WO2000009720A2

WO2000009720A2 - Cytochrome b5 from petunia

Info

Publication number: WO2000009720A2
Application number: PCT/GB1999/002676
Authority: WO
Inventors: Ronald Koes; Nick De Vetten; Jos Mol
Original assignee: International Flower Developments Pty Ltd; Vrije Universiteit; Jones, Elizabeth
Priority date: 1998-08-14
Filing date: 1999-08-13
Publication date: 2000-02-24
Also published as: WO2000009720A3; AUPP526898A0

Abstract

The present invention relates generally to a plant regulatory gene and derivatives and homologues thereof. More particularly, the present invention provides a nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides, the expression of which, modulates or otherwise facilitates activity of a cytochrome P450 protein in plant cells and tissues including petals, flowers, stems, leaves and seeds. Even more particularly, the nucleic acid molecule of the present invention encodes a cytochrome b5 or a mutant, part, fragment, portion, functional and/or structural equivalent or homologue thereof or agonist or antagonist thereof involved in modulating or otherwise facilitating activity of a dihydrokaempferol (DHK) hydroxylating enzyme such as but not limited to flavonoid 3', 5'-hydroxylase. The present invention further provides transgenic plants or parts thereof or cells of transgenic plants as well as cut or severed flowers or stems from transgenic plants.

Description

A PLANT REGULATORY GENE

The present invention relates generally to a plant regulatory gene and derivatives and homologues thereof. More particularly, the present invention provides a nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides, the expression of which, modulates or otherwise facilitates activity of a cytochrome P450 protein in plant cells and tissues including petals, flowers, stems, leaves and seeds. Even more particularly, the nucleic acid molecule of the present invention encodes a cytochrome b₅ or a mutant, part, fragment, portion, functional and/or structural equivalent or homologue thereof or agonist or antagonist thereof involved in modulating or otherwise facilitating activity of a dihydrokaempferol (DHK) hydroxylating enzyme such as but not limited to flavonoid 3', 5 '-hydroxylase. The present invention further provides transgenic plants or parts thereof or cells of transgenic plants as well as cut or severed flowers or stems from transgenic plants.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

The subject specification contains nucleotide and amino acid sequence information prepared using the programme Patentln Version 2.0, presented herein after the bibliography. Each nucleotide or amino acid sequence is identified in the sequence listing by the numeric indicator <210 > followed by the sequence identifier (e.g. <210> 1, <210> 2, etc). The length, type of sequence (DNA, protein (PRT), etc) and source organism for each nucleotide or amino acid sequence are indicated by information provided in the numeric indicator fields <211 > , <212 > and <213 > , respectively. Nucleotide and amino acid sequences referred to in the specification are defined by the information provided in numeric indicator field < 400 > followed by the sequence identifier (eg. <400 > 1, < 400 > 2, etc). The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.

Bibliographic details of the publications numerically referred to in this specification are collected at the end of the description.

The flower industry strives to develop new and different varieties of flowering plants. Altering flower colour has become a particularly important aim in the research and development undertaken by or on behalf of the flower industry.

Classical breeding techniques have been successfully employed to develop new flowering varieties. However, the generation of plants with desired traits is constrained by, for example, the species' gene pool, a development process which is time consuming and a frequently low success rate. The rapidly increasing sophistication of genetic engineering techniques offers a great opportunity to develop new varieties of plants without some or all of the above constraints.

One important area of flowering plant development is the generation of plants with altered flower colour. Flower colour is predominantly due to two different pigments: flavonoids and carotenoids. The flavonoids contribute to a range of colours from yellow to red to blue. Carotenoids impart an orange or yellow tinge. Particularly important flavonoid molecules include the anthocyanins which are glycosylated derivatives of cyanidin, delphinidin, petunidin, peonidin, malvidin and pelargonidin.

The biosynthetic pathway for flavonoid pigments (hereinafter referred to as the "flavonoid pathway") is now well established (1). The essence of the pathway is a condensation of three molecules of malonyl-CoA with one molecule of -coumaroyl-CoA which is catalysed by chalcone synthase. The product of this reaction, 2', 4, 4', 6'- tetrahydroxychalcone, is generally rapidly isomerised to produce naringenin by chalcone flavanone isomerase. Naringenin is subsequently hydroxy lated at the 3' position of the central ring by flavanone 3 -hydroxylase to produce dihydrokaempferol (DHK).

The B-ring of the DHK can be hydroxylated at either the 3' or both 3' and 5' positions to produce dihydroquercetin (DHQ) and dihydromyricetin (DHM), respectively. Two key enzymes involved in this pathway are flavonoid 3 '-hydroxylase (hereinafter referred to as "F3'H") and flavonoid 3', 5 '-hydroxylase (hereinafter referred to as "F3'5'H").

F3'H acts on DHK to produce DHQ and on naringenin to produce eriodicytyol. F3'5'H is a broad spectrum enzyme catalysing hydroxylation of naringenin and DHK in the 3' and 5' positions, in both instances producing pentahydroxyflavanone and DHM, respectively, as well as catalysing hydroxylation of DHQ in the 5' position. The essence of these catalysed reactions is shown in Figure 1 (1).

The ability to control F3'H and F3'5'H activity in plants provides a means to manipulate flower colour. This is successfully described, for example, in International Patent

Application Nos. PCT/AU92/00334, PCT/AU93/00127 and PCT/AU94/00265. Levels of F3'H and F3'5'H can be manipulated using genetic means such as altering promoter strength, using anti-sense and ribozyme technologies and through co-suppression. It is important, however, to fully elucidate the endogenous regulatory mechanisms for these and other flavonoid pathway enzymes. Such knowledge can lead to even greater modulation of enzyme activity, especially in plants where expression of, for example, a F3'5'H gene is low.

In work leading up to the present invention, the inventors sought to identify genes involved in the regulation of anthocyanin modification. In accordance with the present invention, the inventors have now identified a molecule which modulates or other otherwise facilitates activity of a flower cytochrome P450.

The present invention is predicated in part on the isolation of a genetic sequence which encodes a polypeptide which represents a novel class of plant cytochrome b₅ (Cyt b₅) molecules. The genetic sequence of the present invention is referred to and exemplified herein by "difF" which includes a sequence of nucleotides or complementary sequence of nucleotides which encodes the Cyt b₅, i.e., DIF-F, or a mutant, part, fragment, portion thereof or a functional and/or structural equivalent or homologue thereof. For convenience, all such mutants, parts, fragments and portions are referred to herein as a "derivative" or "derivatives". A "derivative" includes mutants, parts, fragments, portions, variants and fusions of the Cyt b₅ protein or corresponding difF gene as well as single or multiple nucleotide substitutions, additions and/or deletions of difF. A "derivative" may also include an agonist or antagonist of Cyt b₅. The term "difF" includes a genomic DNA isolate as well as a cDNA molecule or a chemically prepared molecule generated by the stepwise addition of nucleotides or chemical equivalents thereof. The term "difF" is generically used herein to encompass any molecule encoding a Cyt b₅ or a derivative or homologue thereof and which modulates or otherwise facilitates activity of a Cyt p450 such as but not limited to Cyt P450's involved or otherwise associated with the hydroxylation of a flavonoid compound. An example, the Cyt b₅ or derivative might impact on the activity of a Cyt P450 or may indirectly act via a reductase such as NADPH cytochrome P450 reductase.

Accordingly, one aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof.

More particularly, the present invention is directed to an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof wherein said Cyt b₅ modulates or otherwise facilitates activity of a Cyt P450. Even more particularly, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof wherein said Cyt b₅ modulates or otherwise facilitates activity of a Cyt P450 wherein the Cyt P450 comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X

(R/H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position.

Still more particularly, the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof wherein said Cyt b₅ modulates or otherwise facilitates activity of a Cyt P450 enzyme comprising the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X (PJH/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position and which Cyt P450 is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

The preferred Cyt b₅ of the present invention is DIF-F which modulates or otherwise facilitates activity of F3'5'H. However, the present invention extends to other Cyt b₅ molecules which facilitate activity of any Cyt P450 capable of directly or indirectly hydroxy lating a flavonoid compound. The present invention is hereinafter described with reference to a Cyt b₅ and its activity on F3'5'H but this is done with the understanding that the present invention extends to any member of the Cyt b₅ family especially those involved in the direct or indirect hydroxylation of a flavonoid compound. Examples of other enzymes which are modified or otherwise facilitated by Cyt b₅ include but are not limited to F3'H.

Although not intending to limit the invention to any one theory or mode of action, Cyt b₅ molecules are believed to interact with cytochrome P450 via electrostatic interactions. These interactions are determined by the primary as well as the tertiary structure of the proteins. An amino acid sequence alignment of petunia Cyt b₅ with other plant Cyt b₅ sequences reveals two regions in the petunia Cyt b₅ sequence that have insertions of six (SELELN) and nine (EDPKPKYLT) amino acids in length. Furthermore, petunia Cyt b₅ protein has a net positive charge while other plant cytochrome b₅ proteins have a net negative charge. These insertions, which result in a longer petunia Cyt b₅ as well as a change in its charge distribution, may influence the interaction of petunia Cyt b₅ with cytochrome P450 proteins such as petunia F3'5'H.

The difF of the present invention is considered to reside on a separate phylogenetic branch to known Cyt b₅ genes. The preferred novel Cyt b₅ molecule encoded by difF comprises the amino acid sequence YKASDDSELELNLVTDSIKEPN or an amino acid sequence having at least about 70% similarity thereto. Even more preferably, the Cyt b₅ of the present invention comprises the amino acid sequence:

[X. ₂ X KE [X X₂' X_n ]F [X," X₂" X"_n2]

YKASDDSELELNLVTDSIKEPNDSIKEPN [X_!'" X₂'" X'"_n3] EDPKPYLTFVEY

wherein [X, X₂ XJ, [X X₂' X'_nι'], [_Xl" X₂" ........X"_n2] and [Xj " ' X₂ " ' X " '„₃ " '] are sequences of any amino acid residues up to n, , and r^ amino acid residues in length wherein n, n_l5 n₂' and n₃' may be the same or different and each is from about 1 to about 200.

In a preferred aspect of the present invention, there is provided an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof wherein said Cyt b₅ molecule modulates or otherwise facilitates activity of F3'5'H or a derivative, homologue or functional equivalent thereof.

