WO2000006751A2 - Repressor proteins producing cell lines for the propagation of vectors - Google Patents

Abstract

The present invention provides eukaryotic cells capable of replicating recombinant expression vectors that produce heterologous proteins, wherein the cell comprises a polynucleotide encoding a repressor protein that is capable of repressing production of the heterologous protein. The invention also provides recombinant vectors, such as viruses (for example, adenoviruses) comprising (i) a first polynucleotide sequence encoding a heterologous protein and (ii) a second polynucleotide sequence operably linked to the first polynucleotide in order to permit repression of the expression of the first polynucleotide gene.

Description

REPRESSOR PROTEINS PRODUCING CELL LINES FOR THE PROPAGAΗON OF VECTORS

»

REFERENCE TO RELATED APPLICATION

The subject matter of U.S. provisional patent application serial number

60/094,681 filed July 30, 1998 is incorporated herein by reference. The present application claims priority to provisional patent application serial number 60/094,681.

The present invention relates to various cell lines, including

derivatives of the 293 cell line. The present invention also relates to

recombinant viruses, such as recombinant adenoviruses.

BACKGROUND OF THE INVENTION

Human adenoviruses have become one of the vectors of choice for

the delivery and expression of foreign or exogenous proteins for gene

therapy, immunotherapy and vaccination. For a recent review, see Hitt et

ah. Adv. Pharmacol. 40: 137-206 (1997). Human adenoviruses have been shown to be effective vaccines, for example, for the delivery of rabies

glycoprotein antigens to non-human hosts. Protective immune responses have been induced in animals immunized with either infectious or defective vectors of this type delivered either by parenteral or oral routes. Prevec et

ah, J. Infect. Dis. 161, 27-30 (1990); Charlton et ah, Arch. Virol. 123: 169- 179 (1992); Yarosh et ah, Vaccine 14, 1257-1264 (1996); Xiang et ah,

Virology 219, 220-227 (1996). Replication-defective vectors generally have disruptions/deletions of the early transcription El region and optionally the E3 region and inserts of cassettes containing an appropriate exogenous promoter and the gene(s) to

be expressed. Vectors of this type are produced and grown on El complementing cell lines such as the human 293 cell line, which is a human embryonic cell line. Graham et ah, J. Gen. Virol. 36: 59-72 (1977). Through established procedures employing plasmid shuttle vectors (Graham & Prevec, Molec. Biotech. 3: 207-20 (1995)), the foreign gene (or promoter-

gene cassette) is inserted into convenient restriction sites in the shuttle

plasmid(s) and co-transfection of 293 cells with the appropriate pair of

plasmids results in the rescue of a recombinant adenovirus vector which contains and expresses the desired exogenous protein. This procedure has been successfully used to produce many recombinant viruses expressing

different types of proteins from a range of different sources.

However, there are instances where exogenous protein expressed by

the virus seems to interfere with the subsequent development of viral

progeny. As a result, rescue of virus by transfection and viral growth may be severely compromised in some cases.

There have been cases where there is a reduction in glycoprotein

expression as a consequence of transcriptional suppression or "squelching."

For example, the activity of the Herpes Simplex Virus VP16 transactivation

domain on the LAP348 protein. Natesan et ah, Nature 139: 349-350 (1997) have shown that transcription of episomal DNA is preferentially inhibited by

"squelching".

A number of solutions to the problem of over expression of

inactivating genes by viral vectors have been explored. Yoshida and Hamada, Biochem. and Biophys. Res. Comm. 230: 426-430 (1997) placed the VSV glycoprotein gene under the control of a minimal HCMV promoter

fused to several tetracycline operator sequences. The operator sequences serve as potential binding sites for a chimeric transactivator protein

consisting of the C-terminal domain of the herpes simplex virus protein

VP 16 fused to the tetracycline repressor protein. In the presence of tetracycline, the transactivator cannot bind to the promoter region, while in

its absence, expression of transcripts from this promoter is a function of the amount of transactivator present. In order to provide adequate levels of

transactivator, Yoshida and Hamada used a second recombinant Ad vector.

Massie et ah, J. Virol. 72: 2289-2296 (1998) also exploited the tetracycline

regulatable expression system, developing 293 cells that expressed the tet-

regulated transactivator to obtain high level expression of a inactivating protein. In yet another approach. Tomanin et ah. Gene 193, 129-40 (1997)

developed Ad vectors containing cassettes regulated by a T7 promoter in

combination with vectors expressing the T7 RNA polymerase to express proteins having an inactivation potential.

These approaches, while potentially useful for the production of

proteins in cell culture, do not lend themselves to an in vivo expression system, such as those implicated in genetic therapy and vaccination. In contrast to the efforts of the art, the approach described herein utilizes repression of transgene expression during vector isolation and growth, and has proved to be very successful in producing recombinant adenoviruses

capable of expressing heterologous proteins, such as rabies glycoproteins, at high levels in host cells and in animals. Studies in mice indicate that a very high level of rabies neutralizing antibody can be induced by the intron- containing vectors following a single intraperitoneal injection.

SUMMARY OF THE INVENTION

It is an object of the present invention to provide a technique for

increasing expression of heterologous proteins by recombinant viruses, such

as adenoviruses.

It is also an object of the present invention to provide cells for the production of certain viruses.

It is a further object of the present invention to provide cells useful in

the production of adenoviruses.

It is a further object of the present invention to provide cells in which

certain heterologous foreign protein products from certain adenoviruses is

inhibited.

It is a further object of the present invention to provide cells based on human embryonic cell lines, such as embryonic kidney cell lines, that are capable of producing a protein or other entity capable of binding with a

It binding site on the genome of certain adenoviruses to inhibit production of certain proteins whose overexpression interferes with the production of those

adenoviruses.

These and other objects are accomplished by the present invention, which provides, in accordance with one aspect of the invention, a eukaryotic cell capable of replicating a recombinant expression vector that produces a

heterologous protein, wherein the cell comprises a polynucleotide encoding

a repressor protein that is capable of repressing production of the

heterologous protein. The cell can be a mammalian cell. Moreover, the

vector can be a plasmid or a virus, such as an adenovirus. The cell can

complement a virus, for example, the cell can express the protein product of a defective region of the virus. For example, the cell can express the El product (or its functional equivalent) that cannot be expressed by an El

functionally deleted virus. The vector can be a defective virus. For

example, the virus can have a functionally disrupted El and optionally the

E3 region can be functionally disrupted as well. The cells can be derived

from embyonic kidney cells, such as 293 cells. The polynucleotide encoding

the repressor can be integrated in the genome of the cell. The repressor can be a Lac repressor or a repressor derived therefrom. One source for a

repressor-encoding polynucleotide is plasmid pHMCVLAP348. Cells

according to the invention include cell line 293Lapl0 (ATCC Accession No. CRL-12586) and cell line 293Lapl3 (ATCC Accession No. CRL-12587). In accordance with another aspect of the invention, there are provided recombinant vectors, such as viruses (for example, adenoviruses) comprising (i) a first polynucleotide sequence encoding a heterologous protein and (ii) a second polynucleotide sequence operably linked to the first polynucleotide in order to permit repression of the expression of the first polynucleotide gene. The recombinant vector, such as an adenovirus, includes those wherein the second polynucleotide sequence is an operator that can be bound by a repressor. Representative sequences include a lac

operator sequence and sequences derived therefrom (all are types of

polynucleotides). In the case of a recombinant adenovirus, the adenovirus

can have a functionally disrupted El and optionally the E3 region can be functionally disrupted as well. A recombinant vector, such as an adenovirus,

can encode a variety of heterologous proteins, such as the rabies glycoprotein G. A recombinant vector, such as an adenovirus, also can include an intron sequence to facilitate protein production.

