WO2000008138A2 - Ribosomal rna (rrn) operon altered bacteria and uses thereof - Google Patents

Abstract

The present invention relates to a genetically manipulated organism useful in the screening of novel proliferation modulating compounds. More specifically, this invention relates to an rRNA operon alterable bacterium useful for the selection of antibiotics against pathogenic microorganisms.

Description

NOVEL rrn OPERON ALTERED BACTERIA AND USES THEREOF

Background of the Invention

An increasing body of evidence points to the conclusion that ribosomal RNA (ma), more than ribosomal proteins (r-proteins), is the primary functional molecule involved in protein synthesis (Noller and Nomura (1996) Ribosomes. In Escherichia coli and Salmonella: Cellular and Molecular Biology, F.C. Niedhart et al, eds. Washington, DC: ASM Press), pp. 167-186; Green and Noller (1996) RNA 2:1011-1021). Because protein synthesis is required for the growth and/or viability of organisms, ribosomes represent excellent targets for growth and viability modulating agents.

However, it has been difficult to test the effects of compounds on ribosomes in because of the multiplicity of RNA genes present in bacteria. For example, E. coli has seven RNA genes which are organized into similar transcription units, herein called operons (A-G), comprised of genes for 16S, 23S, and 5S RNAs and several tRNAs (Ellwood and Nomura (1980) J Bad 143(2):1077-1080, Nomura et al (1977) Annu Rev Genet 11:297-347, Boros et al (1979) Nuc Acids Res 6:1817-1830).

Homogeneous mutant ribosomes necessary for a variety of assays have been obtained in vitro by the reconstitution of ribosomes (Dohme and Nierhaus, 1976; Krzyzosiak et al., 1987). Although a highly sophisticated reconstitution technique allows the achievement of very low levels of background activity derived from contaminating wt ribosomes (Green and Noller, 1996), the drawback to this technique is that the efficiency of reconstitution is low. An alternative approach is the use of a multicopy plasmid carrying a mutant RNA operon to increase the relative number of mutant ribosomes in the cell. In theory, if the cloned mutant operon also contains a mutation for the resistance to an antibiotic, the function of wt ribosomes in a mixed ribosomal population prepared from the cell can be specifically blocked in vitro by the antibiotic (Thompson et al., 1988; Leviev et al, 1995). Although cells in which a large number of ribosomes in the cell incorporate plasmid-derived mutant RNA molecules have been described (Sigmund et al., 1988), the background activity caused by unblocked wt ribosomes is significantly higher than that observed with the reconstitution method (Nierhaus et al., 1995; Porse and Garrett, 1995). Achieving a system that allows expression of a more homogenous population of ribosomes will be instrumental in studies on the function of specific species of ribosomal components. Further, the development of a simple genetic system with RNA genes would greatly help elucidate the molecular mechanism of translation and would reveal novel (or highly specific) targets for compounds, e.g., antibiotic drugs. Clearly, the development of new reagents and methods for expressing a homogenous population of ribosomes would be of great benefit in the development of new agents for modulating the growth and/or viability of organisms from which the RNA is derived.

Summary of the Invention

The present invention represents an advance over the prior art in that it provides, inter alia, RNA operon altered bacteria that express a homogenous population of ribosomes. These altered bacterial cells can be used as tools for the selection of compounds that modulate the growth and/or viability of organisms. In one aspect, the invention provides an rrn operon altered bacterium deficient in most RNA operons endogenous to the wild type genome of the bacterium. In one embodiment, the bacteria is Escherichia coli.

In one embodiment, the number of RNA operons present in the altered bacterium which are endogenous to the bacteria is selected from the group consisting of: 0, 1 , and 2. In one embodiment, the bacteria is deficient in all RNA operons endogenous to the wild type genome of the bacterium.

In one embodiment, the rrn operon altered bacterium further comprises an RNA operon or portion thereof which is heterologous to the bacterium. In one embodiment, the heterologous RNA operon is not integrated into the genome of the bacterium. In one embodiment, the heterologous RNA operon is contained in a plasmid. In one embodiment, the RNA operon or the portion thereof contained within the plasmid is derived from an organism which is different from the RNA operon altered bacterium.

In one embodiment, the RNA operon or portion thereof is derived from a gram- positive or gram-negative bacterium. In one embodiment, the RNA operon or portion thereof is derived from a fungal cell. In one embodiment, the RNA operon or portion thereof is derived from a plant cell. In one embodiment, the RNA operon or portion thereof is derived from a mammalian cell. In one embodiment, the RNA operon or portion thereof is derived from a mitochondria. In one embodiment, the RNA operon or the portion thereof is not wildtype.

In one embodiment, the bacteria further comprise a modification which renders an efflux pump non-functional. In a preferred embodiment, the efflux pump is an AcrAB efflux pump.

In one embodiment, the bacteria further comprise a modification which results in increased expression of a membrane channel. In one embodiment, the membrane channel is a porin molecule. In another aspect, the invention pertains to a method of selecting a compound capable of modulating proliferation and/or viability of an rrn operon altered bacterium by contacting said rrn operon altered bacterium with the compound under conditions suitable for proliferation of said rrn operon altered bacterium; and selecting the compound which modulates proliferation and/or viability of the rrn operon altered bacterium.

In one embodiment, proliferation is promoted. In another embodiment, proliferation is inhibited.

In one embodiment, the bacteria further comprise a modification which renders an efflux pump non-functional. In one embodiment, the efflux pump is an AcrAB efflux pump. In one embodiment, the bacteria further comprise a modification which results in increased expression of a membrane channel. In one embodiment, the membrane channel is a porin molecule.

In another aspect, the invention pertains to a method for the replacement of endogenous RNA genes with a null gene replacement plasmid in a bacterium by transformation of a bacterium with an RNA operon targeted gene replacement plasmid containing a selection marker; and replacement of endogenous RNA operons with a null sequence; and selecting for those bacteria which contain the selection marker and thus integration of the gene replacement plasmid.

In one embodiment, tRNA genes are subsequently reintroduced into the rrn operon altered bacterium. In yet another aspect, the invention pertains to a method for the addition of episomal non-integrating RNA operon plasmids into bacteria by transformation of a bacterium with an RNA operon plasmid containing a selection marker; and selection for those bacteria containing the episomal non-integrated RNA operon plasmid containing a selection marker by growing said bacteria in a suitable environment containing the selection agent.

In a further aspect, the invention pertains to a method for the addition of episomal non-integrating tRNA operon plasmids into bacteria by transformation of a bacterium with a tRNA operon plasmid containing a selection marker; and selection for those bacteria containing the episomal non-integrated tRNA operon plasmid containing a selection marker by growing said bacteria in a suitable environment containing the selection agent.

In another aspect, the invention pertains to a method of selecting a compound capable of modulating proliferation and/or viability of an rrn operon altered bacterium by contacting said rrn operon altered bacterium with an operon site-specific compound under conditions suitable for proliferation and/or viability of said rrn operon altered bacterium; and selecting the operon site-specific compound which modulates proliferation and/or viability of the rrn operon altered bacterium.

In yet another aspect, the invention pertains to a method of selecting a compound capable of inhibiting proliferation and/or viability of an rrn operon altered bacterium by contacting said rrn operon altered bacterium with the operon site-specific compound under conditions suitable for proliferation and/or viability of said rrn operon altered bacterium; and selecting the operon site-specific compound which inhibits proliferation and/or viability of the rrn operon altered bacterium. In another aspect, the invention pertains to a method for designing an operon site- specific compound by determining the specific characteristics of an operon site in an operon contained in an rrn operon altered bacterium; and using these operon site-specific characteristics for designing pathogen proliferation and/or viability modulating agents directed against said site. In one embodiment, the modulating agent is an inhibitory agent.

In one embodiment, the rrn operon altered bacterium is Escherichia coli. In one embodiment, the bacterium comprises a heterologous rrn operon derived from an organism selected from the group consisting of : a gram-positive bacterium, a gram-negative bacterium, a fungal cell, a plant cell, and a mammalian cell.

In a further aspect, the invention pertains to a method for producing an rrn operon altered bacterium by inactivating most of the endogenous RNA operons of a bacterium forming an rrn operon altered bacterium deficient in most endogenous RNA operons.

In one embodiment, the method further comprises transforming said bacterium with a vehicle containing a heterologous RNA operon forming a heterologous RNA containing rrn operon altered bacterium (HOAB).

In one embodiment, the vehicle is a plasmid. In one embodiment, the step of inactivating comprises deleting the endogenous RNA operons. In one embodiment, the number of RNA operons inactivated is more than four. In one embodiment, the number of RNA operons inactivated is selected from the group consisting of: 5, 6, and 7. In one embodiment, the number of RNA operons inactivated is 7. In one embodiment, the method further comprises the insertion of at least a portion of an rrn operon. In one embodiment, the inactivation is accomplished by gene replacement. In another aspect, the invention pertains to a method of selecting a compound which interacts with a heterologous RNA operon for targeting compounds against the species from which the heterologous RNA is derived by contacting a heterologous RNA containing rrn operon altered bacterium (HOAB) with a compound under conditions suitable for proliferation of said HOAB; and selecting the compound which modulates proliferation and/or viability of the HOAB thereby selecting compounds which interact with the heterologous RNA operon.

Brief Description of the Drawings

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which: Figure 1 depicts a diagrammatical representation of deletion mutations and tRNA and RNA plasmids

Figure 2 depicts the pedigree of rrn-deletion strains

Figure 3 depicts a diagrammatical representation of autoradiograms of Southern blot hybridization showing the inactivation of chromosomal rRNA operons

Figure 4 depicts a diagrammatical representation of the expression of homogeneous rRNA in Δ7 strains

Figure 5 depicts a diagrammatical representation of the expression of foreign rRNA in Δ7 strains

Detailed Description

The present invention provides, inter alia, RNA operon altered bacteria that express a homogenous population of ribosomes. These altered bacterial cells can be used as tools for the selection of compounds that modulate the growth and/or viability of organisms. The advantages of a simple bacterial system are considerable. First, both classical genetics and recombinant DNA techniques are highly advanced in bacteria, making the production of mutant or foreign rRNAs relatively easy. More specifically, the vast majority of biochemical, structural and mutational studies of RNA have been done on E. coli ribosomes, providing an enormous base of information upon which to add new observations (Noller and Nomura, 1996; Green and Noller, 1997; Wilson and Noller, 1998). rrH-deletion strains are highly suitable for regulatory, physiological, mutational, and evolutionary studies of rna. The strains also provide particularly powerful tools for biochemical and structural analyses of RNA and are useful tools for screening of compounds that modulate the growth and/or viability of organisms. I. Definitions

The present invention provides an rrn operon altered bacterium deficient in most rRNA operons endogenous to the wildtype genome of the bacterium.

