- naphthoflavone did not block die cytotoxicity of CPA to AHH-1 cells. These results suggested that CYP 1 Al is not capable of hydroxylating CPA. This is inconsistent with the study of Chang et al. (Chang et al, 1993). CYP3A4 gene transfer also sensitizes prostate cancer cells to CPA and coexpression of NADPH reductase enhances cell kill- To deteπrune whether coexpression of the NADPH reductase enhances cytotoxicity of CYP3 A4, PPC- 1 cells were transfected with CYP3 A4 and stable clones were selected by G418 and pooled. PPC- 1 -CYP3 A4 pooled cells were then transiently transfected with either NADPH reductase plasmid or control plasmid. After 48 hours, cells were incubated with various concentrations of CPA (0-2.5mM) for 8 days. By 2mM CPA, PPC-1-CYP3 A4 cell number was 47% of control cells, whereas PPC-1 -CYP3A4 cells transfected with NADPH reductase had a cell number that was 25% of control cells (Figure 9). Thus, NADPH reductase and CYP3 A4 coexpression enhanced cytotoxicity of CPA. Moreover, it appears that CYP2C9 is better than CYP3A4 in con ferring sensitivity to CPA as the non RED transfected CYP3 A4 cells had less cell kill than the CYP2C9 PPC-1 cells (compare Figure 9 to Figure 4 and 5).

The cytochrome 2C9 ρ450 and NADPH p450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase gene or fragment, where applicable, may be employed in gene therapy methods in order to increase the amount ofthe expression products of such genes m cancer cells. Such gene therapy is particularly appropriate for use in both cancerous and pre-cancerous cells, in which the level of cytochrome 2C9 p450 and NADPH p450 reductase or cytochrome 3 A4 p450 and NADPH p450 reductase is absent or diminished compared to normal cells. It may also be useful to increase the level of expression of a given cytochrome 2C9 ρ450 and NADPH p450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase gene even in those tumor cells in which the mutant gene is expressed at a "normal" level, but the gene product is not fully functional.

In an approach which combines biological and physical gene transfer methods, plasmid DNA of any size is combined withapolylysme-conjugated antibody specific to the adenovirus hexon protein, and the resulting complex is bound to an adenovirus vector. The trimoleculai complex is then used to infect cells. The adenovirus vector pennits efficient binding, intemalization, and degradation ofthe endosome before the coupled DNA is damaged. Liposome/DNA complexes have been shown to be capable of mediating direct in vivo gene transfer. While in standard liposome preparations the gene transfer process is nonspecific, localized in vivo uptake and expression have been reported in tumor deposits, for example, following direct m situ administration (Nabel, 1992). Receptor-mediated gene transfer, for example, is accomplished by the conjugation of DNA (usually in the form of covalently closed supercoiled plasmid) to a protein ligand via polylysine. Ligands are chosen on the basis of the presence ofthe corresponding ligand receptors on the cell surface of the target cell/tissue type.

Further, the vector may be administered in combination with other cytokines or gro th factors include but are not limited to: IFN γ or α, IFN-β; interleukin (IL) 1, IL-2, LL- 4, IL-6. IL-7, IL-12, tumor necrosis factor (TNF) α, TNF-β, granulocyte colony stimulating factor (G-CSF), granulocyte/macrophage CSF (GM-CSF); accessory- molecules, including members of the integrin superfamily and members of the Ig superfamily such as, but not limited to, LFA-1, LFA-3, CD22, and B7-1, B7-2, and ICAM-1 T cell costimulatory molecules

It is contemplated by this invention that cytochrome 2C9 ρ450 and NADPH ρ450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase replacement therapy could be used similarly in conjunction with chemo- or radiotherapeutic intervention. To inhibit prostate cell growth or to kill prostate cells, such as malignant or metastatic cells, using the methods and compositions of he present invention, one would contact a "target" cell with the expression vector and at least one DNA damaging agent In one embodiment the cell is contacted with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the vector and the other includes the DNA damaging agent. In anothei embodiment, treatment with the vector may precede or follow the DNA damaging agent treatment by intervals ranging from minutes to weeks. Protocols and methods are known to those skilled in the art. DNA damaging agents or factors are known to those skilled in the art and means any ^~ chemical compound or treatment method that induces DNA damage when applied to a cell. Such agents and factors include radiation and waves that induce DNA damage such as, gamm -irradiation, X-rays, UV-uxadiation, microwaves, electronic emissions, and the like. A variety of chemical compounds, also described as "chemotherapeutic agents", function to induce DNA damage, all of which are intended to be of use in the combined treatment methods disclosed herein. Chemotherapeutic agents contemplated to be of use, include, e.g.. adriamycin, 5-fluorouracil (5FU), etoposide (VP-16). camptothecin, actinomycin-D, mitomycin C, cisplatin (CDDP) and even hydrogen peroxide. The invention also encompasses the use of a combination of one or more DNA damaging agents, whether radiation-based or actual compounds, such as the use of X-rays with cisplatin or the use of cisplatin with etoposide.

Other neoplastic or toxic agents include but are not limited: 5-fluorouracil. methotrexate .and adriamycin which may be linked in each case to, for example, a cephalosporin (see WO-A94 01 137 and EP-A-0 382 411) or cephalosporin mustards (see EP-A-O 484 870). In each case the cephalosporin/toxic agent conjugate shows markedly reduced toxicity but can be converted to the active form by β-lactamase thus making it suitable for use as a prodrug in GDEPT. Other toxic agents can be linked to cephalosporins in a similar way. Other anti-cancer, anti-neoplastic, al ylating agents are known to those skilled in the art.

Prodrugs for use according to the present invention may thus be based on any compound showing a suitable chemotherapeutic effect Such chemotherapeutic agents are preferably anti-inflammatory, anti-viral or anti-cancer compounds, and more preferably cytotoxic compounds such as nitrogen mustard agents, antifolates, nucleoside analogs, the vinca alkaloids, the anthracyclines, die mimycins, the bleomycins, the cytotoxic nucleosides. the pteridine family of drugs, the podophyophyllotoxins, the sulfonylureas (as described in EP-A-0 222, 475) and low- molecular weight toxins such as the trichothecense and the colchic es. Particularly including doxorubicin, daunorubicin, aminopterin. methotrexate. taxol, methapterin, dichloromethotrexate, mitomycm C, porfir oycin, 5-fluorouracil, 6-mercaptopurine, cy_tosme arabinoside, podophyllotoxin, etoposide, melphalan. vinblastine, vincristine, desacetylvmblastine, tomoxiferen, toremiferene, hydrazide, leurosidme, vindesine, leurosine, trochothecene and dεsacetylcolchicine.