In accordance with still another aspect of the invention, there are

provided eukaryotic cells according to the invention that are infected or

transfected with vectors according to the invention.

In accordance with yet another aspect of the invention, there are

provided methods of propagating vectors encoding a heterologous protein,

comprising transfecting or infecting eukaryotic cells according to the invention with vectors according to the invention. These and other aspects of the present invention will become ft apparent to the skilled person in view of the teachings contained herein.

Modifications may be made without departing from the scope and spirit of

the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1 depicts the construction of plasmids having the rabies glycoprotein gene (Fx) under the control of the MCMV promoter, an intron (I) sequence with or without a copy of the lac operator sequence (o) just downstream of the transcription start site. Unlabelled portions of the circles

comprise plasmid or Ad5 sequences. The sequences of linkers AB9483 and

AB9484, comprising the operator sequence, are set forth below.

FIGURE 2 A concerns probing for the inserted genes in 293 LAP

cells. DNA extracted from 293LAP10 (lanes 1, 4 and 7), 293LAP13 (lanes 2, 5 and 8) or 293 (lanes 3, 6 and 9) cells was digested with Hind III (lanes 1,

2 and 3), Xba I (lanes 4, 5 and 6) or Pst I (lanes 7, 8 and 9) and fragments

separated by agarose gel electrophoresis. The DNA was analysed by

Southern blot hybridization (as shown in FIGURES 2B and 2C) using respectively, probe A, the BamHI to Bgl II fragment of pMPG2, or probe B,

the Ndel to Hindlll fragment of pMPG3. The proposed structure of the insert in 293 LAP cells is indicated at the bottom of the FIGURE 2D. The

markers were generated by digestion of pMPG2 with Hindlll and Sad (B) or of pMPG3 with BamHI and Sad (C). FIGURES 2E and 2F are schematic

representations of plasmids pMPG2 and pMPG3 respectively. FIGURE 3 depicts expression of LAP348 protein in 293LAP13 cells and induction following infection with an El -deleted Ad5 virus. Whole cell extracts, analyzed by Western blot, were prepared from uninfected

293LAP13 cells (lane 1) or at 24 hours (lane 2), 48 hours (lane 3) and 72 hours (lane 4) following infection with Ad dl70-3 at an m.o.i. of 5 pfu/cell.

As controls, extracts also were prepared from uninfected 293 cells (lane 5)

and from 293 cells at 72 hours following infection with Ad dl70-3 (lane 6).

The LAP348 protein was detected with commercial anti-Lac repressor antibody as described in the text. Two exposure times, 15 min.(top) and 1 min (bottom) are shown for comparison.

FIGURE 4A depicts expression of rabies glycoprotein by different

vector viruses in 293 and 293LAP13 cells. Monolayer cultures of 293 or 293LAP13 cells were infected at 2 pfu/cell with one of the following

viruses: Ad5BHGE3MH5Fx, which lacks intron or operator sequences but is otherwise identical to the other vectors (lanes 1,4,7 and 10);

AdMH5(I)E3Fx, which has the intron but no operator sequences (lanes 2,5,8

and 1 1) and AdMH5(I)E3Fx(o), which has the intron and one operator

sequence (lanes 3,6,9 and 12). The infected monolayers were radiolabelled

with ³⁵S-methionine from 8 to 10 hours or from 17 to 19 hours post-

infection and the cells harvested, cell extracts prepared, immunoprecipitated

with anti-rabies glycoprotein antibody and analysed by PAGE, all as described in the text. Lane 13 has extracts from uninfected 293LAP13 cells. Two different exposures (18 hr and 2 hr) are presented for comparison. FIGURE 4B depicts operator-dependent inhibition of rabies glycoprotein expression in 293LAP13 cells and reversal by IPTG. Monolayer cultures of

293LAP13 cells, without (lanes 3 and 6) or with pretreatment with IPTG

(lanes 4 and 7) were infected with AdMH5(I)E3Fx, the vector lacking an

operator sequence (lanes 3 and 4) or with AdMH5(I)E3Fx(o), the vector having one operator sequence (lanes 6 and 7). As a control, 293 cells were

also infected with AdMH5(I)E3Fx (lane 2) or AdMH5(I)E3Fx(o) (lane 5).

All infections were at 2 pfu/cell and all infected cultures were radiolabelled with ³⁵S-methionine between 8 to 10 hours post-infection and analysed as

described herein.

FIGURE 5 depicts expression of rabies glycoprotein by different

vectors in non-complementing human (MRC5) or canine (MDCK) cell lines. Monolayer cultures of MDCK cells (lanes 1 to 5) or MRC5 cells (lanes 6 to

10) were infected at 10 pfu/cell with one of the following:. Ad5BHGE3MH5Fx (lanes 1 and 6) or 50 pfu/cell (lanes 2 and 7);

AdMH5(I)E3Fx (lanes 3 and 8); AdMH5(I)E3Fx(o) (lanes 4 and 9); or were

not infected (lanes 5 and 10). The infected cultures were labeled from 8 to 10 hours post-infection and harvested, immunoprecipitated and analyzed on

PAGE. The long exposure is 20 hours (top) and the short exposure is 4

hours (bottom).

FIGURE 6 contains growth curves of recombinant adenoviruses expressing rabies glycoprotein in either 293 or 293LAP13 cell lines.

Replicate monolayer cultures containing approximately lxlO⁶ cells each (either 293 or 293 LAP 13 cells) were infected with the recombinant viruses at a moi of 1 pfu/cell. At the indicated times post infection duplicate cells and supernatants were harvested and assayed for pfu on 293LAP13 cells.

Titres are plotted on an exponential scale. Open symbols represent yields from 293 cells for AdMH5(I)E3Fx (D) and AdMH5(I)E3Fx(o) (D). Closed symbols represent yields from 293 LAP 13 cells for AdMH5(I)E3Fx (D) and

AdMH5(I)E3Fx(o) (D).

FIGURES 7A-C depict the sequence of plasmid pMPG2.

FIGURES 8A-D depict the sequence of pMPG3 type of plasmid.