The language "ribosomal RNA" or "rRNA" is art-recognized and intended to include those ribonucleic acids (RNAs) which are not translated and serve a structural and catalytic function in the ribosomal translation machinery. The language "rRNA operon" is intended to include those sequences which include rRNA genes including one or more of the following genes: 16S, 23S, and 5S rRNA genes.

The language "rrn operon altered" is intended to include inactivation of a ribosomal RNA operon of the bacterium. The inactivation can be by deletion or can be by replacement of a sufficient portion of the gene to cause inactivation.

The term "endogenous" is art-recognized and is intended to include those elements of the genome of an organism which have not been artificially contributed, e.g., which occurs naturally as part of the genome in which it is present. As used herein, "heterologous" or "heterologous non-endogenous" includes nucleic acid molecules that does not occur naturally as part of the genome in which it is present or which is found in a location or locations in the genome that differs from that in which it occurs in nature or which is operatively linked to DNA to which it is not normally linked in nature (i.e., a gene that has been operatively linked to a heterologous promoter). Heterologous DNA is not naturally occurring in that position or is not endogenous to the cell into which it is introduced, but has been obtained from another cell. Heterologous DNA can be from the same species or from a different species. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by the term heterologous DNA. The terms include those elements of the genome of an organism which have been artificially contributed.

In an embodiment, a an RNA operon expressed in an rrn operon altered bacterium is an RNA operon which is heterologous to the bacterium. In an embodiment, a an RNA operon expressed in an rrn operon altered bacterium is an RNA operon which is from a different species than rrn operon altered bacterium. In another embodiment, a heterologous RNA operon is not integrated into the genome of the bacterium. In yet another embodiment the heterologous RNA operon is not integrated into the genome of the bacterium, e.g., is contained in a plasmid.

The term "bacterium" is art-recognized and is intended to include both Gram- positive and Gram-negative bacteria. It is understood that "bacterium" refers not only to the particular bacterium but to the progeny or potential progeny of such a bacterium. Exemplary bacteria are those causing disease or unwanted conditions in plants, animals, or humans.

The language "deficient in most rRNA operons" is intended to include inactivation of a majority of the endogenous rRNA operons. In one embodiment of the invention, an operon altered bacterium is E. coli and more than four of the endogenous RNA operons are deficient or inactivated. In an embodiment, more than four of the endogenous rRNA operons of the bacterium have been inactivated, preferably more than five, more preferably more than six, most preferably and up to all endogenous rRNA operons being activated. In another embodiment, at least 57%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the endogenous rRNA operons of the bacterium have been inactivated. Preferably, a RNA operon altered bacterium has a sufficient number of endogenous RNA operons inactivated such that heterologous RNA expressed in the bacterium results in the expression of a homogenous population of ribosomes, e.g., without background contributed by endogenous rna. The term "gene" is art-recognized and includes a nucleic acid comprising an open reading frame encoding a rRNA of the present invention.

In an embodiment, the rrn operon altered bacterium is deficient in most rRNA operons endogenous to the wildtype genome of the bacterium and further contains a heterologous rRNA operon and is termed a heterologous rrn operon altered bacterium or HOAB. The terms "heterologous rrn operon altered bacterium" or "HOAB" are intended to include those rrn operon altered bacteria which harbor a heterologous rRNA operon. The portion is of sufficient size such that the heterologous rRNA can perform its intended function.

The term "wildtype" is intended to include a gene, genome, genotype, or phenotype which has not been artificially manipulated. The term "plasmid" is art-recognized and includes a nucleic acid molecule capable of autonomous replication. Preferred plasmids of the invention comprise an RNA operon of an organism.

The term "nucleic acid" is art-recognized and includes polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. In another embodiment, the rrn operon altered bacterium is deficient in most rRNA operons endogenous to the wildtype genome of the bacterium and further contains a heterologous rRNA operon which confers an antibiotic resistant phenotype and is termed an antibiotic resistant rrn operon altered bacterium. The terms "antibiotic resistant rrn operon altered bacterium" or "ROAB" are intended to include those rrn operon altered bacteria which harbor rRNA operons which confer an antibiotic resistant phenotype. The term "antibiotic resistance phenotype" is intended to refer to the ability of an organism to remain viable in the presence of anti-microbial agents.

The term "antibiotics" is art-recognized and includes antimicrobial agents isolated from natural sources and chemically synthesized antibiotics. Preferred antibiotics are those which affect translation. Semi-synthetic derivatives of antibiotics, and antibiotics produced by chemical methods are also encompassed by this term. Chemically-derived antimicrobial agents such as isoniazid, trimethoprim and sulfa drugs are considered antibacterial drugs, although the term antibiotic has been applied to these. These agents and antibiotics have specific cellular targets for which binding and inhibition by the agent or antibiotic can be measured. For example, erythromycin, streptomycin and kanamycin inhibit specific proteins involved in bacterial ribosomal activity. It is within the scope of the screens of the present invention to include compounds derived from natural products and compounds that are chemically synthesized. The language "antimicrobial compound" is art-recognized and is intended to include a compound which inhibits the proliferation and/or viability of a microbe which is undesirable. The language further includes diminishment of an activity which is undesirable and associated with the microbe. In an embodiment, the rrn operon altered bacterium is deficient in most rRNA operons endogenous to the wildtype genome of the bacterium and further contains a heterologous rRNA operon which confers an multi-drug resistant phenotype and is termed an multi-drug resistant rrn operon altered bacterium. The terms "multi-drug resistant rRNA operon altered bacterium" or "MROAB" are intended to include those bacteria which harbor rRNA operons which confer a multi-drug resistant phenotype. The language "multi-drug resistance phenotype" is intended to refer to the ability of an organism to remain viable and/or proliferate in the presence of two or more antimicrobial agents.

In another embodiment the rrn operon altered bacterium is deficient in most rRNA operons endogenous to the wildtype genome of the bacterium and further contains at least one plasmid consisting of a tRNA.

In an embodiment, the rrn operon altered bacterium of the present invention which is deficient in most or all rRNA operons endogenous to the wildtype genome of the bacterium can contain plasmids with wildtype and/or genetically modified rRNA operons. In another embodiment, the rrn operon altered bacterium of the present invention which is deficient in most rRNA operons endogenous to the wildtype genome of the bacterium can contain plasmids with wildtype and/or genetically modified tRNA operons.

The term "genetically modified" refers to mutation, including without limitation point mutation, substitution, transition, transversion, deletion, insertion, inversion and translocation mutation of nucleic acid. It includes manipulation with recombinant or genetically engineered nucleic acid such as transformation and transfection.

Another aspect of the present invention pertains to a packaged rrn operon altered bacterium. The rrn operon altered bacterium is packaged with instructions for use within the methods described herein. II. RNA operon altered bacteria

The present invention includes a method for producing an rrn operon altered bacterium wherein most or all of the endogenous rRNA operons of the bacterium are inactivated using methods known in the art, e.g., by deletion, forming an rrn operon altered bacterium deficient in most endogenous rRNA operons as well as the bacteria produced by this method.

Preferably, an rrn operon altered bacterium is an E. coli bacterium. One or more endogenous RNA operons of a bacteria can be inactivated using a variety of techniques known in the art. For example, n one method of the present invention, a bacterium is transformed with an RNA operon inactivating element (e.g., a RNA operon gene replacement plasmid) and a majority of RNA operons of said bacterium are inactivated. The term "transformation" is art-recognized and meant to include the introduction of a nucleic acid, e.g., an expression vector, into a bacterium. After the inactivation of one or more endogenous RNA operons, an rrn operon altered bacterium is further altered to comprise at least one heterologous RNA operon. In one embodiment, the heterologous RNA is integrated into the genome of the rrn operon altered bacterium. In another embodiment, the heterologous RNA is not integrated into the genome of the rrn operon altered bacterium. In a preferred embodiment, the heterologous RNA is present in a plasmid. This invention provides for episomal plasmids which contain RNA operons. Rrn altered bacteria of the invention can be engineered to express such plasmids. The invention includes plasmids which contain rRNA operons from an organism (e.g., prokaryote (e.g., a Gram-positive or Gram-negative bacterium), a eukaryote (e.g., a fungal, plant, or animal cell (or a mitochondria). Preferably, such plasmids comprise an rRNA operon derived from a pathogenic organism, e.g., an organism which is pathogenic to humans, animals, or plants.

The invention provides for rrn operon altered bacteria that comprise heterologous RNA derived from an organism, e.g., a prokaryotic or eukaryotic organism. Exemplary prokaryotic organisms include Gram-positive and Gram-negative bacteria. Exemplary eukaryotic organisms include fungi, plants, parasites (e.g., protozoa), and animals (e.g., mammals). In one embodiment, heterologous RNA is derived from an organelle of a eukaryotic cell, e.g., a mitochondria.

In one embodiment, an rrn operon altered bacterium expresses a heterologous RNA derived from a bacterium from a genus selected from the group consisting of: Staphylococcus, Streptococcus, Bacillus, Clostridium, Lactobacillus, Listeria, Mycobacterium, Meisseria, Pseudomonas, Brucella, Bordetella, Escherichia, Salmonella, Shigella, Proteus, Yersinia, Bibrio, Haemophilus, Bacteroides, and Treponema.

In one embodiment, an rm operon altered bacterium expresses a Rickettsia ma. In one embodiment, an rm operon altered bacterium expresses a Chlamydia ma. In one embodiment, an rm operon altered bacterium expresses a Mycoplasma ma.

In one embodiment, an rm operon altered bacterium expresses a heterologous RNA derived from a fungus from a genus selected from the group consisting of: Candida, Aspergillus, Mucor, Absidia, Rhizopus, Histoplasma, Cryptococcus. In one embodiment, an rm operon altered bacterium expresses a heterologous

RNA derived from a bacterium from a protozoan selected from the group consisting of: Giardia, Trypanosoma, Leishmania, and Plasmodium.

In one embodiment, a rm operon altered bacterium expresses a heterologous RNA derived from a mammalian cell. In one embodiment, the ability of a compound to modulate the proliferation and/or viability of a rm altered bacterium comprising RNA from a cancer cell can be tested. In another embodiment, the ability of a compound to modulate the proliferation and/or viability of an rm altered bacterium expressing a bacterial RNA can be compared with the ability of the compound to modulate the proliferation and/or viability of an rm altered bacterium expressing a mammalian RNA in order to identify compounds which are specific for bacterial ma.

