WO2000010389A1 - BLOCAGE DE LA TOXICITE DU GLUCOSE POUR LES CELLULES β DANS LES ILOTS DE LANGERHANS - Google Patents

BLOCAGE DE LA TOXICITE DU GLUCOSE POUR LES CELLULES β DANS LES ILOTS DE LANGERHANS Download PDF

Info

Publication number
WO2000010389A1
WO2000010389A1 PCT/US1999/019055 US9919055W WO0010389A1 WO 2000010389 A1 WO2000010389 A1 WO 2000010389A1 US 9919055 W US9919055 W US 9919055W WO 0010389 A1 WO0010389 A1 WO 0010389A1
Authority
WO
WIPO (PCT)
Prior art keywords
glcnac
streptozotocin
cell
drug
cells
Prior art date
Application number
PCT/US1999/019055
Other languages
English (en)
Inventor
Jeffrey E. Kudlow
Original Assignee
The Uab Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Uab Research Foundation filed Critical The Uab Research Foundation
Priority to AU56830/99A priority Critical patent/AU5683099A/en
Publication of WO2000010389A1 publication Critical patent/WO2000010389A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/005—Enzyme inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/28—Insulins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present invention relates generally to the fields of protein biochemistry and medical therapy for diabetes. More specifically, the present invention relates to drugs that block glucose toxicity to the ⁇ cells in the islets of Langerhans an d thereby prevent the accumulation of damage to the ⁇ cells an d methods for screening for such drugs. The present invention further relates to transgenic mice with impaired glucosamine synthesis and the usage of such transgenic mice for screening for diabetes-treating drugs. Description of the Related Art
  • ⁇ cell function is sufficient such th at oral hypoglycemic agents are adequate for the treatment of th e condition.
  • type 2 diabetes adult onset type
  • high blood glucose concentrations appear to lead to the loss of capacity of th e ⁇ cells in the islets of Langerhans to produce sufficient amounts of insulin to control the blood sugar.
  • a vicious cycle arises where high blood sugar destroys ⁇ cell function leading to even higher blood sugar and worsening of the condition. Complications would therefore occur, such as accelerated atherosclerosis, kidney, eye and peripheral nerve disease.
  • the drugs used to prevent the progression of type 2 diabetes and the complications are directed at lowering th e blood sugar and dependent on insulin injections.
  • th e conventional approaches do contribute greatly to the control of th e disease, they do not completely succeed in controlling the blood sugar at all times.
  • streptozotocin has b een used to create animal models of type 1 diabetes.
  • a single dose of 50-100 mg/kg of streptozotocin to a rat results, within 4 to 8 hours, in the death of most of the ⁇ cells and the development of a picture similar to type 1 diabetes. No other tissues sustain significant damage in this animal model by the administration of this dose of streptozotocin, other than secondarily through th e development of diabetes.
  • Streptozotocin is an antibiotic with a structure that is remarkably similar to N-acetylglucosamine (GlcNAc) (Figure 1) (1).
  • a nitrosourea group is present in a position that corresponds to the acetate in GlcNAc.
  • streptozotocin toxicity derives from its ability to behave as an alkylating agent (2, 3) or as an NO donor (2, 4) .
  • Exposure of cells to NO donors has been associated with apoptotic death (5, 6) and streptozotocin has been shown to cause DNA fragmentation in ⁇ cells (7), a possible indication that these cells undergo apoptosis in response to this drug.
  • streptozotocin The alkylating property of streptozotocin has also made this drug useful as a chemotherapeutic agent in humans for the treatment of islet cell tumors, particularly insulinomas.
  • streptozotocin is nephrotoxic and hepatotoxic in addition to its toxicity to the islets.
  • th e these properties of streptozotocin may explain its non-specific toxicity to tissues other than the ⁇ cells.
  • the specificity of streptozotocin for the ⁇ cell has been suggested to result from th e GLUT2 glucose transporter that is expressed in the ⁇ cell.
  • This transporter appears to transport streptozotocin (8) and GlcNAc (9), perhaps more efficiently than other glucose transporters such a s GLUT1 (8). While this preferential transport might explain partially the ⁇ cell specificity of streptozotocin, it does not explain how other tissues that express GLUT2, such as liver, kidney an d small intestine (10) are less susceptible than ⁇ cells to streptozotocin toxicity.
  • streptozotocin is a structural analog of GlcNAc suggested that the specificity of this drug for the ⁇ cell might result from alterations in glucosamine metabolism.
  • Glucosamine is a product of glucose metabolism and is synthesized from fructose- 6-phosphate by the apparently unique and rate limiting enzyme, glutamine:fructose-6-phosphate amindotransferase (GFAT) ( 1 1 - 13). This metabolic step provides the hexosamine substrates that are necessary for glycoprotein synthesis.
  • glycosylation occurs on those proteins destined for export or th e cell surface; however, in eukaryotic cells, there is also a cytoplasmic form of glycosylation that involves the O-linkage of the monosaccharide, GlcNAc, to cytoskeletal and nuclear proteins at serine or threonine residues (14).
  • O-GlcNAc transf erase An enzyme responsible for this intracellular form of protein modification, O-GlcNAc transf erase ( ⁇ GT), has been characterized (15) and its cDNA cloned (15, 16). Studies on th e tissue distribution of O -GlcNAc transf erase have indicated that th e O-GlcNAc transferase mRNA, although ubiquitous, is particularly abundant in the pancreas (16). The high abundance of O-GlcNAc transferase in the pancreas and the structural similarity of streptozotocin to GlcNAc suggested that the specificity of toxicity of streptozotocin to the pancreatic ⁇ cells might be related to this high abundance of O-GlcNAc transferase. This postulate depends on whether O -GlcNAc transferase is localized to the ⁇ cells or some other cell type in the pancreas.