FIGURES 9A-B depict the sequence of plasmid pDCSVFx.

DETAILED DESCRIPTION OF THE INVENTION

As will be described below, there are provided cells, including cell lines, for use as hosts for replicating recombinant expression vectors, such as viruses and plasmids, wherein the cells comprise a gene encoding a repressor protein capable of repressing expression of certain heterologous proteins of

the vector and which otherwise deleteriously impact replication thereof.

The term "repressor," particularly in the context of proteins, is

intended to refer to entities (e.g., proteins) having the capacity to inhibit,

interfere, retard and/or repress the production of heterologous protein

product of a recombinant expression vector. For example, by interfering

with a binding site at an appropriate location along the expression vector, such as in an expression cassette. One appropriate repressor for use according to the invention is the repressor that interacts with the lac operator

(which is a type of interaction partner for the repressor). See, e.g., Watson et ah, MOLECULAR BIOLOGY OF THE GENE (4^th ed. 1987) (Benjamin/Cummings Publishing Co.) Other appropriate repressors and interaction partners are available in the field. Thus, examples of repressors include the lac repressor, the tφ repressor, the gal repressor and the lambda

repressor. Other appropriate repressors can be employed as well.

The cell line can be derived from 293 cells and the polynucleotide inserted therein encodes a lac repressor derivative. According to one

embodiment, the gene includes a nuclear localization signal from a SV40

large T antigen, along with a transcription activation domain from heφes

simplex type 1 VP 16, as well as a portion of plasmid pHMCVLAP348,

which is described in U.S. Patent 5,674,730.

The vector can be an adenovirus, more preferably a defective adenovirus with a functionally disrupted El region and optionally the E3 region can be functionally disrupted as well. In the context of the present

invention, the term "heterologous" connotes a difference in origin, source, form, structure, activity or location between two or more entities. The

referents and effect of the term "heterologous" depend upon the context in which it is used. For example, in the context of recombinant viruses, a

heterologous protein typically is a protein encoded by a recombinant virus

wherein that protein does not naturally occur in a native or source virus, or the protein is changed in a manner that is distinct from the form which naturally or usually occurs in the native or source virus.

In other aspects, the invention provides a system for replicating a recombinant protein expression vector, comprising a cell, such as from a cell line, comprising a gene which encodes a repressor protein capable of repressing certain heterologous protein products of the vector, which vector-

encoded proteins otherwise inhibit production of the virus.

The vector can be an adenovirus, such as a defective adenovirus. Defective adenoviruses can have a functionally disrupted El region and

optionally the E3 region can be functionally disrupted as well. Functional disruptions can be undertaken by insertions and/or deletions in a given

region

A particular feature of the vector used in the present system is that it

contains a binding site, such as an operator sequence. For example, the vector contains a lac operator sequence which serves as a binding site for the repressor protein, preferably within the expression cassette of the vector.

The repressor protein can be the lac repressor, a derivative thereof, or other

repressors available in the art. In the case of defective adenovirus, the

binding site may be placed in the El region, the E3 region and/or another

region where the binding site can be operably linked.

In another aspects, the invention also provides a method of replicating a recombinant protein expression vector. Repressor proteins for use according to the invention can repress

production of the heterologous protein. For example, the vector has an expression cassette containing a gene (a type of polynucleotide) encoding the heterologous protein, the method further comprising the step of locating the binding site within the expression cassette.

In another of its aspects, the present invention provides cells,

including cell lines, that produce a repressor protein and a vector for

transforming that cell line, the vector comprising an expression cassette in which DNA encoding for a heterologous protein product is operably linked

for expression to a promoter sequence or the like that is disfunctional or impaired in the presence of the repressor protein. The phrase "operably

linked" in the context of the present invention refers to a first sequence(s)

being positioned sufficiently proximal to a second sequence(s) such that the first sequence(s) can exert influence and/or control over the second

sequence(s) or another sequence(s) under control of the second sequence(s).

Operably linked includes, but is not limited to, sequences that are

contiguous.

The vector can be an adenovirus, such as a defective adenovirus, and

the cell line complements the defect to allow the adenovirus to replicate.

In still another aspect of the present invention, the invention provides

methods of producing cells, such as cell lines, useful as a host for replicating expression vectors, comprising the step of introducing into the host a

polynucleotide sequence encoding a repressor protein capable of repressing a heterologous protein of the vector which otherwise inhibits replication of ft that vector. Preferably, the introduction comprises integration of the repressor encoding sequence into the genome of the host cell.

The expression vectors can include a promoter sequence and a polynucleotide sequence encoding the heterologous protein product, the binding site being located therebetween, which is one example of operably

linked. Alternatively, the expression cassette includes a promoter sequence

and a sequence encoding the heterologous protein product, the binding site

being located upstream of the promoter sequence, which is another example of being operably linked.

In still another embodiment, the method includes the step of providing a plurality of binding sites.

As will be described below, the present cells, in particular when used in conjunction with expression vectors such as adenovirus, are capable of

repressing the production of certain heterologous protein products from such vectors, and thereby minimize the interfering effects of the presence of

certain proteins on the further replication of the vector itself. This capability

is particularly advantageous in adenovirus-based recombinant vector systems

whose protein products, such as rabies glycoprotein, have been shown to interfere with further replication of the adenovirus vector itself.

The present invention also provides a combination of cells that

produce a repressor protein and a vector for transforming those cells, the vector comprising an expression cassette in which DNA (a type of polynucleotide) encoding for a heterologous protein is operably linked to a promoter sequence that is disfunctional or at least substantially impaired in the presence of the repressor protein. In this case, the cell line and the adenovirus can, if desired, be made available in a single package. The package also can include instructions for the user on how to use the combination, such as explaining how to infect and/or transfect the

adenovirus into the cell line under conditions suitable for transfection and

then to select for and then to culture under suitable conditions for adenovirus

replication. The instructions also may instruct the user how to rescue the adenovirus or to recover the protein of interest.

The invention can utilize a cell line which is a derivative of the human 293 cell line, commonly used as a host for the replication of

adenovirus-based expression vectors. Other appropriate cells useful

according to the invention are disclosed in Fallaux et ah, Hum. Gene Ther.

7: 215-22 (1996); Fallaux et ah, Hum. Gene Ther. 9: 1909-17 (1998). In the

context of cells, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For

example, the cell that is derived is based upon or obtained from a naturally occurring cell or other type of cell. Cells that are "derived" can be obtained

by screening cells for desired properties, conducting mutations on cells

and/or transforming cells with DNA to impart a desired trait or property on the recipient cell. Other approaches also are available. Two examples of cell lines according to the present inventions are described in more detail below and are 293 -based cell lines, designated

293LAP10 and 293LAP13, which contain and express a repressor protein in the form of a derivative of the lac repressor protein, viz: LAP348 (Labow et ah, 1990). In the context of polynucleotide sequences and regions, genes and plasmids, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For example, a DNA

sequence that is derived is based upon or obtained from a naturally occurring

DNA sequence or other type of source DNA sequence.