Preferably, the Cyt b₅ is expressed substantially exclusively in the flower although any Cyt b₅ is contemplated by the present invention provided it modulates or otherwise facilitates activity of a Cyt P450 molecule. In a particularly preferred embodiment, the Cyt b₅ modulates or otherwise facilitates activity of F3'5'H in flowers.

According to this preferred embodiment, there is provided an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a Cyt b₅ molecule or a derivative, homologue or functional equivalent thereof wherein said Cyt b₅ modulates or otherwise facilitates activity of F3'5'H or a derivative, homologue or functional equivalent thereof substantially exclusively in flowers.

In one particular embodiment, the Cyt b₅ modulates or otherwise facilitates activity of F3'5'H in flowers. In another embodiment, over expression of difF may also enhance F3'H activity.

Although not intending to limit the present invention to any one theory or mode of action the Cyt b₅ of the present invention may act at the level of activity of hydroxylating enzyme (e.g. F3'5'H), at the level of gene transcription (e.g. a transcription regulator) or at the level of translation. The Cyt b₅ may also act alone or in association with another molecule. For example, the Cyt b₅ may form a complex with another molecule, e.g. a reductase, and the Cyt b₅ complex may then act on the hydroxylating enzyme or its genetic sequence. Alternatively, the Cyt b₅ molecule may require the interaction of another molecule at the level of hydroxylating enzyme or its genetic sequence. In particular, one of Cyt b₅ or another molecule may interact with the flavonoid hydroxylating enzyme or genetic sequence encoding same and simultaneously or sequentially, the other of the Cyt b₅ or another molecule may also interact with the flavonoid hydroxylating enzyme or its genetic sequence. The effect(s) of the Cyt b₅ on modulating or otherwise facilitating activity of the hydroxylating enzyme may require interaction of both Cyt b₅ and the other molecule.

The preferred Cyt b₅ is DIF-F and comprises the amino acid sequence substantially as set forth in <400 > 2. Accordingly, another aspect of the present invention provides an isolated nucleic acid molecule comprising a sequence of nucleotides or complementary sequence of nucleotides encoding a Cyt b₅ protein or a derivative, homologue or functional equivalent thereof having the amino acid sequence substantially as set forth in <400>2 or an amino acid sequence having at least about 30% similarity thereto and which Cyt b₅ or derivative, homologue or functional equivalent modulates or otherwise facilitates activity of a flavonoid hydroxylating enzyme such as but not limited to F3'5'H.

The percentage amino acid similarity may be at least about 40%, or at least about 50%, or at least about 60%, or least about 70%, or at least about 80% , or at least about 90-95% or greater to the amino acid sequence set forth in <400 >2.

Yet another aspect of the present invention contemplates an isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary sequence encoding a Cyt b₅ or a derivative, homologue or functional equivalent thereof wherein the nucleotide sequence is substantially as set forth in <400 > 1 or a nucleotide sequence having at least 30% similarity thereto or is a nucleotide sequence capable of hybridizing to <400> 1 under low stringency conditions at 42°C.

The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. In a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity. Any number of programs are available to compare nucleotide and amino acid sequences. Preferred programs have regard to an appropriate alignment. One such program is Gap which considers all possible alignment and gap positions and creates an alignment with the largest number of matched bases and the fewest gaps. Gap uses the alignment method of Needleman and Wunsch (18). Gap reads a scoring matrix that contains values for every possible GCG symbol match. GAP is available on ANGIS (Australian National Genomic Information Service) at website http://mell.angis.org.au.

Preferably, the percentage identity is considered rather than percentage similarity. The term "identity" is used in its broadest sense to include the exact nucleotide or amino acid matches having regard to an appropriate alignment using a standard algorithm. Convenient algorithm in this regard include the Gene works program (Intelligenetics).

The percentage nucleotide similarity may be at least about 40%, or at least about 50% , or at least about 60%, or least about 70%, or at least about 80%, or at least about 90-95% or greater to the nucleotide sequence set forth in <400 > 1.

Reference herein to a low stringency at 42 °C includes and encompasses from at least about 0% v/v to at least about 15% v/v formamide and from at least about IM to at least about 2M salt for hybridisation, and at least about IM to at least about 2M salt for washing conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridisation, and at least about 0.0 IM to at least about 0.15M salt for washing conditions.

The present invention further provides isolated naturally occurring and recombinant or chemically synthetic forms of DIF-F or other related Cyt b₅ molecules or their derivatives, homologues or functional equivalents thereof. The molecules may be in isolated form or when present in a plant cell. The present invention further extends to antibodies to DIF-F and related Cyt b₅ molecules or their derivatives, homologues or functional equivalents. Such antibodies are useful in the immunological detection and/or analysis of plants. The present invention also extends to agonists and antagonists of the Cyt b₅ molecules. Conveniently, where appropriate, such agonists and antagonists come under the terms "derivative" or "derivatives".

It is proposed in accordance with the present invention that a functional Cyt b₅ (e.g. DIF-F encoded by difF) is required for activity of a flavonoid hydroxylating enzyme such as F3'5'H. The term "activity" includes full activity or enhanced, heightened or otherwise facilitated activity. Accordingly, it is further proposed that genetic constructs carrying a nucleotide sequence encoding a flavonoid hydroxylating enzyme such as but not limited to F3'5'H either contain a difF or a functional derivative, homologue or equivalent thereof or are used in conjunction with a genetic construct carrying a difF or its derivative, homologue or functional equivalent thereof.

Accordingly, another aspect of the present invention contemplates a genetic construct optionally further comprising cistrons encoding one or both of a Cyt P450 or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; and/or a reductase or other associated protein.

A single cistron comprises a coding sequence of a particular protein under the control of a promoter sequence. The coding sequence is said to be operably linked to the promoter sequence multiple cistrons may each be under the control of a promoter.

Generally, the Cyt b₅ modulates or otherwise facilitates activity of the Cyt P450 enclosed by the same genetic construct or a Cyt P450 on another genetic construct or encoded by the genome of a host cell.

An "associated protein" is a protein which catalyses the transfer of electrons from, for example, a co-enzyme to a prosthetic haem group on reductase. An associated protein may also have a role in facilitating interaction between a Cyt P450 and a reductase.

In another embodiment of the present invention, there is provided a genetic construct carrying difF or its functional derivative, homologue or equivalent thereof said genetic construct further comprising a gene for a flavonoid hydroxylating enzyme such as but not limited to a gene encoding a F3'5'H or a functional derivative, homologue or equivalent thereof.

Another aspect of the present invention provides a transgemc plant or part thereof or cells therefrom comprising genetic material encoding a Cyt b₅ molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof.

A "part" of a plant includes plant cells and tissues such as petals, flowers, stems, leaves and seeds. Parts of plants include cut or severed flowers.

Yet another aspect of the present invention contemplates a transgenic plant or parts thereof or cells of a transgenic plant, said plant or plant cells comprising genetic material corresponding to difF or a functional derivative, homologue or equivalent thereof and optionally a gene encoding an F3'5'H or its derivative, homologue or equivalent.

As stated above, reference to cells of a transgenic plant includes reference to tissues and organs of a plant. Reference to "parts" of a transgenic plant includes flowers (e.g. cut flowers) or flowering plants such as petals.

The present invention also extends to other cells containing or carrying the genetic constructs herein described. Such other cells include yeast cells and bacterial cells.

In petunia, the alleles encoding F3'5'H are referred to as "hfl " and "hf2 ". It is proposed, in accordance with the present invention, that difF and/or the product of difF (DIF-F) have a role in facilitating activity of F3'5'H or expression of a gene encoding F3'5'H or its derivatives or homologues or other flavonoid pathway enzymes such as F3 Η or its genetic sequences. The present invention extends, however, to the effects of difF or its product DIF-F or other related Cyt b₅ molecule on any gene or allele encoding an F3'5'H or a functional derivative, homologue or equivalent thereof. The present invention also extends, in one particular embodiment, to the effect of difF or DIF-F facilitating or otherwise influencing expression of hfl and hf2.

Yet another aspect of the present invention provides a method of expressing a nucleotide sequence encoding a Cyt P450 or a functional derivative, homologue or equivalent thereof in a plant or cells of a plant, said method comprising introducing into said plant or cells of said plant a genetic construct in single or multicistronic form wherein at least one cistron encodes a Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; the genetic construct optionally further comprising cistrons encoding one or both of a Cyt P450 or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; and/or a reductase or other associated protein.

More particularly, the present invention contemplates a method of expressing a genetic sequence encoding an F3'5'H or functional derivative, homologue or equivalent thereof in a plant or cells of a plant, said method comprising introducing a difF gene or enhancing expression of a difF gene or a functional derivative, homologue or equivalent thereof for a time and under conditions sufficient for the product of difF to enhance or otherwise modulate expression of a gene encoding F3'5'H.

The present invention further extends to introducing genetic constructs containing separately or together a difF and/or a gene encoding F3'5'H or derivatives, homologues or equivalents thereof.

Preferably, the modulation of difF expression is substantially exclusively in the flowers of plants.

Still another aspect of the present invention provides for the use of a genetic construct comprising a nucleotide sequence encoding a Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof in the manufacture of a plant or cells of a plant in which said Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof enhances, modulates or otherwise facilitates expression of genetic material encoding a Cyt P450 or activity of a Cyt P450.

Still another aspect of the present invention is directed to the use of difF or a functional derivative, homologue or equivalent thereof in the manufacture of a genetic construct capable of enhancing, modulating or otherwise facilitating F3'5'H gene expression or F3 '5 'H activity.

The present invention also extends to flowers and cut flowers from transgenic plants and which comprises modified F3'5'H expression levels due to manipulation of difF expression. In particular, the present invention is directed to the modulation of flower colour. For example, various shades of blue flowers such as blue roses, carnations and chrysanthemums are contemplated by the present invention.

Although the present invention is particularly directed to the use of difF to enhance expression of F3'5'H, the manipulation of certain flower colours may require that the F3'5'H be down regulated. This can be effected by down regulating the expression of difF such as by antisense, co-suppression or ribozymes. Alternatively, an endogenous F3'5'H may be down regulated by targeting an endogenous difF and then an exogenous F3'5'H with an altered substrate specificity or activity introduced to again alter the flow of the metabolites to the flavonoid pathway. All such manipulations and modifications to the methods described therein are contemplated by the present invention.

The present invention is further described by the following non-limiting Figures and Examples.