  • the prior art is deficient in the lack of effective means of blocking glucose toxicity to the ⁇ cells in the Islets of Langerhans, thereby preventing the accumulation of damage to the ⁇ cells in diabetes.
  • the present invention fulfills this longstanding need and desire in the art.
  • the present invention demonstrates that the O-GlcNAc transferase mRNA is highly abundant in the rat pancreatic islet in a distribution that corresponds to the distribution of ⁇ cells. Also disclosed is that streptozotocin markedly alters the metabolism of O-GlcNAc by inhibiting an enzyme that removes this sugar from proteins. It is proposed that this correlation between the high abundance of O -GlcNAc transferase in the ⁇ cells and the ability of streptozotocin to block O-GlcNAc removal may explain the ⁇ cell specificity of streptozotocin toxicity.
  • the present invention also demonstrates that using a transgenic mouse with impaired ⁇ -cell glucosamine synthesis , these mice are also resistant to the diabetogenic effect of streptozotocin plus glucose yet succumb to streptozotocin plus glucosamine.
  • This study links the apoptotic effect of streptozotocin on ⁇ -cells with the O-GlcNAc modification potentially implicating this pathway of glucose metabolism with ⁇ - cell apoptosis glucose toxicity.
  • a method of treating an individual with type 2 diabetes using an effective dose of a drug that blocks glucose metabolic pathway .
  • a method of treating an individual with type 2 diabetes using an effective dose of a drug which activates O-linked N-acetylglucosamine removal from intracellular proteins is provided.
  • a method of screening for a drug for blocking production and/or accumulation of O-GlcNAc-modified proteins and therefore, treating type 2 diabetes comprising th e steps of contacting an animal with a drug candidate; staining pancreatic islets from the treated animal with an antibody directed against O-GlcNAc-modified proteins; obtaining a distribution of the antibody in pancreatic ⁇ cells of the treated animals; comparing the distribution in the treated animal and a distribution in an untreated animal.
  • a method of screening for a compound th at blocks production of O-GlcNAc comprising the steps of contacting a cell in a glucose-containing medium with a compound suspected to block O-GlcNAc production; measuring the level of glucosamine in the cell; and comparing the level with level of glucosamine in a n untreated cell. If the level of glucosamine in the treated cell is less than the level of glucosamine in the untreated cell, the tested compound blocks O-GlcNAc production.
  • transgenic animal such as a mouse containing an antisense glutamine: fructose-6-phosphate amindotransferase (GFAT) transgene.
  • GFAT fructose-6-phosphate amindotransferase
  • Such a transgenic animal o r mouse may be used for screening for diabetes-treating drugs.
  • Figure 1 shows the chemical structures of N- acetylglucosamine and streptozotocin.
  • Figure 2A shows immunohistochemical localization of insulin in a normal rat pancreas. A 5 ⁇ m section of pancreas w as incubated with a rabbit polyclonal anti-insulin antiserum. The bound antibody was detected by the immunoperoxidase method using 3,3'-diaminobenzidine tetrahydrochloride (DAB) as a chromogen. Insulin was localized to the central part of each islet.
  • Figure 2B shows localization of the O-GlcNAc transferase mRNA in the pancreas by in situ hybridization.
  • DAB 3,3'-diaminobenzidine tetrahydrochloride
  • FIG. 1 A 10 ⁇ m thick frozen section of pancreas was probed with an 35 S-UTP-labeled antisense riboprobe corresponding to nucleotides 828 to 1801 of the rat O- GlcNAc transferase cDNA.
  • Figures 2C and 2D show effect of streptozotocin on monoclonal antibody RL2 detectable glycoproteins in the pancreas.
  • Rats approximately 150 g each, were deprived of food overnight, then injected intraperitoneally with a 100 mg/kg dose of streptozotocin (Figure 2D) or with vehicle (Figure 2C) (citrate buffer, pH 4). At various times after the injection, the pancreas was removed for examination b y immunohistochemistry. A 5 ⁇ m section of pancreas, after appropriate permeablization, was incubated with the monoclonal antibody, RL2. Bound RL2 was detected by the immunoperoxidase method using DAB as a chromogen.
  • BSC40 cells w ere infected with a recombinant vaccinia virus that directed th e expression of a fusion protein composed of GST and a 97 amino acid peptide containing the sequence of the B domain of th e transcription factor, Spl .
  • a fusion protein composed of GST and a 97 amino acid peptide containing the sequence of the B domain of th e transcription factor, Spl .
  • cells were placed i n glucose-free DMEM with 10% serum and treated with (Figure 3 A ) or without ( Figure 3B) 5 mM streptozotocin for 24 hours.
  • the GST fusion proteins were affinity and HPLC-purified, and then subjected to MALDI mass spectrometry analysis.
  • Figure 4 shows effect of streptozotocin on O-GlcNAc turnover on the Spl peptide.
  • BSC40 cells were infected with vaccinia virus to express the GST fusion protein and were treated with (dashed line) or without (solid line) 5 mM STZ. 16 hours after infection, [ 35 S]methionine and [ H]glucosamine were added to the cells for 4 hours in glucose-free DMEM. After washing th e cells 3 times, they were placed in glucose-free DMEM containing 10% serum and either 2.5 mM glucosamine (solid square) or 2.5 mM streptozotocin (hollow circle).
  • the GST-fusion proteins w ere purified by affinity chromatography at the indicated times following the removal of the label and the radioactivity attributable to 35 S and 3 H was determined by dual-counting scintillation spectroscopy.
  • Figure 5 shows effect of streptozotocin on O- GlcNAcase and jack bean hexosaminidase activity.