The lac operator sequence, to which the repressor protein binds, is incoφorated into a transcription unit, where it is operably linked, controlling rabies glycoprotein expression. In one case, the operator sequence is located

immediately downstream of the transcription start site.

Cell lines made according to the invention are provided. Cell line

293LAP 10 was deposited with the American Type culture Collection

pursuant to the Budapest Treaty and was assigned Accession No. CRL- 12586. The 293LAP13 cell line was deposited with the American Type

culture Collection pursuant to the Budapest Treaty and was assigned Accession No. CRL-12587. The invention is not limited to these cell lines, however. Following the teachings of this application, the skilled person will

be able to readily attain other cell lines in accordance with the present

invention. The operator-containing adenovirus of the present invention, can be ft grown to higher titres in 293LAP10 and 293LAP13 and has been shown to produce plaques more efficiently in 293LAP10 and 293LAP13 cells than in

293 cells not modified in accordance with the teachings of the invention.

In accordance with another embodiment, adenovirus expression vectors are provided with a promoter-intron expression cassette for

expressing rabies glycoprotein. This vector has been shown to express the

rabies glycoprotein with enhanced synthesis kinetics in non-complementing

human and canine cell lines compared to vectors lacking the intron.

Furthermore, it has been shown that the repressor protein produced by the 293 LAP 10 and 293LAP13 cell line is effective at repressing the expression of rabies glycoprotein by the operator-containing adenovirus vectors . Moreover, it has also been shown that the repressing effect of the

repressor protein is at least partly relieved by isopropylthio-β-galactoside

(IPTG).

Therefore, it is believed that cell lines according to the present invention, including, for example those based on the 293 cell line, still more particularly the 293LAP10 and 293LAP13 cell lines, are useful for the

rescue and propagation of other expression vectors in which expression of the desired protein prevents vector rescue in the host cell.

Although the cell lines disclosed herein are based on 293 cells, other

cell lines are contemplated which have utility as a host for adenovirus or other expression vectors capable of producing a heterologous protein

product.

Based on published observations showing that the presence of an

intron can significantly increase the expression of some gene sequences (Petit clerc et ah, J. Biotech. 40, 169-178 (1995); Yew et al, Gene Therapy

8: 575-584 (1997)) and observations that expression of a number of glycoprotein antigens in adenovirus vectors can be greatly amplified by the

presence of an intron upstream of the gene, attempts to produce defective adenovirus vectors were undertaken in which the expression of a rabies

glycoprotein gene was driven by the highly effective murine cytomegalovirus promoter (MCMV) (Dorsch-Hasler et al, Proc. Nat 'I Acad. Sci. USA 82: 8325-29 (1985); Addison et al, 1997) in combination with an intron sequence previously used in adenovirus vectors (Berkner & Shaφ,

1985). The construction detail for plasmid pMH5(I)Fx is shown in Fig. 1.

Numerous attempts, to rescue a defective adenovirus vector containing the

rabies glycoprotein gene under the control of this promoter construction

were unsuccessful following standard co-transfection protocols in 293 cells.

These unsuccessful attempts amounted to over a dozen independent experiments including some with slightly modified constructs and

representing over 300 transfected plates of 293 cells in total (data not

shown). The only successful rescue of vectors of this type resulted from a

plasmid which had a fortuitous deletion of 59 nucleotides from the start of the rabies glycoprotein open reading frame as a result of EcoRl STAR endonuclease activity (data not shown). Since these rescued vectors were unable to express the rabies glycoprotein, this suggested that the failure to rescue functional vectors may be due to the inactivation potential of the overexpressed rabies glycoprotein. To overcome this problem, a 293 -based

cell line was constructed which expressed a repressor protein and could therefore be used to reduce glycoprotein expression, and its attendant interfering capabilities, in transfected, infected and/or transformed cells.

These and other aspects of the invention will become apparent to the

skilled person in view of the disclosure contained herein. Modifications

may be made to the various teachings contained herein without departing

from the scope and spirit of the invention.

EXAMPLE I: Cells. Viruses and Plasmids.

The 293 cells (Graham et al, 1997) and 293 cell derivatives, were

maintained as previously described by Graham and Prevec. Isolated

colonies of cells transformed to G418 resistance (described below) were

maintained in a-MEM supplemented with Fetal Bovine Serum (10% v/v; a

supplier), Penicillin (100 U/ml), Streptomycin (100 μg/ml) and G418 (400

ug/ml, Gibco BRL). Control adenovirus Ad dl70-3 is derived from Ad5 but

with the El region deleted and a deletion and/or substitution in the E3 region (Bett et al. Proc. Nat 7 Acad. Sci. USA 9X : 8802-06 (1994)). In the context

of viruses, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For example, the virus

that is derived is based upon or obtained from a naturally occurring virus or other type of virus. Viruses that are "derived" can be obtained by screening virally-infected cells for desired properties, conducting mutations on virally- infected cells and/or genetic manipulation of viral genomes with polynucleotides to impart a desired trait or property on the recipient virus. Other approaches also are available, including in vivo homologous

recombination and the the direct in vitro insertion of polynucleotide sequences. The term polynucleotide can encompass DNA, RNA and

synthetic entities, such as peptide nucleic acids. In the context of the vectors and eukaryotic cells according to the invention, the term polynucleotide can

be considered synonymous with DNA.

The rescue, isolation, propagation, gradient purification and titration

of recombinant viruses described herein can be done according to known techniques. See Hitt et ah, Meth. Molec. Genet. 7, 13-30 (1995). The virus

particle number in gradient purified stocks, was determined from the OD₂₆₀

of an aliquot in buffer containing 0.1 % SDS using the relationship OD_{2 0} =

1.1 x 10 ⁿ pfu/ml (Mittereder et ah, J. Virol. 70, 7498-7509. (1996)).

Turning to plasmids, the molecular cloning techniques described

herein below are described by Sambrook et ah, Molecular Cloning: A

Laboratory Manual, 2^nd ed.. Cold Spring Harbor , NY: Cold Spring Harbor

Laboratory (1989). All DNA fragments were separated from contaminants by agarose gel electrophoresis and eluted from the agarose using GeneClean

(Bio 101 Inc.). Plasmid pMPG2 (Figure 2E) contains a neomycin resistance

gene under the control of an HCMV promoter all flanked by a Bam HI site and a Bgl II site as shown in Fig 2 A. The sequence of plasmid pMPG2 is depicted in FIGURE 7. Plasmid pHCMVLAP348 (Labow et ah, Molec. Cell. Biol. 10: 3343-3356 (1990) (NRRL.B- 18664)) comprises a modified lac repressor gene containing a nuclear localization signal from the SV40 large T antigen and the transcription activation domain from heφes simplex

type 1 VP16 (LAP348). This plasmid was cut with Hind III and the 2.5 kbp fragment containing the HCMV promoter and the LAP348 gene was ligated in a series of steps with other plasmids to produce plasmid pMPG3 (figure 2F). Plasmid pMPG3 contains the HCMV promoter, the gene for protein

LAP348, an SV40 derived polyA addition sequence and a copy of the

Adenovirus inverted terminal repeats (known as "ITRs"), representing the

sequences from nt37,628 to ntl95 from plasmid pFG140 (Graham, EMBO J. 3: 2917-2922 (1984)). This entire insert is flanked on one side by a unique Bam HI site and on the other side a unique Bgl II site as shown in Fig 2B. The sequence of a pMPG3 type of plasmid is depicted in Figure 8.