In the Figures:

Figures la and lb are schematic representations of the flavonoid biosynthesis pathways in P. hybrida flowers showing the enzymes and genetic loci involved in the conversions. Enzymes involved in the pathway have been indicated as follows: PAL = phenylalanine ammonia-lyase; C4H = cinnamate 4-hydroxylase; 4CL = 4-coumarate: CoA ligase; CHS= chalcone synthase; CHI= chalcone isomerase; F3H= flavanone 3 -hydroxylase; F3Η= flavonoid 3'-hydroxylase; F3'5Η=- flavonoid 3'5' hydroxylase; FLS= flavonol synthase; DFR= dihydroflavonol-4-reductase; ANS= anthocyanin synthase; 3GT= UDP-glucose: anthocyanin-3-glucoside; 3RT= UDP-rhamnose: anthocyanidin-3-glucoside rhamnosyltransferase; ACT= anthocyanidin-3-rutinoside acyltransferase; 5GT= UDP- glucose: anthocyanin 5- glucosyltransferase; 3' OMT- anthocyanin O-methyltransferase; 3', 5' OMT=anthocyanin 3', 5' 0-methyltransferase. Three flavonoids in the pathway are indicated as: P-3-G= pelargonidin-3-glucoside; DHM=dihydomyricetin;

DHQ=dihydroquercetin. The flavonol, myricetin, is only produced at low levels and the anthocyanin, pelargonidin, is rarely produced in P. hybrida.

Figure 2 is a representation showing molecular analysis of difF. (A) Diagram showing the structure of difF. Exons are depicted as thick bars. The triangles indicate the position of dTphl insertions in the alleles difF-V2082 and difF-W2090. (B) Phylogenetic tree showing the homology of the DIF-F protein to a variety of Cyt b₅ proteins. (C) Alignment of the DIF-F protein with Cyt b₅ from mammals, plants and yeast. Amino acids conserved in more than half of the sequences are indicated by black shading.

Figure 3 is a photographic representation showing Northern blot analysis of difF expression. (A) difF expression in different tissues and (B) in the corolla limb at different stages (1-6) of development (2) (C) difF expression in the corolla limb of wild type (R27) and mutant lines (W162, W115, W134) for the regulators anl, an2 and anil. (D) difF mRNA corolla limbs homozygous for the mutable alleles difF-V2082 or difF-W2090 (m/m) and wildtype (+/+) siblings.

Figure 4 is a representation showing analysis of difF mutant flowers. (A) Phenotype of the diβ-W2090 allele in a hfl⁺rt⁺ (top) and a hfPrr background (bottom). (B) PCR analysis of the difF locus in homozygous mutable (m/m) and revertant (+/m) sectors in flowers in different hfl, hβ and rt genotypes. The intermediately sized fragments are heteroduplexes that consist of difF: :dTphl and a difF* strand. (C) HPLC analysis of anthocyanin aglycones accumulated in the same sectors. The identity and the molar ratios of the anthocyanin peaks were established by chromatography of pure compounds: del, delphinidin; cya, cyanidin: peo, peonidin; mal, malvidin. (D) F3'5'H enzyme activity in the petal limbs of plants with the indicated phenotype selected from the backcross populations.

Figure 5 is a representation of the nucleotide sequence < 400 > 1 and corresponding amino acid sequence < 400 > 2 of difF. The triangle marks the position of an intron. The underlined sequences mark the insertion sites in the two mutant alleles.

Figure 6a is a diagrammatic representation of the binary plasmid pCGP1280, construction of which is described in Example xx.. Abbreviations are as follows: Tet = the tetracycline resistance gene; LB = left border; RB = right border; surB = the coding region and terminator sequence from the acetolactate synthase gene; 35S = the promoter region from the cauliflower mosaic virus 35S transcript. Restriction enzyme sites are also marked.

Figure 6b to 6g are diagrammatic representations of intermediate plasmids used in the construction of pCGP1280 (Figure 6a). Restriction enzyme sites are also marked. Amp = ampicillin resistance gene.

Figure 6h is a schematic representation of the construction of the binary vector pCGP1280 (Figure 6a). pBS = pBluescript (Stratagene, USA). pANS= antocyanidin synthase promoter, anthocyanidin synthase terminator, Hfl=petunia flavonoid 3 '5' hydroxylase cDNA clone, 35S= cauliflower mosaic virus 35S promoter.

Figure 7a is a diagrammatic representation of the binary plasmid pCGP2355, construction of which is described in Example xx.. Abbreviations are as follows: Tet = the tetracycline resistance gene; LB = left border; RB = right border; surB = the coding region and terminator sequence from the acetolactate synthase gene; 35S = the promoter region from the cauliflower mosaic virus 35S transcript. Restriction enzyme sites are also marked.

Figures 7b to 7d are diagrammatic representations of intermediate plasmids used in the construction of pCGP2355 (Figure 7a). Restriction enzyme sites are also marked. Amp = 5 ampicillin resistance gene.

Figure 7e A schematic representation of the construction of the binary vector pCGP2355 (Figure 7a). AntCHS= Antirrhinum (snapdragon) chalcone synthase promoter difF/DifF= petunia cytochrome b₅ cDNA clone, D8=petunia lipid transfer protein 10 terminator.

Figure 8 is a photograph of transgenic and non-transgenic Exquisite carnation flowers. Transgenic Exquisite carnations transformed with the T-DNA contained in pCGP 1280 (b and c) produce flower of a similar colour to the non-transformed controls (a and d). 15 Transgenic Equisite carnations transformed with the T-DNA contained in pCGP2355 (e and f) produce flowers of a novel colour in the violet to deep purple range. Colour photographs are available upon request to the Applicant.

Figure 9 is a representation of an autoradiograph of an RNA blot probed with ³²P-labelled 20 fragments of the Hfl cDNA clone contained in ρCGP602 (Holton et al. , 1993) and difF contained in pCGP2353. A ~ 1.8 kb Hfl transcript was detected in the petals of the transgenic Exquisite carnations transformed with the T-DNA contained in pCGP2355 (Lanes 2 to 5) or pCGP1280 (Lanes 6 to 9). The same size transcript ws detected in the positive controls of petunia petals of cultivars V30 (Lne 10) and Old Glory Blue (Lane 25 11). As expected no Hfl transcript was detected in non-transgenic Exquisite petals (negative control) (Lane 1). A -0.6 kb difF transcript was only detected in the petals of the transgenic Ezquisite carnations transformed with the T-DNA contained in pCGP2355 (Lanes 2 to 5) and in the positive controls of petunia petals, cultivar V30 and OGB (Lane 10 and 11), respectively. Each lane contained a ~ lOμg sample of total RNA. A 30 photgraph of the ethidium bromide stained 255 rRNA band is shown as an indication of relative RNA levels. EXAMPLE 1 GENETIC PROCEDURES

Northern blot, PCR and sequence analyses were done as previously described (2). The petunia lines W138 (relevant genotype: anl-W138, hfl^', hfl, rf) and V30 (relevant genotype: Anl⁺, Hfl , Hf2⁺, Rt⁺) were maintained as inbred stocks for several generations and were grown under standard greenhouse conditions. Transposon insertion alleles of difF were isolated in the W138 background as previously described (3) using primers complementary to difF and dTphl and maintained by selfing. In the backcrosses of the difF mutant lines with V30, segregation of the unstable anI-W138 and the linked rt^' allele were scored visually, while the anthocyanin substitution pattern was assayed by TLC and in a few selected plants by HPLC. Segregation of hfl and hfl alleles was determined by RFLP analysis (4) and by PCR amplification of the region containing the dTphl insertions for the mutant difF alleles.

³²P-Labelling of DNA Probes

DNA fragments (50 to 100 ng) were radioactively labelled with 50 μCi of [a-³²P]-dCTP using an oligolabelling kit (Bresatec). Unincorporated [a-³²P]-dCTP was removed by chromatography on a Sephadex G-50 (Fine) column.

DNA Sequence Analysis

DNA sequencing was performed using the PRISM™ Ready Reaction Dye Primer Cycle Sequencing Kits from Applied Biosystems. The protocols supplied by the manufacturer were followed. The cycle sequencing reactions were performed using a Perkin Elmer PCR machine (GeneAmp PCR System9600) and run on an automated 373A DNA sequencer (Applied Biosystems).

Homology searches against Genbank, SWISS-PROT and EMBL databases were performed using the FASTA and TFASTA programs (Pearson and Lipman, 1988) or BLAST programs (Altschul et al, 1990). Percentage sequence similarities were obtained using the LFASTA program (Pearson and Lipman, 1988). In all cases ktup values of 6 for nucleotide sequence comparisons and 2 for amino acid sequence comparisons were used, unless otherwise specified.

Multiple sequence alignments (ktup value of 2) were performed using the ClustalW 5 program incorporated into the Mac Vector™ 6.0 application (Oxford Molecular Ltd.).

Low stringency hybridization conditions

Hybridization conditions included a prehybridization step in 10% (v/v) formamide, 1 M NaCl, 10% (w/v) dextran sulphate, 1% (w/v) SDS at 42 °C for at least 1 hour. The 10 ³²P-labelled fragments (each at lxltf cpm/mL) were then added to the hybridization solution and hybridization was continued at 42 °C for a further 16 hours. The filters were then washed in 2 x SSC, 1% (w/v) SDS at 42 °C for 2 x 1 hour and exposed to Kodak XAR film with an intensifying screen at -70 °C for 16 hours.

15 RNA blots

Total RNA was isolated from the petal tissue of Exquisite carnation flowers using an RNAeasy kit from QIAGEN and following the protocols supplied by the manufacturer.

RNA samples were electrophoresed through 2.2 M formaldehyde/ 1.2% (w/v) agarose 0 gels using running buffer containing 40 mM morpholinopropanesulphonic acid (pH 7.0), 5 mM sodium acetate, 0.1 mM EDTA (pH 8.0). The RNA was transferred to Hybond-N filters (Amersham) as described by the manufacturer.