In another embodiment one may irradiate the localized tumor site with DNA damaging radiation such as X-rays, UV-light, gamma -rays or even microwaves. Alternatively, the tumor cells may be contacted with the DNA damaging agent by administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a DNA damaging compound such as, adriamycin, 5-fluorouracil, etoposide, camptothecin, actinomycin-D, mitomycin C, or more preferably, cisplatin The DNA damaging agent may be prepared and used as a combined therapeutic composition, or kit, by combining it with a cytochrome 2C9 ρ450 and NADPH p450 reductase or cytochrome 3A4 p450 and NADPH p450 reductase expression construct, as described above. Agents that directly cross-linlc nucleic acids, specifically DNA. are envisaged and are shown herein, to eventuate DNA damage leading to a synergistic antineoplastic combination. Agents such as cisplatin, and other DNA alkylating may be used. Cisplatin has been widely used to treat cancer, with efficacious doses used in clinical applications of 20 mg/m² for 5 days every three weeks for a total of three courses. Cisplatin is not absorbed orally and must tiierefore be delivered via injection intravenously, subcutaneously, intratumorally or intiapeπtoneally. Agents that damage DNA also include compounds that interfere with DNA replication, mitosis and chromosomal segregation. Such chemotherapeutic compounds include adriamycin. also known as doxombicm, etoposide, verapamil, podophyllotoxin, and the like. Widely used in a clinical setting for the treatment of neopl asms, those compounds are admuiistered through bolus mj ections intravenously at doses ranging from 25-75 mg/m² at 21 day mteivals for adriamycin, to 35-50 mg/m² for etoposide intravenously or double the intravenous dose oially

Agents that disrupt the synthesis and fidelity of nucleic acid precursors and subunits also lead to DNA damage. As such a number of nucleic acid precursors have been developed.

Particularly useful are agents that have undergone extensive testing .and are readily available. As such, agents such as 5-fluorouracil (5-FU), are preferentially used by ^~ neoplastic tissue, making this agent particularly useful for targeting to neoplastic cells. Although quite toxic, 5-FU, is applicable in a wide range of earners, including topical, however intravenous administration with doses ranging from 3 to 15 mg/kg/day being commonly used,

Other factors that cause DNA damage and have been used extensively include what are commonly known as gamma -rays, X-rays, and or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-hτadiation. It is most likely that all of these factors effect a broad range of damage DNA, on the precursors of DNA, the replication and repair of DNA. and the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 weeks), to single doses of 2000 to 6000 roentgens. Dosage ranges foi radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.

As used herein, "pharmaceutical composition" could mean therapeutically effective amounts of polypeptide products of the invention to ethei with suitable diluents. preservatives, solubihzers, emuisifiers, adjuvant and/or carriers A "therapeutically effective amount" as used herein refers to that amount which pi ovides a therapeutic effect for a given condition and administration regimen. Such compositions are liquids or lyophilized or otherwise dried formulations and include diluents of various buffer content (e.g.. Tris-HCl., acetate, phosphate). pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68. bile acid salts), solubilizing agents (e.g , glycerol. polyethylene glycerol), anti- oxidants (e.g.. ascorbic acid, sodiu metabisulfite), preservatives (e.g.. Thimerosal, benzyl alcohol, parabens), bulking substances or tonicity modifiers (e.g . lactose, mannitol), covalent attachment of polymers such as polyethylene glycol to the protein, complexation with metal ions, or mcorporation ofthe material into oi onto paiticulate preparations of polymeric compounds such as polylactic acid, polglycolic acid, hvdrogels, etc, or onto liposomes. microe ulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte ghosts, or spheroplasts. Other embodiments of the compositions of the invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral. In one embodiment the pharmaceutical composition is administered systemically, parenterally, mnatumorally, paracancerally, transmucosally, transdermally, mtram.uscul.ariy, intravenously, mtradermally, subcutaneously, inrraperitonealy, mtraventricularly , intracranially . In the preferred embodiment the prodrug is introduced systemically.

Further, as used herein "pharmaceutically acceptable carrier" are well known to those skilled m the art and include, but are not limited to, 0.01-O. lM and preferably 0.05M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non- aqueous solvents axe propylene glycol, polyetliylene glycol, vegetable oils such as olive oil. and in ectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteial vehicles include sodium chloride solution. Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intiavenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, collating agents, inert gases and the like.

The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adj uvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifϊcally enhances the immune response (Hood et al., Immunology, Second Ed , 1984. Benjamin/Cummings: Menlo Park. California, p. 384). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvant include, but are not limited to. complete Freund's adjuvant, incomplete Freund's adjuvant saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin. pluronic polyols, pofyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet ^"~ hemocyanins, dinitrophenol. Preferably, the adjuvant is pharmaceutically acceptable.

Controlled or sustained release compositions include formulation in lipophilic depots (e.g. fatty acids, waxes, oils). Also comprehended by the invention are paniculate compositions coated with polymers (e.g. poloxamerε or poloxamines) and the compound coupled to antibodies directed against tissue-specific receptors, ligands or antigens or coupled to ligands of tissue-specific receptors. Other embodiments ofthe compositions ofthe invention incorporate particulate forms protective coatings, protease inhibitors or permeation enhancers for various routes of administration, including parenteral, pulmonary, nasal and oral.

When administered, compounds are often cleared rapidly from mucosal surfaces or the circulation and may therefore elicit relatively short-lived pharmacological activity. Consequently, frequent administrations of relatively large doses of bioactive compounds may by required to sustain therapeutic efficacy. Compounds modified by the covalent attachment of water-soluble polymers such as polyethylene glycol, copolymers of polyethylene glycol and polypropylene glycoL carboxymethyl cellulose, dextran, polyvinyl alcohol, polyviiiylpyrrolidone or polyproline are known to exhibit substantially longer half-lives in blood following intravenous injection than do the corresponding unmodified compounds (Abuchowski et al., 1981; Newmar et al.. 1982; and Katre et al, 1987). Such modifications may also increase the compound's solubility in aqueous solution, eliminate aggregation, enhance the physical and chemical stability ofthe compound, and greatly reduce the immunogenicity and reactivity of the compound. As a result, the desired in vivo biological activity may be achieved by the administration of such polymer- compound abducts less frequently or in lower doses than with the unmodified compound.

Dosages. The sufficient amount may include but is not limited to from about 1 μg/kg to about 1000 g/kg. The amount may be 10 mg/kg. The pharmaceutically acceptable form ofthe composition includes a pharmaceutically acceptable carrier. The preparation of therapeutic compositions which contam an active component is well ^~~ understood in the art. Typically, such compositions aie prepared as an aerosol of the polypeptide delivered to the nasopharynx or as lnjeclables either as liquid solutions or suspensions, however, solid forms suitable for solution m. or suspension in, liquid prior to injection can also be prepared. The preparation can also be emulsified. The active theiapeutic ingredient is often mixed with excipients which .are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are. for example, water, saline, dextrose, glycerol. ethanol, or the like and combinauons thereof. In addition, if desired, the composition can contam minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient

An active component can be formulated into the therapeutic composition as neutralized pharmaceutically acceptable salt forms. Phaniiaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide or antibody molecule) and winch are formed with inorganic acids such as for example, hy drochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric. mandelic, and the like. Salts formed from the ft ee carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as lsopropylam e, tπmethyiannnc, 2-ethylammo ethanol. histidme. procaine, and the luce.

A composition comprising "A" (where "A" is a single protein. DNA molecule, vector, etc.) is substantially free of "B" (where "B" comprises one or more contaminating proteins, DNA molecules, vectors, etc ) when at least about 75% by weight of the proteins. DNA, vectors (depending on the category of species to which A and B belong) in the composition is ' A" Preferably. "A" comprises at least about 90% by weight ofthe A+B species m the composition most preferably at least about 99% by weight.

The term "umt dose" when used in reference to a therapeutic composition ofthe present invention refers to physically discrete units suitable as unitan dosage foi humans, each unit containing a predeteπnined quantity of active material calculated to produce the ^~ desired therapeutic effect in association with the required diluent; i. e.. carrier, or vehicle.