In one embodiment, the heterologous RNA expressed by the rm altered bacterium is derived from an a wild-type organism. In another embodiment the heterologous RNA is not wild-type, e.g., the heterologous RNA comprises some modification, e.g., a mutation which renders the organism from which it is derived resistant to antibiotics. The invention further pertains to rm operon altered bacteria which comprise tRNA operons which are endogenous to the rm operon altered bacterium or are heterologous to the rm altered bacterium. In one embodiment, the RNA operon expressed by an rm operon altered bacterium is not wild-type. The present invention further includes a method for the making of an rRNA operon altered bacterium deficient in most rRNA operons endogenous to the wildtype genome of the bacterium and further comprising a tRNA operon. In this method, an rm operon altered bacterium deficient in most rRNA operons endogenous to the wildtype genome of the bacterium is transformed with a vehicle comprising a tRNA operon. In an embodiment, the tRNA operon containing vehicle is integrated into the genome of the rm operon altered bacterium. In another embodiment, the tRNA operon containing vehicle is not integrated into the genome of the rm operon altered bacterium. In another embodiment, the tRNA operon containing vehicle is a plasmid.

It will be understood by one of ordinary skill in the art that an rm altered bacteria of the invention can be further altered to comprise additional modifications. For example, such bacteria can comprise mutations which result in the failure to express a molecule normally expressed by the cell in functional form. Additionally or alternatively, such bacteria can be engineered to express molecules which are not normally expressed by the cell (e.g., heterologous molecules) or to express molecules which are normally expressed by the cell, but at levels which are higher wild-type levels. In one embodiment, an rRNA operon altered bacterium further fails to express a functional efflux pump. Efflux pumps are one mechanism by which bacterial cells decrease the concentration of an agent, e.g., an antibiotic, within a cell (Lewis. 1994. TIBS 19:120; Nikaido. 1996. J. Bacteriol. 178:5853). The modification of the bacterial cells of the invention so that they do not functionally express efflux pumps allows compounds to accumulate to higher intracellular concentrations in the screening assays of the invention. Genes encoding efflux pump components can be altered such that a functional efflux pump is not expressed using any art recognized technique, e.g., mutation or deletion. Efflux pumps have been classified into several different groups (see, e.g., Paulsen et al. 1996. Microbiological Reviews 60:575; Nikaido. 1996. J. Bacteriol. 178:5853). Efflux pumps for modification in an rRNA operon altered bacteria of the instant invention are those efflux pumps that can increase drug resistance in an organism. For example, in one embodiment, an rRNA operon altered bacterium is altered such that an efflux pump of the major facilitator superfamily, e.g., QacA/B, EmrB, NorA, VMAT1 or the like is not expressed in functional form. In another embodiment, an rRNA operon altered bacterium is altered such that an efflux pump of the small multidrug resistance family, e.g., Smr, EmrE, QacE or the like is not expressed in functional form. In another embodiment, an rRNA operon altered bacterium is altered such that an efflux pump of the resistance/nodulation/cell division (RND) family, e.g., AcrAB, MexAB, MtrCDE, or the like is not expressed in functional form. Preferably, a modification to an rRNA operon altered bacterium results in the failure to express the transporter or linker component of the efflux pump in functional form, while an outer membrane channel (e.g., TolC), if required for a particular pump may be unmodified.

In a preferred embodiment, the efflux pump is in the RND family. In a particularly preferred embodiment, the efflux pump is an AcrAB efflux pump.

In another embodiment, an rm operon altered bacterium is further modified to overexpress a membrane channel that is normally expressed by the cell or to express a membrane channel that is not normally expressed by the cell. In one embodiment, a membrane channel is a porin molecule. Porin molecules are a means by which compounds enter bacterial cells. By increasing the expression of porin molecules in a bacterial cell of the invention it is possible to increase the concentration of a compound being screened within a bacterial cell. Exemplary porin molecules include OmpF. The expression of membrane channels can be increased, e.g., by expressing them in a compatible expression vehicle, e.g., a plasmid. Preferably, introduction of such a plasmid into a cell of the invention results in overexpression of the membrane channel. III. Use of rRNA operon altered organisms to select for proliferation modulating agents

The present invention includes a method for selecting a compound capable of modulating the proliferation of an rm operon altered bacterium wherein said bacterium is contacted with a compound under conditions suitable for proliferation of said bacterium and further determining the compound which modulates the proliferation of said bacterium.

The term "compound" is art-recognized and includes compounds being tested for their ability to function within the methods described herein, e.g., antimicrobial activity. The compound can be designed to incorporate a moiety known to interact with an rRNA operon or can be selected from a library of diverse compounds, e.g., based on a desired activity, e.g., random drug screening based on a desired activity. The synthesis of combinatorial libraries is well known in the art and has been reviewed (see, e.g., E.M. Gordon et al., J. Med. Chem. (1994) 37:1385-1401 ; DeWitt, S. H.; Czamik, A. W. Ace. Chem. Res. (1996) 29:114; Armstrong, R. W.; Combs, A. P.; Tempest, P. A.; Brown, S. D.; Keating, T. A. Ace. Chem. Res. (1996) 29:123; Ellman, J. A. Ace. Chem. Res. (1996) 29:132; Gordon, E. M; Gallop, M. A.; Patel, D. V. Ace. Chem. Res. (1996) 29:144; Lowe, G. Chem. Soc. Rev. (1995) 309, Blondelle et al. Trends Anal. Chem. (1995) 14:83; Chen et al. J Am. Chem. Soc. (1994) 116:2661; U.S. PAtents 5,359,115, 5,362,899, and 5,288,514; PCT Publication Nos. WO92/10092, WO93/09668,

WO91/07087, WO93/20242, WO94/08051). The subject invention includes methods for synthesis of combinatorial libraries of modulators. Such libraries can be synthesized according to a variety of methods. Preferably, the compound of the present invention is a small molecule. Examples of compounds of the present invention include chloramphenicol and erythromycin compounds.

The language "modulating the proliferation" is intended to include changes in the rate of proliferation of an organism. The changes include both promotion and inhibition of the proliferation of an organism. All measurable change in the rate of proliferation is included. Change in the rate of proliferation can be measured directly by determining an increase or decrease in the population size of an organism from a previously determined standard or baseline level. The term "proliferation" is intended to include the sequential increase in population size due to successive cell cycle passages or generations. The term "inhibition" is intended to refer to the suppression of an activity of that which is being acted upon.

The language "conditions suitable" is intended to include those conditions which support the viability and proliferation of an organism. The ordinarily skilled artisan would be able to determine such conditions. For example, the conditions would vary based on the particular bacterium selected for rRNA alteration.

In one embodiment, the compound selected by the method of the present invention can promote the proliferation of rm operon altered bacteria. In another embodiment, the compound selected by the method of the present invention can promote the proliferation of rm operon altered bacteria. In an embodiment, the method of the present invention further comprises the determination of the extent to which the modulation of proliferation of said bacterium occurs. In another embodiment, the compound selected by the method of the present invention can be an antibiotic (e.g., erythromycin). In one embodiment, the rm operon altered bacterium used in the method of the present invention can be an ROAB. In another embodiment, the rm operon altered bacterium used in the method of the present invention can be a MROAB. In yet another embodiment, the rm operon altered bacterium used in the method of the present invention can be a HOAB. In an embodiment, the compounds selected interact with the heterologous rRNA contained within the rm operon altered bacterium. For example, the method of screening compounds which are effective against an antibiotic resistant bacteria can be selected using ROAB. Compounds effective against multi-drug resistant bacteria can be selected using a MROAB. In yet another embodiment, the heterologous rRNA is from a non-bacterial source and the compound selected targets this non-bacterial source, e.g., an antifungal resistant yeast.

IV. Use of rRNA operon altered organisms in the design of synthetic proliferation modulating agents The present invention includes a method for designing an operon site-specific compound wherein the specific characteristics of an operon site in an operon contained in an rm operon altered bacterium are determined and further wherein these characteristics are used to design a pathogen proliferation modulating agent directed against said site. The term "pathogen" is meant to include organisms which that are disease-producing organisms such as bacteria, viruses, fungi, and protozoans. The term "fungi" is meant to include the yeasts.

In one embodiment, the modulating agent designed by the method of the present invention can be an proliferation inhibitory agent. In another embodiment, the modulating agent designed by the method of the present invention can be a proliferation promoting agent. As an illustrative example, the rRNA operon altered bacterium of the present invention can be used to modulate the proliferation of other organisms (e.g., pathogens, for example, fungus, e.g., yeast, for example, Candida albicans). Preferably, the rRNA operon altered bacteria is acted upon by a proliferation modulating agent wherein the modulating compound affects an increase in proliferation which would facilitate enriching a diseased environment for non-pathogenic competitive bacteria and thus out competing a pathogen. The language "diseased environment" is intended to include any tissue, body cavity or other organ system of an organism which contains significant populations of pathogenic organisms. A specific example includes immunocompromised subjects which have a pathological infection of Candida albicans. The language "immunocompromised subject" is art-recognized and is intended to include subjects having an immune system which is compromised, at least in part. For example, the subject can be immunocompromised due to a genetic disorder, disease or drugs that inhibit the immune response. The compromise of the immune system can be temporary or permanent. An immunocompromised subject includes individuals who are afflicted with HIV or cystic fibrosis, or who are taking corticosteroids or immunosuppressive agents. The terms "subject" or "subjects" as used herein, means a living animal, susceptible to the conditions or state described herein. Examples include reptiles, rodents, horses, sheep, cattle, dogs, cats, gorillas, and humans. It also includes healthy animals and those suffering from diseases characterized by the infection of pathogenic bacteria. The language "pathological infection" as used herein, means an infection which leads to a disease state out of balance with homeostasis for an organ or the entire organism.

The use of an rm operon altered bacterium in conjunction with a proliferation inducing modulating compound would produce an environment wherein the Candida albicans cells would be unable to compete, thus affecting the diminishment of Candida albicans populations in the effected site.

This invention is further illustrated by the following examples which in no way should be construed as being further limiting. The contents of all references, pending patent applications and published patent applications, cited throughout this application (including the background section) are hereby incorporated by reference.

Examples

The following methods were used in the examples:

Media and Growth Conditions

Unless otherwise stated, cells were grown at 37 °C in LB broth. Overnight cultures were incubated without shaking and subcultured into fresh medium. The initial cell density of all subcultures was adjusted to 5 klett units with a Klett-Summerson photoelectric colorimeter using a red filter and then incubated with aeration by shaking. Antibiotics were added at the following concentrations when required: ampicillin (Ap), 100 μg/ml; Kanamycin, 50 μg/ml; chloramphenicol (Cm), 30 μg/ml, tetracycline (Tc), 12.5 μg/ml; Spc, 40 μg/ml.