Hybridization and washing conditions 5 RNA blots were probed with P-labelled cDNA fragment (1 x lυ cpm/mL). Prehybridizations (1 hour at 42 °C) and hybridizations (16 hours at 42 °C) were carried out in 50% (v/v) formamide, 1 M NaCl, 1% (w/v) SDS, 10% (w/v) dextran sulphate. Filters were washed in 2 x SSC, 1% (w/v) SDS at 65 °C for 1 to 2 hours and then 0.2 x SSC, 1% (w/v) SDS at 65 °C for 0.5 to 1 hour. Filters were exposed to Kodak XAR

30 film with an intensifying screen at -70°C for 16 hours. EXAMPLE2 CHEMICAL PROCEDURES

Total anthocyanins of flower corolla sectors were extracted and hydrolysed by boiling in 1 ml 2N HCl for 30 min. The anthocyanin aglycones were analysed on a gradient HPLC system equipped with a Vydac C₁₈ reversed phase column (5 μm; 250 x 4.6 mm) and a SPD-MlOAvp diode array UV-detector (Shimadzu, Kyoto, Japan). Samples were eluted at 40°C, at a flow rate of 1 ml/min. Anthocyanins were monitored at 547 nm and dihydroflavonols at 280 nm. Solvent system used: a linear gradient elution for 22.5 min from 10 to 75% solvent B (1.5% phosphoric acid, 20% acetic acid and 25% acetonitrile in water) in solvent A (1.5% phosphoric acid in water). Anthocyanins were identified and quantified by comparison with the retention times and peak areas from standards. F3'5'H activity was measured with dihydroquercetin as a substrate as previously described (5), except that formation of the dihydromyricetin product was monitored by HPLC.

EXAMPLE3 TRANSFORMATIONPROCEDURES

A. tumefaciens transformations

The plasmids pCGP1280 or pCGP2355 (Figures 6a and 7a) are introduced into the Agrobacterium tumefaciens strain AGL0 by adding 5 μg of plasmid DNA to 100 μL of competent AGL0 cells prepared by inoculating a 50 mL MG/L (II) culture and growing for 16 hours with shaking at 28 °C. The cells were then pelleted and resuspended in 0.5 mL of 85% v/v 100 mM CaCl₂/15% v/v glycerol. The DNA- Agrobacterium mixture was frozen by incubation in liquid N₂ for 2 minutes and then allowed to thaw by incubation at 37° C for 5 minutes. The DN A/bacterial mix was then placed on ice for a further 10 minutes. The cells are then mixed with 1 mL of LB (Sambrook et al, 1989) media and incubated with shaking for 16 hours at 28°C. Cells of A. tumefaciens carrying pCGP1280 or pCGP2355 are selected on LB agar plates containing 50 μg/mL tetracycline. The presence of pCGP1280 or pCGP2355 is confirmed by Southern analysis of DNA isolated from the tetracycline-resistant transformants.

Petunia transformations

(a) Plant Material

Leaf tissue from mature plants is treated in 1.25% w/v sodium hypochlorite for 2 minutes and then rinsed three times in sterile water. The leaf tissue is then cut into 25 mm2 squares and precultured on MS media (13) supplemented with 0.05 mg/1 kinetin and 1.0 mg/1 2,4-dichlorophenoxyacetic acid (2,4-D) for 24 hours.

(b) Co-cultivation of Agrobacterium Tissue

Agrobacterium tumefaciens strain AGL0 containing genetic material is maintained at 4°C on MG/L agar plates with 100 mg/L gentamycin. A single colony is grown overnight in liquid medium containing 1 % w/v Bacto-peptone, 0.5% w/v Bacto-yeast extract and 1 % w/v NaCl. A final concentration of 5 x 10^ cells/ml is prepared the next day by dilution in liquid MS medium containing B5 vitamins (14) and 3% w/v sucrose (BPM). The leaf discs were dipped for 2 minutes into BPM containing AGLO/genetic material. The leaf discs are then blotted dry and placed on co- cultivation media for 4 days. The co-cultivation medium consists of SH medium (15) supplemented with 0.05 mg/1 kinetin and 1.0 mg/12,4-D and included a feeder layer of tobacco cell suspension spread over the co-cultivation medium with a filter paper placed on top of the tobacco cell suspension.

(c) Recovery of transgenic plants

After co-cultivation, the leaf discs are transferred to a selection medium (MS medium supplemented with 3% w/v sucrose, α-benzylaminopurine (BAP) 2 mg/1, 0.5 mg/1 α-naphthalene acetic acid (NAA), kanamycin 300 mg/1, 350 mg/L cefotaxime and 0.3% w/v Gelrite Gellan Gum (Schweizerhall)). Regenerating explants are transferred to fresh selection medium after 4 weeks. Adventitious shoots which survive the kanamycin selection are isolated and transferred to BPM containing 100 mg/1 kanamycin and 200 mg/1 cefotaxime for root induction. All cultures are maintained under a 16 hour photoperiod (60 μmol. m², s^"1 cool white fluorescent light) at 23 ± 2°C. When roots reach 2-3 cm in length the transgenic petunia plantlets are transferred to autoclaved Debco 51410/2 potting mix in 8 cm tubes. After 4 weeks, plants are replanted into 15 cm pots, using the same potting mix, and maintained at 23 °C under a 14 hour photoperiod (300 μmol. m ², s^"1 mercury halide light).

Flower Colour coding The colour codes are taken from the Royal Horticultural Society's Colour Chart (RHSCC).

EXAMPLE 4 TRANSFORMATION OF DIANTHUS CARYOPHYLLUS CV. EXQUISITE

The binary vectors pCGP1280 or pCGP2355 were introduced into A. tumefaciens strain AGL0 cells, as described in Example . The pCGP1280/AGL0 or pCGP2355/AGL0 cells were used to transform carnation plants.

(a) Plant Material

Dianthus caryophyllus (cv. Exquisite) cuttings are obtained Baguely F & I, Flower and Plant Growers, Heatherton Road, Clayton South, Victoria, Australia. The outer leaves are removed and the cuttings are sterilised briefly in 70% v/v ethanol followed by 1.25% w/v sodium hypochlorite (with Tween 20) for 6 min and rinsed three times with sterile water. All the visible leaves and axillary buds are removed under the dissecting microscope before co-cultivation.

(b) Co-cultivation of Agrobacterium and Dianthus Tissue

Agrobacterium tumefaciens strain AGL0 (19), containing the binary vector pCGP1280 or pCGP2355, is maintained at 4°C on LB agar plates with 50 mg/L tetracycline. A single colony is grown overnight in liquid LB broth containing 50 mg/L tetracycline and diluted to 5 x 10 cells/mL next day before inoculation. Dianthus stem tissue is co- cultivated with Agrobacterium for 5 days on MS medium supplemented with 3% w/v sucrose, 0.5 mg/L BAP, 0.5 mg/L 2,4-dichlorophenoxy-acetic acid (2,4-D), 100 mM acetosyringone and 0.25% w/v Gelrite (pH 5.7).

(c) Recovery of Transgenic Dianthus Plants

For selection of transformed stem tissue, the top 6-8 mm of each co-cultivated stem is cut into 3-4 mm segments, which were then transferred to MS medium (13) supplemented with 0.3% w/v sucrose, 0.5 mg/L BAP, 0.5 mg/L 2,4-D, 1 μg/L chlorsulfuron, 500 mg/L ticarcillin and 0.25% w/v Gelrite. After 2 weeks, explants are transferred to fresh MS medium containing 3% w/v sucrose, 0.16 mg/L thidiazuron (TDZ), 0.5 mg/L indole-3 -butyric acid (LBA), 2 μg/L chlorsulfuron, 500 mg/L ticarcillin and 0.25% w/v Gelrite and care is taken at this stage to remove axillary shoots from stem explants. After 3 weeks, healthy adventitious shoots are transferred to hormone free MS medium containing 3% w/v sucrose, 5 μg/L chlorsulfuron, 500 mg/L ticarcillin, 0.25% w/v Gelrite. Shoots which survive 5 μg/L chlorsulfuron are transferred to the same medium for shoot elongation.

Elongated shoots are transferred to hormone-free MS medium containing 5 μg/L chlorsulfuron, 500 mg/L ticarcillin and 0.4% w/v Gelrite, in glass jars, for normalisation and root production. All cultures are maintained under a 16 hour photoperiod (120 mE/m /s cool white fluorescent light) at 23± 2°C. Normalised plantlets, approximately 1.5-2 cm tall, were transferred to soil (75% perlite/25% peat ) for acclimation at 23 °C

2 under a 14 hour photoperiod (200 mE/m /s mercury halide light) for 3-4 weeks. Plants were fertilised with a carnation mix containing lg/L CaNO₃ and 0.75 g/L of a mixture of microelements plus N:P:K in the ratio 4.7:3.5: 29.2. EXAMPLE 5 TRANSFORMATION OF ROSA HYBRIDA

1. Rosa hybrida Plant tissues of the rose are transformed according to the method disclosed in PCT/AU91/04412, having publication number WO92/00371.

2. Rosa hybrida a. Plant Material Kardinal shoots are used. Leaves are removed and the remaining shoots (5-6 cm) are sterilized in 1.25 % w/v sodium hypochlorite (with Tween 20) for 5 minutes followed by three rinses with sterile water. Isolated shoot tips are soaked in sterile water for 1 hour and precultured for 2 days on MS medium containing 3 % w/v sucrose, 0.1 mg/L BAP, 0.1 mg/1 kinetin, 0.2 mg/1 Gibberellic acid, 0.5% w/v polyvinyl pyrrolidone and 0.25% w/v Gelrite Gellan Gum, before co-cultivation.

b. Co-cultivation of Agrobacterium and Rosa shoot Tissue

Agrobacterium tumefaciens strains ICMP 8317 (18) and AGL0, containing genetic a particular construct are maintained at 4°C on MG/L agar plates with 100 mg/L gentamycin. A single colony from each Agrobacterium strain is grown overnight in o liquid MG/L broth. A final concentration of 5 x 10 cells/ml is prepared the next day by dilution in liquid MG/L. Before inoculation, the two Agrobacterium cultures are mixed in a ratio of 10: 1. A longitudinal cut is made through the shoot tip and an aliquot of 2 μl of the mixed Agrobacterium cultures is placed as a drop on the shoot tip. The shoot tips are co-cultivated for 5 days on the same medium used for preculture.