The gene encoding a rabies glycoprotein, cloned from a red fox

isolate (Nadin-Davis et ah, Gen. Virol. 74: 829-837 (1993)) was modified by

removing the ATG sequence immediately preceding the probable protein initiating ATG and cloned into plasmid pDCSVFx. The sequence of

plasmid pDCSVFx is depicted in Figure 9. Plasmid pMH5(I) was derived

from pMH5 (Addison et ah, J. Gen. Virol. 78: 1653-1661 (1997)) by insertion into the EcoRl site of an intron sequence obtained by PCR

replication of the adenovirus-immunoglobulin hybrid intron present in

plasmid pMLPspla (Kaufman & Shaφ, Mol Cell. Biol. 11, 1304-1319 (1982); Berkner & Shaφ, Nucl. Acids Res. 13: 841-857 (1985)). As shown ft in Fig. 1, the rabies glycoprotein gene was cloned into pMH5(I) downstream of the MCMV promoter and intron to produce plasmid pMH5(I)Fx. A derivative of pMH5(I)Fx, namely pMH5(I)Fx(o) contains one copy of the Lac operator inserted at the unique Kpnl site located just downstream of the transcription start site (Fig 1). Synthetic primers C :5' GCGGTACCGTCGGAATTGTGAGCGGA- TAACAATTGGTACCCG 3' (AB9483) and

D: 5' CGGGTACCAATTGTTATCCGCTCACAATTCCGACGGTACCGC 3' (AB9484) were synthesized and annealed together to achieve the desired construction. The annealed primers were then restricted with Kpn I and

ligated to similarly restricted pMH5(I)Fx plasmid. Recombinants containing

one (pMH5(I)Fx(o)) copy of the repressor binding sequence were identified

by restriction enzyme digestion and fragment analysis on agarose gels. The orientation of the near palindromic operator sequence in pMH5(I)Fx(o) was verified by sequencing.

EXAMPLE 2: Transient transfection assays.

Plasmids pMH5(I)Fx, pMH5(I)Fx(o), and pMPG3 were assayed for

expression of the appropriate proteins by transient transfection in various cells lines followed by Western blotting analysis of total cell lysates. Briefly,

1 μg of purified plasmid DNA was transfected into approximately lxl 0⁶

cells using the calcium phosphate technique (Graham and Van der Eb,

Virology 52, 456-467 (1973)). Two days post transfection, the total cell monolayer was harvested, and the expression of the relevant protein assayed by Western blotting, as discussed herein below. A sample of cells similarly

transfected with pElspla (Bett et al, 1994) was used as a control.

EXAMPLE 3: Generation of cell lines expressing the LAP348

protein.

Plasmids pMPG2 (6 μg) and pMPG3 (60 μg) pMPG3 were cut with

restriction enzymes Bam HI and Bgl II and the appropriate fragments were isolated. The pMPG3 fragment was then ligated on its own for 30 minutes in

a volume of 20 μl at 16°C. The mixture was then restricted again with Bam

HI and Bgl II for 60 minutes at 37 C before heat inactivating the mixture at

65°C for 15 minutes. This cycle was repeated once more before adding the

pMPG2 fragment and ligating overnight at 16°C. Samples were examined by agarose gel electrophoresis and the remaining mixture was transfected

into 60mm diameter dish of confluent 293 cells by the calcium phosphate method (Graham and Van der Eb, 1973). After 24 hours, the cells were divided amongst 10 similar 60mm diameter dishes and the media supplemented with G418 at a concentration of 400 ug/ml. After 2 weeks of

selection, colonies of G418 resistant cells were evident and 12 were isolated and expanded. The procedure was repeated a second time (i.e., fresh DNA was prepared, examined and transfected) and a further 15 colonies were isolated. No more than two colonies from an individual dish thus reducing

the possibility that identical clones would be isolated.

EXAMPLE 4: Antibodies, Polyacrylamide gel electrophoresis

(PAGE) and Western blotting.

All Western blot analysis and PAGE was performed as previously described (Matthews and Russell, J. Gen. Virol. 75: 3365-3374 (1994)).

Rabbit anti-Lac repressor serum was purchased from Stratagene and used

according to supplier's protocols. Bound primary antibody was detected

using a secondary anti-rabbit serum linked to Horse Raddish Peroxidase

(HRP) and chemiluminescent detection was performed using ECL

(Amersham) according to the manufacturer's instructions.

EXAMPLE 5: DNA preparation and Southern Blotting

Approximately 5xl0⁷ cells were harvested and treated with SDS

(0.5% w/v) and Pronase (0.5 Dg/ml) at 37°C overnight in a final volume of

10 ml. The lysed cells were then extracted twice with buffered phenol and

once with chloroform before precipitating the DNA with lithium chloride

and ethanol. The precipitated DNA was washed twice with 70% ethanol, air dried and resuspended in 0.5 ml O.lxSSC. The resuspension of the DNA was facilitated by placing on an end-over-end roller for 20 hours at 4°C. The ft DNA was quantified by spectroscopy and 10 Dg samples digested with

appropriate restriction enzymes before agarose electrophoresis on 0.8% (w/v) agarose gels. The agarose gels were prepared for DNA transfer as described by Sambrook et al. (1989) then transferred to positive charge nylon membranes (Boerhinger Mannheim) using a pressure blotter

(Stratagene) over two hours. The nylon membranes were then UV cross-

linked using a Stratalinker (Stratagene) and used immediately or stored at -

20°C for up to 5 days. DNA fragments were derived from plasmids pSV2neo

(Smal to Bgl II fragment containing the neomycin gene open reading frame) and pHCMVLAP348 (Sac I to Pvu II fragment containing the LAP348 open reading frame) and used to generate 'DIG' labelled probes using the 'DIG

HighPrime' system (Boerhinger Mannheim) according to the manufacturer's

protocols. Detection of DNA bound to the membranes was performed using

"High SDS buffer" and the 'DIG detection kit' (Boerhinger Mannheim)

according to the manufacturer's protocols except that the high temperature stringency wash time was reduced from 2 15 minutes to 2 x 10 minutes.