Several non-viral methods for the transfer of expression constructs to cultured mammalian cells also are contemplated by the present invention These include calcium phosphate precipitation (Graham and Van Der Eb, 1 73 : Chen and O ayama.1987; Rippe et al., 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al., 1986; Potter et al., 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al., 1979) and hpofecta inc-DNA complexes, cell sonication (Fechheimer et al.. 1987), gene bombardment using high velocity microprojectiles (Yang et al., 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use. Also, helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g. , Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the preferred helper cell line is 293

In another embodiment, the active compound can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat ei al.. in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York. pp. 353-365 (1989); Lopez-Berestein. ibid., pp 317-327: see generally ibid).

In yet another embodiment, the therapeutic compound can be dehveied in a controlled release system. For example, the polypeptide may be administered using intravenous infusion, an i plantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (see Langer, supra; Sefton. CRC Crit. Ref. Biomed. Eng. 14.201 (1987): Buchwald et al.. Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release. Langer and Wise (eds ), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug ^~ Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984), Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al.. Science 228-190 (1985); During et al.. Ann. Neurol 25:351 (1989): Howard et al., I. Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release system can be placed m proximity of he therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Preferably, a controlled release device is introduced into a subject in proximity of the site of inappropriate immune activation or a tumor. Other controlled release systems are discussed in tlte review by Langer (Science 249:1527-1533 (1990)).

As can be readily appreciated by one of ordinary skill m the art, the methods and pharmaceutical compositions of the present invention are particularly suited to admirristration to a mammal, preferable a human subject.

In the therapeutic methods and compositions of the invention, a therapeutically effective dosage ofthe active component is provided. A thexapeutically effective dosage can be determined by the ordinary skilled medical worker based on patient characteristics (age. weight, sex. condition, complications, other diseases, etc ). as is well known in the art. Furthermore, as further routine studies are conducted, more specific information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients. and the ordinary skilled worker, considering the therapeutic context, age and general health of the recipient, is able to ascertain proper dosing. Generally, for intravenous mjection or infusion, dosage may be lower than for intraperitoneal, intramuscular, or other route of administration. The dosing schedule may vary, depending on the circulation half-life, and the formulation used. The compositions are administered in a manner compatible with the dosage formulation in the therapeutically effective amount. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may lange from about 0.1 to 20, preferably about 0.5 to about 10. and more preferably one to several, milligrams of active ingredient per kilogram body weight of ^~ individual per day and depend on the route of administration. Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent mj ection or other administration. Alternatively, continuous intravenous infusion sufficient to maintain concentrations of ten nanomolar to ten micromolar in the blood are contemplated.

The present invention provides a kit comprising the all the essential materials and reagents required for inhibiting prostate tumor cell proliferation, transforming prostate cells or detecting prostate cancer cells, may be assembled together in a kit. This generally will comprise selected expression constructs. Also included may be various media for replication ofthe expression constructs and host cells for such replication. Such kits will comprise distinct containers for each individual reagent. When the components ofthe kit are provided in one or more liquid solutions, the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred For in vivo use, the expression construct may be formulated into a pharmaceutically acceptable syringeable composition. In this case, the container means may itself be an inhalent, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area ofthe body, such as the lungs, m ected to an animal, or even applied to and mixed with the other components ofthe kit. The components ofthe l it may also be provided m dried or lyophilized forms . When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.

The kits ofthe present invention also will typically include a means for containmg the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained. Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of die ultimate complex composition within the body of an animal. Such an instrument may be an inhalent, syringe, pipette, forceps, measured spoon, eye dropper or any such medically ^~ approved delivery vehicle.

The following examples are presented in order to more fully illustrate the preferred embodiments ofthe invention. They should in no way be construed, however, as limiting the broad scope o the invention.

EXPERIMENTAL DETAILS SECTION

MATERIALS AND METHODS

Chemicals. CPA, sulfaphenazole, diclofenac, isoxicam, alpha-naphtboflavone and all other reagents were purchased from Sigma Chemical Co. (St. Louis, MO). 4'- hydroxydiclofenac was purchased from Gentest Co. (Wobum. MA). Tienilic acid was kindly provided by Dr. Daniel Mansuy (Universite Rene Descartes, France). All materials were used as received from the manufacturer.

Cell lines and culture conditions. Dunning rat prostate cancer cell lines G and MATLyLu, andhuman prostate cancer cell lines LNCaP,DU145, PPC-1 and TSU-Pr (all from ATCC, Rockville, MD) were grown mRPMI 1640 medium (Cellgro. Hemdon. VA) containing 10% heat mactivated fetal bovine serum (FBS) (Hyclone, Logan, Utah), 100 units/ml penicillin, 100 mg/ml streptomycin. NIH-3T3 cell fine and 293, an adeno virus- ckaging cell line. (ATCC) were grown in high glucose Dulbeccos modified essential medium (DMEM) (Cellgro) containing 10% heat inactivated FBS. 100 units/ml penicillm, 100 mg/ml streptomycin. The human lymphoblastoid cell line (AHH-1) which does not express the cytochrome P450 2C9 (CYP2C9) enzyme was grown as a suspension culture in RPM1 1640 medium containing 2 mM L-glutamine supplemented with 9% horse sermn. AHH-1 cells stably u-ansfecied with a cDNA encoding CYP2C9 (Rettie et al.. 1994) (hereafter referred to asH2C9) were grown under identical conditions with additional 2 mM L-histidinol to maintain selection. The AHH- 1 and H2C9 cell lines were purchased from Gentest Co. (Wobu , MA). All cell lines were maintained at 37°C ^~ in 5% C0₂.

Cytotoxicity Assay. AHH-1 and H2C9 cells were plated in 96-well microtiter plates at a density of 2500 cells/well and incubated at 37 °C. Six hours later, cells were treated with different concentrations (0.01 to 4 mM) of CPA Cells were preincubated with or without 100 μM sulfaphenazole, a CYP2C9 specific inhibitor, (Pond et al, 1997; Mancy et al., 1996) two hours before treatment with CPA. Cultures were incubated for an additional 2 days at 37 * C . [³H] thymidine (1 μCi/well) was added to the cells for the final 18 hours of incubation. Cells were then harvested onto filter paper using a 12-well h_<arvester (Brandel M-12, Biomedical Research and Development Laboratories Inc.. Gaithersburg, MD). Filter discs were removed from the cell harvester and placed in glass vials containing 5 ml of EcoLite PlusTM scintillation cocktail (ICN Biomedical, Costa Mesa, CA). Radioactivity was counted in a liquid scintillation counter (Model L56800, Becknian Instruments Inc. Fullerton, CA). Ten μM alpha-naphthoflavone (NP), a potent inhibitor of CYPl l, (Girrtoo et al., 1979) w∑is also used in an attempt to protect AHH-1 cells from CPA cytotoxicity. Tntiatedthj'midineincorpoiation s a percentage of control (no drug treatment) was plotted versus CPA concentration and the ICD₅₀ (the CPA concentration required to inhibit thymidine incorporation by 50%) was determined by computer-fitted using a FORTRAN subroutine written for NONLIN (SCI Software, Lexington, KY).