Agrobacterium tumefaciens strain AGL0 is maintained at 4°C on MG/L agar plates with 100 mg/L kanamycin. A single colony from each Agrobacterium strain is grown overnight in liquid MG/L broth. A final concentration of 5 x 10 cells/ml is prepared the next day by dilution in liquid MG/L. c. Recovery of Transgenic Rosa Plants

After co-cultivation, the shoot tips are transferred to selection medium. Shoot tips are transferred to fresh selection medium every 3-4 weeks. Galls observed on the shoot tips are excised when they reached 6-8 mm in diameter. Isolated galls are transferred to MS medium containing 3% w/v sucrose, 25 mg/1 kanamycin, 250 mg/1 cefotaxime and 0.25% w/v Gelrite Gellan Gum for shoot formation. Shoots regenerated from gall tissue are isolated and transferred to selection medium. GUS histochemical assay and callus assay are used to identify transgenic shoots. Transgenic shoots are transferred to MS medium containing 3% w/v sucrose, 200 mg/1 cefotaxime and 0.25% w/v Gelrite Gellan Gum for root induction. All cultures are maintained under 16 hour photoperiod (60 μE cool white fluorescent light) at 23 ± 2°C. When the root system is well developed and the shoot reached 5-7 cm in length the transgenic rose plants are transferred to autoclaved Debco 514110/2 potting mix in 8 cm tubes. After 2-3 weeks plants are replanted into 15 cm pots using the same potting mix and maintained at 23 °C under a 14 hour photoperiod (300 μE mercury halide light). After 1-2 weeks potted plants are moved to glasshouse (Day/Night temperature : 25- 28°C/14°C) and grown to flowering.

EXAMPLE 6 TRANSFORMATION OF CHRYSANTHEMUM MORIFOLIUM

a. Plant Material

Chrysanthemum morifolium cuttings are obtained. Leaves are removed from the cuttings, which were then sterilized briefly in 70% v/v ethanol followed by 1.25% w/v sodium hypochlorite (with Tween 20) for 3 minutes and rinsed three times with sterile water. Internodal stem sections are used for co-cultivation.

b. Co-cultivation of Agrobacterium and Chrysanthemum Tissue

Agrobacterium tumefaciens strain LBA4404 (Hoekema et al 1983), containing is grown on MG/1 agar plates containing 50 mg/1 rifampicin and 10 mg/1 gentamycin.

A single colony from each Agrobacterium is grown overnight in the same liquid medium. These liquid cultures are made 10% v/v with glycerol and 1 ml aliquots transferred to the freezer (-80°C). A 100-200μl aliquot of each frozen Agrobacterium is grown overnight in liquid MG/1 containing 50 mg/1 rifampicin and 10 mg/1 o gentamycin. A final concentration of 5 x 10 cells/ml is prepared the next day by dilution in liquid MS containing 3% w/v sucrose. Stem sections are co-cultivated with Agrobacterium in co-cultivation medium for 4 days.

c. Recovery of Transgenic Chrysanthemum Plants

After co-cultivation, the stem sections were transferred to selection medium. After 3-4 weeks, regenerating explants are transferred to fresh medium. Adventitious shoots which survive the kanamycin selection are isolated and transferred to MS medium containing kanamycin and cefotaxime for shoot elongation and root induction.

All cultures are maintained under a 16 hour photoperiod (80 μE cool white fluorescent light) at 23 ± 2°C. Leaf samples are collected from plants which rooted on kanamycin and Southern blot analysis is used to identify transgenic plants. When transgenic chrysanthemum plants reach 4-5 cm in length, they are transferred to autoclaved Debco 51410/2 potting mix in 8 cm tubes. After 2 weeks, plants are replanted into 15 cm pots using the same potting mix and maintained at 23 °C under a 14 hour photoperiod (300 μE mercury halide light). After 2 weeks potted plants are moved to glasshouse (Day/Night temperature : 25-28°C/14°C) and grown to flowering.

EXAMPLE 7 PLANTS

The Exquisite carnation was employed for transformation experiments (Baguley F&I, Flower & Plant Growers, Heatherton Road, Clayton South, Victoria, Australia), this carnation has a bicoloured flower. EXAMPLE 8 IDENTIFICATION OF difF

To identify additional genes involved in anthocyanin modification, the inventors isolated cDNAs corresponding to genes that are down-regulated in flowers with a mutation in the regulatory anthocyanin- 1 (anl) gene (6). Based on its sequence, one gene, potentially involved in flavonoid hydroxylation, was chosen for detailed analysis. This gene, termed herein "difF", encodes a polypeptide of 149 amino acids that represents a novel class of plant Cyt b₅ proteins (Fig. 2b, c). The highest degree of similarity is clustered around the pairs of histidine residues (His-39 and His-63) that correspond to the axial ligands for heme binding (7). Although the Cyt b₅ sequences show strong divergence in the C-terminal part of the polypeptide, they have a strikingly similar hydropathy plot. This hydrophobic C-terminal part anchors the enzyme to the endoplasmic reticulum (ER) membrane (7).

EXAMPLE 9 EXPRESSION OF difF

To examine the function of difF in anthocyanin biosynthesis, its expression pattern was analysed by Northern blots and compared to the expression pattern of the dfr gene, encoding dihydroflavonol 4-reductase, a key enzyme of the anthocyanin pathway. Fig. 3 A shows that the difF transcripts accumulate in the limb and tube of the flower corolla and in the ovaries, but not in vegetative organs such as leaves, root and stem. During petal development the temporal difF expression pattern closely matches that of the gene encoding dihydroflavonal reductase (dfr), with both transcripts reaching a maximum around stage 3, when the flower bud starts to open

(Fig. 3B). To test if difF expression is controlled by any of the known regulators of the anthocyanin pathway, the inventors analysed difF transcript levels in stage 3 flowers (2) of the corresponding mutants. Fig. 3C shows that difF expression is down-regulated in petal limbs of anl^', an2 and anil mutants, when compared to wildtype. Although an2-W115 is a null allele, this mutation reduces anthocyanin synthesis strongly, but does not block it completely. This indicates that an2 function is partially redundant and explains the residual difF and dfr transcripts detected in an2-W115 petal limbs (Fig. 3C). Taken together, these data show that the spatio- temporal and genetic control of difF expression are consistent with a role in athocyanin synthesis.

EXAMPLE 10 ISOLATION OF difF MUTANTS

To establish the in vivo function of difF, the inventors isolated difF mutants by a PCR based screen (3) to identify plants of the line W138 in which a dTphl transposon had inserted in the difF gene. Among 4000 W138 plants, the inventors found that two individuals that were heterozygous for the wildtype difF* allele and a transposon insertion derivative (difF-V2082 and difF-W2090 respectively). Seeds were germinated from these individuals, that had been produced by self-pollination, and progeny homozygous for difF-V2082 and difF-W2090 identified by PCR. Sequence analysis showed that in difF-V2082 a 284 bp dTphl element had inserted in the first exon, 10 bp upstream of the splice-site, thereby disrupting the protein coding sequence. The difF-W2090 allele contained a 284 bp dTphl insertion in the middle of exon 2, that also disrupts the coding sequence, see Figure 5 for mapping of insertions. Northern analysis showed that flowers of difF-V2082 homozygous progeny accumulated difF transcripts that are about 300 bp larger than the wildtype difF transcript (Fig. 3D). By analogy to other dTphl insertion alleles this mutant transcript is likely to contain the transcribed dTphl sequence. In difF-W2090 homozygotes the amount of difF mRNA was reduced about three-fold when compared to difF* siblings. Since difiF-W2090 is relatively unstable, these transcripts most likely result from dTphl excisions and probably contain different transposon footprints. EXAMPLE 11 MUTATIONS OF difF AFFECTS FLOWER COLOUR

To study the effects of mutant difF alleles into an hfl* or hfl* genetic background, the inventors made backcrosses with line V30 {hfl*, hfl* , ant , i ), using difF mutant lines as the recurrent parent. As expected, these progenies (co-)segregated 1:1 for anl"¹""* mutable {anl ) and rt plants (Table 1). If the 5' substitution of anthocyanin is dependent on the segregation of hfl and hfl alone, one would expect to find plants accumulating malvidin (hfl* hfl* and hf*, hfl), malvidin plus peonidin (hfl^', hfl*; the relatively weak hfl locus enables the 5' substitution of only about 50% of the anthocyanins) or peonidin (hfl^' hfl) corolla pigments in a ratio 2:1:1. However, combined results of the two backcross populations segregating for difF- V2082 and difF-W2090, respectively showed a segregation ratio of 38:51:6 (Table 1). This suggested that a third mutant gene segregated that reduced the 5' substitution, possibly difF. To test this directly, the inventors subjected representative plants of the various phenotypic classes to Southern blot and PCR analyses to determine the hfl, hfl and difF genotype. This revealed that the malvidin accumulating plants were all hfl* difF* , while those accumulating a mixture of malvidin and peonidin were either hfl*, difF", hfl^' hfl* difF¹ or hfl^' hfl* difF* .

Closer inspection showed that the hfl* rt* individuals which were homozygous for the difF-W2090 allele had variegated flowers with purple (revertant) sectors and spots on a purplish magenta (mutant) background (Fig. 4A top). Also flowers of hfl^' hfl* difF" siblings were variegated, although the colour difference between mutant and revertant tissue was less pronounced. In an hfl* rt^' plants the variegation was seen as "dull-grey" revertant spots and sectors on a "dull-red" mutant background (Fig. 4A bottom). To test whether these variegated flower colours were due to genetic instability of the difF-W2090 allele, the inventors isolated DNA from several large revertant petal sectors and from the mutant corolla sectors and analysed the difF gene by PCR. Fig. 4B shows that reversion of the flower colour are associated with (somatic) excision of the dTphl element from difF-W2090. Also difF-V2068 individuals had variegated flowers, but the frequency of revertant spots was lower by at least one order of magnitude.

EXAMPLE 12 MUTATION OF difF REDUCES MODIFICATION OF THE

ANTHOCYANIN

To examine how the difF mutation affected flower colour, the inventors dissected (isogenic) difF* revertant and difF mutant sectors of single flowers and analysed the anthocyanin aglycones by HPLC. Some representative chromatograms are shown in Fig. 4C. In difF* revertant petal sectors on hfl ^' rt plants about 80% of the anthocyanins are 3', 5' substituted (delphinidin), while in dif mutant sectors of the same flower this amount is reduced to about 40% (Fig. 4C, top). The reduced delphinidin accumulation is correlated with an increase in the accumulation of 3' substituted and anthocyanin (cyanidin) from 20 to 63%. This indicates that the difF mutation reduced the formation of 3', 5' hydroxylated anmocyanins by about 50% and that the remaining precursors are converted into a 3' hydroxylated anthocyanin. The same phenomenon was observed in hfl*, rt* flowers. In this background, the difF- W2090 mutation reduced the fraction of 3', 5' substituted anthocyanins (malvidin) from 94 to 73%, which correlated with an increase in 3' substituted anthocyanin (peonidin) from 6 to 27% (Fig. 4C, middle). This indicated a 25% inhibition in the formation of 3', 5' substituted anthocyanins. In hfl^' hfl* tissue less than half of the anthocyanins were 3',5' substituted (44%), possibly because the hfl locus expresses lower amounts of F3'5'H protein, or a F3'5'H protein with lower activity. In this background a difF mutation decreased 3 ',5' substitution further down to 29%, corresponding to about 35% inhibition (Fig. 4C, bottom).