Allele exchange with a polA strain and the sacB gene

An effective method was developed for allele exchange between chromosomal and plasmid-encoded rRNA operons by modifying previously reported techniques (Gutterson and Koshland, 1983; Slater and Maurer, 1993). A DNA fragment containing an rRNA operon and its flanking regions was first cloned into a Col El -type plasmid vector carrying the Ap resistance gene, and a deletion mutation inactivating both 16S and 23 S rRNA genes was introduced into the operon. The sacB-Kmr cassette was then prepared from pBIP3 (Slater and Maurer, 1993) and inserted into the plasmid within the vector sequence. This cassette contains the Bacillus subtilis sacB gene and the Km resistance marker. Expression of sacB in E. coli is lethal in the presence of sucrose (Gay et al., 1985). Thus the cassette allows both positive [Km-resistant (Kmr)] and negative [sucrose-sensitive (Sues)] selection of the resultant plasmid (A similar selection can be made using e.g., a temperature sensitive replica). The plasmid was then introduced by electroporation into polAl(am) mutant cells in which the rRNA operon on the chromosome corresponding to the cloned one had been inactivated with the cat gene. Previous work from the Condon laboratory (Condon et al., 1992) was taken advantage of in which each rRNA operon on the chromosome was inactivated by this gene. Initiation of DNA replication from the Col El -type origin requires the polA gene product, DNA polymerase I. The polA mutant cells transformed to Ap and Km resistance contain the entire plasmid in the chromosome due to a single crossover. All transformants (termed integrants) showed sucrose sensitivity. The integration site of each rRNA plasmid was verified by either Southern blot analysis (for rmB) or PI transduction (for rmH, rmG, and rrnA). In the latter case, a PI lysate was prepared on each integrant and the cotransduction frequency of antibiotic resistance markers was analyzed. Plasmids integrated into the chromosome near the operon corresponding to the cloned one, the Cm resistance marker and the other two markers introduced by the plasmid cotransduce with a high frequency.

Wherein a second crossover occurred, the vector DNA, which included the Ap resistance gene and the sacB-Kmr cassette, and the cat-containing operon were excised, leaving the operon with the deletion mutation on the chromosome. Cells that had undergone such an excision event were effectively isolated by selecting the integrants for sucrose resistance, followed by screening the sucrose-resistant (Sucr) cells for sensitivity to Ap, Km, and Cm. Several Sues Cmr integrants were grown independently at 37 °C overnight in LB broth without antibiotics. The cultures were then diluted and plated on salt-free LB plates containing 8% sucrose. The plates were incubated at 30°C (for rmB, rmH, and rmG) or 37°C (for rrnA) for 20 hours and colonies were picked for a Cm sensitivity test. Typically -1% of the cells grown overnight in the absence of antibiotics was Sucr, and ~5% of these Sucr cells was Cms. All Cms cells were sensitive to Ap and Km.

Construction of rrn-deletion strains Before the first allele exchange, the polAl mutation was introduced into TX Δ 11 by PI transduction by virtue of its linkage to zih::TnlO, generating TA340. The presence of the mutation in this strain was verified by its sensitivity to methyl methane- thiosulfonate. (As used herein, inactivated RNA operons are indicated by capital letters derived from their specific operon names (for example, A for rrnA). When the inactivation was carried out by a deletion/insertion mutation, a capital letter is followed by a lower case letter c or z representing the inserted gene cat+ or lacZ+, respectively (for example, Ac for rrnA::cat+). It should be noted that, when recA56 was introduced by Hfr mating into TA527 to construct TA542, the deletion mutation, Δ rrnG::lacZ+ (Gz), in TA527 was replaced with another mutation, Δ rrnG::cat+ (Gc). See Table 1 for precise genotypes. polA and recA mutant strains are resistant to Tc since these mutations are linked to TnlO. pTRAN, pHK-rrnC+, and pSTL102 contain Spc, Km, and Ap resistance markers, respectively).

1. Inactivation of rmB. The rrnB operon in TA340 was first inactivated by introducing the Δ (rrsB-gltT- rrlB)l ::kan+ mutation (Condon et al., 1993). (For rrnB, a cat-containing operon was not used in this step.) The resultant strain (TA405) was then transformed to Apr (TA406) with pMAlOl, and the Δ (rrsB-gltT-rrlB)l ::kan+ allele was removed from the chromosome as described above except that Sucr cells were screened for sensitivity to Ap and Km. The presence of the Δ (rrsB-gltT-rrlB)lOl deletion mutation in one of the Aps Kms clones (TA410) was confirmed by amplifying ribosomal DNA on the chromosome with PCR and by analyzing the amplified fragments on agarose gel. The primers used for the PCR reaction were 5'- GGCCTAACACATGCAAGTCGAA -3' (SEQ ID NO:l) and 5'- GCTTACACACCCGGCCTATCAA -3' (SEQ ID NO:2), which hybridized to near the 5' end of the 16S gene and near the 3' end of the 23 S gene, respectively. With these primers, the rmB operon carrying the deletion gave a 2287 bp PCR fragment, whereas the wt and kan-containing operons gave 4791 and 4026 bp fragments, respectively.

2. Inactivation of rmH.

TA410 was first transduced to Cmr (TA415) with Δ (rrsH-ileV-alaV- rrlH)37::cat+ and then transformed to Apr Kmr (TA418) with pMA103. The Δ (rrsH- ileV-alaV-rrlH)37::cat+ allele was removed from TA418 as described above. The presence of the deletion mutation in one of the Cms Aps Kms clones (TA420) was confirmed by PCR with the primers described above. An expected PCR fragment (1290 bp) was detected.

3. Inactivation of rmG.

TA420 was first transduced to Cmr (TA443) with Δ (rrsG-gltW-rrlG)33::cat+ and then transformed to Apr Kmr (TA445) with pNY30. This plasmid carries an rmG allele inactivated by deletion and concomitant insertion of a lacZ+ gene into the deleted operon. The Δ (rrsG-gltW-rrlG)33::cat+ allele was removed from TA445 as described above except that X-gal (60 mg/ml) was added to sucrose-containing plates. Sucr and blue colonies were then screened for sensitivity to Ap, Km and Cm. Cells that were sensitive to these antibiotics contain only the Δ (rrsG-gltW-rrlG)30::lacZ+ allele on the chromosome and were termed TA447.

4. Inactivation of rrnA.

The standard inactivation procedure was slightly modified as described below to restore the polA+ genetic background. The Δ (rrsA-ileT-alaT-rrlA)l ::cat+ mutation was first introduced into TA410 and TA447. The transductants with TA410 were selected for resistance to Cm and Tc, and screened for PolA- by assaying the transformation efficiency of pBR322. This strain was named TA472. With TA447, the polA+ allele was cotransduced with the Δ (rrsA-ileT-alaT-rrlA)l ::cat+ mutation, generating TA476. Next, pNY34 was integrated into the chromosome of the PolA- strain, TA472, near rrnA. A PI lysate was prepared on the resultant strain (TA480) and used to transduce integrated pNY34 (zih::pNY34) into TA476. The transductants were selected for resistance to Ap, Km and Cm, and screened for sensitivity to Tc. The presence of polA+ in Apr Kmr Cmr Tcs cells was confirmed by assaying the transformation efficiency of pACYC184, which requires DNA polymerase I for replication. The resultant cells (TA485) were grown to saturation and Sucr cells were obtained as above. Finally, the Sucr cells were screened for sensitivity to Ap, Km and Cm, obtaining TA488. The presence of the deletion in this strain was verified by Southern blot analysis.

5. Inactivation of rrnD.

TA488 carrying pTRNA65 (TA500) was transduced to Cmr with Δ(rrsD-ileU- alaU-rrlD)25::cat+, generating TA516.

6. Inactivation of rrnC. pHK-rrnC+ was first introduced into TA516, generating TA520. A spontaneous deletion of the gene for tRNA Glu-2 from pTRNA65 in TA520 led to TA520.5 carrying pTRNA66 (Figure IB). The Δ (rrsC-gltU-rrlC)15::cat+ mutation was then introduced into TA520.5 by PI transduction by virtue of its linkage to ilv500::Tnl0. The presence of Δ (rrsC-gltU-rrlC)15::cat+ in Tcr transductants (TA525) was verified by PCR with the following primers: 5' - CTTCCATGTCGGCAGAATGCTT - 3' (SEQ ID NO:3) and 5^* - GCCTGCATACCGTTGTCGATAG - 3' (SEQ ID NO:4). These primers hybridized to near the ends of the cat gene and the rrnC operon, respectively. Finally, the ilv+ allele was introduced into TA525, generating TA527.

7. Construction of TA531.

A recA deletion mutation, D(srlR-recA)306, was introduced into TA527 by PI transduction by virtue of its linkage to srlR::Tnl0, generating TA531. 8. Construction of TA542.

JC 10240, an Hfr strain carrying the recA56 mutation linked to srlC::Tnl0, was first made recombination-proficient by introducing pBEU49, a derivative of a runaway- replication mutant of plasmid Rl carrying the recAo281 gene and Ap and Km resistance markers. The resultant strain (TA538) was then transduced to Cmr with Δ (rrsG-gltW- rrlG)33::cat+ (TA538.5) and the plasmid was removed from the strain by using its runaway replication property, generating TA539. Finally, both recA56 and Δ (rrsG- gltW-rrlG)33::cat+ mutations were introduced into TA527 from TA539 by Hfr mating, generating TA542. The presence of Δ (rrsG-gltW-rrlG)33::cat+ in this strain was verified by PCR with the following primers: 5' - GGTGAATTGGTTCCGGGTAAAG - 3' (SEQ ID NO:5) and 5' - GCTGAACGGTCTGGTTATAGGT - 3' (SEQ ID NO:6). These primers hybridized to near the 3' end of the clpB gene and near the 5' end of the cat gene, respectively.