Bystander effect assay. PPC-1 cells were plated in 96-well plates at a density of 1000 cells/well and incubated at 37 °C Fifteen hours later, H2C9 cells were added at a density of 1 X 10 ^ά cells/well. After another 4 hours incubation, cells were treated with different concentrations (8 μM to 3.2 mM) of CPA. Cells were incubated for an additional 54 hours and then washed once with fresh RPMI 1640 medium to remove suspended H2C9 cells. Incubation was continued for 18 hours at 37 ° C in RPMI 1640 medium containing [³H] thymidine (1 μCi/well). The cells were detached by 0.25% Trypsin without EDTA, and harvested onto filter paper using the cell harvester, and radioactivity was determined as described above for cytotoxicity assays. PPC-1 cells treated with different concentrations of CPA in the absence of H2C9 cells were used as control. All ^— experiments were performed m triplicate

Determination of CYP2C9 Activity in Whole Cell. Diclofenac 4'-hydroxylation was determined at different incubation time (5-120 minutes) and different total cell concentration (1.25 X 10⁶ - 2 X 10⁷ cell/ml) to establish the linear r.ange for 4'- hydroxydiclofenac formation. AHH- 1 or H2C9 cells were grown and maintained in 75 cm 2 culture flasks as described above On the morning of the experiment, cells were centrifuged for 5 mm at 1 ,000 g in a refrigerated centrifuge (Centra-MV4R, International Equipment Company, Needham, MA). Cell pellets were resuspended in phosphate buffered saline, centrifuged again, and then resuspended in 0.1 M Tris buffer (pH 7,5) at a density of 1 X 10⁷ cells/ml. An aliquot (100 μl) ofthe cell suspension was mixed with 100 μl of a buffered solution containing diclofenac (final concentrations range from 1 μM to 1 mM). The drug containing cell suspension was vortexed and incubated at 37 °C in a water bath for 45 minutes. Reactions were stopped by adding 40 μl of ice-cold 6% glacial acetic acid in acetonitrile, and 20 μl of 50 μg/ml isoxicam (internal standard). The mixture was vortexed and centrifuged at 1.000 g for 2 minutes in a icrocentrifuge (Savant Speedfuge, HSC 10K, Instruments Inc., Farmingdale. NY). The supernatant was transferred to a small tube and a 150 μl aliquot was used for quantitation. An HPLC metliod for 4'-hydroxydiclofenac and isoxicam was developed based on the method of Leemann (Leemann et al., 1993). Briefly, samples were injected directly onto a C18 reversed-phase column (Waters Nova-Pak 3 9 X 150 mm, 3 micro particle size, Waters Corp., Milford, MA). The mobile phase (0.5% formic acid in a 40:60 mixture of acetonitrile and deiomzed water) was delivered at 1.0 ml/min (Waters Model 510, Waters Corp. , Milford. MA) and the column effluent was monitored using a variable wavelength UV detector (Model 481, Waters Corp., Milford. MA) set at 280 nm. The peak height ofthe analytes was measured using commercially available software MULTICHROM program. The retention times for 4'-hydroxydiclofenac and isoxicam were 5.8 minutes and 9.5 minutes respectively. Diclofenac eluted at 18.5 minutes and did not interfere with quantitation ofthe other analytes. Kinetic parameters describing the rate of metabolism were determined from plots ofthe initial rate of 4'-hydroxydιclofenac formation versus diclofenac concentration. Specifically, d e maximal rate of 4'-hydroxydiclofenac formation ^~" Vmax and Michaelis-Menten constant Km were calculated using a FORTRAN subroutine and NONLIN computer program.

Construction of recombinant replication deficient adenoviral vectors: Ad RSV-2C9,

Ad RSV-3A4, and Ad5RSV-RED. The following adenoviral type 5 vectors with deleted El and E3 regions were constructed using an upstream RSV promoter: Ad RSV- 2C9, Ad RSV-3A4, and Ad5RSV-RED. These human genes (CYP2C9, CYP3A4, or NADPH cytochrome P450 reductase) were subcloned under the control of RSV promoter mto an E1/E3 deleted adenoviral shuttle vector. The resultant adenovir^ shuttle vector was cotransfected into 293 cells with pJM17, (McGrory et al., 1987) an adenoviral type 5 genome plasmid, by calcium phosphate method (Kingston et al.. 1993) to generate a replication-deficient adenovirus type 5 containing El /E3 deleted regions. RSV promoter, full-length sense CYP2C9, CYP3A4, or NADPH reductase cDNA, and a SV40 polyadenylation signal (Figure 2). Individual plaques were screened by PCR using specific primers for both the RSV promoter and transgene sequences. Individual clones of adenoviral vectors were obtained by twice plaque purification. Adenoviral vector expressing coli β-galactosidase gene (Ad5RSVlacZ) was similarly constructed as an adenoviral vector control. Single viral clones were propagated in 293 cells. The culture medium ofthe 293 cells showing the completed cytopathic effect (CPE) was collected and adenovirus was purified and concentrated by twice CsCl, gradient ultracentrifugation. The titration and transduction of viruses λvere performed as previously described (Graham et al., 1991). DNA sequences o the adenoviral vectors are set forth in SEQ ID Nos: 1

Adenoviral transduction. The culture medium of he 293 cells showing the completed cytopathic effect was collected and centrifuged at l OOxg for 10 mm. The pooled supematants were aliquoted and stored at -70°C as viral stocks. The viral titers were determined by plaque assays as described. Infection ofthe cell lines was earned out by addition ofthe viral solutions (0.5 ml per 60-mm dish) to cell monolaycrs and incubation at room temperature for 30 min with brief agitation every 5 min. Next, culture medium was replaced with fresh standard medium and cells were placed in a 37°C incubator. Northern blot. Total RNA was isolated using RNeasy Total RNA Kit (Qiagen Inc., ^~ Chatsworth, CA) from culture cells according to the anufacturer's protocol. Total RNA (10 g/ lane) was loaded onto a 1.2% agarose- formaldehyde gel. After electrophoresis, the gel was transferred to nylonmembrane (Hybond-N⁺. Amersham Life Science, Buckinghamshire, England) (Lu et al, 1995) The cDNA probe for CYP2C9, CYP3A4, or NADPH cytochrome P450 reductase was ³²P -labeled by the random primer method (Pnme-It π Kit, Stratagene, La Jolla, C A) . The membrane was hybridized with these probes in Rapid-hyb buffer (Amersham Life Science, Bucl ngha shire, England) according to Manufacturer's protocol. The membrane was exposed to a Kodak X-ray film using intensifying screens at -80°C.

Enzyme activity assays. The functional enzymatic assay will be performed to determine the activity of CYP2C9 or CYP3A4 as described (Weber et l, 1993; Sandhuet l., 1993; Schnieder et al, 1996) Concentrations of CPA and its metabolites was etermined in cell culture medium collected during m vitro experiments and in pl sma collected durmg in vivo experiments. All analytical procedures are based on previously published methods (Evelo et al., 1986; Chen et al., 1995). The desired biological sample was collected in polypropylene or silanized glass tubes, and immediately treated extracted and/or derivatized. Blood samples were centrifuged at l,500g for 10 mm after collection, and the plasma fraction was analyzed 30 ml of IFA (or CPA. as appropπatc) and 5 ml of ethyl acetate was be added to each sample. After shaking for 10 mm, the mixture was centrifuged at l,5Q0g for 10 mm. The supernatant was transferred to a clean tube and evaporated under a stream of nitrogen. The residue was derivatized with 100 ml of ethyl acetate and 50 ml of heptafluorobutyric anhydride and incubated at 70°C for 2 h. The derivatization solution was evaporated under a stream of nitrogen a second time and then reconstituted in 500 ml of ethyl acetate Samples were analyzed by gas chromatography/mass spectrometry (GC/MS) using a Hewlett-Packard 5790 gas chromatography and a model 5970 mass selective detector. A capillary column packed with cross-linked dimethyl sihconc (film thickness 0.3 mm, 16 m length, and 0.2 mm internal diameter) was used with a nitrogen flow of 1 5 ml/mm at a pressure of 5 psi. Injector and column temperatures were at 250 and 80°C, respectively Concentrations of CPA, phosphoramide mustard, and oraitrogenmustard was quantified by comparison of ^~ unlcnown samples to independently prepared standard curves. The rate of dιsappear.ance of CPA and the rate of appearance of metabolites was determined by nonlinear least squares estimation using the NLIN procedure of S AS (Statistical Analysis Software, Cary, NC).