  • Purified O- GlcNAcase and hexosaminidase were incubated with the indicated concentrations of streptozotocin for 15 min at 4°C in hexosaminidase assay buffer prior to the addition of the substrate, -nitrophenyl- ⁇ -D-N- acetylglucosaminide.
  • the reaction w as incubated at 37° for 1 hour and the OD at 400 nM was determined .
  • FIG. 6 shows effect of streptozotocin on RL2 detectable glycoproteins in BSC40 cells.
  • Confluent BSC40 cells were incubated overnight in glucose-free DMEM with 10% serum . The cells were treated with or without 5 mM streptozotocin in glucose- and serum-free medium as indicated on the figure.
  • the cells were also treated as indicated with 100 ⁇ M 6 - diazo-5-oxonorleucine (DON) 1 hour prior to the initiation of streptozotocin treatment and either 5 mM Glc or 5 mM GlcN during the streptozotocin treatement. After 6 hours, the proteins, in high-salt extracts from the cells, were separated by SDS gel electrophoresis and analyzed by a Western blot that was probed with the RL2 monoclonal antibody.
  • DON diazo-5-oxonorleucine
  • FIG. 7 shows a summary of the metabolic pathway leading from glucose metabolism to O-linked protein glycosylation.
  • the structure of protein- O-GlcNAc is shown.
  • Glc glucose; Gin: glutamine; Glu: glutamate; other abbreviations are defined below.
  • Figure 8 shows the effect of hyperglycemia and streptozotocin on O-GlcNAc accumulation in pancreatic islets in vivo .
  • the rats were infused with glucose with or without STZ- pretreatment and the pancreases were examined for th e distribution of RL2 detectable glycoprotein.
  • Figures 8A and 8D overnight fasted;
  • Figures 8B and 8E 45 min after glucose infusion;
  • Figures 8C and 8F 170 min after insulin treatment;
  • Figures 8D, 8E and 8F STZ-pretreatment. (magnification 400 X).
  • Figure 9 shows the effect of glucose and glucosamine on the cytotoxicity of streptozotocin to ⁇ cells.
  • Column A Single dose streptozotocin (50 mg/kg).
  • Row 1 The pancreas was stained by immunohistochemistry with a polyclonal insulin antibody (magnification 400 X).
  • Row 2 Bright field view of the in situ hybridization with a 35 S-UTP-labeled insulin antisense riboprobe (magnification 400 X).
  • Row 3 Dark field view of the same sections shown in row 2. The hybridization signal appears as dark grains in the bright field and white grains in the dark field views.
  • Row 4 In situ TUNEL assay for DNA nicking (magnification 600 X).
  • FIG. 10A and 10B Hematoxylin-eosin staining: Figures 10C and 10D : Insulin immunohistochemical staining.
  • Figure 1 1 shows the characterization of th e antisense-GFAT transgenic mice.
  • Figure 11 A Upper left panel : The schematic diagram of the transgene. Upper right panel shows the PCR analysis of DNA derived from the tails of FI mice (lanes 2 and 4 are gene positive). Ml : 1 kb markers; M2: 100 bp markers ; P: 0.5 pg plasmid DNA. The expected amplified target sequence is about 1.28 kb.
  • Lower panel antisense GFAT mRNA w as determined to be expressed specifically in the ⁇ -cells of transgenic mice by in situ hybridization with 35 S-UTP-labeled GFAT sense riboprobe (left: bright field; right: dark field, magnification 400 X).
  • FIG 11B shows the effect of the antisense GFAT transgene on the ⁇ -cell O-GlcNAc accumulation in hyperglycemic mice.
  • the mice were injected with streptozotocin followed by glucose and th e pancreas was examined by immunohistochemical staining with RL2 antibodies.
  • Figure 12 shows the blood glucose response following treatment with multiple low doses of STZ.
  • the arrows indicate the streptozotocin injections (40 mg/kg, 5 consecutive days). Blood glucose was determined in samples from a tail bleed at th e indicated times. Results are given as the mean ⁇ S.E. for 1 4 transgenic and 16 wild type littermate mice. *: p ⁇ 0.05; **: p ⁇ 0.01 (unpaired t-test).
  • Streptozotocin an analog of N-acetylglucosamine (GlcNAc), is a specific toxin for the pancreatic ⁇ cell.
  • the present invention demonstrates that treatment of rats with streptozotocin results in an early ⁇ cell-specific increase in the level of intracellular protein modification by O-linked GlcNAc (O-Glc ⁇ Ac).
  • the cell with the most rapid on-rate for O- GlcNAc the ⁇ cell
  • the present invention shows that the on-rate of O -GlcNAc is substrate driven in several cell types, it is speculated that the ⁇ cell, with its high level of O-GlcNAc transferase, may also respond to elevations of blood sugar with increased protein modification by O-GlcNAc.
  • this proposed mechanism of streptozotocin toxicity on the ⁇ cell may result from an exaggeration of a heretofore unrecognized physiological response to glucose mediated through the high level of O-GlcNAc transferase in these cells.
  • a method of treating an individual with type 2 diabetes using an effective dose of a drug that blocks glucose metabolic pathway Preferably, the drug inhibits the activity of one or more than one enzyme involved in the pathway.
  • the enzyme can b e glutamine:fructose-6-phosphate amidotransferase, which is responsible for conversion of glucose to glucosamine, or O-linked N-acetylglucosamine transferase, which modifies the proteins in the nucleus.
  • a method of treating an individual with type 2 diabetes using an effective dose of a drug which activates O-linked N-acetylglucosamine removal from intracellular proteins Specifically, the drug enhances the activity of O-GlcNAc-selective N-acetyl- ⁇ -D-glucosaminidase.
  • the above disclosed methods may be synergized with conventional approaches, such as insulin injection.
  • a method of screening for a drug for blocking production and/or accumulation of O-GlcNAc-modified proteins and therefore, treating type 2 diabetes comprising th e steps of injecting an animal with a drug candidate; staining pancreatic islets from the treated animal with an antibody directed against O-GlcNAc-modified proteins; obtaining a distribution of the antibody in pancreatic ⁇ cells of the treated animals; comparing the distribution in the treated animal and a distribution in an untreated animal. If the distribution in th e treated animal is less than the distribution in the untreated animal, the tested drug blocks the production and/or accumulation of O-GlcNAc-modified proteins, therefore, is suitable for treating type 2 diabetes.