EXAMPLE 13 difF MUTATION REDUCES F3'5'H ACTIVITY

To test if difF stimulates 3', 5' substitution of anthocyanin precursors by regulating the activity of the CytP450 enzyme F3'5'H, the inventors measured F3'5'H activities in different genotypes. Because this required larger quantities of petal tissue, these measurements could not be performed on (isogenic) mutant and revertant sectors of single flowers. Instead, the inventors selected two or three plants from the V30 backcross populations for each genotype and determined F3'5'H enzyme activity in microsomes that were isolated from stage 4 petal limbs. Fig. 4D shows that the difF mutation reduced hfl encoded F3'5'H activity by about 20-fold, while hfl encoded F3'5'H activity was reduced approximately 3 -fold.

The data show unequivocally that in vivo, a Cyt b₅ (DIF-F) is required for activity of Cyt P450, F3'5'H, without an apparent effect on other Cyt P450 enzymes, such as those involved in 3 '-hydroxylation of dihydroflavonols, synthesis of the flavonoid precursor cinnamic acid, or synthesis of hormones controlling plant development. Both in vitro reconstruction experiments (7) as well as in vivo over-expression experiments in yeast (8) and human cells (9) have shown that the activity of a Cyt P450 can be increased 10 to 20 fold by co-expression of a Cyt b₅. Therefore, difF may provide a critical tool to increase the activity of a ? '57ι transgene in ornamental flowers that normally lack blue colours.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. EXAMPLE 14 SCREENING FOR EFFECTS OF CYT B₅ ON P450 MOLECULES

The effects of Cyt b₅ molecules on different P450 molecules such as F3'5'H or F3'H is determined using yeast. Details of suitable yeast strains and expression vectors is sshown in US Patent No. 5,349,125. In one embodiment, the petunia Cyt b₅ is incorporated into the genome of a yeast and genetic constructs encoding a Cyt P450 introduced into the cell. Expression of Cyt P450 may be measured by any number of ways. In relation to F3'5'H, for example, radiolabelled dihydrokoenpferol (DHK) or radiolabelled naringinin may be used. For other P450's, the product or substrate may be measured using, for example, HPLC, TLC or other suitable procedures.

Exquisite is a carnation cultivar that produces bi-coloured flowers with a deep red centre and a pale pink rim. The petals normally accumulate cyanidin, a 3',4'- hydroxylated anthocyanidin and the flavonolos quercetin and kaempferol (a 3 ',4'- hydroxylated flavonol and 4 '-hydroxylated flavonol, respectively).

Introduction of a petunia flavonoid 3 '5' hydroxylase (F3'5'H) under the control of a carnation ANS (anthocyanidin synthase) promoter (contained in pCGP1280 [Figure 6a]) results in either no or a slight alteration of petal colour with low levels of delphinidin (3 ',4', 5 '-hydroxylated anthocyanidin) [Figure la and lb] (Tables 2 and 3) being produced.

Introduction of the same chimeric F3'5'H (ANS:HF1:ANS) along with difF under the control of a snapdragon CHS (chalcone synthase) promoter both contained in pCGP2355 (Figure 7a) resulted in a major shift in flower colour. The flowers of the transgenic Exquisite/pCGP2355 flowers were deep purple with a pale purple rim (figure 8). HPLC analysis of the anthocyanidins and flavonol content of Exquisite/pCGP2355 showed that delphinidin (the 3',4',5'-hydroxylated anthocyanidin) was the predominant anthocyanidin produced. This result suggested that expression of the introduced difF along with the F3'5'H chimeric gene enhanced F3'5'H activity so that higher levels of delphinidin were produced compared to the expression of the F3'5'H chimeric gene with the absence of cytb₅.

Table 2

45-

Table 3

3 CΛ

∞

^■3

l --.-

ANSpromoter -> Restriction Map

DNA &*quence 2552 b.p. GAATTCACTCGA ... TCATAATCTAGA linear

Sau3A Mbo I Dpn I

Pie I Bel I

EcoR I Taq I Hinf I Mnl I Mae II

GAATTCACTCGAAATGATACTGTGAGTCTGCGATAGGCTCGTTTTGAGGCGGAAATTATGATTTTACG 80

CTTAAGTGAGCTTTACTATGACACTCAGACGCTATCCGAGCAAAACTCCGCCTTTAATACTAAAATGCTGCACTAGTTAA

24 46 69 24 72 73 73 73

Mbo II

Mse Bbv II HgiA I Nla III Hga I Dde I Bspl286 I

GAGCATGACTTAAATTTGCGTCTTCTCAGTCGTCGTTGCA^ 160

Taq I Sal I

Mse I HinC II Mbo II Bspl286 I

Rsa I Dra I EcoR V Ace I Ear I Mse I Mae II

I I I - I I I I I I I I

GTACATCGTTTTTAAAATGGATATCTTTTTGTTCTGGTCG^ 240

CATGTAGCAAAAATTTTACCTATAGAAAAACAAGACCAGCTGAATGAGAAG^

161 171 180 197 206 217 226 172 197 207 228

197

198

Mae II Mae I Afl III Mnl I Spe I BsaA I Hga I Taq I Rsa I

I I

CTACGTGTA^*rTCACAAAGGTATGACCGTGTTCTGTAGCGTC 320

GATGOVCATAAGTGTTTCCATACTGGCACAAGACATC^

I I • I ^{• •} I I ^• I I I •

242 277 300 314 243 302 316 243 317

Sau3A I Hp I

Mbo I Mae III

Dpn I BstE II te I Mnl I Mbo II Mnl

TCCGATAATAATTAGTATCGTTTTCΛTACTGATACTAGATCGGAGGTCACCATACCCGTGAAGATTTTTCTGTGAGAGGA 400 AGXXrTATTATTAATCATAGCAAAAGTATGACTATGATCTAGCCTCCAGTGGTATGGGCACTTCTAAAAAGACACTCTCCT

I I • I I I I ^• I ^• I ^•

355 363 380 396

358 365

358 366

358 367

Hga I Mse I

Sty I Aha II Hpa I Sec I Mnl I Nla III HinC II

AAAGAACCCAAGGACGAGGTTCAAATCTACACATGGAAAGACGCCACGCTO 480

TTTCTTGGGTTCCTGCTCCAAGTTTAGATGTGTACCTTTCTGCGGTGCGAAG^

408 416 432 457 408 440 457

440 458 ANSpromoter -> Restriction Map

HinP I Nla III

Hha I NspH I

Dde I Hae II Nsp752 I

Esp I Eco47 III Hph I Fo I PflM I Afl III

TCG MC^*rTAGCGTAMGCGCTGAACATCGTTTTICACCCTGCTI I II 560

AGCGAATCGCATCGCGACTTGTAGCAAAAGTGGGACGAGGTAGGTAGTTGGTAAATAACCAGAATATGTACACACTAACG

4 I8I3 • 4I9I2 5I0-9 5I20 5I30 5I4I7•

484 492 547

493 547

493 548 Fnu4H I Bbv I Alu I

Pvu II Pie I SfaN I Gsu I Mae I Taq I χ_Ca I

Hph I Mae II NSDB II Hinf I Ace I

I I I I I I I I I I I

GTTGTTCTTACATTTAGGTGAAAGACGTTTCTCCAGCTGCTAGGA^ 640

CAACAAGAATGTAAATCCACTTTCTGCAAAGAGGTCGACGATCCTCAGCTCTACGCTTTAACAGCAAACGCTGACATATG

I ^• I - I I I I I I I - I ^■ I

577 585 594 604 635

591 600 607 635

594 604 611

595

596

Nla III

Soh I

NspH I

Nsp7524 I

Nsi I

SfaN I

Fok I Mbo II BsmA I Tthlll I

I I I I I I I I

CTTGATAGAAATGGATGCATGCAAGTAAAGAAGGTATCTTCTAATTCATC 720

GAACTATCTTTACCTACGTACGTTCATTTCTTCCATAGAAGA^

^• M i l l - ^• I ^{• •} I ^{• •} I ^•

653 677 698 717

654 655 657 657 657 658

Mae II SnaB I BsaA I Alu I Hph I

I I I I

GGGTCTTTGGTTTGAGAAAGATAACAGCTTTACGTATTTTTC^ 800

CCCAGAAACCT-AACTCTTTCTATTGTCGAAATGCATAAAAACATCTACCCACTTTGGAAAAGT^

I ' l l ' I *

746 769

751 751 752

Sau3A I Mbo I Dpn I Bsr I SfaN I BsmA I Bel I

I I I I I

AGACGACAACTGGGCTTTAGGGGACACATTCTTTCAGGTATAATTGATGC^ 880

TCTGCTGTTGACCCGAAATCCCCTGTGTAAGAAAGTCCATATTAACTACGCTGATTGTTATCAGAGGTGACTAGTATAAG |. . . I . 'I ll

809 846 862 870

871 871 871 ANSpromoter -> Restriction Map

Mbo II Taq I

Ear I Mae II Ace I Mae II

I I I I I I

TACTCTTCTACGTTCGATACTGACTGTTTCTGGTTATTTGGTAGACAGGAGATTATTTGGACG^ 960

ATGAGAAGATGCAAGCTATGACTGACAAAGACCAATAAACCATCTGTCCTCTAATAAACCTGCATCGTTAAGTCATCGCA

8M83 8i90l ' ' ' 9I21 '9I41 '

884 894

Mae II

Afl III Mae I

Pml I Sty I

BsaA I Sec I

Afl III Ayr II

III II

AGAGATGTTTCCACACGTGTTATCGTAAAAGAAGCAAGATAAGCCTAATGCCTAGGGTGGTGGTATGACTTCCGTTG^ 1040 TCTC

Sau3A I

Mbo I

Dpn I

Pvu I

Taq I Mbo II Nla III

Cla I Tthlll II Mse I Mae I PspH

M

ATCGATCGTGCTTGTAAGTAATTTCCGTCTTATCTTTTCCTGTTAT 11₂0

TAGCTAGCACGAACA^*TTCATTAAAGGCAGAATAGAAAAGGACAATATATTTCAATTAGAAGAGATCCTGAAAGTACT^

1041 1049 1093 1103 1112 1042 1097 1113 1043 1044 1044 1044

Mae I Sau3A I Spe I

Mbo I Xca I

Dpn I Alu I Ace I

Tthlll II Taq I Nla III Mae I Mse I Mae II Mse I

TTGTTTGTGTATTTATTTCTCGATCAACATGATAGAGCTAGTTTTTAAGCAACGTATACTAGTAGTC 1200

AACAAACACATAAATAAAGAGCTAGTTGTACTATCTCGATCAAAAATTCGTTGCATATGATCATCAGATAACCTT^

1122 1 1114400 11114488 1 1115588 11116655 1 1117722 1197

1142 1156 1174

1142 1174

1142 1178 1179

Sau3A I

Mbo I

Dpn I Nla III

Alw I NspH I Mae I Pie I

Mse I Rsa I Nsp752 I Mbo II Hinf I

I . .