EXAMPLE 6: Isolation and screening of cells

The approach was to produce a 293 -based cell line which expressed a

lac repressor derived protein (LAP348) for use, in one instance, in

conjunction both with vector precursors which contained the lac operator or

other operators or DNA sequences, to which the repressor binds, within the promoter-transcription region so as to inhibit synthesis of the rabies glycoprotein in this cell line. Low passage (pass 29) 293 cells were transfected with Bam HI - Bgl II fragments from pMPG2 and pMPG3 and resistant clones were selected in the presence of G418. After 3 weeks of selection, 28 resistant colonies were isolated and expanded. All 28 cell lines were assayed for expression of the LAP348 protein by Western blotting and two were identified as suitable for further investigation.

EXAMPLE 7: Characterization of LAP cell lines by Southern

blotting Because the 293 LAP cells had been transfected with a ligation mixture containing Bglll-BamHI fragments from pMPG2 and

pMPG3 it was of some interest to determine the structure of the integrated sequences in these lines. DNA was extracted from 293 cells and 293LAP10

and 293 LAP 13 and analyzed by Southern blot hybridization using as probes

the Bam HI - Bgl II fragment of pMPG2 (probe A) and the Nde I - Hind III

fragment of pMPG3 (probe B) (Fig. 2A). The pattern of fragments detected

in both 293LAP10 and 293LAP13 cells corresponded to that predicted by the non-homologous integration of a DNA segment with the structure

indicated in Fig 2D. Both probes detected an Xbal fragment of about 8.6 kb in 293 LAP 10 cells and one of about 7.4 kb in 293LAP13 cells. Since Xbal

does not cut within either the pMPG2 or pMPG3 derived fragments these

bands suggest a single insertion at distinct sites within the two cell lines. As shown in Fig 2B, probe A primarily detects different fragments in the

Hindlll digestion products of 293LAP13 and 293LAP10 cells. These are believed to be the fragments resulting from Hindlll cleavage at the site depicted at ntl592 in Fig 2D and a Hindlll site, unique to each cell line, in

DNA sequences leftward of the insertion site. The fragments at about 2.3 kb

in lanes 1 and 2 of Fig. 2B are believed to represent the 2333 kb Hindlll fragment (from 1592 to 3925 in Fig 2D) which is detected by the HCMV sequences present in probe A. These Hindlll fragments are more strongly detected by probe B (Fig. 2C) as expected. As predicted by the structure

indicated in D, probes A and B hybridized to a Pstl fragment of

approximately 2.7 kb generated by cleavage at 634 bp and 3401 bp in Fig.

2D as well as Pstl fragments unique to each cell line due to cleavage at 634 bp and at sites in cell DNA sequences leftward of the insertion site. Probe B consistently detected DNA fragments of 10 kb or larger but these fragments

were also detected in 293 DNA.

Both LAP cell lines therefore appeared to contain a single copy of the

LAP348 expression cassette (from pMPG3) linked to a single copy of the neomycin resistance gene expression cassette (from pMPG2) as

schematically depicted in Fig 2D. This combined cassette is integrated into distinct sites within the 293LAP10 and the 293LAP13 cell lines. The 293LAP13 cell line was chosen for most of the subsequent studies.

EXAMPLE 8: LAP348 protein expression increases after infection of

293LAP cells by adenovirus. Both 293 and 293LAP13 cell lines were infected with Ad dl70-3 and samples of infected cells were harvested at various times post infection. Levels of LAP348 protein expression were assayed by Western blotting and compared to protein levels present in uninfected cells. Figure 3 shows that at

24 hours post infection there is significantly more protein LAP348 present than in the uninfected samples. The levels of LAP348 remain high for 3 days

post infection. Furthermore, levels of an unknown cellular protein which cross-reacts with the antiserum have dramatically declined as would be expected for a cellular protein with a relatively short half life since

adenovirus would shut off mRNA transport.

EXAMPLE 9: Rescue of recombinant viruses in 293LAP 13 cell

line.

Co-transfections of plasmids pMH5(I)Fx or pMH5(I)Fx(o) with either plasmids pBHGlO or pBHGE3 into both 293 and 293LAP13 cell lines

were performed to determine if recombinant adenoviruses could be

generated containing the expression cassette in the El region, along with

either a deleted (pBHGl 0) or wild type (pBHGE3) E3 region (Bett et ah,

1994). Table 1 presents the results of one experiment in which the relative efficiency of rescue of recombinant vectors was compared in 293 and 293LAP13 cells employing different plasmid combinations and using

standard protocols as outlined in Methods. After 12 days the number of

plaques on each dish were recorded. As can be seen from the table,

recombinant virus constructed from pMH5(I)Fx(o) in combination with

either pBHGlO or pBHGE3 could be efficiently rescued in 293 LAP 13 cells

whereas they could not be rescued in 293 cells. When the operator sequence was absent from the construct, rescue of virus was very inefficient as evidenced by only one AdMH5(I)E3Fx rescue in combination with pBHGE3

in 293LAP13 cells. These results agree with earlier, failed, attempts to rescue the pMH5(I)Fx construct in 293 cells in combination with either

pBHGlO or pBHGE3 as mentioned above. Table 1 presents the results of transfections in 293LAP13 cells alone which again demonstrate the higher efficiency of rescue, in this cell line, of vectors containing an operator

sequence compared to that lacking the operator.

In the studies detailed in Table 1, the relative efficiency of rescue of

adenovirus recombinants expressing rabies glycoprotein on 293LAP13 cells.

Monolayer cultures of 293LAP13 cells were cotransfected with plasmid pBHGE3 and one of pMH5(I)Fx, or pMH5(I)Fx(o) at the total DNA concentrations shown. The control plasmid pFG140 was also included. The

total number of plaques observed after 12 days was counted and is presented

in column 2 along with the number of dishes represented. The average

number of plaques per dish is presented in column 3. Some representative plaques were picked and the virus in these plaques was screened by restriction enzyme analysis to confirm the expected virus DNA structure as

shown in column 4. Table 1 : The relative efficiency of rescue of adenovirus recombinants with and without the operator sequence and expressing rabies glycoprotein on

293LAP13 cells.

The fact that vectors lacking the operator sequence could be rescued

in the 293LAP13 cell line was in contrast to an inability to do so in 293

cells. In addition to the recombinant plasmids, 293LAP13 cells also were tested for their ability to generate plaques from the infectious plasmid pFG140 which does not require a recombination event to generate El deleted adenovirus (Graham, 1984). As shown in Table 2, both 293 and 293LAP13 cell lines are equally capable of generating plaques from this

plasmid.

The studies detailed in Table 2 concern the relative efficiency of

rescue in 293 and 293LAP13 cells of recombinant adenoviruses expressing

rabies glycoprotein. Plasmids pMH5(I)Fx or pMH5(I)Fx(o) were

contransfected onto monolayers of 293 or 293LAP13 cells along with either

plasmid pBHGlO or pBHGE3 as described by Bett et ah, 1994. All plasmid

DNA was used at 5 μg per dish. As a control, cells also were transfected

with the infectious plasmid pFG140 but in this case only one μg of DNA

was used. The number of plaques observed after 12 days was counted and

the total number observed as well as (the number of dishes per experiment)

are presented in the table.