Detection of transgene expression. Protein levels of CYP2C9 or CYP3A4 were determined by Western blot (Lu et al., 1995: Shimada et al , 1986) CYP2C9. CYP3A4 and NADPH cytochrome reductase mRNA levels were deteπ ned by Northern blot (Lu et al., 1 95). The functional enzymatic assay was performed to determine the activity of CYP2C9 or CYP3A4 as previously described (Sandhu et al , 1993, Weber et al., 1993). Concentrations of CPA and its metabolites in cell culture media collected during m vitro experiments and in plasma collected during m vivo experiments were measured (Chen et al., 1995; Evelo et al., 1986)

Evaluation of CYP2C9 or CYP3A4 followed by prodrug cytotoxic effects on prostate cancer cell lines in vitro and in vivo. Prostate cancer cell growth rate was determined by plating 1x10 cells into 60 mm cultui e dishes 24 h before viral infection. The cells (untreated, control adenoviral vector Ad5RSVLacZ, and Ad5RSV-2C9 or Ad5RSV-3A4) with or without Ad5RSV-RED were grown m medium contammg prodrug. The conditioned medium was used to measure prod g and activated drug concentrations. Cells were counted daily up to 8 days post infection In vivo studies, the antitumor effects o adenoviral vectors were tested rats bearing subcutaneous prostate tumois following prodrug treatment Tumor volume was measured as previously descπbed (Steiner ct al , 1 92)

RESULTS

CYP2C9 gene transfer by Ad5RSV-2C9- Prostate cancer cell lines PPC-1, PC3.

DU145, TSU-Pr, LNCaP, MATLyLu, and G were screened by Northern blot analysis for expression of endogenous CYP2C9 No CYP2C9 mRNA transcripts were detected suggesting that prostate cancer cells do not produce CYP2C9 Consequently, PPC- 1 cells were transduced with Ad5RSV-2C9 at an MOI of 200 Cells were harvested at 0, 24. and — 48 firs after infection. Total RNA was extracted and subjected to Northern blot analysis for CYP2C9 using a ³²P-labeled CYP2C9 cDNA The CYP2C9 transcript was clearly overexpressed in PPC-1 cells 48 hours after transduction with Ad5RSV-2C9 (Figure 3). The Northern blot was then stripped and reprobed with β-actin to normalize for RNA loading per lane (Figure 3). Thus, prostate cancer cells overproduce CYP2C9 following treatment with Ad5RSV-2C9.

CYP2C9 gene transfer sensitizes cells to CPA toxicity. Clonogenic assay of PPC-1 cells transiently transfected with Ad5RSV-2C9. To determine whether prostate cancer cells expressing CYP2C9 are sensitized to CPA cytotoxicity, PPC- 1 cells were transiently transfected with CYP2C9 (Ad5RSV-2C9). Forty eight horns after transfection, the transfected and untiansfected control PPC-1 cells were incubated with CPA at various concentrations of CPA ranging from 0-2mM for 8 days. Figure 4 shows that with less than 1/1000 PPC-1 cells transfected. which would be equivalent to anMOI=0.001₅ PPC- 1/ Ad5RSV-2C9 cells were 5% of control at 1 5mM and 2% of control at 2mM CPA. interestingly, this degree of cytotoxicity cannot be accounted for by the transfection of 1/ 1000 cells with the CYP2C9 gene, thus, the bystander effect following transfection with Ad5RSV-2C9 was dramatic.

Cytotoxicity of CPA in human lymphoblastoid cell line (AHH-1) and derivative cell line (H2C9) expressing CYP2C9: CYP2C9 positive (H2C9) and CYP2C9 negative (AHH-1) cells were cultured with various concentrations of CPA. Growth of H2C9 cells was inhibited m a concentration-dependent manner by CPA with an ICD₅₀ of 0 81 ( .02 mM) (Figure 5). CPA was significantly less cytotoxic to thenon-CYP2C9 expressingparental control cells AHH-1 (ICD₅₀ of 3,92 at 0 32 mM CPA). This finding is consistent with the requirement of P-450 metabolism to convert CPA to cytotoxic metabolites. The CYP dependent nature of this cytotoxicity was confirmed m experiments using the CYP2C9 specific inhibitor sulfaphenazole (SPZ), which fully blocked the cytotoxicity of CPA towards H2C9 cells (Figure 5). In control experiments, sulfaphenazole has no effect on the cytotoxicity CPA to parental AHH-1 cells The ability of SPZ to protect H2C9 cells from CPA cytotoxicity demonstrated that the presence of a catsύytically active CYP2C9 ^— enzyme could be used to elicit CPA chemo sensitivity However, Tienihc acid, a mechanism based inhibitor of CYP2C9, (Lopez-Garcia et al., 1994) had no influence on the cytotoxicity of CPA. High CPA concentrations led to decreased cell survival in both AHH-1 and H2C9 cells. The fact that this cytotoxicity occurred in non-CYP2C9 expressing AHH-1 cells and could not be completed blocked by SPZ suggested that other oxidative enzymes were contributing to CPA cytotoxicity in these cells.

Both AHH-1 and H2C9 cells express CYPlAl (Crespi et al, 1984: Crespi et al. 1985). WhetherCYPlAl can activate CPA was also tested. AHH-1 cells were treated with CPA in the absence or presence of 10 μM alpha-naphthoflavone. apotent inhibitor of CYP 1 Al . As shown in Figure 6, alpha-naphthoflavone did not block the cytotoxicity of CPA to AHH-1 cells. These results demonstrate that CYPlAl is not capable of hydroxylating CPA. This is m consistent with the study of Chang et al, (Chang et al, 1993).

Direct cell to cell contact not required for CYP2C9 gene transfer CPA cytotoxicity:

To test wh etiier H2C9 cells mediate a CP A-dependent bystander killing effect, mono layer- culture CYP2C9 negative prostate cancer cells (PPC- 1 ) and suspension-culture CYP2C9 positive cells (H2C9) were co-cultured (10-1). The mixed culture was then treated with various concentrations of CPA. As shown in Figure 7, H2C9 cells chemosensitized the adj acent CYP2C9 negative PPC-1 cells. PPC- 1 cells exhibited a sinking growth inhibition following treatment with CPA in the presence of H2C9 cells. Howevei, the majority (- 80%) of PPC-1 cells survived in the absence of H2C9 cells Moreover, H2C9 cells did not inhibit the growth of PPC-1 cells when both cells were co-cultured. These results indicated that CYP2C9 positive cells confer a bystander killing effect on adjacent CYP2C9 negative cells by a mechanism that involves CYP2C9 enzyme activity.

Kinetic analysis of CYP2C9 activity in whole cells: Experiments showed that 4'- hydroxydiclofenac formation was linear for up to 45 minutes in incub ations containing up to 5 X 10⁶ cells/ml. H2C9 cells quickly metabolized diclofenac, mdicatingthe presence of high levels of CYP2C9. The formation of 4'-hydroxydιclofenac can be totally blocked by sulfaphenazole. The reaction exhibited single enzyme Michaelis-Menten kinetics for diclofenac concentrations up to ImM. Mean Vmax and Km were demonstrated 0.012 pniol/mfn lO⁶ cells and 0 62 μM, respectively (Figure 8) These values are consistent with earlier studies (Sladek et al., 1988) that CYP2C9 is a low Km enzyme. Diclofenac 4'-hydroxylase activity was undetectable in AHH-1 cells, mdicatmg no detectable endogenous CYP2C9 enzyme activity.