GACACGGTTCTTAAAAAGGTACGATCCAAGTGAAGCATGTTAGATATG^ 1280

CTGTGCC^ΛGAATTTTTCC^TGCTAGGTTCACTTCGTACAATCTATACTGTGAAAGAAGATCCCTGCTG^

•I I- I II • - I I- I •

1211 1219 1235 1255 1267

1223 1235 1259 1267

1223 1236

1223

Fok I SfaN I

Nsi I BsmA I

ACCCGACTTTTTCAATTTTTTTTGTGAATGTTAGATGTGTGTATATAATGCATC 1360

TGGGCTGAAAAAGTTAAAAAAAACACTTACAATCTACACACATATATTACGTAGG^

I I I - I

1328 1343

1330 1331 ANSpromoter -> Restriction Map

Sau3A I Sau3A I Mbo I Mbo I Dpn I Mse I Dpn I Taq I Ase I Mse I Bel I

GCCACCTACTT ICGIATCACTCGCTATCAATOTTAITITAATGCCTTGTTGATTTITAATAGTTIGIATCAATAATAGTAAAATCTA 1440 CGGTGGATGAAGCTAGTGAGCGATAGTTACAATAATTACGGAACAACTAAAATTATCAACTAGTTATTATCATTTTAGAT

• 1I37I1 - • 1I3I93 - 1I411 1I4I19 1373 1394 1420 1373 1420 1373 1420

Alu I Sac I HgiA I

Bspl286 I Nla IV BsmA I

Mae I Ase I Ban I Taq I Dde I BsmA I Mae III Ban II Mse I Mse I Hga I

I I I I I I I I I I I I I

TTCAAGGGTATAGTCTCCCGTTCACACTC^*ATCGGGGTTACACTAG^ 1520

AAGTTCCCATATCΛGAGGGCAAGTGTGAGTAGCCCCAATGTGATCG

1453 1476 1487 1495 1507 1515

1482 1494 1501 1511 1519

1487 1501 1513

1487

1488

Nla III

Sty I

Sec I

Neo I Sau3A I

Dsa I Mbo I

Mae I HinP I Dpn I

Tthlll I Hha I Hae III Alw I

Nla III Hae II Hae I Taq I Mae I

AAGAACTATACCATGACCTAGTCAGCGCCATGGGACTGATGTAGGCCACACAATCTCGATGATCCGAAAACGCTAGAGTT 1600 TTCTTGATATGGTACTGK_ATCAGTCGCGGTACCCTGACTACA^

^• I I I ^• I I I I - - I I ^• I - I - I

1532 1544 1563 1576 1593

1535 1545 1564 1581

1538 1545 1581

1548 1581

1548

1549

Sty I

Sec I

Neo I

Dsa I Mae I

Taq I Nla : III EcoR V BsmA I

Mae I BsmA I 1 Mae III BstU I I Taq I Drd I

CAAGACC ITAGTT ICG IAGAC ICIATGG ITCACGGTTTαΛCC IGCGIATATCTCAACAATGCAATTTTTTT MCGAGACiTAGACAGlACG 1680 GTTCTGGATCAAGCTCTGGTACCAGTGCCAAAGTTGGCGCTATA^

I ' M I I' I • I I • - I I I I

1607 1614 1623 1637 1664 1677 •

1612 1619 1640 1666

1618 1670

1760

ANSpromoter -> Restriction Map

Alu I Sac I ScrF I

HgiA I EcoR II

Bspl286 I Mae III

Dde I Ban II Mae I Tthlll II BstN I AACATTTCGTGTTC ITCAGACGIAIGCTCCTTTCGCITAGTTTGGTAAAC I I I LΒ40

TTGTAAAGCACAAGAGTCTGCTCGAGGAAAGCGATCAAACCATTTGAACAAACCACAATGGACCGAATAGTATCGGGTGA

^• I -II • I • I ' l l

1774 1781 1793 1808 1820

1781 1816

1781 1820

1782

Nla III NspH I Ace I Nsp7524 I

CAATTTGGCG-AAACATAACAATTGTTTCACATGCGAAGGTCTACAC^^ 1920

GTTAAACCGCTTTTGTATTGTTAACAAAGTGTACGCTTCCAGATGTC

1870 1870 1880 1871

Ξau3A I Mbo I Dpn I

Tthlll II Taq I

Taq I Mae II Cla I Bsr I

TATTATTGCCTTTCGAGCAATTTACGTTGTTTGAAGTTTGTGTAAAAACAAAATCGATCTATAAT^ 2000

ATAATAACGGAAAGCTCGTTAAATGCAACAAACTTCAAACACATTTTTGTTTTAGCTAGATATTAATGAC

1933 1944 1973 1991

1948 1974

1976

2018 2075

2018 2078

Alu I

Mse I Xmn I

TGAACTGAACTTATAAGAGTTGAACTGAACTTATAAGGGCTGAAATTA^ 2160

ACTTGACTTGAATATTCTCAACTTGACTTGAATATTCCCGA

2126 2138

2129

Mme I

Fok I Mnl I Pie I Hinf I Hinf I Mme I Mbo II Hinf I Taq I

TT G IAATCACTAAAGITTGIGATGIAAGATAGIAGGCGAGAAACGCTCCCCTTTCCACAGTTTGIACTCTACTICGIAATICCGACCA 2240 AAACTTAGTGATTTCAACCTACTTCTATCTCCGCTCTTTGCGAGGGGAAAGGTC

I • I I • I I- ^{• •} I 64 2175 2182 2220 2I22I8 I

21

2178 2189 2220 2230

2233 ANSpromoter -> Restriction Map

Xca I Fnu4H I Mnl I Bbv I

Fok I Bs I Nla III HσiE II Nla III Alu I Ace I

I I I I I I I I I

AAATTGGATGTAAATTAGAAGTGAGCATTCCTCATGCCAACCΛCCGTTCTTGGTCGTGAAAACATGA 2320

TTTAACCTACATTTAATCTTCACTCGTAAGGAGTACGGTTGGTGGCAAGAACCAGCACTTTTGTACTAAACATCGACGAC

2 I246^• - 2I265 I 2I273 - 2I283 ^• - 2I303 • 2I3I13 2I320

2270 2314

2314

2320 Mme I Mse I

I I

TATACTTCCf^AACCCGTGATAATCTGCCACACTTCCAACACTT^ 2400

ATATGAAGGGTTTGGGCACTATTAGACGGTGTGAAGGTTGTGAATTAACTAA

• • • I • I • • _{• •}

2355 2363

Mae III HinC II

TTTACTCCTAAACTATGCTGTCTTTTTACAAGTTG ITTACACC I 2480

AAATGAGGATTTGATACGACAGAAAAATGTTCAACAATGTGGAA^

2435 2446

Mae I Mse I Mnl I Xba I

AAAGACCATATAACTTCCCTACACTAATGCCACAACACT ITAAAAGCATAGAACACAAACICTCATAATICITAGA 2552

BIBLIOGRAPHY

1. Holten, T. Drug Metabolism and drug interactions 12: 359-368, 1995.

2. de Vetten, N. et al. Genes Dev. 11: 1422-1434, 1997.

3. Koes, R. et al. Proc. Natl. Acad. Sci. USA 81: 8149-8153, 1995.

4. Holton, T. A. et al. Nature 336: 276-279, 1993.

5. Menting et al. Plant Physiol. 106: 633-642, 1994.

6. Kroon et al. Plant J. 5: 69-80, 1994.

7. Vergeres, G & Waskell, L. Biochimie 77: 604-620, 1995.

8. Auchus et al. J. Biol. Chem. 273: 3158-3165, 1998.

9. Aoyama et al. Proc. Natl. Acad. Sci. USA 87: 5425-5429, 1990.

10. G. Vergeres & L. Waskell. Biochimie 77: 604-620, 1995.

11. Ito et al Journal of Bacteriology 153: 163-168, 1983.

12. Gerfinkel and Nester. Journal of Bacteriology 144: 732-743, 1980.

13. Sambrook et al. (eds) Molecular Cloning: A Laboratory Manual (2nd ed). Cold Spring Harbor Laboratory Press, USA, 1989.

14. Murashige and Skoog. Plant Physiology 15: 73-97, 1962.

15. Gamborg et al. Experimental Cell Research 50: 151-158, 1968.

16. Schenk and Hilderbrandt. Canadian Journal of Botany 50: 199-204, 1972.

17. Jefferson et al. EMBO Journal 6(13): 3901-3907, 1987.

18. Needleman and Wunsch, J. Mol. Biol. 48: 443-453, 1970

Claims

CLAIMS:

1. An isolated nucleic acid molecule comprising a sequence of nucleotides encoding or complementary to a sequence encoding a cytochrome b₅ (Cyt b₅) molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof.

2. An isolated nucleic acid molecule according to claim 1 wherein the Cyt b₅ modulates or otherwise facilitates activity of a cytochrome P450 molecule (Cyt P450).

3. An isolated nucleic acid molecule according to claim 1 or 2 wherein the Cyt P450 comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X

(R H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position.

4. An isolated nucleic acid molecule according to claim 3 wherein the Cyt P450 molecule is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

5. An isolated nucleic acid molecule according to claim 4 wherein the Cyt P450 is flavonoid 3 ',5 '-hydroxylase (F3',5'H).

6. An isolated nucleic acid molecule according to claim 4 wherein the Cyt P450 is flavonoid 3 '-hydroxylase (F3'H).

7. An isolated nucleic acid molecule according to any one of claims 1 to 6 wherein the Cyt b₅ comprises the amino acid sequence:

Y K A S D D S E L E L N L V T D S I K E P N or an amino acid sequence having at least 70% similarity thereto.