Table 2: Relative efficiency of rescue in 293 and 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein.

a: all plasmid DNA at 5 μg/dish except pFG140 which is at 1 μg/dish

EXAMPLE 10: Rabies glycoprotein expression in 293 and 293LAP13 cell lines To determine the kinetics of synthesis of rabies glycoprotein by the

vectors isolated as described above, 293LAP13 cells or 293 cells, infected at

2 pfu/ml, based on titrations in 293LAP13 cells, with AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) or with the control 'intron-less' virus

Ad5BHGE3MH5Fx, were labelled with ³⁵S methionine at 8 to 10 or at 17 to 19 hours post infection. The infected culture was harvested at the end of the

labelling period and the expressed rabies glycoprotein was

immunoprecipitated and analyzed by SDS-PAGE, and the resultant

autoradiograms presented in Figure 4A. To conduct the study, approximately lxlO⁶ cells were infected with the indicated recombinant adenovirus (or PBS as a control) and at the indicated time post infection the media was supplemented with ³⁵S labeled methionine. After two hours further incubation the cells were harvested and the radiolabeled rabies glycoprotein immunoprecipitated as previously

described (Graham and Prevec). When required, isopropylthio-β-

galactoside (IPTG), purchased from Gibco BRL, was used at final

concentration of 10 mM in medium and was added to cells 24 hours prior to

infection. The anti-rabies glycoprotein mouse monoclonal antibody (Mab)

used was kindly provided by Dr Alex Wandeler, Canadian Food Inspection

Agency, Napean, Ontario. Other such antibodies are readily attained by the person having skill in the art. The immune precipitated proteins were separated by SDS-PAGE, the gel dried and exposed for various time to

Kodak XAR5 X-ray film.

AdMH5(I)E3Fx and AdMH5(I)E3Fx(o) show comparable amounts of radiolabelled rabies glycoprotein in 293 cells at either 8-10 hours or 17-19

hours post infection. However, in 293LAP13 cells the expression of the

rabies glycoprotein by AdMH5(I)E3Fx(o) is markedly reduced compared to

AdMH5(I)E3Fx at 8-10 hours. Moreover, pre-treatment of the 293LAP13 cells with IPTG relieves this block on expression of rabies glycoprotein by

AdMH5(I)E3Fx(o) (Fig. 4B). This is consistent with the results of the transient transfection experiments, described above, using the plasmids from

which the recombinant adenoviruses were created. It is possible that the two, self-annealing palindromic operator sequences in the transcript mRNA ft encoding the rabies glycoprotein in this construct inhibits normal processing and translation. The other observation apparent from these results is that the presence of the intron sequence in AdMH5(I)E3Fx and AdMH5(I)E3Fx(o) allows increased rabies glycoprotein expression over that produced by the comparable but intron-less vector, Ad5BHGE3MH5Fx. Because the

293LAP13-derived titre was used as a standard in this experiment, as will be

seen below, the particle number of AdMH5(I)E3Fx is about six-fold higher

than that of the other viruses in this experiment, and direct quantitative

comparisons for this virus cannot be made. Nevertheless, comparisons between Ad5BHGE3MH5Fx and AdMH5(I)E3Fx(o), where the particle

numbers are not significantly different, show that this conclusion is valid.

EXAMPLE 11 : Rabies glycoprotein expression in non-complementing cell lines To determine if the presence of the intron increased protein

expression in non-complementing cell lines as well, purified virions were

used to infect human (MRC-5) and canine (MDCK) cells which cannot

complement the adenovirus El deletion defect present in the recombinant

viruses under study. Levels of expression achieved by viruses without (Ad5BHGE3MH5Fx) were compared to those with (AdMH5(I)E3Fx and

AdMH5(I)E3Fx(o)) an intron between the transcription start site and the start codon for the glycoprotein. The cells were infected at an m.o.i. of 20

pfu (based on titre in LAP 13 cells) and 8 hours later pulsed for 2 hours with

³³S. As shown in Fig. 5, a comparison of rabies protein expression kinetics after infection with approximately equal numbers of virus particles of Ad5BHGE3MH5Fx or AdMH5(I)E3Fx(o), proves that the presence of the intron greatly increases the amount of rabies glycoprotein synthesized. While the level of rabies glycoprotein produced by the operator containing virus, AdMH5(I)E3Fx(o), appears to be less than that of AdMH5(I)E3Fx, a direct comparison is not possible since there are some six times as many

particles of the latter virus per infected cell. Nevertheless, it is clear that

expression of rabies glycoprotein can be achieved in non-complementing

cells, both human and canine, by the recombinant adenoviruses containing

the intron sequence.

EXAMPLE 12: Comparative plaguing efficiency on 293 cells and

293LAP 13 cells

It is believed that high level expression of the rabies glycoprotein

results in inhibition of virus replication and hence prevented efficient rescue

of vectors. To confirm whether this effect manifests during plaque

formation, the relative plaquing efficiency of the recombinant viruses was

measured on both 293 cells and 293LAP13 cells. Table 3 shows the results

of titrations on 293 and 293LAP13 cells of CsCl gradient banded viruses AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) and a control vector lacking the intron sequence, Ad5BHGE3MH5Fx. The particle to pfu ratios of the control vector and of the vector containing two Lac operons were essentially

identical on both 293 and 293LAP13 cells. Interestingly, as predicted, both

of the high level glycoprotein expressors, AdMH5(I)E3Fx and AdMH5(I)E3Fx(o), are an order of magnitude less efficient in inducing plaques on 293 cells, as measured by the inverse of particle to pfu ratio, than

is the control virus. More importantly, the AdMH5(I)E3Fx(o) vector, which contains the operator sequence, is as efficient on 293LAP13 cells as is the control virus. Thus decreasing the level of glycoprotein expression by this vector, through binding of the repressor present in 293LAP13 cells, results in a plaquing efficiency for this vector equal to that of control virus. Thus,

these results support a correlation between the level of glycoprotein

expression and the level of inactivation potential exhibited by the adenovirus

vectors. The vector lacking the operator sequence also had an increased plaquing efficiency on 293 LAP 13 cells of approximately three-fold compared to the result on 293 cells. This suggests that the small reduction in

rabies glycoprotein synthesis in the 293LAP13 cells compared to 293 cells,

as observed in Fig. 4, may be sufficient to allow adenovirus replication to

escape some of the inactivation potential associated with rabies glycoprotein

overexpression. Also consistent with this explanation is the finding (Table

3) that the vector containing the operator sequence was almost threefold

more efficient than the vector lacking this sequence when both are plaqued

on 293 cells. The presence of the nucleotides comprising the operator sequence near the transcription start site may reduce the level of expression of rabies glycoprotein from the former vector and thus allow more adenovirus synthesis. The studies detailed in Table 3 concern the relative plaque forming titre and particle to pfu ratios on 293 or 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein. The following recombinant adenoviruses: Ad5BHGE3MH5Fx, which lacks intron or operator sequences but is otherwise identical to the other vectors, AdMH5(I)E3Fx, which has the intron but no operator sequences, AdMH5(I)E3Fx(o), were grown in large scale cultures in 293LAP13 cells (except for