CYP3A4 gene transfer also sensitizes prostate cancer cells to CPA and coexpression of NADPH reductase enhances cell kill: To determine whether coexpression of the NADPH reductase enhances cytotoxicity of CYP3 A4, PPC- 1 cells were transfected witli CYP3A4 and stable clones were selected by G418 and pooled PPC-1 -CYP3A4 pooled cells were then transiently transfected with either NADPH reductase plasmid or control phasmid. After 48 hours, cells were incubated with various concentrations of CPA (0- 2.5mM) for 8 days. By 2mM CPA, PPC-1-CYP3A4 cell number was 47% of control cells, whereas PPC- 1 -CYP3 A4 cells transfected with NADPH reductase had a cell number that was 25% of control cells (Figure 9). Thus. NADPH reductase and CYP3A4 coexpression enhanced cytotoxicity of CPA. Moreover, it appears that CYP2C9 is better than CYP3 A4 m conferring sensitivity to CPA as the non RED transfected CYP3 A4 cells had less cell kill than the CYP2C9 PPC-1 cells (compare Figure 9 to Figure 4 and 5).

Table 1, Cell line Cytochrome MOI (pfu) % of Control Concentration p450 of PA fmM)

9L rat glioma* AdCMV2Bl 100 55% 1

9L rat glioma* AdCMV2Bl 500 2% 1 DU 145 prostate* AdCMV2Bl 50 12% 1

PPC-1 prostate ¹ Ad5RSV2C9 0.001 5% 1.5

PPC-1 prostate ' Ad5RSV2C9 0.001 2% 2

References: * Manome ei al., 1996 , * Chen et al, 1996, and ^''^" Present study DISCUSSION ^~

In the present experiments. PPC- 1 cells transduced by Ad5RS V-2C9 had high expression of CYP2C9 mRNA. PPC-1 cells that were transfected with the same construct (Ad5RSV-2C9) at what would be an equivalent MOI of 0 001 followed by CPAresulted in a dramatic decrease in cell number. As shown in Table 1. Ad5RSV-2C9 construct is better than the AdCMV-2B 1 vector against cancer cells in vitro. This was true not only in 9L rat glioma cells, but also for this same construct in prostate cancer DU145 cells. One reason for a more pronounced CPA toxicity effect seen for Ad5RSV-2C9 compared to AdCMV-2Bl may be that the RSV promoter may be more active than the CMV promoter. Another reason may be that CYP2C9 is better than CYP2B1 in sensitizing ca cer cells to CPA. Again, this is not surprising as the activiti es of all cytochrome p450s are not the same Moreover, it also appears that the CYP2C9 gene may be even better than CYP3A4 for the activation of CPA.

The bystander effect was very prominent the Chen et al. ( 1996) study in which 9L rat glioma cells stably transfected with C YP2B 1 were mixed with untiansfected 9L rat glioma cells at a ratio of 1 : 1. This cell coculture treated with CPA results in an 80% cell kill. In this current study, PPC-1 cells were exposed to H2C9 cells at a 10:1 ratio followed by CPA treatment which reduced the cell number to 55% of control, hence, CYP2C9 appears to have a greater bystander effect than CYP2B 1. The mechanistic basis for the bystander lolling effect may involve intracellular transfer of activated soluble cytotoxic metabolic drug through cell-cell contact. This bystander effect has great therapeutic significance because only a subset of a tumor cell population can be effectively transferred with drug sensitive gene in a practical settuig. The limitation that all tumor cells must express the drug sensitive gene to eradicate a tumor can be overcome by this bystander effect (Crespi et al.. 1985; Freeman et al., 1993).

hi summary, transduction of tumor cells with a CPA-activatmg P450 gene CYP2C9 can sensitize the tumor cells to CPA. This sensitization is likely the results of CYP2C9 activation of CPA. Cells expressing CYP2C9 have a bystander effect on the adjacent non- CYP expressmg cells. Ad5RSV-2C9 vector has efficient transduction and expression of CYP2C9 in cancer cells. Therefore, the enzyme/prodrug system of CYP2C9 and prodrugs like CPA may be an effective combination for GDEPT. In addition, evidence that overexpression of RED augments cytochrome p450 activity and enhances the cytotoxicity of prodrugs is provided.

REFERENCES Anderson W F. Editorial: Gene therapy for cancer. Hum. Gene Ther., 5:1-2. 1994.

Benvenuto JA. Ayele W, Legha SS, Raber MN, Nicaise C, and Newan RA. Clinical pharmacokinetics of ifosfaniide in combination with N-acetylcysteme. Anti-Cancer Drugs, 3:19-23, 1992.

Brenner MK. Gene transfer and therapeutic drug monitoring. Ther. Drug Monit., 18:322-327, 1996.

Carter HB, Piantadosi S, and Isaacs JT. Clinical evidence for and implications of the multistep development of prostate cancer. J Urol, 143:742, 1990.

Chan KK. Hong PS, Tutsch K, and Trump DL Clinical pharmacokinetics of cyclopbosphamide and metabolites with and without SR-2508. Cancer Res., 54:6421- 6429, 1994.

Chang TKH. Yu L, Mantel P, and Waxman DJ. Enhanced cyclophosphamlde and lfosfamide activation in primary human bepatocyte cultures: Response to cytochrome P- 450 inducers and automduction by oxazapliosphoπnes Cancer Res., 57:1946-1954, 1997.

Chang TKH. Weber GF, Crespi CL, and Waxman DJ. Differential activation of cyclophosphamlde and lfosphamide by cytochromes P450 2B and 3A in human hver microsoiiies Cancer Res , 53:5629-5637, 1993

Chang TKH, Lu Y, Goldstein JA, and Waxman DJ. Identification of polymoiphically expressed CYP2C19 and the wild-type CYP2C9-ILE 359 allele as low-Km catalysts of cyclopbosphamide and lfosfamide activation. Pharmacogenetics, 7-211-221, 1997. Chang TKH, Weber GF, Crespi CL, and Waxman DJ. Differential activation of cyclophosphamlde and ifosphamide by cytochromes P-450 2B and 3A in human liver microsomes Cancer Res , 53:5629-5637, 1993.

Chen L. and Waxman DJ. Intiatumoral activation and enlianced chemotherapeutic effect of oxazaphosphorines following cytochrome P-450 gene transfer: Development of a combined chemotherapy/cancer gene therapy strategy. Cancer Res., 55:581-589, 1995.

Chen L, Waxman DJ, Chen D, and Kufe DW. Sensitization of human breast cancer cells to cyclophosphaniide and ifosfamide by transfer of a livei cytochrome P450 gene. Cancer Res., 56:1331-1340, 1996.

Chen L, Yu LJ, and Waxman DJ, Potentiation of cytochrome P450/cyclophosphamide- based cancer gene therapy by coexpression of P450 reductase gene Cancer Res , 57:4830-4837, 1997.

Chen TL, Passos-Coelho JL, Noe DA, Kennedy MJ. Black KC. Colvm M, and Grochow LB. Nonlinear pharmacokinetics of cyclophosphamide in patients with metastatic breast cancer receiving high-dose chemotherapy followed by autologous bone marrow transplantation. Cancer Res., 55:810-816, 1995.