8. An isolated nucleic acid molecule according to claim 7 wherein Cyt b₅ comprises the amino acid sequence:

[X₁X₂...X_n]KE[X₁',X₂'...X_nl'] F[X₁",X₂"...X_n2"] YKASDDSELELNLVTDSIKEPNDSIK EPNfX,"',^"' ...X"'_n3]EDPKPYLTFVES wherein [X„ X₂... XJ, [X , XJ ... X'_nl], [X"„ X₂" ... X"j and [X ", X₂*" ... X^'"] are amino acid sequences of any amino acid residues up to n, n,, n₂ and n₃ amino acid residues in length wherein n, n_t , n₂ and n₃ may be the same or different and each is from about 1 to about 200.

9. An isolated nucleic acid molecule according to any one of claims 1 to 8 wherein the Cyt b₅ comprises the amino acid sequence substantially as set forth in <400>2 or an amino acid sequence having at least about 30% similarity thereto.

10. An isolated nucleic acid molecule according to any one of claims 1 to 9comprising the nucleotide sequence substantially as set forth in <400> 1, or a nucleotide sequence having at least about 30% similarity thereto or a nucleotide sequence capable of hybridizing to < 400 > 1 under low stringency conditions at 42°C.

11. A genetic construct in single or multicistronic form wherein at least one cistron encodes a Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; the genetic construct optionally further comprising cistrons encoding one or both of a Cyt P450 or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; and/or a reductase or other associated protein.

12. A genetic construct according to claim 11 wherein the Cyt b₅ modulates or otherwise facilitates activity of the Cyt P450 encoded by the same genetic construct or a Cyt P450 on another genetic construct or encoded by the genome of a host cell.

13. A genetic construct according to claim 11 or 12 wherein the Cyt P450 molecule comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X

(R/H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M,A,L,I,P,ForT and wherein the residues in parentheses represent alternatives of a single position.

14. A genetic construct according to claim 13 wherein the Cyt P450 molecule is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

15. A genetic construct according to claim 14 wherein the Cyt P450 molecule is F3',5'H.

16. A genetic construct according to claim 14 wherein the Cyt P450 molecule is F3Η.

17. A genetic construct according to any one of claims 11 to 16 wherein the Cyt b₅ comprises the amino acid sequence:

YKASDDSELELNLVTDSIKEPN or an amino acid sequence having at least 70% similarity thereto.

18. A genetic construct according to claim 17 wherein the Cyt b₅ comprises the amino acid sequence:

[X₁X₂...X_n]KE[X₁ ^,,X₂' ...X_nl'] F[X₁",X₂"...X_n2"] YKASDDSELELNLVTDSIKEPNDSIK

E P N PC,"', X₂"' ... X"'_n3] EDPKPYLTFVES wherein [X„ X₂... XJ, [X/, X₂ ^« ... X'_nl], [X'\, X₂" ... X"J and [X/", X₂'" ... X^'"] are amino acid sequences of any amino acid residues up to n, n_l5 n₂ and n₃ amino acid residues in length wherein n, n,, n₂ and n₃ may be the same or different and each is from about 1 to about 200.

19. A genetic construct according to any oen of claims 11 to 18 claim 17 or 18 wherein the Cyt b₅ comprises the amino acid sequence substantially as set forth in <400>2 or an amino acid sequence having at least about 30% similarity thereto.

20. A genetic construct according to any one of claims 11 to 19 wherein the Cyt b₅ is encoded by a nucleotide sequence substantially as set forth in <400> 1, or a nucleotide sequence having at least about 30% similarity thereto or a nucleotide sequence capable of hybridizing to < 400 > 1 under low stringency conditions at 42°C.

21. A transgenic plant or part thereof or cells therefrom comprising genetic material encoding a Cyt b₅ molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof.

22. A transgenic plant or part thereof or cells therefrom according to claim 21 wherein the Cyt b₅ modulates or otherwise facilitates activity of a Cyt P450.

23. A transgenic plant or part thereof or cells therefrom according to claim 21 or 22 wherein the Cyt P450 molecule comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X(R/H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position.

24. A transgenic plant or part thereof or cells therefrom according to claim 23 wherein the Cyt P450 molecule is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

25. A transgenic plant or part thereof or cells therefrom according to claim 24 wherein the Cyt P450 is F3',5'H.

26. A transgenic plant or part thereof or cells therefrom according to claim 24 wherein the Cyt P450 is F3'H.

27. A transgenic plant or part thereof or cells therefrom according to any one of claims 21 to 26 wherein the Cyt b₅ comprises the amino acid sequence:

28. A transgenic plant or part thereof or cells therefrom according to claim 27 wherein Cyt b₅ comprises the amino acid sequence:

[X₁X₂ ... XJKE[X₁\X₂' ... X_nl']

YKASDDSELELNLVTDSIKEPNDSIK

E P N [X", X₂"' ... X"^] EDPKPYLTFVES wherein [X,, X₂ ... XJ, [X,\ XJ ... X'_nl], [X"„ X₂" ... X" j and [X,"' , XJ " ...

X^'"] are amino acid sequences of any amino acid residues up to n, n,, n₂ and n₃ amino acid residues in length wherein n, n_l5 n₂ and n₃ may be the same or different and each is from about 1 to about 200.

29. A transgemc plant or part thereof or cells therefrom according to claims 21 to 28 wherein the Cyt b₅ comprises the amino acid sequence substantially as set forth in <400>2 or an amino acid sequence having at latest about 30% similarity thereto.

30. A transgenic plant or part thereof or cells therefrom according to any one of claims 21 to 29 or 28 or 29 comprising the nucleotide sequence substantially as set forth in <400 > 1, or a nucleotide sequence having at least about 30% similarity thereto or a nucleotide sequence capable of hybridizing to < 400 > 1 under low stringency conditions at 42°C.

31. A method of expressing a nucleotide sequence encoding a Cyt P450 or a functional derivative, homologue or equivalent thereof in a plant or cells of a plant, said method comprising introducing into said plant or cells of said plant a genetic construct in single or multicistronic form wherein at least one cistron encodes a Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; the genetic construct optionally further comprising cistrons encoding one or both of a Cyt P450 or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent of homologue thereof; and/or a reductase or other associated protein.

32. A method according to claim 31 wherein the Cyt b₅ modulates or otherwise facilitates activity of the Cyt P450 encoded by the same genetic construct or a Cyt P450 on another genetic construct or encoded by the genome of a host cell.

33. A method according to claim 31 or 32 wherein the Cyt P450 molecule comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X (R/H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position.

34. A method according to claim 33 wherein the Cyt P450 molecule is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

35. A method according to claim 34 wherein the Cyt P450 molecule is F3',5'H.

36. A method according to claim 34 where the Cyt P450 molecule is F3'H.

37. A method according to any one of claims 31 to 36 wherein the Cyt b₅ comprises the amino acid sequence:

38. A method according to claim 37 where the Cyt b₅ comprises the amino acid sequence:

[X₁X₂...XJKE[X₁',X₂' ...X_nl ¹] F[X₁",X₂"...X_n2"] YKASDDSELELNLVTDSIKEPNDSIK E P N [X,"', X₂"' ... X"'_n3] EDPKPYLTFVES wherein [X_t, X₂... XJ, [X/, X₂' ... X'_nl], [X",, X₂" ... X"J and [XJ", XJ" ... X^'"] are amino acid sequences of any amino acid residues up to n, n„ n₂ and n₃ amino acid residues in length wherein n, n_l5 n₂ and n₃ may be the same or different and each is from about 1 to about 200.

39. A method according to any one of claims 31 to 38 where the Cyt b₅ comprises the amino acid sequence substantially as set forth in <400>2 or an amino acid sequence having at latest about 30% similarity thereto.

40. A method according to any one of claims 31 to 39 where the Cyt b₅ is encoded by a nucleotide sequence substantially as set forth in < 400 > 1 , or a nucleotide sequence having at least about 30% similarity thereto or a nucleotide sequence capable of hybridizing to < 400 > 1 under low stringency conditions at 42°C.

41. Flowers cut or severed from a plant according to any one of claims 21 to

30.

42. Reproductive parts of a plant according to any one of claims 21 to 30.

43. Use of a genetic construct comprising a nucleotide sequence encoding a Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof in the manufacture of a plant or cells of a plant in which said Cyt b₅ or a mutant part, fragment or portion thereof or a functional and/or structural equivalent or homologue thereof enhances, modulates or otherwise facilitates expression of genetic material encoding a Cyt P450 or activity of a Cyt P450.

44. Use according to claim 43 wherein the Cyt P450 molecule comprises the amino acid sequence (F/P/W/L/Y)(G/S/C/N/H/E)X(G/D/A/E)X(R/H/S/K/T) XCX_a(G/A) wherein X is any amino acid and X_a is selected from V, M, A, L, I, P, F or T and wherein the residues in parentheses represent alternatives of a single position.

45. Use according to claim 45 wherein the Cyt P450 molecule is involved in or otherwise associated with the direct or indirect hydroxylation of a flavonoid compound.

46. Use according to claim 46 wherein the Cyt P450 is flavonoid 3 ',5'- hydroxylase F3',5'H.

47. Use according to claim 46 wherein the Cyt P450 is F3'H.

48. Use according to any one of claims 44 to 47 wherein the Cyt b₅ comprises the amino acid sequence:

49. Use according to claim 49 wherein Cyt b₅ comprises the amino acid sequence:

[X₁X₂ ... XJKE[X₁',X₂' ... X„₁']

FIX,-^"..-^"^] YKASDDSELELNLVTDSIKEPNDSIK

E P N [XJ", X₂"^* ... X"'_n3] EDPKPYLTFVES wherein [X_l5 X₂ ... XJ, [X,\ X₂' ... X'_nl], [X'\, X₂" ... X"J and [X," ' , X₂ ^* " ...

X^'"] are amino acid sequences of any amino acid residues up to n, n_l5 n₂ and n₃ amino acid residues in length wherein n, n,, n₂ and n₃ may be the same or different and each is from about 1 to about 200.

50. Use according to any one of claims 43 to go wherein the Cyt b₅ comprises the amino acid sequence substantially as set forth in < 400 > 2 or an amino acid sequence having at latest about 30% similarity thereto.

51. Use according to any one of claims 43 to 50 comprising the nucleotide sequence substantially as set forth in <400> 1, or a nucleotide sequence having at least about 30% similarity thereto or a nucleotide sequence capable of hybridizing to <400> 1 under low stringency conditions at 42°C.