  • a method of screening for a compound th at blocks production of O-GlcNAc comprising the steps of contacting a cell in a glucose-containing medium with a test compound suspected of blocking O-GlcNAc production; measuring the level of glucosamine in the cell; and comparing the level with level of glucosamine in an untreated cell. If the level in treated cell is less than the level in the untreated cell, the test compound blocks O- GlcNAc production.
  • a transgenic mouse containing antisense glutamine:fructose-6-phosphate amindotransferase (GFAT) transgene containing antisense glutamine:fructose-6-phosphate amindotransferase (GFAT) transgene.
  • GFAT antisense glutamine:fructose-6-phosphate amindotransferase
  • 150 bp 5 ' UTR and complete coding sequence of mouse GFAT cDNA is inserted in the antisense direction into an Xbal-Xbal site between the rat insulin 1 1 promoter (RIP) and the SN40 small T-antigen intron and polyadenylation sequences to form RIP-mGFAT (antisense)-SN40 construct in the transgene.
  • the transgene is expressed in islet ⁇ - cells that blocks the glucose-stimulated increase in O-GlcNAc modification, resulting impaired ⁇ -cell glucosamine synthesis.
  • a method of screening for a drug useful for treating diabetes comprising the steps of: administering the transgenic mouse disclosed herein with streptozotocin (STZ) in combination with glucosamine to obtain diabetic transgenic mouse ; measuring blood glucose level in the diabetic transgenic mouse; administering a drug candidate to the diabetic transgenic mouse; and measuring blood glucose level in the drug-treated diabetic transgenic mouse, wherein if the blood glucose level in the drug- treated diabetic transgenic mouse is lower than that in th e diabetic transgenic mouse without the drug treatment, the test drug is useful for treating diabetes.
  • STZ streptozotocin
  • a method of screening for a drug useful for treating diabetes comprising the steps of: administering the transgenic mouse disclosed herein with streptozotocin (STZ) i n combination with glucosamine to obtain diabetic transgenic mouse; measuring ⁇ -cell apoptosis in the diabetic transgenic mouse; administering the diabetic transgenic mouse with a drug candidate; and measuring ⁇ -cell apoptosis in the drug-treated diabetic transgenic mouse, wherein if the ⁇ -cell apoptosis in th e drug-treated diabetic transgenic mouse is reduced compared to that in the diabetic transgenic mouse without the drug treatment, the test drug is useful for treating diabetes.
  • STZ streptozotocin
  • BSC40 cells were grown in Dulbecco modified Eagle medium (DMEM) with 10% newborn calf serum (Gibco/BRL, Grand Island, NY), 100 ⁇ g of penicillin/ml, and 50 ⁇ g of gentamicin/ml a t 37°C in a humidified incubator with 7.5% C0 2 .
  • DMEM Dulbecco modified Eagle medium
  • penicillin/ml 100 ⁇ g
  • gentamicin/ml a t 37°C in a humidified incubator with 7.5% C0 2 .
  • GST Glutathione-S-Transferase
  • a recombinant vaccinia virus was generated a s described (17). After BSC40 cells were infected with the vaccinia virus that directed the expression of the fusion protein ( 17 ) composed of GST and a 97 amino acid peptide containing th e sequence of the B domain of the transcription factor Spl , cells were placed in glucose-free DMEM with 10% serum. Cells w ere then treated with or without 5 mM streptozotocin for 20 hours.
  • a whole cell extract was made by freezing and thawing cells twice in a buffer containing 20 mM Tris (pH 7.5), 0.5 M NaCl, 0.5 M GlcNAc, 0.5 mM EDTA, 0.5 M MgCl 2 , 1 mM dithiothreitol, 0.2 m M phenylmethylsulfonyl fluoride, and 20% glycerol.
  • the supernatant was collected after centrifugation.
  • Glutathione-Sepharose 4B (Pharmacia) was added to the extract for 30 min. The beads w ere collected and washed three times with the extraction buffer minu s the glycerol and GlcNAc.
  • This procedure extracted at least 90% of the fusion protein from the extract.
  • the beads were further washed with a buffer containing 20 mM Tris, 100 mM NaCl, and 2.5 mM CaCl 2 .
  • the peptide w as then cleaved from GST with 4 U of thrombin (Sigma) per mg of fusion protein.
  • MALDI-TOF Matrix-assisted laser desorption ionization-time-of- flight
  • a delayed extraction method was used in the determination of molecular mass .
  • Measurement of ion flight times through the drift region of th e mass spectrometer were carried out with a Tektronix (Beaverton, OR) TDS784A oscilloscope. The instrument was calibrated with external molecular weight standards.
  • Confluent BSC40 cells were incubated overnight in glucose-free DMEM andl0% serum. The cells were then washed with glucose-free DMEM and treated with or without 5 mM streptozotocin in this glucose-free medium. In addition, the cells were also treated as indicated with 100 ⁇ M 6-diazo-5 - oxonorleucine (DON) (Sigma) 1 hour prior to the initiation of streptozotocin treatment and either 5 mM glucose or 5 mM glucosamine during the streptozotocin treatement.
  • DON 6-diazo-5 - oxonorleucine
  • the proteins in high-salt extracts from the cells, were sep arated by SDS gel electrophoresis and analyzed by a Western blot that was probed with the RL2 monoclonal antibody as previously described (13).
  • the RL2 antibody was from Dr. L. Gerace, (19).
  • Confluent BSC40 cells in 15 cm plates were infected with vaccinia virus to express GST fusion protein and were treated with or without 5 mM streptozotocin. 16 hours after infection, 2 ⁇ Ci of [ 35 S]methionine (1000 Ci/mmol) and 5 ⁇ Ci of [6- 3 H]glucosamine (40 Ci/mmol) (Amersham) were added to the cells for 4 hours in glucose-free DMEM. After washing the cells 3 times, they were placed in glucose-free DMEM containing 10% serum and either 2.5 mM glucosamine or 2.5 mM streptozotocin.