Crespi CL, and Thilly WG- Assay for gene mutation inhuman lymphoblast line, AHH-1 , competent for xenobiotic metabolism. Mutat. Res., 128:221-230, 1984

Crespi CL,. Altman JF, and Maiietta MA. Xenobiotic metabolism and mutation in a human lymphoblastoid cell hne. Chem. Biol Interactions, 53:257-272, 1985.

Evelo CTA, Bos RP, Peters JGP, and Hederson PT. Urinary cyclophosphamide assay as a method for biological monitoring of occupational exposure to cyclophophamide. Int. Arch Occup. Environ Health. 58:151-155, 1986 Fisher CW, Shet MS, Caudle DL, Martin- Wixtiom CA, and Estabrook RW. High level expression in Escherichia coli of enzymatically active fusion proteins containing the domains of mammalian cytochromes P450 and NADPH-P450 reductase flavoprotein. Proc. Natl. Acad. Sci. USA, 89:10817-10821, 1992.

Freeman SM, Abbound CN, Whartenby KA, Packman CH, KoeplinDS, Moolten FL, and Abraham GN. Cancer Res., 53.5274-5283, 1993.

Graham FL, and Prevec L. Manipulation of Adenovirus Vectors. In: Murray E.L ed. Methods in Molecular Biology. Clifton, New Jersey: The Humana Press Inc., 7:ppl 09- 128, 1991.

Guengerich FP. In vitro techniques for studying drug metabolism. J. Pharmacold.net.

Biopharm., 24:521-533, 1996..

Gurtoo HL, Parker NB, Paigen B, Havens MB, Minowadw J, and Freedman HJ.

Induction, inhibition, and some enzymological properties of aryl hydrocarbon hydroxylase in fresh rajtogen-activated human. Cancer Res., 39:4620-4629, 1979.

Huber BE, Richards CA, Krenitsky TA. Retroviral-mediated gene therapy for the treatment of hepatocellular carcinoma: an innovative approach for cancer therapy. Proc.

Natl. Acad. Sci. USA, 88:8039-8043, 1991.

Kolberg R. Gene therapist test puzzling "bystander effect" [News], NIHRes., 4:68-74. 1992.

Leemann T, Transon C, and Dayer, P. Cytochrome P450TB (CYP2C): A major monooxygenase catalyzing diclofenac 4'-hydroxylation in human liver. Life Sci. , 52:29-34 1993. Lewis LD, Fitzgerald DL, Harper PG, and Rogers HJ Fractionated lfosfamide therapy produces a time-dependent increase in lfosfamide metabolism. Br. J Clin. Pharmacol, 30:725-732, 1990.

Lopez-Garcia, MP, Dansette PM, and Mansuy D. Thiophene deπvates as new mechanism-based inhibitors of cytochromes P-450: Inactivation of yeast-expressed human liver cytochrome P-450 2C9 by tienilic acid. Biochemistry, 33:166-175, 1994.

Lu Y, Whitaker L, Li X, Lolan D, and Lotan R. Coexpression of galectin-1 and its complementary glycoconjugates laminin and lysosome-associated membr. ne proteins mmuπnePCC4.azalRembryonal carcinoma cells induced to differentiation by butyrate Mol. Cell. Differ., 3:175-191, 1995.

Mancy A, Dijols S, Poli S , Guengerich FP, and Mansuy D. Interaction of sulfaphenazole derivatives witli human liver cytochromes P450 2C: Molecular origin of the specific inhibitory effects of sulfaphenazole on CYP2C9 and consequences for the substrate binding site topology of CYP2C9. Biochemistry, 35: 16205-16212, 1996.

Manome Y, WenPY, Chen L, Tanaka T, Dong Y, Yamazoe M, Hirshowitz A, Kufe DW, and Fine HA. Gene therapy for malignant ghomas using replication incompetent retroviral and adenoviral vectors encoding the cytochrome P450 2B1 gene together with cyclophosphamide. Gene Ther., 3:513-520, 1996.

MooltenFL. Drag sensitivity ("suicide") gene for selective cancer chemotiierapy Cancer Gene Ther., 1:279-287, 1994.

Moore ML Clinical pharmacokinetics of cyclophosphamide Clin. Pharmacokinet.. 20:194-208, 1991.

Morgan RA, Courure L, Eroy-Stem O, Ragheb J, Moss B, and Anderson WF. Retroviral vectors containing putative internal ribosome entry sites development of apolycistronic gene transfer system and applications to human gene therapy. Nucleic Acids Res., 20:1293-1299, 1992.

Pond SM, Brikett DJ, and Wade D N. Mechanism of inhibition of tolbutamide metabolis ^• phenylbutazone, oxyphenbutazone. sulfaphenazole. Clin. Pharmacol. Ther., 22:573-579, 1977.

Ren S. Yang J-S, Kalhom TF, Slattery JT. Oxidation of cyclophosphamide to 4- hydroxycyclophosplramide and deschlorothylcyclophosphamide in human liver mcrosomes. Cancer Res , 57:4229-4235, 1997.

Rettie AE, Wienkers LC, Gonzalez FJ, Trager WF, and Korzekwa, KR. Impaired (S)- warfaπn metabohsm catalysed by the R144C allelic variant of CYP2C9. Pharmacogenetics 4:39-42, 1994

SandhuP,BabaT, andGuengerichFP. Expression ofmodιfiedcytochroroeP4502C10 (2C9) in Escherichia coh, purification, and reconstitution of catalytic activity. Arch. Biochem. Biophys , 306:443-450, 1993.

Schneider A, Schmalix WA, Siruguri V, de Gioene EM, Horbach GJ, Kleingeist B, Lang D, Booker R. Belloc C. Beaune P, Greim H, and Doehmer J Stable expression of hum a cytochrome P450 3A4 in conjunction with human NADPH-cytochrome P450 oxidoreductase in V79 Chinese hamster cells Arch Biochem Biophys.. 332:295-304, 1996.

Schuler U, Waidelich P. Kolb H, Wagner T, and Ehmnger G Pharmacolcmetics and metabolism of cyclophosphamide administered after total body irradiation of bone marrow transplant recipients. Eur J Clin. Pharmacol., 40:521-523, 1991

Sladek NE. Metabolism of oxazaphosphormes. Pharmacol. Ther. 37: 301-355, 1988. Sterner MS, and Barrack ER. Transforming growth factor- 1 overproduction in prostate cancer: effects on growth in vitro and in vivo. Mol. Endocrinology, 6:15-25, 1992.

Tahara H, Zitvigol L, Storkus WJ, Zeh HJ III, McKinney TG, Schreiber RD, Gubler U, Robbins PD, and Lotze, MT. Effective eradication of estabhshed muπne tumors with LL- 2 gene therapy using a polycistronic retroviral vector. J. Immunuol , 154: 6466-6474. 1995

W sh PC Prostate cancer kills: strategy to reduce deaths. Urology, 44:463, 1994.

Weber GF, and Waxman DJ. Activation ofthe anti-cancer drug Ifosphamide by rat liver microsomal P450 enzymes. Biochem Pharmacol, 45- 1685-1694, 1993. Wei MX, Ta iya T, Chase M, Boviatsis E.T, Chang TKH, Kowall NW, Hochberg FH, Waxman DJ, Breakefield XO, and Chiocca EA. Experimental tumor therapy in mice using the cyclophospharaide-activating cytochrome P450 2B1 gene. Human Gene Tlierapy, 5: 969-978, 1994.