Construction of an rrn+ strain, TA563

An rrn+ strain was constructed from TX Δ 1 1 by introducing rrnE+ with Hfr mating. The donor and recipient strains were CAG5052 and TA559.5, respectively. TA559.5 was constructed from TX Δ 11 by introducing pBEU49 (see above). This plasmid was used only to provide a convenient counter selection of the donor strain. The mating was carried out at 30°C for 20 min and the cells were plated on LB plates containing Tc, Ap and Km. The plates were incubated at 30°C for 16 hours and the exconjugants were screened for Pur+ and _τnE+. The screening for rrnE+ was carried out by PCR. The primers used for the reaction were 5' - GAATTCGACGATACCGGCTTTG - 3' (SEQ ID NO:7) and 5' - CCACTCGTCAGCAAAGAAGCAA - 3' (SEQ ID NO:8), which hybridize to the purH and 16S sequences, respectively. Finally, pBEU49 was removed from one of the Pur+ rrnE+ exconjugants (TA560) by using its runaway replication property, generating TA563. Although metA+ was most likely introduced into TA560 with pur+-rrnE+ by Hfr mating, the strain remains Met- since the metB 1 mutation is located close to btuB::Tnl0 in the donor chromosome. The presence of all seven rRNA operons in TA563 was confirmed by Southern blot analysis (Figure 3).

Construction of pTRNA plasmids The following tRNA-containing fragments were first subcloned in pSL 130 (Li et al., 1984) within the multiple cloning site located downstream from the tac promoter. All fragments were cloned in such a way that functional tRNAs were produced by transcription from the promoter. The tRNA cluster with the promoter (the Scal-Hindlll fragment) was then ligated to the EcoRI-Hindlll fragment of pACYC184W containing the replication origin and the Spc resistance marker (W fragment). [pACYCl 84 W is a derivative of pACYCl 84 carrying the W fragment (Prentki and Krisch, 1984) between the two PvuII sites.] The resultant plasmid was pTRNA65.

1. A DNA fragment (226 bp) carrying the tRNA genes for Asp-1 and Trp was prepared by PCR using pC4 as a template. The primers for the reaction were as follows: 5'-GCCGGTCATAAAATCGATGGTTG-3' (SEQ ID NO:9), 5'-

CCTTAGCTGTCGACAAGGATGAT-3' (SEQ ID NO: 10). The amplified fragment was digested with Clal and AccI, and inserted into the Clal site of pSL130.

2. The Smal-Hpal fragment of pC8 containing the tRNA genes for Ile-1 and Ala-

IB was first cloned in the Smal site of pUC19. The resultant plasmid was then digested with EcoRI and BamHI, and the tRNA-containing fragment was inserted into the BamHI site of pSL130 by blunt-end ligation.

3. The Smal-Hpal fragment of pKK3535 carrying the tRNA gene for Glu-2 was inserted into the Sail site of pSL130 by blunt-end ligation.

4. The Xmnl-EcoRI fragment of pC8 carrying the tRNA gene for Thr-1 and the transcription terminators was first cloned in pUC 19 between the Smal and EcoRI sites. The fragment was then excised by digesting the resultant plasmid with Sail and Hindlll, and inserted into pSL130 between the Sail and Hindlll sites. A spontaneous deletion of the gene for tRNA Glu-2 from pTRNA65 led to pTRNA66 (Figure IB).

Plasmid replacement TA531 contains pHK-rrnC+ and is resistant to Km. This strain was transformed by electroporation to Ap resistance with pSTL102 and several transformants were independently grown at 37°C until saturation in LB broth containing only Ap. The cultures were diluted and plated on LB + Ap plates and the plates were incubated at 37°C for 20 hours. Colonies growing on the plates were then screened for sensitivity to Km. This procedure resulted in TA540, which is the same as TA531 but contains pSTL102 in place of pHK-rrnC+. In this experiment, -20% of Apr transformants was Kms. The efficiencies of plasmid exchange in other experiments were similar to this value.

Determination of total-RNA/protein and tRNA/rRNA ratios

The amount of total RNA, which is roughly equivalent to the amount of stable RNA in the cell, was obtained by measuring the absorption at 260 nm of RNA hydroly sates as described in Brunschede et al. (1977). The amount of rRNA in stable RNA was determined from the molar ratio of rRNA to tRNA. To obtain this ratio, total RNA was prepared from cells as described in Emilsson and Kurland (1990) and 5S rRNA and tRNA (4S) were fractionated by polyacrylamide gel electrophoresis (4% gel, see Peacock and Dingman, 1967). The RNA molecules were visualized either by ethidium bromide staining and the intensity of each band was determined with the IS- 1000 Digital Imaging System (Alpha Innotech Corporation, San Leandro, CA), or by Cyber Green II staining and the intensity of each band determined with the STORM (Molecular Dynamics, Sunnyvale, CA). The ratio of rRNA to tRNA thus obtained with rrn-i- cells represent the known ratio, i.e., one 5S rRNA molecule per nine tRNA molecules (Bremer and Dennis, 1996). The rRNA/tRNA ratio in each rrn-deletion strain was calculated. The total size of rRNA and the average size of tRNAs used to obtain the amount of rRNA in total RNA were 4566 bp and 80 bp, respectively. The amount of total protein was determined with BCA Protein Assay Reagent (Pierce, Rockford, IL). Southern blot analysis of the inactivation of chromosomal RNA operons

Total cellular DNA was prepared from rrn+ and rrn-deletion strains, digested with BamHI and PstI, and fractionated on a 0.8% agarose gel. The DNA was then transferred to a nylon membrane and hybridized with 32P-labeled probe I carrying the DNA sequence between the Sail and the Smal sites in the 16S rRNA gene (Figure 1 A). The experiment was carried out as described previously (Magee et al., 1992). The number of operons inactivated and strain numbers are shown on the top of figure 3 A, B. The rRNA operon carried by each fragment is shown on the left. TA520, 531, and 542 contain an rRNA plasmid, pHK-rrnC+ and thus give an additional band (8.4 kb) carrying the plasmid-bome rrnC operon (see Figure 1C) just above the rrnD band (8.1kb, Boros et al., 1979). Deletion of the 23 S rRNA genes. Probe I was removed from the membrane shown in Figure 3 A and the cellular DNA was re-hybridized with 32P- labeled probe II carrying the DNA sequence between the Hpal and the Sail sites in the 23S rRNA gene (Figure 1A). Again, TA520, 531, and 542 gave a plasmid-derived band. The DrrnG::lacZ+ construct contains the Hpal-Sall region of the gene (Figure 1 A). Therefore, in TA447, 488, 516, 520, and 531 in which the rmG operon was inactivated with this construct, the rrnG+-containing band (~14 kb) disappeared and a new band (-12 kb, indicated by an arrow) appeared just above the rrnE band (11.2 kb). This band disappeared in TA542 in which DrrnG::lacZ+ was replaced with DrrnG::cat+.

Determination of the physiological effects of rrn inactivation

Cells from exponential cultures were stained with BacLight (Molecular Probes Inc., Eugene, OR) and analyzed by fluorescent microscopy. Relative growth rate and relative ratios of total-RNA/protein and tRNA/rRNA. Growth rate (doublings/hour) was determined by monitoring the turbidity of each culture with a Klett-Summerson photoelectric colorimeter and are presented as relative values to the rrn+ strain. The actual growth rate of the rm+ strain, TA563, was 2.0. Total-RNA/protein and the tRNA/rRNA ratio in each total RNA sample were determined as described herein. These parameters were normalized to the total RNA amount of the rrn+ strain. Expression of homogeneous rRNA in Δ7 strains

16S rRNA molecules in the rτn+ strain and in Δ7 strains carrying either wt (pHK-rrnC+) or mutant (pSTL102) rRNA plasmid were analyzed by primer extension. The experiment was carried out essentially as described previously (Sigmund et al., 1988, Heinrich et al., 1995). Cells were grown to 80 Klett units and total cellular RNA was prepared with an RNeasy kit (Qiagen, Chatsworth, CA). The RNA samples were treated with RNase-free DNasel (Boehringer Mannheim, Indianapolis, IN) and purified from the enzyme with the same kit. A 32P-labeled DNA primer was then annealed to the RNA and extended with M-MuLV reverse transcriptase (Boehringer Mannheim) in the presence of one dideoxynucleotide (ddATP) and three deoxynucleotides (dGTP, dCTP, and dTTP). The primer hybridized to 16S rRNA at the 3' side of the Spc resistance mutation (C to U change) carried in pSTL102. In the presence of the above nucleotides the primers hybridized to wt and mutant 16S molecules were extended by four nucleotides and one nucleotide, respectively. The extended products were separated on 20% polyacrylamide-urea gel and the gel was exposed to an X-ray film.

Expression of foreign rRNA in Δ7 strains

23 S rRNA molecules in the rrn+ strain and in Δ7 strains carrying either E. coli (pSTL102) or S. typhimurium (pStl-Km) rRNA plasmid were analyzed by primer extension as described in Figure 5. The primer hybridized to a common sequence in E. coli and S. typhimurium 23 S rRNAs but gave different extension products because of a sequence difference between the two molecules. Total cellular RNA prepared from the rrn+ strain and Δ7 strains carrying plasmids with E. coli (Ec, pSTL102), S. typhimurium (St, pStl-Km), or P. vulgaris (Pv, pPM2) rRNA was fractionated on a 1.2% agarose gel and rRNA molecules were visualized by ethidium bromide staining. Total cellular RNA was purified from Δ7 strains carrying an E. coli (pHK-rrnC+), S. typhimurium (pStl- Km), or P. vulgaris (pPM2) rRNA plasmid. cDNA molecules were amplified by PCR with Tth DNA polymerase (Promega, Madison, WI) following the manufacturer's instruction. The forward primer for the reaction was 5' - GTTACCCGCAGAAGAAGCACCGG - 3' (SEQ ID NO: 11 ), and the reverse primer 5' - CTCTACGCATTTCACCGCTA - 3' (SEQ ID NO: 12). These primers hybridized to 16S rRNA near the SacII site shown in Figure 1 A. The PCR products were sequenced with the same polymerase using the reverse PCR primer.

The identification of an erythromycin resistant bacterium and use of RNA operon altered bacteria for screening compounds

A Δ 7 strain bacteria containing a plasmid with wild type rRNA genes is plated on media containing a lethal concentration of Erythromycin and mutant cells which gain resistance to this antibiotic proliferate. The mutant cells are contacted with test compounds under conditions suitable for proliferation, and compounds which modulate proliferation are identified as compounds useful against erythromycin resistance bacteria. Plasmid from the erythromycin resistant Δ 7 bacteria is purified and the insert rRNA operon containing the rescue mutation is sequenced.

Mapping of Erythromycin interaction sites

Erythromycin resistant rRNA operon sequence is compared to wildtype rRNA operon sequence and sites which represent a change are determined to be erythromycin interaction sites.