  • the GST- fusion proteins were purified by glutathione affinity chromatography (see above) at the indicated times following th e removal of the label and the radioactivity attributable to 35 S an d 3 H was determined by dual-counting scintillation spectroscopy o n an appropriately calibrated Beckman LS 5000TD counter.
  • Sprague Dawley rats weighing between 150 and 170 g were fasted overnight and then injected intraperitoneally with vehicle (50 mM citrate buffer, ph 4) alone or streptozotocin ( 1 00 mg/ml) made fresh in citrate buffer at a dose of 100 mg/kg .
  • Blood glucose concentrations were determined before the injection and at various times after the injection on blood derived from a tail bleed using an "Advantage" blood glucose monitor (Boehringer Mannheim). After the injection, the animals were allowed to feed on standard rat chow and were sacrificed by C0 2 inhalation a t various times after the injection. The treatment of these animals was approved by the institutional animal care committee.
  • Formaldehyde fixed and paraffin embedded pancreas sections (5 ⁇ m) were prepared and immunostained with RL2 monoclonal antibody (ascites diluted 1 :20), or anti-insulin polyclonal antibody (1 :50, NCL-INS, Novocastra, UK) using th e Vectastain Elite ABC Kit (Vector, Burlingame, CA). 3,3 ' - diaminobenzidine tetrahydrochloride (DAB) was used as th e chromogen, and sections were counterstained with Gill's Hematoxylin (Vector). To facilitate immunostaining, sections w ere pretreated with 2 N HC1 for 20 min at 37 °C, and exposed to 0.01 % trypsin at 37 °C for 3 min.
  • DAB diaminobenzidine tetrahydrochloride
  • the 978-bp rat OGT cDNA corresponding to nucleotides 828 to 1801 of the rat OGT cDNA (accession number U76557) ( 15 ) was cloned by RT-PCR from rat liver RNA using two oligonnucleotides 5'- CATGGATCCGCAATTGAGACGCAACC -3' (SEQ ID NO: 1), and 5'- CATGGTACCTGAGGATGGACAGAAGGC -3' (SEQ ID NO: 2).
  • the identity of the PCR product was confirmed b y restriction enzyme digestion and partial automated sequencing.
  • the PCR fragment was subcloned into a plasmid.
  • Frozen normal rat pancreas sections (10 ⁇ m) were utilized for in situ hybridization. Preparation of the 35 S-UTP labeled antisense riboprobe and hybridization were performed as described (20) . After hybridization, photographic emulsion dip, exposure an d developing, the sections were counterstained with hematoxylin and eosin, and subjected to microscopic examination under bright field and dark field illumination.
  • the animals were sacrificed at various times following injection, and the pancreatic islets were examined for the presence of O-GlcNAc modified proteins using the monoclonal antibody, RL2.
  • This antibody recognizes the O-GlcNAc protein modification on a wide variety of proteins (13, 19, 21, 22).
  • pancreas from untreated animals showed the typical (13) stochastic distribution of RL2 positivity predominantly in the nuclei of both the islet and exocrine pancreatic cells (Figure 2C).
  • the peripheral non- ⁇ cells of th e islets exhibited more staining than the central ⁇ cells.
  • streptozotocin treatment when the blood sugar of the treated and untreated animals were both about 1 50 mg/ 100ml and before histological evidence of ⁇ cell damage h ad developed, a marked change in the distribution of RL2 positivity was noted in the STZ-treated animal.
  • streptozotocin chase resulted in continued accumulation of 3 H-O-GlcNAc on the peptide.
  • the ability of th e unlabeled glucosamine to "chase" the counts implies that th e labeled O-GlcNAc on the peptide can be replaced with unlabeled O-GlcNAc during the chase.
  • the failure of streptozotocin to chase the GlcNAc counts implies that streptozotocin or a metabolite of streptozotocin does not act as a substrate for O-GlcNAc transferase and is thus incapable of replacing the labeled O-GlcNAc on th e modified peptide.
  • Streptozotocin had no significant effect on the activity of jack bean hexosamindase suggesting that the inhibition of the O- GlcNAcase was not simply a result of competition for sub strate based on the hexosamine-like structure of STZ. Streptozotocin treatment of cultured cells for 6 hours also resulted in the loss of nuclear O- GlcNAcase activity but not lysosomal hexosaminidase activity as measured on cell extracts (data not shown).
  • Inhibitors of O-GlcNAcase activity whose structure is based on GlcNAc, have been described (18).
  • th e activity of the O-GlcNAcase has been shown to be blocked by N- ethylmaleimide, indicating the presence of a free sulfhydryl group in the active site.
  • streptozotocin is thought to b e either an NO donor (2, 4) or alkylating agent (3) raising th e possibility that the free sulfhydryl group in the active site of th e O-GlcNAcase might be covalently modified either by NO (5) o r alkylation, resulting in an irreversible inactivation of the enzyme .
  • streptozotocin could be targeted specifically to the O- GlcNAcase as a result of its structural similarity to GlcNAc an d could inactivate this enzyme through the covalent modification of its active site. While this mechanism by itself would not explain the specificity of streptozotocin for the ⁇ cell, the abundance of O- GlcNAc transferase in these cells would make them particularly sensitive to a process that delays removal of O -GlcNAc residues.
  • the O-GlcNAc modification is present in all eukaryotic cells (14) and in mammalian cells, the enzymes involved in th e metabolic steps leading to this modification appear to b e ubiquitous.
  • th e same simian BSC40 cell line used for vaccinia virus expression of the Spl peptide was generated. After an overnight incubation, th e cells were placed in glucose-free medium to enhance the uptake of STZ. Intracellular proteins extracted from cells incubated in glucose-free medium for 6 hours displayed a low O-GlcNAc content as detected by RL2 immunoblotting.