Yabusaki Y. Artificial P450/reductase fudion enzymes: What can we leam from their structures ? Biochemie, 11: 594-603, 1995.

Yamazalα H, Gillam EMJ. Dong M-S, Johnson WW, Guengeπch FP, and Shimada T Reconsitution of recombinant cyctochrome P450 2C10(2C9) and comparison with cytochrome P450 3A4 and othei fonns: Effects of cytochrome P450-P450 and cytochrome P450-b₃ interactions. Arch Biochem. Biophys., 342.329-337, 1997.

Claims

What is Claimed is:

1. A method of inducing chemotoxicity of a tumor cell comprismg the steps of introducing into the cell a:

arephcation-deficientadenovinis type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a promoter; and

a replication-defici ent adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region of the genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, whereby the cell become selectively sensitized to a prodrug; and a

a prodrug, whereby the cells are selectively killed, t ereby mducing chemotoxicity of die tumor cell.

2. A method of inducing chemotoxicity of a tumor cell compnsmg the steps of introducing into the cell:

a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 under the control of a promoter; and

a replication-deficient adenovirus type 5 expression vector which compπses an adenovirus genome having a deletion the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, whereby the cell become selectively sensitized to a prodrug; and

a prodrug, whereby the cells are selectively killed, thereby inducing chemotoxicity of the tumor cell

3. The method of claim 1 , wherein the tumor cell is a prostate tumor cell.

4. The metliod of claim 1 , wherein the cytochrome 2C9 p450 has the nucleic acid sequence as set forth in Figure 11A.

5. The method of claim 2, wherein the cytochrome 3 A4 p450 has the nucleic acid sequence as set forth in Figure 1 IB.

6. The metliod of claim 1 or 2, wherein the cytochrome NADPH p450 reductase has tlie nucleic acid as set forth in Figure 11 C

7. The method of claim 1 , wherem the promoter is a Rous Sarcoma Virus promoter.

8. The method of claim 7, wherem the Rous Sarcoma Virus promoter has the nucleic acid sequence as set forth in SEQ ID NO. 1

9. The method of claim 1, wherein tlie prodrug is cyclophosphamide, lfosfamide, or methylpropylchloronitrosourea.

10. The method of claim 1, wherein the replication-deficient adenovirus type 5 expression vector encoding a cytochrome 2C9 p450 under the control of a promoter is designated as Ad5RSV2C9 deposited with the American Type Culture Collection.

11. The method of claim 2, wherem the replication-deficient adenovirus type 5 expression vector encoding a cytochrome 3A4 p450 under the contiol of a promoter is designated as AdSRS V3A4 deposited with the American Type Culture Collection.

12. The method of claim 1 or 2, wherem the rephcation-deficient adenovirus type 5 expression vector encoding a NADPH cytochrome p450 reductase under tlie control of a promoter is designated as Ad5RS VRED deposited with the American Type Culture Collection.

13. A method of treating a subject with cancer comprising the following steps, administering to the subject a therapeutically effective amount of:

apharmaceutical composition compnsmg a replication-deficient adenovinis type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of anucleic acid encoding a cytochrome 2C9 p450 under tlie control of a promoter, and suitable carrier or diluent; and

pharmaceutical composition comprising areplication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase tinder the control of a promoter, and suitable carrier or diluent, whereby the cell become selectively sensitized to a prodrug; and

administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a prodrug, or a vector comprismg a nucleic acid encoding a prodrug, and suitable carrier or diluent, whereby tumor cells of tlie subj ect are selectively killed, thereby treating the subj ect with cancer.

14. A method of treating a subject with cancer comprising the following steps, administering to tlie subject a therapeutically effective amount of:

apharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome havmg a deletion in the El and E3 region of tlie genome and an insertion within the region of a nucleic acid encoding a cytochrome 3A4 p450 under the control of a promoter, and suitable carrier or diluent; and

a pharmaceutical composition comprising a replication-deficient adenovirus type 5 expression vector which compπses an adenovirus genome havmg a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a promoter, and suitable carrier or diluent, whereby the cell become selectively sensitized to a prodrug; and

administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of a prodrug, or a vector comprising a nucleic acid encoding a prodmg, and suitable carrier or diluent, whereby tumor cells ofthe subject are selectively killed, thereby treating the subject with cancer.

15. The method of claim 13, wherem the tumor cell is a prostate mmor cell.

16. The method of claim 13, wherein the cytochrome 2C9 p450 has the nucleic acid as set forth in Figure 11 A.

17 The method of claim 13, wherein the cytochrome 3A4 p450 has the nucleic acid as set forth in Figure 1 IB.

18. The method of claim 13, wherein the cytochrome NADPH p450 reductase hasthe nucleic acid as set forth in Figure 1 lC.

19. The method of claim 13, wherem the promoter is aRous Sarcoma Virus promoter

20. The method of claim 19, where the Rous Sarcoma Virus promoter has the nucleic acid sequence as set forth in SEQ ID NO. 1.

21. The method of claim 13, wherein the prodrug is cyclophosphamide, ifosfamide, or methylpropylchloronitrosourea.

22. The method of claim 13, wherein the replication-deficient adenovirus type 5 expression vector encoding a cytochrome 2C9 ρ450 under the control of a promoter is designated as Ad5RSV2C9 deposited with the Amencan Type Culture Collection.

23. The method of claim 14, wherem the rephcation-deficient adenovirus type 5 expression vector encoding a cytochrome 3A4 p450 under the control of a promoter is designated as Ad5RS V3 A4 deposited with the American Type Culture Collection.

24. The method of claim 13 or 14, wherein the replication-deficient adenovirus type 5 expression vector encoding a NADPH cytochrome ρ450 reductase under the control of a promoter is designated as Ad5RSVRED deposited with the American Type Culture Collection

25. The method of claim 13, further comprising the step of treating the subject with chemotherapy, radiation or chemopreventative therapies.

26. The method of claim 13, wherein the pharmaceutical composition is administered systemically, intratumorally, parenterally. paracancerally, transmucosally, transdermally, intramuscularly, intravenously, intradeπnaly, subcutaneously, intraperitonealy, intraventricularly, intracranialy.

27. A rephcation-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an insertion within the region of a nucleic acid encoding a cytochrome 2C9 p450 under the control of a Rous Sarcoma Virus promoter

28. The replication-deficient adenovirus type 5 expression vector of claim 27, wherem the adenovirus is designated as Ad5RSV2C9 deposited with tlie American Type

Culture Collection.

29. A replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome havmg a deletion in the El and E3 region ofthe genome and an insertion withm the region of a nucleic acid encoding a cytochrome 3 A4 ρ450 under the control of a Rous Sarcoma Virus promoter.

30. The replication-deficient adenovirus type 5 expression vector of claim 29, wherein the adenovirus is designated as Ad5RSV3 A4 deposited with the American Type Culture Collection having ATCC Accession Number VR-2628.

1. A replication-deficient adenovirus type 5 expression vector which comprises an adenovirus genome having a deletion in the El and E3 region ofthe genome and an msertion within tlie region of a nucleic acid encoding a NADPH cytochrome p450 reductase under the control of a Rous Sarcoma Virus promoter having

ATCC Accession Number VR-2629.

32 The replication-deficient adenovirus type 5 expression vector of claim 1 , wherein tlie adenovirus is designated as Ad5RSVRED deposited witli the American Type Culture Collection having ATCC Accession Number VR-2630.