Structure prediction for the synthesis of derivatives of Erythromycin

Structure prediction for the synthesis of derivatives of Erythromycin that can overcome the resistance changes are determined from the analysis of the domain within the rRNA topological structure which corresponds to the sites of change found in the mutant erythromycin resistant rRNA operon sequence. The interaction between the test compounds and erythromycin are visualized. Derivatives are prepared or designed using information acquired from visualization of this interaction.

Screening test compounds using engineered Δ 7 strain for Erythromycin resistance

Δ 7 strains containing the erythromycin resistance conferring operon plasmid can be prepared producing engineered Δ 7 strains for erythromycin resistance. The engineered cells can be contacted with test compounds, as described above. Example 1. Inactivation of all RNA operons on the chromosome

Ell wood and Nomura (1980) were the first to construct several E. coli strains in which one (rrnE) of the RNA operons was completely deleted. One strain (TXΔ11, Table 1) was chosen for the starting material and introduced deletion mutations into the 16S and 23 S RNA genes of the rest of the operons (see the Methods outlined above). The deletions are shown in Figure 1 A. All strains and plasmids used for this work are described in Tables 1 and 2, respectively. The relevant deletion strains and the order of deletions introduced are summarized in Figure 2. The lack of intact 16S and 23S RNA genes in these strains (termed here Δl, Δ2, Δ3, etc.) was verified by Southern blot analysis and a typical result is shown in Figure 3.

Each RNA operon contains at least one tRNA gene between the 16S and 23 S RNA genes: rrnB, rrnC, rrnE, and rmG contain the tRNA gene for Glu-2, whereas the tRNA genes for Ile-1 and Ala- IB are found in rrnA, rrnD, and rrnh (Komine et al., 1990). These tRNA (spacer tRNA) genes are encoded only in the RNA operons. Since introduction of these deletions ultimately removes all spacer tRNA genes, these genes have been cloned, as well as other tRNA (distal tRNA) genes encoded in the RNA operons, into a derivative of pACYCl 84 carrying the spectinomycin (Spc) resistance marker (resulting in plasmids pTRNA65 and 66; Figure IB). The presence of one of these plasmids is essential for the viability of TA516, in which only the rrnC operon is left on the chromosome, and the derivatives of this strain (see Figure 2). Similarly, a plasmid producing active 16S and 23 S rRNAs is essential for Δ strains. A derivative of pSClOl carrying the wt rrnC operon. pHK-rmC⁺ (Figure 1C), was used for the construction of the first Δ7 strain, TA527.

Example 2. Physiological effects of sequential RNA operon inactivation Previously four of the RNA operons by deletion/insertion mutations with antibiotic resistance genes have been inactivated (Condon et al., 1993). That work suggested that inactivation of more than four RNA operons might have serious deleterious effects on cell growth and viability. Therefore, the cellular and physiological parameters which were likely to be influenced by the deletion of RNA operons such as cell size, growth rate, and RNA/protein ratio were examined. Interesting variations from the wt state were noted for each parameter studied.

Microscopic examination of cells from exponential cultures showed a pronounced morphological change in the cells with RNA operons inactivated. The cells become more and more elongated, with this change being vary apparent in the Δ6 strain (TA516). The elongated cell morphology was not completely reversed in a Δ7 strain (TA527) containing RNA and tRNA plasmids, suggesting that some cellular parameters are still perturbed in this strain (see below). The influence of RNA operon inactivation on growth rate should be most pronounced in rapidly growing cultures were large numbers of ribosomes are needed for short cell division times (Condon et al., 1993: 1995a). The growth rates of the deletion strains to an rrn" strain when grown at 37°C in LB broth were compared. As observed by Ell wood and Nomura (1980), a Δl strain TA566 grew at a rate that was indistinguishable from the rate of the rrn^' strain. Inactivation of two operons. however, significantly reduced the growth rate (TA567) and it continued to decrease gradually as the number of deletions was increased from three to six (TA568, 430, 476, and 516). A Δ7 strain, TA527, grew slower than the rm^' and Δl strains. The persistence of an elongated cell phenotype in microscopic examinations is consistent with Δ7 not being restored to rrn^' properties by the presence of the RNA and tRNA containing plasmids. The unbalanced expression of spacer and distal tRNAs responsible may be responsible, at least in part, for this reduced growth rate. The copy numbers and promoter activities of these tRNA genes in TA527 are different from those in the rm^" strain. Some of these tRNAs may not be sufficient for efficient translation in TA527. Increased expression of tRNAs (see below) might also reduce the growth rate by titrating tRNA-modifying enzymes (Winkler, 1998). Examination of the rrn strain transformed with pTRNA66 and pHK-rτnC⁺ plasmids resulted in a strain with morphological and growth characteristics intermediate between the untransformed rm^" and Δ7 were contributed by these two plasmids.

Bremer and Dennis (1996) report that stable RNA constitutes 98 percent of the total RNA of the cell, and 14 percent of stable RNA is tRNA in E. coli B/r. They further state that these ratios are essentially invariant and growth rate independent. Inactivation of four RNA operons had been shown to cause increased expression from the remaining intact operons (Condon et al., 1993). While this response could, in itself, conceivably maintain a constant ma/protein ratio, it might also increase the relative synthesis of tRNA molecules in the cell because the control of tRNA levels is thought to be regulated similarly to that of RNA (Keener and Nomura, 1996). The relative amount of 4 S to 5 S RNA was examined in these strains. Aa striking increase was found in the relative amount of RNA in the 4S size range as the number of RNA operons activated increased. This result is consistent with models for tRNA derepression following RNA derepression (Jinks-Roberston et al., 1983; Dong et al., 1996). Surprisingly, the total- RNA/protein ratio of the various RNA mutant strains remained relatively constant, with Δ6 having -84 percent of the r ^' strain. The relative increase of 4S to 5S RNA suggests a mechanism cells might use to maintain this overall relatively constant RNA/protein ratio.

Example 3. Expression of homogeneous RNA in Δ7 strains: Manipulation of RNA species by plasmid replacement

The RNA molecules in Δ7 strains were expected to be homogeneous because these strains contained only a single intact RNA operon on a plasmid. To confirm this, an RRNA plasmid, pHK-rrnC⁺ in a Δ7ΔrecA strain (TA531 , Figure 2) was replaced with another RNA plasmid, pSTL102 (plasmid replacement, see Experimental Procedures). The resultant strain is TA540. PStL102 is a derivative of pBR322 carrying a mutant, but functional, rrnB operon (Triman et al., 1989). It contains single base substitutions in the 16S RNA gene at position 1192 (Figure 1 A), conferring resistance to Spc and in the 23 S RNA gene at position 2058, conferring resistance to erythromycin (Ery) (Sigmund et al., 1984). Either of these base substitutions can be distinguished from the wt sequence by the method developed by Morgan and co-workers that utilizes primer extension (Sigmund et al., 1988). As shown in Figure 4, wt 16S molecules were not detected in a total RNA sample prepared from TA540, suggesting that 16S RNA molecules in Δ7 strains were homogeneous. By using an RNA plasmid carrying the S. typhimurium rrnD operon, 23SrRNA molecules in Δ7 strains were also found to be homogeneous (see below). Thus, both 16S and 23 S RNA molecules in Δ7 strains are homogeneous and that plasmid replacement provides a powerful and reliable tool for manipulating RNA species in Δ7 strains.

Example 4. Expression of foreign RNA in Δ7 strains: Formation of homogeneous hybrid ribosomes in vivo It has been demonstrated that the RNA genes of E. coli and S. typhimurium contain many differences in DNA sequences (Gregory et al., 1996). Furthermore, the 23S RNA genes of S. typhimurium have been shown to carry at least one intervening sequence (IVS), which is excised by Rnase III during RNA maturation (Burgin et al., 1990). This results in 23S RNA molecules that are fragmented by nevertheless functional in the bacterium.

To show one utility of Δ7 strains, a strain producing in vivo homogeneous hybrid ribosomes containing S. typhimurium 16S and 23S rRNAs and E. coli r-proteins. pStl is a derivative of pBR322 carrying the entire rrnD operon (including regulatory regions) of S. typhimurium (Burgin et al., 1990). The 23 S gene in this operon contains a single IVS in helix 45 beginning at position 1164 (Figure 1 A). The kanamycin (Km) resistance gene was inserted into pStl within the vector sequence and the resultant plasmid, pStl-Km, was introduced into a Δ7 strain TA548 to generate TA554 by replacing pSTL102 (Figure 2). The successful plasmid replacement strongly suggests that E. coli can grow with S. typhimurium 16S and 23S rRNAs. The following observations demonstrate that only S. typhimurium RNA was expressed in TA554 and most, if not all, 23 S RNA molecules in the strain were fragmented (i) The EcoRI-Sall fragment (500 bp, Figure 1 A) of the E. coli 23S gene was not detected in a total DNA preparation isolated from TA554 by Southern blot analysis with probe II (shown in Figure 1 A) for early 23 S sequences. A different fragment was detected that was between 100 bp larger than the E. coli fragment. This is consistent with the result that the size of this IVS is between 90 bp (Burgin et al, 1990). It should be noted that TA554 is a derivative of TA542 and contains the ΔrrnG::ca~ not ΔrrnG::lacZ⁺, mutation (Figure 1 A and 2, see Methods above), (ii) E. coli 23S RNA molecules were not detected by primer extension in a total RNA preparation isolated from TA554 (Figure 5 A), (iii) Intact 23 S RNA molecules were not detected in the same RNA preparation (Figure 5B). (iv) Sequencing of cDNA molecules amplified by polymerase chain reactions (PCR) from 16S RNA in TA 554 detected only S. typhimurium sequence. From these results, S. typhimurium 16S and 23S rRNAs can likely form functional translational machinery in vivo with other E. coli components. No significant difference was detected in either growth rate or ma/protein ratio between an E. coli ribosome-containing strain, TA548, and a hybrid ribosome-containing strain, TA554. Since a ribosome defect or deficiency would lower the growth rate of the cells (Bremer and Dennis, 1996) these results suggest that the translation efficiency of the hybrid ribosomes is similar to that of E. coli ribosomes.

The same approach to the RNA molecules from P. vulgaris, one of the enteric bacteria that is most distantly related to E. coli (Ochman and Lawrence, 1996). Although the sequence of the 23S RNA gene of P. vulgaris is unknown, the 23S gene cloned in pPM2 (Niebel et al., 1987) contained a large (200 bp) IVS in helix 5 beginning at position 533 (Figure 1 A; DZ, CS, and CLS, unpublished). All E. coli 16S and 23S RNA molecules could be replaced with the corresponding P. vulgaris molecules. The growth rate of the cells expressing P. vulgaris RNA was similar to that of E. coli ma-containing cells, suggesting that P. vulgaris RNA functioned effectively in these cells. In contrast, one of the RNA operons in Pseudomonas aeruginosa, which is more distantly related to E. coli than P. vulgaris, failed to replace the E. coli rrnC operon.

The cells of the instant invention represent a new system for the analysis of RNA in E. coli by inactivating all 16S and 23 S RNA genes on the chromosome. Using mutant and foreign RNA operons. demonstrate that homogeneous 16S and 23 S rRNAs were expressed in such a strain (Δ7 strain) from a cloned operon. This system provides a powerful method for the isolation of mutant 16S and 23 S rRNAs, since altered RNA genes can be efficiently and specifically introduced into a cloned RNA operon. Conditional lethal mutations can also be generated and analyzed in this system. Cells carrying mutant rRNAs can be readily studied by examining their properties with respect to RNA sequences, cell growth and physiology, and the functioning of the novel ribosomes both in vivo and in vitro.

References Boros, I., Kiss, A., and Venetianer, P. (1979). Physical map of the seven ribosomal RNA genes of Escherichia coli. Nucleic Acids Res. 6, 1817-1830.

Bremer, H., and Dennis, P. (1996). Modulation of chemical composition and other parameters of the cell by growth rate. In Escherichia coli and Salmonella: Cellular and Molecular Biology, F.C. Neidhardt, R. Curtiss. J.L. Ingraham, E.C.C. Lin, K.B. Low, B. Magasanik, W.S. Reznikoff, M. Riley, M. Schaechter and H.E. Umbarger, eds. (Washington, DC: ASM Press), pp. 1553-1569.

Brunschede, H., Dove, T.L., and Bremer, H. (1977). Establishment of exponential growth after a nutritional shift-up in Escherichia coli B/r: Accumulation of deoxyribonucleic acid, ribonucleic acid, and protein. J Bacteriol. 129, 1020-1033.

Condon, C, Philips, J., Fu, Z.-Y., Squires, C, and Squires, CL. (1992). Comparison of the expression of the seven ribosomal RNA operons in Escherichia coli. EMBOJ. 11, 4175-4185.

Condon, C, French, S., Squires, C, and Squires, CL. (1993). Deletion of functional ribosomal RNA operons in Escherichia coli causes increased expression of the remaining intact copies. EMBO J. 12, 4305-4315.

Gay, P., Le Coq, D., Steinmetz, M., Berkelman, T., and Kado, C (1985). Positive selection procedure for entrapment of insertion sequence elements in gram- negative bacteria. J Bacteriol. 164, 918-921.

Gutterson, N.I., and Koshland, D.E. (1983). Replacement and amplification of bacterial genes with sequences altered in vitro. Proc. Natl. Acad. Sci. USA 80, 4894- 4898.

Heinrich, T., Condon, C, Pfeiffer, T., and Hartmann, R.K. (1995). Point mutations in the leader boxA of a plasmid-encoded Escherichia coli rrnB operon cause defective antitermination in vivo. J Bacteriol. 177, 3793-3800.

Li, S.C, Squires, C.L., and Squires, C (1984). Antitermination of E. coli rRNA transcription is caused by a control region segment containing lambda nut-like sequences. Cell 38, 851-860. Magee, T.R., Asai, T., Malka, D., and Kogoma, T. (1992). DNA damage- inducible origins of DNA replication in Escherichia coli. EMBO J. 11, 4219-25.

Peacock, A.C, and Dingman, C.W. (1967). Resolution of multiple ribonucleic acid species by polyacrylamide gel electrophoresis. Biochemistry 6, 1818-1827.

Prentki, P., and Krisch, H. (1984). In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29, 303-313.

Sigmund, CD., Ettayebi, M., Borden, A., and Morgan, E.A. (1988). Antibiotic resistance mutations in ribosomal RNA genes of Escherichia coli. Methods Enzymol. 164, 673-706.

Slater, S., and Maurer, R. (1993). Simple phagemid-based system for generating allele replacements in Escherichia coli. J. Bacteriol. 175, 4260-4262.

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Table 1. E. coli K-12 Strains

Strain Relevant Genotype Source, Reference, or Construction

TXΔ11 A{pwDHn-rrnE-metA) HI wood and Nomura, 1980

Strains of TXΔ1 1 background

TA340 TXΔ1 1 polAl zi . nJO TXΔ1 1 x P1.AQ8809 select Tc^r,

PolA- TA405 TA340 A(rr*B-gltT-rrlB)l ::kxm+ TA340 x PI. CC164 select Kirf

TA406 TA340 A(rrsB-gltT-rrlB)l::k n^ zij::≠ΛA10l TA405 transformed with pMA 101, select Ap¹, Suc^s TA410 TA34 A(rrsB-gltT-rrlB)10l Sue*^" derivative of TA406, ApS π_s

TA415 TA410 A(rrsH-ileV-alaV-rrlH)37::cai+ TA410 x P1.JP37 select Cm^r

TA418 ΥAΛ\0 A(rrsH-ileV-alaV-rrlH)37::cat⁺ TA415 transformed with pMA 103, z f.:pMAJ03 select Ap^1" Km^r, Suc^s

TA420 TA410 A(rrsH-ileV-alaV-rrlH)103 Suc^r derivative of TA418, Ap^s m^s

Cm^s TA430 TA420 A(rrsA-ileT-al T-rrlA)l .car polA⁺ TA420 x P1.CC164 select Cm^r, Tc

PolA÷ TA443 TA420 A(rrsG-gltW-rrlG)33::caV TA420 x P1.JP33 select Cm^r

TA445 TA420 A(rrsG-gltW-rrlG)33::car _zfg::pϊ Y30 TA443 transformed with pN^'Y30, select Ap¹ K_m^r, Suc^s TA447 TA420 A(rrsG-gh\V-rrlG)30::lac∑- Suc^r deπvauve of TA445. Ap^s Km^s

Cm^s TA472 TA410 A(rrsΛ-ileT-alaT-rrlA)l: car TA410 x P1.CC164 select Cmr j_cT_|

PolA^" TA476 TA447/. o/Λ⁺ Δ(rrsA-ileT-aIaT-rrlA)l :ca TA447 x PI. CC 164 select Cm^r, Tc*

PolA⁺

TA4S0 TA410 Δ(rrsA-ileT-alaT-rrlA)l::cat*- TA472 transformed with pNY34, zih::pNY34 select Ap^1" Km^r, Suc^s TA485 TA441polA⁺ Δ(rrsA-ileT-aIaT-rrlA)l::car TA476 x P1.TA480 select Cm^r Km^r zih::pNY34 Ap^1", Tcs PolA+ Sues TA 88 TA447 po/Λ⁺ A(rrsA-ileT-alaT-rrlA)34 Suc^r derivative of TA485, Ap^s Km^s

Cm^s

TA500 TA48S/pTRNA65 TA488 transf rmed with pTRNA65, select Spc^r

TA516 TA488 A(rrsD-ileU-alaU-rrlD)25: :car TA500 x PI. JP25 select Cm^r

/pTRN A 65 TA520 TA4S8 A(rrsD-ileU-al U-rrlD)25::car TA516 transformed with pHK-rrnC",

/pTRNA65 pHK-rraC÷ select Km^r TA520.5 TA4S8 A(rrsD-ileU-al U-rrlD)25::caT tRNA Glu-2 deletion from pTRNA65

/pTRNA 66 pHK-rrnC^ inTA520, generating pTRN A 66 TA525 TA 520.5 A(rrsC-glιU-rrlC)15: :cai+ TA520.5 x PI .TA575 select Tc^r,

UV500: :TΏJ0 rrnCwcar TA527 TA520.5 A(rrsC-gltU-rrlC)15::car⁺

TA525 x PI. JP15 select Ilv^÷ , Tc^S

TA531 TA527 A(srlR-recA)306 srlR. nJO TA527.X P1.JC10284 select Tcr, UV*

TA540 TA531/pSTL102 (pHK-rτnO free) TA531 transformed with pSTLl 02, select Ap¹, m^s

TA542 TA527 A(rrsG-gltW-rrlG)33::car recA56 TA527 x Hfr TA539 select Km^rTc^T, srlC .Ti O UV^S rrnGv.car TA548 TA542'pSTL102 (pHK-rτnC⁺ free) TA542 transformed with pSTL102, select ApT, Km^s

TA554 TA54S/pStl -Km (pSTL102 free) TA548 transformed with pStl-Km, select Km^r, Ap^s

TA 559.5 TX 11 /pB EU49 TXΔ11 transformed with pBEU49, select Ap¹ Km^r, Ts

TA560* pur* rrnEy metA⁺ metBl TA559.5 x Hfr CAG5052 select Tc^1" btuB3191::TnlO/pBEU49 Ap¹ Km^r, Pur⁺ rrnE* Mer

TA563 pur* rr Ey metA⁺ metBl Temperature-resistant derivative of btuB3191::TnJ0 TA560, Ap³ Km^s

TA566 TA563 A(rrsA-ileT-alaT-rrlA)l .car TA563 x P l.CC 164 select Cm^r TA567 TXΔ1 1 A(rrsA-ileT-alaT-rrlA)l:.car TXΔ11 x P1.CC164 select Cm^r TA568 TA410 A(rrsA-ileT-al T-rrlA)l::c r polA+ TA410 x PI. CC164 select Cm^r,

Tc⁵ PolA⁺

Intermediates in strain constructions AQ8809 polAl zih::TnJ0 T. Kogoma

CAG5052 KL221 btuB319l::TτU0 Singer et al., 1989 CAG18431 MG 1655 //v500::Tn/0 Singer et al., 1989 CC 164 W1485 Δ(rrsB-gltT-rrlB)l::kan⁺ BAG1 in Condon et al , 1993

A (rrsA-ileT-alaT-rrlA)l : :ca A(rrsG-gltW-rrlG) I : :spc⁺ JC10240 Hfr KL 16 recA56 sr/C: :Tn70 A. J. Clark

JC10284 A(srLR-recA)306 srlR.- nJO A. J. Clark

JP15 VJ\485 A(rrsC-gltU-rrlC)]5::cat⁺ W 1485 ΔC in Condon et al. , 1992

JP25 W1485 A(rrsD-ileU-alaU-rrlD)25::car W1485 ΔD in Condon et al, 1992

JP33 W1485 A(rrsG-glιW-rrlG)33:.car W 1485 ΔG in Condon et al. , 1992

JP37 1485 A(rrsH-ileV-alaV-rrlH)37 car W 1485 ΔH in Condon et al. , 1992

TA538 JC10240/pBEU49 JC10240 transformed wιt pBEU49, select Apr Km^r, UV^r Ts TA538.5 JC 10240 A(rrsG-gltW-rrlG)33::car /pBEU49 TA538 x P1.JP33 select Cm^r

TA539 JC 10240 A(rrsG-gltW-rrlG)33;.car^r Temperature-resistant derivative of

TA538.5. Aps m* UV*

TA575 \485 A(rrsC-glιU-rrlC)15::cai* JP15 Pl. CAG18431 select Tc^r Cm^r

Uv500::TnJ0

UV^S, UV-sensitive; UV^r, UV-resistant; Ts, temperature-sensitive. *The remaining genotypes are F" ara Alac thi. *The presence of metA⁺ metBl in these strains has not been verified (see Experimental Procedures).