  • streptozotocin to stimulate hyperglycosylation when th e enzyme GFAT is briefly and simultaneously inhibited or wh en cells are deprived of glucose is compatible with the notion that streptozotocin treatment does not result in increased glucosamine synthesis from the activation of GFAT, or increased de novo O- glycosylation through the activation of O-GlcNAc transferase, bu t rather that streptozotocin preserves the state of glycosylation of the proteins through the inactivation of the O-GlcNAcase. This interpretation is compatible with the pulse-chase experiments an d measured effect of streptozotocin on O-GlcNAcase.
  • streptozotocin has been proposed to have a variety of biochemical actions. It has been shown to b e an alkylating agent capable of modifying DNA (3) and an NO donor (2, 4). The accumulation of excessive NO in ⁇ cells has been proposed to be associated with apoptosis (6, 25, 26). However, all of these properties of streptozotocin have failed to adequately explain how this antibiotic is so specifically toxic to the ⁇ cell. It is observed that the ⁇ cell is so richly endowed with
  • Glucosamine has also been proposed to contribute to insulin resistance (37-41 ) and the vascular complications of diabetes (13). Increased O-GlcNAc modification of nuclear an d cytoplasmic proteins in blood vessels, muscle and fat may also play a role in these aspects of diabetes. However, the association of O-GlcNAc with the ⁇ cell toxicity of streptozotocin is the first potentially direct connection between this protein modification and the development of diabetes.
  • mice Male Sprague-Dawley rats (Charles River laboratory, body weight 150- 175 g) were fasted overnight. Catheterization was performed under anesthesia. The experimental rats w ere infused through a catheter in the right femoral vein with either dextrose (0.042-0.125 mg.g ' .min " 1 , Sigma) or glucosamine (0.025 mg.g '.min B 1 , Sigma) by a electronically-controlled syringe pu mp (KD Scientific) while control rats were infused with PBS solution (PH 7.4).
  • dextrose 0.4%
  • glucosamine 0.025 mg.g '.min B 1 , Sigma
  • Blood glucose was determined before and during th e infusion at ten minute intervals on blood derived from a tail bleed using an AAdvantage@ blood glucose monitor (Boehringer Mannheim).
  • Human insulin (Eli Lilly) was dissolved in 0.9% saline and administrated intravenously.
  • the streptozotocin 200 mg.kg " 1 freshly dissolved in 100 mM citrate buffer, pH 4.2 was inj ected intravenously 15 minutes before the glucose infusion.
  • the pancreas w as removed and formaldehyde-fixed immediately. Animal treatments were performed in an approved manner in a certified animal care facility.
  • Formaldehyde-fixed and paraffin-embedded pancreas sections were deparaffinized in xylene and rehydrated through graded alcohol concentrations to water. To facilitate immunostaining, the sections were pretreated with 2 N HC1 for 2 0 minutes at 37°C and exposed to 0.01% trypsin at 37°C for 5 minutes. The sections were immunostained with RL2 monoclonal antibody (ascites, diluted 1 :20) or anti-insulin polyclonal antibody (1 :50; NCL-INS, Novocastra) using the Vectastain Elite ABC kit (Vector). 3,3 ' -Diaminobenzi dine tetrahydrochloride (DAB) w as used as the chromogen, and sections were counterstained with Gill' s Hematoxylin (Vector).
  • DAB 3,3 ' -Diaminobenzi dine tetrahydrochloride
  • mice 74 overnight fasted male SJLXB6 mice (body weight 19.6 to 27.4 g) were divided into three groups.
  • 50 mice were divided into five groups and injected intraperitoneally with streptozotocin at dose of 55, 60, 65, 75, 8 0 mg/kg respectively. The blood glucose was monitored frequently prior to sacrifice 26 hours later.
  • the paraffin and frozen sections of mouse pancreas were prepared and hybridized as described by Hanahan, D., Nature 315 , 115-22 (1985).
  • the antisense insulin 35 S-cRNA riboprobe was synthesized from the 350 bp rat insulin I cDNA in pBlueScript KS (Stratagene), using T3 polymerase.
  • the sense 35 S - cRNA riboprobe, to detect the transgenic antisense mouse GFAT mRNA was synthesized from the 2.1 kb mouse GFAT cDNA i n pT 7 T 3 (Pharmacia), using T7 RNA polymerase. After hybridization, photographic emulsion dip, exposure, and developing, the sections were counterstained with hematoxylin and eosin and w ere subjected to microscopic examination under bright field and d ark field illumination.
  • the TUNEL assay was performed in paraffin- embedded sections of the pancreases using an in situ cell de ath detection kit (Boehringer Mannheim).
  • the endogenous perioxidase activity was blocked by immersing the sections in 0.3% H 2 0 2 in methanol for 30 min prior to cell permeablization.
  • Non-specific binding of the peroxidase-coupled anti-fluorescein antibody was blocked with PBS containing 3% BSA for 20 min. Positive cells were visualized using peroxidase substrate enhancer and DAB substrate (Boehringer Mannheim) and sections w ere counterstained with Hematoxylin.
  • the 2.2 kb mouse GFAT cDNA 22 consisting of 150 b p 5'UTR and complete coding sequence, was inserted in th e antisense direction into an Xbal-Xbal site between the rat insulin II promoter (RIP) 41 and the SV40 small T-antigen intron an d polyadenylation sequences.
  • streptozotocin 50 mg/kg
  • All values are expres sed as mean ⁇ S.E.
  • Statistical analysis is carried out with unpaired t test and ⁇ 2 test. Differences are considered statistically significantly at p ⁇ 0.05 or p ⁇ 0.01.
  • O-GlcNAc Level in ⁇ -cells is Rapidly Responsive to the Blood Glucose in vivo
  • GFAT glutamine:fructose-6-phosphate amidotransferase
  • Provision of substrate for GFAT requires a glucose concentration sufficient for phosphorylation b y the ⁇ -cell glucokinase.
  • GFAT is known to b e regulated by feedback inhibition by UDP-GlcNAc 20 . While in other cell types, altered glucose concentrations can be reflected b y changes in the O-GlcNAc modification of intracellular proteins, th e pancreatic ⁇ -cell has not been shown to respond in this manner.