Ad5BHGE3MH5Fx, which was grown in 293 cells) and were purified on

CsCl density gradients. An estimate of the virus particle number in the

purified stock was obtained by OD _o0 as described in the text. The virus was titrated in duplicate by standard plaque assay on monolayers of 293 or 293LAP13 cells and the plaques counted after 12 days. The particle to pfu ratio of each recombinant vector was determined for 293 cells and

293LAP13 cells from this data and the ratio of the relative titre on

293LAP 13 to that on 293 cells is presented in the last column.

Table 3: The relative plaque forming titres and particle to pfu ratios on 293 or 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein.

EXAMPLE 13: Growth curves on 293LAP13 cells and 293 cells

In view of the effect on transfection and on plaque formation, studies

were made to determine whether the growth of these recombinant vectors

was substantially different in 293 or 293LAP13 cells. Figure 6 shows one

step growth curves for the two viruses AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) grown on 293 and 293LAP13 cells with all virus yields assayed on

293LAP13 cells. As expected. AdMH5(I)E3Fx and AdMH5(I)E3Fx(o), that produce the highest levels of glycoprotein, also produced the lowest titres on

293 cells by 48 hours, a time at which cytopathic effect is essentially complete in the infected cell monolayer. On 293LAP13 cells the

AdMH5(I)E3Fx(o) vector attains a final yield some 20-fold higher than that obtained in 293 cells. The virus lacking the operator sequence,

AdMH5(I)E3Fx, also showed a ten fold greater virus yield on 293LAP13 cells compared to the parental 293 cell line. Assuming a comparable particle to pfu ratio as determined for gradient purified viruses, the amount of AdMH5(I)E3Fx virus and AdMH5(I)E3Fx(o) virus synthesized in

293LAP13 cells is approximately the same. It is believed that the enhanced

growth on 293LAP13 cells of viruses expressing excess rabies glycoprotein

whether the virus does or does not carry the lac operator sequence is due to

the relative reduction of rabies glycoprotein expression in the LAP348

expressing cell line.

Inhibition might be most pronounced during transfection with plasmids, permitting the generation of virus in co-transfected 293LAP13

cells and might be sufficiently strong early in virus replication to account for

the enhanced replication evident in Figure 6. As a consequence the 293LAP13 cell line may be preferred over 293 cells for rescue of transgenes

even without incoφoration of the operator, though presence of the latter in

the expression cassette clearly results in the highest efficiency of virus

rescue and growth.

It is to be understood that the description, specific examples, data, tables and figures, while indicating exemplary embodiments, are given by

way of illustration and are not intended to limit the invention in any manner. Various changes and modifications within the present invention *

will become apparent to the skilled person from the disclosure contained

herein, and thus are considered part of the invention.

Claims

WHAT IS CLAIMED IS:

1. A eukaryotic cell capable of replicating a recombinant

expression vector that produces a heterologous protein, wherein the cell

comprises a polynucleotide encoding a repressor protein that is capable of

repressing production of the heterologous protein.

2. The cell according to claim 1, wherein the cell is a mammalian cell.

3. The cell according to claim 1, wherein the vector is an adenovirus.

4. The cell according to claim 1 , wherein the cell produces the protein

encoded by an El region.

5. The cell according to claim 4, wherein the vector is a defective

adenovirus.

6. The cell according to claim 5, wherein the adenovirus has a

functionally disrupted El region.

7. The cell according to claim 5, wherein the cell is derived from 293

cells.

8. The cell according to claim 7, wherein the polynucleotide encodes a *

lac repressor.

9. The cell according to claim 7, wherein the polynucleotide encodes a

lac repressor derivative.

10. The cell according to claim 9, wherein the polynucleotide includes a

portion of plasmid pHMCVLAP348.

11. Cell line 293Lapl0 (ATCC Accession No. CRL- 12586).

12. Cell line 293Lapl3 (ATCC Accession No. CRL- 12587).

13. A recombinant adenovirus comprising (i) a first polynucleotide

sequence encoding a heterologous protein and (ii) a second polynucleotide

sequence operably linked to the first polynucleotide in order to permit

repression of the expression of the first polynucleotide.

14. The recombinant adenovirus of claim 13, wherein the second

polynucleotide sequence is an operator that can be bound by a repressor.

15. The recombinant adenovirus of claim 13, wherein the adenovirus has

a functionally disrupted El region.

16. The recombinant adenovirus of claim 14, wherein the second * polynucleotide sequence is a lac operator sequence.

17. The recombinant adenovirus of claim 13, wherein the heterologous

protein product is rabies glycoprotein G.

18. The recombinant adenovirus of claim 13, wherein the adenovirus

comprises an intron sequence.

19. A eukaryotic cell capable of replicating a recombinant expression

vector that produces a heterologous protein, wherein the cell comprises a

polynucleotide encoding a repressor protein that is capable of repressing

production of the heterologous protein, and wherein the cell is transfected

with or infected by a recombinant adenovirus comprising (i) a first

polynucleotide sequence encoding a heterologous protein product and (ii) a

second polynucleotide sequence operably linked to the first polynucleotide

in order to permit repression of the expression of the first polynucleotide.

20. The cell of claim 19, wherein the second polynucleotide sequence is

an operator that can be bound by a repressor.

21. The cell of claim 19, wherein the adenovirus has a functionally

disrupted El region.

22. The cell of claim 19, wherein the second polynucleotide sequence is ΓÇ₧

a lac operator sequence.

23. The cell of claim 19, wherein the heterologous protein product is

rabies glycoprotein G.

24. A method of propagating an adenovirus vector encoding a

heterologous protein, comprising

transfecting or infecting eukaryotic cell with a recombinant

adenovirus comprising (i) a first polynucleotide sequence encoding a

heterologous protein and (ii) a second polynucleotide sequence operably

linked to the first polynucleotide in order to permit repression of the

expression of the first polynucleotide, wherein the eukaryotic cell comprises

a polynucleotide encoding a repressor protein that is capable of repressing

production of the heterologous protein.

harvesting recombinant adenovirus propagated in the eukaryotic

cells

25. The method of claim 24, wherein the adenovirus has a functionally

disrupted El region.

26. The method of claim 24, wherein the second polynucleotide

sequence is a lac operator sequence.

27. The method of claim 24, wherein the heterologous protein product is *

rabies glycoprotein G.