Table 2 Plasmids

Designation Relevant characteristics Source or Reference

Plasmids used for the inactivation of rrnB pSTL102 pBR322 carrying a mutant (Spc^r Ery¹) rrnB operon and its flanking Triman et al., 1989 regions in the tet gene pMA lOO pSTL102 carrying the Sall-Sall deletion (ArrnB in Figure 1A) in rrnB J. Vouigaris pMA 101 pMA 100 carrying the sacB-Km^τ cassette in the BamHI site This work

Plasmids used for the inactivation of rrnH pLC7-21 A ColEl plasmid carrying the rrnH operon and its flanking regions Clarke and Carbon

1976 pC5 pBR322 carrying rrnH* (EcoRV fragment of pLC7-21 ) in C. Condon the EcoRV site pMA 102 pC5 carrying the SacII-SacII deletion (ArrnH in Figure 1 A) in rrnH This work pMA 103 pMA 102 carrying the sacB-Km^τ cassette in the Sail site This work

Plasmids used for the inactivation of rrnG pLC23-30 A ColEl plasmid carrying the rrnG operon and us flanking regions Clarke and Carbon

1976 pC14 pBR322 carrying rrnG* (BamHI fragment of pLC23-30) Condon et al , in the BamHI site 1993 pNY2 The S mal-Hpa I region of rrnG in pC 14 was replaced with This work* a lacTy fragment (ArrnG .lacZ* in Figure 1A) pNY30 pNY2 carrying the sacB-Km^τ cassette in the Hindlll site This work*

Plasmids used for the inacuvauon of rrnA pLC 19-3 A ColEl plasmid carrying the rrnA operon and its flanking regions Clarke and Carbon,

1976 pCl pBR322 carrying rrnA⁺ (BamHI fragment of pLC19-3) in C. Condon the BamHI site pCl ΔSacII pCl carrying the SacII-SacII deleuon (ArrnA in Figure 1A) in rrnA This work pNY34 pC 1 Δ SacII carrying the sacB-Km^τ cassette in the EcoRV site This work

Other plasmids pBEU49 A runaway-replication mutant plasmid carrying the recAo2Sl gene Uhlm et aL, 1982

(A KxnP) pBIP3 A source of the ωc_.- m^r cassette (47 kb BamHI fragment) Slater and Maurer,

1993 pC4 pBR322 carrying rrnC* (EcoRV fragment of pLC22-36) in C. Condon the EcoRV site pC8 pBR322 carrying rrnD* (Aflll-PstI fragment of pLCl 6-6) in C Condon the EcoRV site pHK A plasmid carrying the pSClOl origin and the lan gene Asai et al , 1994 pHK-rrnO pHK carrying rrnC* (EcoRV fragment of pC4) This work pKK3535 ρBR322 carrying the wt rrnB operon in the m gene Brosius e al , 1981 pPM2 ρBR322 carrying a P vulgaris rrn operon Niebel et al , 1987 pStl pBR322 carrying the S typhimurium rrnD operon Burgm et al , 1990

(10 kb Pstl fragment) pStl-Km pStl carrying the kan gene in the BamHI site This work pTRNA A Spc¹ derivative of pACYCl 84 carrying tRNA genes see Expenmental

Procedures

¹ All cloning expenments for these plasmids were earned out at 30 °C with M9 Glycerol mediu

Claims

What is claimed is:

1. An ran operon altered bacterium deficient in most ma operons endogenous to the wild type genome of the bacterium.

2. The ran operon altered bacterium of claim 1 wherein said bacteria is Escherichia coli.

3. The ran operon altered bacterium of claim 2 wherein the number of ma operons present in the altered bacterium which are endogenous to the bacteria is selected from the group consisting of: 0, 1, and 2.

4. The ran operon altered bacterium of claim 1 deficient in all ma operons endogenous to the wild type genome of the bacterium.

5. The ran operon altered bacterium of claim 1, further comprising an ma operon or portion thereof which is heterologous to the bacterium.

6. The ran operon altered bacterium of claim 5 wherein the heterologous ma operon is not integrated into the genome of the bacterium.

7. The ran operon altered bacterium of claim 5 wherein the heterologous ma operon is contained in a plasmid.

8. The ran operon altered bacterium of claim 5 wherein the ma operon or the portion thereof contained within the plasmid is derived from an organism which is different from the ma operon altered bacterium.

9. The ran operon altered bacterium of claim 8 wherein the ma operon or portion thereof is derived from a gram-positive or gram-negative bacterium.

10. The ran operon altered bacterium of claim 8 wherein the ma operon or portion thereof is derived from a fungal cell.

11. The ran operon altered bacterium of claim 8 wherein the ma operon or portion thereof is derived from a plant cell.

12. The ran operon altered bacterium of claim 8 wherein the ma operon or portion thereof is derived from a mammalian cell.

13. The ran operon altered bacterium of claim 8 wherein the ma operon or portion thereof is derived from a mitochondria.

14. The ran operon altered bacterium of claim 8 wherein the ma operon or the portion thereof is not wildtype.

15. The ran operon altered bacterium of claim 1, wherein the bacteria further comprise a modification which renders an efflux pump non- functional.

16. The method of claim 15, wherein the efflux pump is an AcrAB efflux pump.

17. The ran operon altered bacterium of claim 1 , wherein the bacteria further comprise a modification which results in increased expression of a membrane channel.

18. The ran operon altered bacterium of claim 17, wherein the membrane channel is a porin molecule.

19. A method of selecting a compound capable of modulating proliferation of an rm operon altered bacterium comprising; contacting said rm operon altered bacterium with the compound under conditions suitable for proliferation of said rm operon altered bacterium; and selecting the compound which modulates proliferation of the rm operon altered bacterium.

20. The method of claim 19 wherein proliferation is promoted.

21. The method of claim 19 wherein proliferation is inhibited.

22. The method of claim 19, wherein the bacteria further comprise a modification which renders an efflux pump non-functional.

23. The method of claim 22, wherein the efflux pump is an AcrAB efflux pump.

24. The method of claim 19, wherein the bacteria further comprise a modification which results in increased expression of a membrane channel.

25. The method of claim 24, wherein the membrane channel is a porin molecule.

26. A method for the replacement of endogenous rRNA genes with a null gene replacement plasmid in a bacterium comprising: transformation of a bacterium with an rRNA operon targeted gene replacement plasmid containing a selection marker; and replacement of endogenous rRNA operons with a null sequence; and selecting for those bacteria which contain the selection marker and thus integration of the gene replacement plasmid.

27. A method of claim 26 wherein tRNA genes are subsequently reintroduced into the rm operon altered bacterium.

28. A method for the addition of episomal non-integrating rRNA operon plasmids into bacteria comprising: transformation of a bacterium with an rRNA operon plasmid containing a selection marker; and selection for those bacteria containing the episomal non-integrated rRNA operon plasmid containing a selection marker by growing said bacteria in a suitable environment containing the selection agent.

29. A method for the addition of episomal non-integrating tRNA operon plasmids into bacteria comprising: transformation of a bacterium with a tRNA operon plasmid containing a selection marker; and selection for those bacteria containing the episomal non-integrated tRNA operon plasmid containing a selection marker by growing said bacteria in a suitable environment containing the selection agent.

30. A method of selecting a compound capable of modulating proliferation of an rm operon altered bacterium comprising; contacting said rm operon altered bacterium with an operon site-specific compound under conditions suitable for proliferation of said rm operon altered bacterium; and selecting the operon site-specific compound which modulates proliferation of the rm operon altered bacterium.

31. A method of selecting a compound capable of inhibiting proliferation of an rm operon altered bacterium comprising; contacting said rrn operon altered bacterium with the operon site-specific compound under conditions suitable for proliferation of said rm operon altered bacterium; and selecting the operon site-specific compound which inhibits proliferation of the rm operon altered bacterium.

32. A method for designing an operon site-specific compound comprising: determining the specific characteristics of an operon site in an operon contained in an rm operon altered bacterium; and using these operon site-specific characteristics for designing pathogen proliferation modulating agents directed against said site.

33. The method of claim 32 wherein the modulating agent is an inhibitory agent.

34. The method of claim 30 wherein the rm operon altered bacterium is Escherichia coli.

35. The method of claim 30 wherein bacterium comprises a heterologous ran operon derived from an organism selected from the group consisting of : a gram-positive bacterium, a gram-negative bacterium, a fungal cell, a plant cell, and a mammalian cell.

36. A method for producing an rm operon altered bacterium comprising: inactivating most of the endogenous rRNA operons of a bacterium forming an rm operon altered bacterium deficient in most endogenous rRNA operons.

37. The method of claim 36 further comprising transforming said bacterium with a vehicle containing a heterologous rRNA operon forming a heterologous ma containing ran operon altered bacterium (HOAB)

38. The method of 37 wherein the vehicle is a plasmid.

39. The method of claim 37 wherein the step of inactivating comprises deleting the endogenous ma operons.

40. The method of claim 37 wherein the number of rRNA operons inactivated is more than four.

41. The method of claim 40 wherein the number of rRNA operons inactivated is selected from the group consisting of: 5, 6, and 7.

42. The method of claim 41 wherein the number of rRNA operons inactivated is 7.

43. The method of claim 37 further comprising the insertion of a portion of an rm operon.

44. The method of claim 43 wherein the inactivation is accomplished by gene replacement.

45. A method of selecting a compound which interacts with a heterologous rRNA operon for targeting compounds against the species from which the heterologous rRNA is derived comprising; contacting a heterologous rRNA containing rm operon altered bacterium

(HOAB) with a compound under conditions suitable for proliferation of said HOAB; and selecting the compound which modulates proliferation of the HOAB thereby selecting compounds which interact with the heterologous rRNA operon.