  • Streptozotocin appears to be specifically toxic to the ⁇ -cell because it can block the O-GlcNAcase in vitro and OGT is selectively abundant in ⁇ -cells, other mechanisms for this specific toxicity have also been proposed. Streptozotocin has been shown to be a DNA alkylating agent and nitric oxide (NO) donor, and its specificity to the ⁇ -cell was suggested to result from th e preferential ability of the GLUT2 to transport this agent into ⁇ - cells.
  • NO nitric oxide
  • streptozotocin behaves as an O- GlcNAcase inhibitor in ⁇ -cells in intact animals. Sprague Dawley rats were pretreated with streptozotocin before the initiation of the glucose infusion. The islets were again examined b y immunohistochemical staining with the RL2 antibody. In th e absence of hyperglycemia, streptozotocin did not alter the O- GlcNAc content of ⁇ -cells. This observation is in agreement with the determination that streptozotocin itself is not incorporated into ⁇ -cell proteins. However, when hyperglycemia was achieved after the streptozotocin dose, the increase in ⁇ -cell O-GlcNAc w as again observed.
  • transgenic mouse line was developed in which an anti-sense GFAT construct w a s expressed in ⁇ -cells that blocks the glucose-stimulated increase in O-GlcNAc modification in cultured mouse cells. Integration of the transgene was detected by PCR in DNA extracted from the mouse tails ( Figure 11) and by Southern blot analysis (not shown). In situ hybridization confirmed the ⁇ -cell-specific expression of th e anti-sense transgene in the islets ( Figure 11).
  • this anti-sense construct was able to blunt the streptozotocin and glucose-induced O-GlcNAc accumulation in the ⁇ -cells of the transgenic mice as compared to the non-transgenic litermates ( Figure 11).
  • the glucosamine administered with th e streptozotocin bypassed the block in glucose metabolism induced by the anti-sense GFAT transgene thereby implicating th e transgene in the streptozotocin resistance. Furthermore, this effect of the anti-sense transgene was observed in three independently developed transgenic lines, ruling out a n integration-site specific mechanism for the streptozotocin resistance.
  • the ⁇ -cell as a glucose sensor has adapted to respond both instantaneously and more chronically to changes in th e nutritional load. The long-term adaptation that switches the ⁇ -cell from the famine mode with limited insulin-secretory capacity to the surplus mode with increased capacity is poorly understood.
  • the rate of ⁇ -cell proliferation increases.
  • this proliferative response is ultimately offset by an increase in apoptosis that results in a failure of the net ⁇ -cell mass to increase sufficiently to fulfill the insulin demand.
  • Both the proliferative and apoptotic response appear to be driven by hyperglycemia. Indeed, the apoptotic response may be part of the glucose toxicity that results in reduced insulin secretion following prolonged hyperglycemia.
  • the present invention demonstrates the link b etween the metabolism of glucose to O-GlcNAc with ⁇ -cell apoptosis.
  • the normal ⁇ -cell like no other known cell, has a markedly accelerated on and off rate of O-GlcNAc, streptozotocin arrests this cycle resulting in the stable and ⁇ -cell-specific accumulation of th e modification in vivo.
  • the enhancement of the apoptotic response to streptozotocin plus glucose is blunted in transgenic animals with impaired glucosamine synthesis from glucose, indicating that it is this pathway of glucose metabolism that is required for the ⁇ - cells-specific toxic and apoptotic effect of STZ.
  • Spl an O-GlcNAc modified transcription factor
  • th e stability of Spl has been shown to be regulated by th e proteasome.
  • glucosamine treatment of cells results in th e stabilization of Spl through the inhibition of proteasomal degradation in vivo 16 and in vitro.
  • the O- GlcNAc response to glucose could upregulate the expression of many ⁇ -cell genes leading to cellular hypertrophy.
  • this inhibition of proteasomal degradation of Spl may extend to other proteins known to b e degraded by the proteasome and involved in apoptosis.
  • Another effect of O-GlcNAc on Spl is in the control of the Spl protein interactions involved in transcriptional activation. This observation raises the possibility that sustained O-GlcNAc modification of a transcription activation domain of Spl could preclude the protein interactions required for transcriptional activation and lead to impaired gene transcription.
  • the difference in behavior of islets treated with glucose from those treated with glucose i n combination with streptozotocin may relate to the cyclical nature of the O-GlcNAc modification. That is, the on-rate for th e modification normally may be matched by the off-rate even though the steady-state level of modification may be high during hyperglycemia. Interruption of this cycle with streptozotocin m ay result in the prolonged accumulation of O-GlcNAc on the critical substrates that become involved in the apoptotic response.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Animal Husbandry (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention démontre que la streptozotocine (STZ) est une toxine spécifique des cellules β pancréatiques et qu'elle inhibe spécifiquement l'activité de la N-acétyl-β-D-glucosaminidase O-GlcNAc-sélective (O-GlcNAcase), et bloque par conséquent l'élimination de la N-acétylglucosamine liée à O dans les protéines intracellulaires. L'invention concerne en outre un animal transgénique présentant une synthèse déficiente de la glucosamine, et différents traitements anti-diabétiques ainsi que des procédés permettant l'identification de médicaments anti-diabétiques.
PCT/US1999/019055 1998-08-18 1999-08-18 BLOCAGE DE LA TOXICITE DU GLUCOSE POUR LES CELLULES β DANS LES ILOTS DE LANGERHANS WO2000010389A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU56830/99A AU5683099A (en) 1998-08-18 1999-08-18 Blockade of glucose toxicity to the beta cells in the islets of langerhans

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US9702198P 1998-08-18 1998-08-18
US60/097,021 1998-08-18

Publications (1)

Publication Number Publication Date
WO2000010389A1 true WO2000010389A1 (fr) 2000-03-02

Family

ID=22260371

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/019055 WO2000010389A1 (fr) 1998-08-18 1999-08-18 BLOCAGE DE LA TOXICITE DU GLUCOSE POUR LES CELLULES β DANS LES ILOTS DE LANGERHANS

Country Status (2)

Country Link
AU (1) AU5683099A (fr)
WO (1) WO2000010389A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002099083A2 (fr) 2001-06-05 2002-12-12 Exelixis, Inc. Gfat en tant que modificateurs de la voie p53 et leur procede d'utilisation
CN112891540A (zh) * 2021-01-28 2021-06-04 滨州医学院 Ogt作为靶点在制备治疗糖尿病中胰高血糖素异常分泌的药物中的应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4952568A (en) * 1988-05-19 1990-08-28 Sanwa Kagaku Kenkyusho Co., Ltd. Remedies and preventives for diabetic diseases
US5827898A (en) * 1996-10-07 1998-10-27 Shaman Pharmaceuticals, Inc. Use of bisphenolic compounds to treat type II diabetes
US5877183A (en) * 1996-06-06 1999-03-02 Ergo Research Corporation Treatment of lipid and glucose metabolism disorders with dopamine and serotonin agonists

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4952568A (en) * 1988-05-19 1990-08-28 Sanwa Kagaku Kenkyusho Co., Ltd. Remedies and preventives for diabetic diseases
US5877183A (en) * 1996-06-06 1999-03-02 Ergo Research Corporation Treatment of lipid and glucose metabolism disorders with dopamine and serotonin agonists
US5827898A (en) * 1996-10-07 1998-10-27 Shaman Pharmaceuticals, Inc. Use of bisphenolic compounds to treat type II diabetes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HANOVER J.A. ET AL.: "Elevated O-Linked N-Acetylglucosamine Metabolism in Pancreatic beta-Cells", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 362, no. 1, 1 February 1999 (1999-02-01), pages 38 - 45 *
SAYESKI P.P.: "Cloning and partial characterization of the mouse glutamine:fructose-6-phosphate amidotransferase (GFAT) gene promotor", NUCLEIC ACIDS RESEARCH, vol. 25, no. 7, 1997, pages 1458 - 1466, XP002923490 *
YKI-JARVINEN H. ET AL.: "UDP-N-acetylglucosamine transferase and glutamine:fructose 6-phosphate amidotransferase activities in insulin-sensitive tissues", DIABETOLOGIA, vol. 40, 1997, pages 76 - 81, XP002923491 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002099083A2 (fr) 2001-06-05 2002-12-12 Exelixis, Inc. Gfat en tant que modificateurs de la voie p53 et leur procede d'utilisation
EP1456650A2 (fr) * 2001-06-05 2004-09-15 Exelixis, Inc. Gfat en tant que modificateurs de la voie p53 et leur procede d'utilisation
EP1456650A4 (fr) * 2001-06-05 2005-11-02 Exelixis Inc Gfat en tant que modificateurs de la voie p53 et leur procede d'utilisation
CN112891540A (zh) * 2021-01-28 2021-06-04 滨州医学院 Ogt作为靶点在制备治疗糖尿病中胰高血糖素异常分泌的药物中的应用

Also Published As

Publication number Publication date
AU5683099A (en) 2000-03-14

Similar Documents

Publication Publication Date Title
Marty et al. Regulation of glucagon secretion by glucose transporter type 2 (glut2) and astrocyte-dependent glucose sensors
Kusminski et al. MitoNEET-Parkin effects in pancreatic α-and β-cells, cellular survival, and intrainsular cross talk
Zhang et al. Hypoxia-inducible factor directs POMC gene to mediate hypothalamic glucose sensing and energy balance regulation
Szekeres et al. The Rab-GTPase-activating protein TBC1D1 regulates skeletal muscle glucose metabolism
Li et al. NAD+-boosting therapy alleviates nonalcoholic fatty liver disease via stimulating a novel exerkine Fndc5/irisin
Miyake et al. Skeletal muscle–specific eukaryotic translation initiation factor 2α phosphorylation controls amino acid metabolism and fibroblast growth factor 21–mediated non–cell-autonomous energy metabolism
Shiura et al. Meg1/Grb10 overexpression causes postnatal growth retardation and insulin resistance via negative modulation of the IGF1R and IR cascades
del Arco et al. Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues
Madonna et al. Empagliflozin reduces the senescence of cardiac stromal cells and improves cardiac function in a murine model of diabetes
Cochrane et al. Leptin modulates pancreatic β-cell membrane potential through Src kinase–mediated phosphorylation of NMDA receptors
Shearer et al. PAR2 promotes impaired glucose uptake and insulin resistance in NAFLD through GLUT2 and Akt interference
KR101910770B1 (ko) Dscr1-4 를 이용한 제2형 당뇨병 치료제의 스크리닝 방법, 및 제2형 당뇨병 진단 또는 예후 예측용 조성물
JP2019065025A (ja) 糖尿病を治療および／または発症を制限するための方法
Denroche et al. Disrupted leptin signaling in the lateral hypothalamus and ventral premammillary nucleus alters insulin and glucagon secretion and protects against diet-induced obesity
Thymiakou et al. Impaired hepatic glucose metabolism and liver-α-cell axis in mice with liver-specific ablation of the Hepatocyte Nuclear Factor 4α (Hnf4a) gene
Yang et al. Reduction of mRNA m6A associates with glucose metabolism via YTHDC1 in human and mice
WO2016172574A2 (fr) Forme marquée de l'enzyme mut, constructions génétiques comprenant celle-ci, et son utilisation en thérapie génique
US20150313961A1 (en) Materials and Methods for Regulating Whole Body Glucose Homeostasis
WO2000010389A1 (fr) BLOCAGE DE LA TOXICITE DU GLUCOSE POUR LES CELLULES β DANS LES ILOTS DE LANGERHANS
Hwang et al. Exocytosis proteins: typical and atypical mechanisms of action in skeletal muscle
CN114432333B (zh) MiR-503簇海绵在制备用于治疗2型糖尿病药物中的应用
CN113398267A (zh) EphB4作为靶标在筛选增加胰岛素敏感性药物或模型中的应用
Guo et al. Mechano-sensor Piezo1 inhibits glucagon production in pancreatic α-cells
WO2011115103A1 (fr) Procédé de criblage pour des composés agonistes candidats pour le récepteur 1 à l'adiponectine
US9168316B2 (en) Methods for treating obesity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase