WO2000006751A2 - Repressor proteins producing cell lines for the propagation of vectors - Google Patents

Repressor proteins producing cell lines for the propagation of vectors Download PDF

Info

Publication number
WO2000006751A2
WO2000006751A2 PCT/IB1999/001349 IB9901349W WO0006751A2 WO 2000006751 A2 WO2000006751 A2 WO 2000006751A2 IB 9901349 W IB9901349 W IB 9901349W WO 0006751 A2 WO0006751 A2 WO 0006751A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
polynucleotide
adenovirus
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB1999/001349
Other languages
French (fr)
Other versions
WO2000006751A3 (en
Inventor
Frank L. Graham
Ludvik Prevec
David Alan Matthews
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Advec Inc
Original Assignee
Advec Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Advec Inc filed Critical Advec Inc
Priority to AU49241/99A priority Critical patent/AU4924199A/en
Publication of WO2000006751A2 publication Critical patent/WO2000006751A2/en
Publication of WO2000006751A3 publication Critical patent/WO2000006751A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10344—Chimeric viral vector comprising heterologous viral elements for production of another viral vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • Human adenoviruses have become one of the vectors of choice for
  • a repressor protein that is capable of repressing production of the
  • the vector can be a defective virus.
  • the virus can have a functionally disrupted El and optionally the
  • repressor-encoding polynucleotide is plasmid pHMCVLAP348.
  • 293LAP13 cells (lane 1) or at 24 hours (lane 2), 48 hours (lane 3) and 72 hours (lane 4) following infection with Ad dl70-3 at an m.o.i. of 5 pfu/cell.
  • FIGURE 4A depicts expression of rabies glycoprotein by different
  • Ad5BHGE3MH5Fx which lacks intron or operator sequences but is otherwise identical to the other vectors (lanes 1,4,7 and 10);
  • FIGURE 4B depicts operator-dependent inhibition of rabies glycoprotein expression in 293LAP13 cells and reversal by IPTG.
  • MRC5 non-complementing human
  • MDCK canine
  • FIGURES 7A-C depict the sequence of plasmid pMPG2.
  • cells including cell lines, for use as hosts for replicating recombinant expression vectors, such as viruses and plasmids, wherein the cells comprise a gene encoding a repressor protein capable of repressing expression of certain heterologous proteins of
  • repressors include the lac repressor, the t ⁇ repressor, the gal repressor and the lambda
  • the present invention also provides a combination of cells that
  • derived in its various grammatical forms connotes a degree of similarity that is indicative of an archetype.
  • Cell lines made according to the invention are provided.
  • the operator-containing adenovirus of the present invention can be ft grown to higher titres in 293LAP10 and 293LAP13 and has been shown to produce plaques more efficiently in 293LAP10 and 293LAP13 cells than in
  • adenovirus expression vectors are provided with a promoter-intron expression cassette for
  • cell lines according to the present invention including, for example those based on the 293 cell line, still more particularly the 293LAP10 and 293LAP13 cell lines, are useful for the
  • glycoprotein gene was driven by the highly effective murine cytomegalovirus promoter (MCMV) (Dorsch-Hasler et al, Proc. Nat 'I Acad. Sci. USA 82: 8325-29 (1985); Addison et al, 1997) in combination with an intron sequence previously used in adenovirus vectors (Berkner & Sha ⁇ ,
  • cell line was constructed which expressed a repressor protein and could therefore be used to reduce glycoprotein expression, and its attendant interfering capabilities, in transfected, infected and/or transformed cells.
  • Viruses that are "derived” can be obtained by screening virally-infected cells for desired properties, conducting mutations on virally- infected cells and/or genetic manipulation of viral genomes with polynucleotides to impart a desired trait or property on the recipient virus. Other approaches also are available, including in vivo homologous
  • polynucleotide can encompass DNA, RNA and
  • EXAMPLE 2 Transient transfection assays.
  • EXAMPLE 3 Generation of cell lines expressing the LAP348
  • Rabbit anti-Lac repressor serum was purchased from Stratagene and used
  • DNA fragments were derived from plasmids pSV2neo
  • IPTG galactoside
  • purified stock was obtained by OD o0 as described in the text.
  • the virus was titrated in duplicate by standard plaque assay on monolayers of 293 or 293LAP13 cells and the plaques counted after 12 days.
  • the particle to pfu ratio of each recombinant vector was determined for 293 cells and
  • AdMH5(I)E3Fx and AdMH5(I)E3Fx(o) that produce the highest levels of glycoprotein, also produced the lowest titres on

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides eukaryotic cells capable of replicating recombinant expression vectors that produce heterologous proteins, wherein the cell comprises a polynucleotide encoding a repressor protein that is capable of repressing production of the heterologous protein. The invention also provides recombinant vectors, such as viruses (for example, adenoviruses) comprising (i) a first polynucleotide sequence encoding a heterologous protein and (ii) a second polynucleotide sequence operably linked to the first polynucleotide in order to permit repression of the expression of the first polynucleotide gene.

Description

REPRESSOR PROTEINS PRODUCING CELL LINES FOR THE PROPAGAΗON OF VECTORS
»
REFERENCE TO RELATED APPLICATION
The subject matter of U.S. provisional patent application serial number
60/094,681 filed July 30, 1998 is incorporated herein by reference. The present application claims priority to provisional patent application serial number 60/094,681.
The present invention relates to various cell lines, including
derivatives of the 293 cell line. The present invention also relates to
recombinant viruses, such as recombinant adenoviruses.
BACKGROUND OF THE INVENTION
Human adenoviruses have become one of the vectors of choice for
the delivery and expression of foreign or exogenous proteins for gene
therapy, immunotherapy and vaccination. For a recent review, see Hitt et
ah. Adv. Pharmacol. 40: 137-206 (1997). Human adenoviruses have been shown to be effective vaccines, for example, for the delivery of rabies
glycoprotein antigens to non-human hosts. Protective immune responses have been induced in animals immunized with either infectious or defective vectors of this type delivered either by parenteral or oral routes. Prevec et
ah, J. Infect. Dis. 161, 27-30 (1990); Charlton et ah, Arch. Virol. 123: 169- 179 (1992); Yarosh et ah, Vaccine 14, 1257-1264 (1996); Xiang et ah,
Virology 219, 220-227 (1996). Replication-defective vectors generally have disruptions/deletions of the early transcription El region and optionally the E3 region and inserts of cassettes containing an appropriate exogenous promoter and the gene(s) to
be expressed. Vectors of this type are produced and grown on El complementing cell lines such as the human 293 cell line, which is a human embryonic cell line. Graham et ah, J. Gen. Virol. 36: 59-72 (1977). Through established procedures employing plasmid shuttle vectors (Graham & Prevec, Molec. Biotech. 3: 207-20 (1995)), the foreign gene (or promoter-
gene cassette) is inserted into convenient restriction sites in the shuttle
plasmid(s) and co-transfection of 293 cells with the appropriate pair of
plasmids results in the rescue of a recombinant adenovirus vector which contains and expresses the desired exogenous protein. This procedure has been successfully used to produce many recombinant viruses expressing
different types of proteins from a range of different sources.
However, there are instances where exogenous protein expressed by
the virus seems to interfere with the subsequent development of viral
progeny. As a result, rescue of virus by transfection and viral growth may be severely compromised in some cases.
There have been cases where there is a reduction in glycoprotein
expression as a consequence of transcriptional suppression or "squelching."
For example, the activity of the Herpes Simplex Virus VP16 transactivation
domain on the LAP348 protein. Natesan et ah, Nature 139: 349-350 (1997) have shown that transcription of episomal DNA is preferentially inhibited by
"squelching".
A number of solutions to the problem of over expression of
inactivating genes by viral vectors have been explored. Yoshida and Hamada, Biochem. and Biophys. Res. Comm. 230: 426-430 (1997) placed the VSV glycoprotein gene under the control of a minimal HCMV promoter
fused to several tetracycline operator sequences. The operator sequences serve as potential binding sites for a chimeric transactivator protein
consisting of the C-terminal domain of the herpes simplex virus protein
VP 16 fused to the tetracycline repressor protein. In the presence of tetracycline, the transactivator cannot bind to the promoter region, while in
its absence, expression of transcripts from this promoter is a function of the amount of transactivator present. In order to provide adequate levels of
transactivator, Yoshida and Hamada used a second recombinant Ad vector.
Massie et ah, J. Virol. 72: 2289-2296 (1998) also exploited the tetracycline
regulatable expression system, developing 293 cells that expressed the tet-
regulated transactivator to obtain high level expression of a inactivating protein. In yet another approach. Tomanin et ah. Gene 193, 129-40 (1997)
developed Ad vectors containing cassettes regulated by a T7 promoter in
combination with vectors expressing the T7 RNA polymerase to express proteins having an inactivation potential.
These approaches, while potentially useful for the production of
proteins in cell culture, do not lend themselves to an in vivo expression system, such as those implicated in genetic therapy and vaccination. In contrast to the efforts of the art, the approach described herein utilizes repression of transgene expression during vector isolation and growth, and has proved to be very successful in producing recombinant adenoviruses
capable of expressing heterologous proteins, such as rabies glycoproteins, at high levels in host cells and in animals. Studies in mice indicate that a very high level of rabies neutralizing antibody can be induced by the intron- containing vectors following a single intraperitoneal injection.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide a technique for
increasing expression of heterologous proteins by recombinant viruses, such
as adenoviruses.
It is also an object of the present invention to provide cells for the production of certain viruses.
It is a further object of the present invention to provide cells useful in
the production of adenoviruses.
It is a further object of the present invention to provide cells in which
certain heterologous foreign protein products from certain adenoviruses is
inhibited.
It is a further object of the present invention to provide cells based on human embryonic cell lines, such as embryonic kidney cell lines, that are capable of producing a protein or other entity capable of binding with a
It binding site on the genome of certain adenoviruses to inhibit production of certain proteins whose overexpression interferes with the production of those
adenoviruses.
These and other objects are accomplished by the present invention, which provides, in accordance with one aspect of the invention, a eukaryotic cell capable of replicating a recombinant expression vector that produces a
heterologous protein, wherein the cell comprises a polynucleotide encoding
a repressor protein that is capable of repressing production of the
heterologous protein. The cell can be a mammalian cell. Moreover, the
vector can be a plasmid or a virus, such as an adenovirus. The cell can
complement a virus, for example, the cell can express the protein product of a defective region of the virus. For example, the cell can express the El product (or its functional equivalent) that cannot be expressed by an El
functionally deleted virus. The vector can be a defective virus. For
example, the virus can have a functionally disrupted El and optionally the
E3 region can be functionally disrupted as well. The cells can be derived
from embyonic kidney cells, such as 293 cells. The polynucleotide encoding
the repressor can be integrated in the genome of the cell. The repressor can be a Lac repressor or a repressor derived therefrom. One source for a
repressor-encoding polynucleotide is plasmid pHMCVLAP348. Cells
according to the invention include cell line 293Lapl0 (ATCC Accession No. CRL-12586) and cell line 293Lapl3 (ATCC Accession No. CRL-12587). In accordance with another aspect of the invention, there are provided recombinant vectors, such as viruses (for example, adenoviruses) comprising (i) a first polynucleotide sequence encoding a heterologous protein and (ii) a second polynucleotide sequence operably linked to the first polynucleotide in order to permit repression of the expression of the first polynucleotide gene. The recombinant vector, such as an adenovirus, includes those wherein the second polynucleotide sequence is an operator that can be bound by a repressor. Representative sequences include a lac
operator sequence and sequences derived therefrom (all are types of
polynucleotides). In the case of a recombinant adenovirus, the adenovirus
can have a functionally disrupted El and optionally the E3 region can be functionally disrupted as well. A recombinant vector, such as an adenovirus,
can encode a variety of heterologous proteins, such as the rabies glycoprotein G. A recombinant vector, such as an adenovirus, also can include an intron sequence to facilitate protein production.
In accordance with still another aspect of the invention, there are
provided eukaryotic cells according to the invention that are infected or
transfected with vectors according to the invention.
In accordance with yet another aspect of the invention, there are
provided methods of propagating vectors encoding a heterologous protein,
comprising transfecting or infecting eukaryotic cells according to the invention with vectors according to the invention. These and other aspects of the present invention will become ft apparent to the skilled person in view of the teachings contained herein.
Modifications may be made without departing from the scope and spirit of
the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 depicts the construction of plasmids having the rabies glycoprotein gene (Fx) under the control of the MCMV promoter, an intron (I) sequence with or without a copy of the lac operator sequence (o) just downstream of the transcription start site. Unlabelled portions of the circles
comprise plasmid or Ad5 sequences. The sequences of linkers AB9483 and
AB9484, comprising the operator sequence, are set forth below.
FIGURE 2 A concerns probing for the inserted genes in 293 LAP
cells. DNA extracted from 293LAP10 (lanes 1, 4 and 7), 293LAP13 (lanes 2, 5 and 8) or 293 (lanes 3, 6 and 9) cells was digested with Hind III (lanes 1,
2 and 3), Xba I (lanes 4, 5 and 6) or Pst I (lanes 7, 8 and 9) and fragments
separated by agarose gel electrophoresis. The DNA was analysed by
Southern blot hybridization (as shown in FIGURES 2B and 2C) using respectively, probe A, the BamHI to Bgl II fragment of pMPG2, or probe B,
the Ndel to Hindlll fragment of pMPG3. The proposed structure of the insert in 293 LAP cells is indicated at the bottom of the FIGURE 2D. The
markers were generated by digestion of pMPG2 with Hindlll and Sad (B) or of pMPG3 with BamHI and Sad (C). FIGURES 2E and 2F are schematic
representations of plasmids pMPG2 and pMPG3 respectively. FIGURE 3 depicts expression of LAP348 protein in 293LAP13 cells and induction following infection with an El -deleted Ad5 virus. Whole cell extracts, analyzed by Western blot, were prepared from uninfected
293LAP13 cells (lane 1) or at 24 hours (lane 2), 48 hours (lane 3) and 72 hours (lane 4) following infection with Ad dl70-3 at an m.o.i. of 5 pfu/cell.
As controls, extracts also were prepared from uninfected 293 cells (lane 5)
and from 293 cells at 72 hours following infection with Ad dl70-3 (lane 6).
The LAP348 protein was detected with commercial anti-Lac repressor antibody as described in the text. Two exposure times, 15 min.(top) and 1 min (bottom) are shown for comparison.
FIGURE 4A depicts expression of rabies glycoprotein by different
vector viruses in 293 and 293LAP13 cells. Monolayer cultures of 293 or 293LAP13 cells were infected at 2 pfu/cell with one of the following
viruses: Ad5BHGE3MH5Fx, which lacks intron or operator sequences but is otherwise identical to the other vectors (lanes 1,4,7 and 10);
AdMH5(I)E3Fx, which has the intron but no operator sequences (lanes 2,5,8
and 1 1) and AdMH5(I)E3Fx(o), which has the intron and one operator
sequence (lanes 3,6,9 and 12). The infected monolayers were radiolabelled
with 35S-methionine from 8 to 10 hours or from 17 to 19 hours post-
infection and the cells harvested, cell extracts prepared, immunoprecipitated
with anti-rabies glycoprotein antibody and analysed by PAGE, all as described in the text. Lane 13 has extracts from uninfected 293LAP13 cells. Two different exposures (18 hr and 2 hr) are presented for comparison. FIGURE 4B depicts operator-dependent inhibition of rabies glycoprotein expression in 293LAP13 cells and reversal by IPTG. Monolayer cultures of
293LAP13 cells, without (lanes 3 and 6) or with pretreatment with IPTG
(lanes 4 and 7) were infected with AdMH5(I)E3Fx, the vector lacking an
operator sequence (lanes 3 and 4) or with AdMH5(I)E3Fx(o), the vector having one operator sequence (lanes 6 and 7). As a control, 293 cells were
also infected with AdMH5(I)E3Fx (lane 2) or AdMH5(I)E3Fx(o) (lane 5).
All infections were at 2 pfu/cell and all infected cultures were radiolabelled with 35S-methionine between 8 to 10 hours post-infection and analysed as
described herein.
FIGURE 5 depicts expression of rabies glycoprotein by different
vectors in non-complementing human (MRC5) or canine (MDCK) cell lines. Monolayer cultures of MDCK cells (lanes 1 to 5) or MRC5 cells (lanes 6 to
10) were infected at 10 pfu/cell with one of the following:. Ad5BHGE3MH5Fx (lanes 1 and 6) or 50 pfu/cell (lanes 2 and 7);
AdMH5(I)E3Fx (lanes 3 and 8); AdMH5(I)E3Fx(o) (lanes 4 and 9); or were
not infected (lanes 5 and 10). The infected cultures were labeled from 8 to 10 hours post-infection and harvested, immunoprecipitated and analyzed on
PAGE. The long exposure is 20 hours (top) and the short exposure is 4
hours (bottom).
FIGURE 6 contains growth curves of recombinant adenoviruses expressing rabies glycoprotein in either 293 or 293LAP13 cell lines.
Replicate monolayer cultures containing approximately lxlO6 cells each (either 293 or 293 LAP 13 cells) were infected with the recombinant viruses at a moi of 1 pfu/cell. At the indicated times post infection duplicate cells and supernatants were harvested and assayed for pfu on 293LAP13 cells.
Titres are plotted on an exponential scale. Open symbols represent yields from 293 cells for AdMH5(I)E3Fx (D) and AdMH5(I)E3Fx(o) (D). Closed symbols represent yields from 293 LAP 13 cells for AdMH5(I)E3Fx (D) and
AdMH5(I)E3Fx(o) (D).
FIGURES 7A-C depict the sequence of plasmid pMPG2.
FIGURES 8A-D depict the sequence of pMPG3 type of plasmid.
FIGURES 9A-B depict the sequence of plasmid pDCSVFx.
DETAILED DESCRIPTION OF THE INVENTION
As will be described below, there are provided cells, including cell lines, for use as hosts for replicating recombinant expression vectors, such as viruses and plasmids, wherein the cells comprise a gene encoding a repressor protein capable of repressing expression of certain heterologous proteins of
the vector and which otherwise deleteriously impact replication thereof.
The term "repressor," particularly in the context of proteins, is
intended to refer to entities (e.g., proteins) having the capacity to inhibit,
interfere, retard and/or repress the production of heterologous protein
product of a recombinant expression vector. For example, by interfering
with a binding site at an appropriate location along the expression vector, such as in an expression cassette. One appropriate repressor for use according to the invention is the repressor that interacts with the lac operator
(which is a type of interaction partner for the repressor). See, e.g., Watson et ah, MOLECULAR BIOLOGY OF THE GENE (4th ed. 1987) (Benjamin/Cummings Publishing Co.) Other appropriate repressors and interaction partners are available in the field. Thus, examples of repressors include the lac repressor, the tφ repressor, the gal repressor and the lambda
repressor. Other appropriate repressors can be employed as well.
The cell line can be derived from 293 cells and the polynucleotide inserted therein encodes a lac repressor derivative. According to one
embodiment, the gene includes a nuclear localization signal from a SV40
large T antigen, along with a transcription activation domain from heφes
simplex type 1 VP 16, as well as a portion of plasmid pHMCVLAP348,
which is described in U.S. Patent 5,674,730.
The vector can be an adenovirus, more preferably a defective adenovirus with a functionally disrupted El region and optionally the E3 region can be functionally disrupted as well. In the context of the present
invention, the term "heterologous" connotes a difference in origin, source, form, structure, activity or location between two or more entities. The
referents and effect of the term "heterologous" depend upon the context in which it is used. For example, in the context of recombinant viruses, a
heterologous protein typically is a protein encoded by a recombinant virus
wherein that protein does not naturally occur in a native or source virus, or the protein is changed in a manner that is distinct from the form which naturally or usually occurs in the native or source virus.
In other aspects, the invention provides a system for replicating a recombinant protein expression vector, comprising a cell, such as from a cell line, comprising a gene which encodes a repressor protein capable of repressing certain heterologous protein products of the vector, which vector-
encoded proteins otherwise inhibit production of the virus.
The vector can be an adenovirus, such as a defective adenovirus. Defective adenoviruses can have a functionally disrupted El region and
optionally the E3 region can be functionally disrupted as well. Functional disruptions can be undertaken by insertions and/or deletions in a given
region
A particular feature of the vector used in the present system is that it
contains a binding site, such as an operator sequence. For example, the vector contains a lac operator sequence which serves as a binding site for the repressor protein, preferably within the expression cassette of the vector.
The repressor protein can be the lac repressor, a derivative thereof, or other
repressors available in the art. In the case of defective adenovirus, the
binding site may be placed in the El region, the E3 region and/or another
region where the binding site can be operably linked.
In another aspects, the invention also provides a method of replicating a recombinant protein expression vector. Repressor proteins for use according to the invention can repress
production of the heterologous protein. For example, the vector has an expression cassette containing a gene (a type of polynucleotide) encoding the heterologous protein, the method further comprising the step of locating the binding site within the expression cassette.
In another of its aspects, the present invention provides cells,
including cell lines, that produce a repressor protein and a vector for
transforming that cell line, the vector comprising an expression cassette in which DNA encoding for a heterologous protein product is operably linked
for expression to a promoter sequence or the like that is disfunctional or impaired in the presence of the repressor protein. The phrase "operably
linked" in the context of the present invention refers to a first sequence(s)
being positioned sufficiently proximal to a second sequence(s) such that the first sequence(s) can exert influence and/or control over the second
sequence(s) or another sequence(s) under control of the second sequence(s).
Operably linked includes, but is not limited to, sequences that are
contiguous.
The vector can be an adenovirus, such as a defective adenovirus, and
the cell line complements the defect to allow the adenovirus to replicate.
In still another aspect of the present invention, the invention provides
methods of producing cells, such as cell lines, useful as a host for replicating expression vectors, comprising the step of introducing into the host a
polynucleotide sequence encoding a repressor protein capable of repressing a heterologous protein of the vector which otherwise inhibits replication of ft that vector. Preferably, the introduction comprises integration of the repressor encoding sequence into the genome of the host cell.
The expression vectors can include a promoter sequence and a polynucleotide sequence encoding the heterologous protein product, the binding site being located therebetween, which is one example of operably
linked. Alternatively, the expression cassette includes a promoter sequence
and a sequence encoding the heterologous protein product, the binding site
being located upstream of the promoter sequence, which is another example of being operably linked.
In still another embodiment, the method includes the step of providing a plurality of binding sites.
As will be described below, the present cells, in particular when used in conjunction with expression vectors such as adenovirus, are capable of
repressing the production of certain heterologous protein products from such vectors, and thereby minimize the interfering effects of the presence of
certain proteins on the further replication of the vector itself. This capability
is particularly advantageous in adenovirus-based recombinant vector systems
whose protein products, such as rabies glycoprotein, have been shown to interfere with further replication of the adenovirus vector itself.
The present invention also provides a combination of cells that
produce a repressor protein and a vector for transforming those cells, the vector comprising an expression cassette in which DNA (a type of polynucleotide) encoding for a heterologous protein is operably linked to a promoter sequence that is disfunctional or at least substantially impaired in the presence of the repressor protein. In this case, the cell line and the adenovirus can, if desired, be made available in a single package. The package also can include instructions for the user on how to use the combination, such as explaining how to infect and/or transfect the
adenovirus into the cell line under conditions suitable for transfection and
then to select for and then to culture under suitable conditions for adenovirus
replication. The instructions also may instruct the user how to rescue the adenovirus or to recover the protein of interest.
The invention can utilize a cell line which is a derivative of the human 293 cell line, commonly used as a host for the replication of
adenovirus-based expression vectors. Other appropriate cells useful
according to the invention are disclosed in Fallaux et ah, Hum. Gene Ther.
7: 215-22 (1996); Fallaux et ah, Hum. Gene Ther. 9: 1909-17 (1998). In the
context of cells, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For
example, the cell that is derived is based upon or obtained from a naturally occurring cell or other type of cell. Cells that are "derived" can be obtained
by screening cells for desired properties, conducting mutations on cells
and/or transforming cells with DNA to impart a desired trait or property on the recipient cell. Other approaches also are available. Two examples of cell lines according to the present inventions are described in more detail below and are 293 -based cell lines, designated
293LAP10 and 293LAP13, which contain and express a repressor protein in the form of a derivative of the lac repressor protein, viz: LAP348 (Labow et ah, 1990). In the context of polynucleotide sequences and regions, genes and plasmids, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For example, a DNA
sequence that is derived is based upon or obtained from a naturally occurring
DNA sequence or other type of source DNA sequence.
The lac operator sequence, to which the repressor protein binds, is incoφorated into a transcription unit, where it is operably linked, controlling rabies glycoprotein expression. In one case, the operator sequence is located
immediately downstream of the transcription start site.
Cell lines made according to the invention are provided. Cell line
293LAP 10 was deposited with the American Type culture Collection
pursuant to the Budapest Treaty and was assigned Accession No. CRL- 12586. The 293LAP13 cell line was deposited with the American Type
culture Collection pursuant to the Budapest Treaty and was assigned Accession No. CRL-12587. The invention is not limited to these cell lines, however. Following the teachings of this application, the skilled person will
be able to readily attain other cell lines in accordance with the present
invention. The operator-containing adenovirus of the present invention, can be ft grown to higher titres in 293LAP10 and 293LAP13 and has been shown to produce plaques more efficiently in 293LAP10 and 293LAP13 cells than in
293 cells not modified in accordance with the teachings of the invention.
In accordance with another embodiment, adenovirus expression vectors are provided with a promoter-intron expression cassette for
expressing rabies glycoprotein. This vector has been shown to express the
rabies glycoprotein with enhanced synthesis kinetics in non-complementing
human and canine cell lines compared to vectors lacking the intron.
Furthermore, it has been shown that the repressor protein produced by the 293 LAP 10 and 293LAP13 cell line is effective at repressing the expression of rabies glycoprotein by the operator-containing adenovirus vectors . Moreover, it has also been shown that the repressing effect of the
repressor protein is at least partly relieved by isopropylthio-β-galactoside
(IPTG).
Therefore, it is believed that cell lines according to the present invention, including, for example those based on the 293 cell line, still more particularly the 293LAP10 and 293LAP13 cell lines, are useful for the
rescue and propagation of other expression vectors in which expression of the desired protein prevents vector rescue in the host cell.
Although the cell lines disclosed herein are based on 293 cells, other
cell lines are contemplated which have utility as a host for adenovirus or other expression vectors capable of producing a heterologous protein
product.
Based on published observations showing that the presence of an
intron can significantly increase the expression of some gene sequences (Petit clerc et ah, J. Biotech. 40, 169-178 (1995); Yew et al, Gene Therapy
8: 575-584 (1997)) and observations that expression of a number of glycoprotein antigens in adenovirus vectors can be greatly amplified by the
presence of an intron upstream of the gene, attempts to produce defective adenovirus vectors were undertaken in which the expression of a rabies
glycoprotein gene was driven by the highly effective murine cytomegalovirus promoter (MCMV) (Dorsch-Hasler et al, Proc. Nat 'I Acad. Sci. USA 82: 8325-29 (1985); Addison et al, 1997) in combination with an intron sequence previously used in adenovirus vectors (Berkner & Shaφ,
1985). The construction detail for plasmid pMH5(I)Fx is shown in Fig. 1.
Numerous attempts, to rescue a defective adenovirus vector containing the
rabies glycoprotein gene under the control of this promoter construction
were unsuccessful following standard co-transfection protocols in 293 cells.
These unsuccessful attempts amounted to over a dozen independent experiments including some with slightly modified constructs and
representing over 300 transfected plates of 293 cells in total (data not
shown). The only successful rescue of vectors of this type resulted from a
plasmid which had a fortuitous deletion of 59 nucleotides from the start of the rabies glycoprotein open reading frame as a result of EcoRl STAR endonuclease activity (data not shown). Since these rescued vectors were unable to express the rabies glycoprotein, this suggested that the failure to rescue functional vectors may be due to the inactivation potential of the overexpressed rabies glycoprotein. To overcome this problem, a 293 -based
cell line was constructed which expressed a repressor protein and could therefore be used to reduce glycoprotein expression, and its attendant interfering capabilities, in transfected, infected and/or transformed cells.
These and other aspects of the invention will become apparent to the
skilled person in view of the disclosure contained herein. Modifications
may be made to the various teachings contained herein without departing
from the scope and spirit of the invention.
EXAMPLE I: Cells. Viruses and Plasmids.
The 293 cells (Graham et al, 1997) and 293 cell derivatives, were
maintained as previously described by Graham and Prevec. Isolated
colonies of cells transformed to G418 resistance (described below) were
maintained in a-MEM supplemented with Fetal Bovine Serum (10% v/v; a
supplier), Penicillin (100 U/ml), Streptomycin (100 μg/ml) and G418 (400
ug/ml, Gibco BRL). Control adenovirus Ad dl70-3 is derived from Ad5 but
with the El region deleted and a deletion and/or substitution in the E3 region (Bett et al. Proc. Nat 7 Acad. Sci. USA 9X : 8802-06 (1994)). In the context
of viruses, the term "derived" in its various grammatical forms connotes a degree of similarity that is indicative of an archetype. For example, the virus
that is derived is based upon or obtained from a naturally occurring virus or other type of virus. Viruses that are "derived" can be obtained by screening virally-infected cells for desired properties, conducting mutations on virally- infected cells and/or genetic manipulation of viral genomes with polynucleotides to impart a desired trait or property on the recipient virus. Other approaches also are available, including in vivo homologous
recombination and the the direct in vitro insertion of polynucleotide sequences. The term polynucleotide can encompass DNA, RNA and
synthetic entities, such as peptide nucleic acids. In the context of the vectors and eukaryotic cells according to the invention, the term polynucleotide can
be considered synonymous with DNA.
The rescue, isolation, propagation, gradient purification and titration
of recombinant viruses described herein can be done according to known techniques. See Hitt et ah, Meth. Molec. Genet. 7, 13-30 (1995). The virus
particle number in gradient purified stocks, was determined from the OD260
of an aliquot in buffer containing 0.1 % SDS using the relationship OD2 0 =
1.1 x 10 n pfu/ml (Mittereder et ah, J. Virol. 70, 7498-7509. (1996)).
Turning to plasmids, the molecular cloning techniques described
herein below are described by Sambrook et ah, Molecular Cloning: A
Laboratory Manual, 2nd ed.. Cold Spring Harbor , NY: Cold Spring Harbor
Laboratory (1989). All DNA fragments were separated from contaminants by agarose gel electrophoresis and eluted from the agarose using GeneClean
(Bio 101 Inc.). Plasmid pMPG2 (Figure 2E) contains a neomycin resistance
gene under the control of an HCMV promoter all flanked by a Bam HI site and a Bgl II site as shown in Fig 2 A. The sequence of plasmid pMPG2 is depicted in FIGURE 7. Plasmid pHCMVLAP348 (Labow et ah, Molec. Cell. Biol. 10: 3343-3356 (1990) (NRRL.B- 18664)) comprises a modified lac repressor gene containing a nuclear localization signal from the SV40 large T antigen and the transcription activation domain from heφes simplex
type 1 VP16 (LAP348). This plasmid was cut with Hind III and the 2.5 kbp fragment containing the HCMV promoter and the LAP348 gene was ligated in a series of steps with other plasmids to produce plasmid pMPG3 (figure 2F). Plasmid pMPG3 contains the HCMV promoter, the gene for protein
LAP348, an SV40 derived polyA addition sequence and a copy of the
Adenovirus inverted terminal repeats (known as "ITRs"), representing the
sequences from nt37,628 to ntl95 from plasmid pFG140 (Graham, EMBO J. 3: 2917-2922 (1984)). This entire insert is flanked on one side by a unique Bam HI site and on the other side a unique Bgl II site as shown in Fig 2B. The sequence of a pMPG3 type of plasmid is depicted in Figure 8.
The gene encoding a rabies glycoprotein, cloned from a red fox
isolate (Nadin-Davis et ah, Gen. Virol. 74: 829-837 (1993)) was modified by
removing the ATG sequence immediately preceding the probable protein initiating ATG and cloned into plasmid pDCSVFx. The sequence of
plasmid pDCSVFx is depicted in Figure 9. Plasmid pMH5(I) was derived
from pMH5 (Addison et ah, J. Gen. Virol. 78: 1653-1661 (1997)) by insertion into the EcoRl site of an intron sequence obtained by PCR
replication of the adenovirus-immunoglobulin hybrid intron present in
plasmid pMLPspla (Kaufman & Shaφ, Mol Cell. Biol. 11, 1304-1319 (1982); Berkner & Shaφ, Nucl. Acids Res. 13: 841-857 (1985)). As shown ft in Fig. 1, the rabies glycoprotein gene was cloned into pMH5(I) downstream of the MCMV promoter and intron to produce plasmid pMH5(I)Fx. A derivative of pMH5(I)Fx, namely pMH5(I)Fx(o) contains one copy of the Lac operator inserted at the unique Kpnl site located just downstream of the transcription start site (Fig 1). Synthetic primers C :5' GCGGTACCGTCGGAATTGTGAGCGGA- TAACAATTGGTACCCG 3' (AB9483) and
D: 5' CGGGTACCAATTGTTATCCGCTCACAATTCCGACGGTACCGC 3' (AB9484) were synthesized and annealed together to achieve the desired construction. The annealed primers were then restricted with Kpn I and
ligated to similarly restricted pMH5(I)Fx plasmid. Recombinants containing
one (pMH5(I)Fx(o)) copy of the repressor binding sequence were identified
by restriction enzyme digestion and fragment analysis on agarose gels. The orientation of the near palindromic operator sequence in pMH5(I)Fx(o) was verified by sequencing.
EXAMPLE 2: Transient transfection assays.
Plasmids pMH5(I)Fx, pMH5(I)Fx(o), and pMPG3 were assayed for
expression of the appropriate proteins by transient transfection in various cells lines followed by Western blotting analysis of total cell lysates. Briefly,
1 μg of purified plasmid DNA was transfected into approximately lxl 06
cells using the calcium phosphate technique (Graham and Van der Eb,
Virology 52, 456-467 (1973)). Two days post transfection, the total cell monolayer was harvested, and the expression of the relevant protein assayed by Western blotting, as discussed herein below. A sample of cells similarly
transfected with pElspla (Bett et al, 1994) was used as a control.
EXAMPLE 3: Generation of cell lines expressing the LAP348
protein.
Plasmids pMPG2 (6 μg) and pMPG3 (60 μg) pMPG3 were cut with
restriction enzymes Bam HI and Bgl II and the appropriate fragments were isolated. The pMPG3 fragment was then ligated on its own for 30 minutes in
a volume of 20 μl at 16°C. The mixture was then restricted again with Bam
HI and Bgl II for 60 minutes at 37 C before heat inactivating the mixture at
65°C for 15 minutes. This cycle was repeated once more before adding the
pMPG2 fragment and ligating overnight at 16°C. Samples were examined by agarose gel electrophoresis and the remaining mixture was transfected
into 60mm diameter dish of confluent 293 cells by the calcium phosphate method (Graham and Van der Eb, 1973). After 24 hours, the cells were divided amongst 10 similar 60mm diameter dishes and the media supplemented with G418 at a concentration of 400 ug/ml. After 2 weeks of
selection, colonies of G418 resistant cells were evident and 12 were isolated and expanded. The procedure was repeated a second time (i.e., fresh DNA was prepared, examined and transfected) and a further 15 colonies were isolated. No more than two colonies from an individual dish thus reducing
the possibility that identical clones would be isolated.
EXAMPLE 4: Antibodies, Polyacrylamide gel electrophoresis
(PAGE) and Western blotting.
All Western blot analysis and PAGE was performed as previously described (Matthews and Russell, J. Gen. Virol. 75: 3365-3374 (1994)).
Rabbit anti-Lac repressor serum was purchased from Stratagene and used
according to supplier's protocols. Bound primary antibody was detected
using a secondary anti-rabbit serum linked to Horse Raddish Peroxidase
(HRP) and chemiluminescent detection was performed using ECL
(Amersham) according to the manufacturer's instructions.
EXAMPLE 5: DNA preparation and Southern Blotting
Approximately 5xl07 cells were harvested and treated with SDS
(0.5% w/v) and Pronase (0.5 Dg/ml) at 37°C overnight in a final volume of
10 ml. The lysed cells were then extracted twice with buffered phenol and
once with chloroform before precipitating the DNA with lithium chloride
and ethanol. The precipitated DNA was washed twice with 70% ethanol, air dried and resuspended in 0.5 ml O.lxSSC. The resuspension of the DNA was facilitated by placing on an end-over-end roller for 20 hours at 4°C. The ft DNA was quantified by spectroscopy and 10 Dg samples digested with
appropriate restriction enzymes before agarose electrophoresis on 0.8% (w/v) agarose gels. The agarose gels were prepared for DNA transfer as described by Sambrook et al. (1989) then transferred to positive charge nylon membranes (Boerhinger Mannheim) using a pressure blotter
(Stratagene) over two hours. The nylon membranes were then UV cross-
linked using a Stratalinker (Stratagene) and used immediately or stored at -
20°C for up to 5 days. DNA fragments were derived from plasmids pSV2neo
(Smal to Bgl II fragment containing the neomycin gene open reading frame) and pHCMVLAP348 (Sac I to Pvu II fragment containing the LAP348 open reading frame) and used to generate 'DIG' labelled probes using the 'DIG
HighPrime' system (Boerhinger Mannheim) according to the manufacturer's
protocols. Detection of DNA bound to the membranes was performed using
"High SDS buffer" and the 'DIG detection kit' (Boerhinger Mannheim)
according to the manufacturer's protocols except that the high temperature stringency wash time was reduced from 2 15 minutes to 2 x 10 minutes.
EXAMPLE 6: Isolation and screening of cells
The approach was to produce a 293 -based cell line which expressed a
lac repressor derived protein (LAP348) for use, in one instance, in
conjunction both with vector precursors which contained the lac operator or
other operators or DNA sequences, to which the repressor binds, within the promoter-transcription region so as to inhibit synthesis of the rabies glycoprotein in this cell line. Low passage (pass 29) 293 cells were transfected with Bam HI - Bgl II fragments from pMPG2 and pMPG3 and resistant clones were selected in the presence of G418. After 3 weeks of selection, 28 resistant colonies were isolated and expanded. All 28 cell lines were assayed for expression of the LAP348 protein by Western blotting and two were identified as suitable for further investigation.
EXAMPLE 7: Characterization of LAP cell lines by Southern
blotting Because the 293 LAP cells had been transfected with a ligation mixture containing Bglll-BamHI fragments from pMPG2 and
pMPG3 it was of some interest to determine the structure of the integrated sequences in these lines. DNA was extracted from 293 cells and 293LAP10
and 293 LAP 13 and analyzed by Southern blot hybridization using as probes
the Bam HI - Bgl II fragment of pMPG2 (probe A) and the Nde I - Hind III
fragment of pMPG3 (probe B) (Fig. 2A). The pattern of fragments detected
in both 293LAP10 and 293LAP13 cells corresponded to that predicted by the non-homologous integration of a DNA segment with the structure
indicated in Fig 2D. Both probes detected an Xbal fragment of about 8.6 kb in 293 LAP 10 cells and one of about 7.4 kb in 293LAP13 cells. Since Xbal
does not cut within either the pMPG2 or pMPG3 derived fragments these
bands suggest a single insertion at distinct sites within the two cell lines. As shown in Fig 2B, probe A primarily detects different fragments in the
Hindlll digestion products of 293LAP13 and 293LAP10 cells. These are believed to be the fragments resulting from Hindlll cleavage at the site depicted at ntl592 in Fig 2D and a Hindlll site, unique to each cell line, in
DNA sequences leftward of the insertion site. The fragments at about 2.3 kb
in lanes 1 and 2 of Fig. 2B are believed to represent the 2333 kb Hindlll fragment (from 1592 to 3925 in Fig 2D) which is detected by the HCMV sequences present in probe A. These Hindlll fragments are more strongly detected by probe B (Fig. 2C) as expected. As predicted by the structure
indicated in D, probes A and B hybridized to a Pstl fragment of
approximately 2.7 kb generated by cleavage at 634 bp and 3401 bp in Fig.
2D as well as Pstl fragments unique to each cell line due to cleavage at 634 bp and at sites in cell DNA sequences leftward of the insertion site. Probe B consistently detected DNA fragments of 10 kb or larger but these fragments
were also detected in 293 DNA.
Both LAP cell lines therefore appeared to contain a single copy of the
LAP348 expression cassette (from pMPG3) linked to a single copy of the neomycin resistance gene expression cassette (from pMPG2) as
schematically depicted in Fig 2D. This combined cassette is integrated into distinct sites within the 293LAP10 and the 293LAP13 cell lines. The 293LAP13 cell line was chosen for most of the subsequent studies.
EXAMPLE 8: LAP348 protein expression increases after infection of
293LAP cells by adenovirus. Both 293 and 293LAP13 cell lines were infected with Ad dl70-3 and samples of infected cells were harvested at various times post infection. Levels of LAP348 protein expression were assayed by Western blotting and compared to protein levels present in uninfected cells. Figure 3 shows that at
24 hours post infection there is significantly more protein LAP348 present than in the uninfected samples. The levels of LAP348 remain high for 3 days
post infection. Furthermore, levels of an unknown cellular protein which cross-reacts with the antiserum have dramatically declined as would be expected for a cellular protein with a relatively short half life since
adenovirus would shut off mRNA transport.
EXAMPLE 9: Rescue of recombinant viruses in 293LAP 13 cell
line.
Co-transfections of plasmids pMH5(I)Fx or pMH5(I)Fx(o) with either plasmids pBHGlO or pBHGE3 into both 293 and 293LAP13 cell lines
were performed to determine if recombinant adenoviruses could be
generated containing the expression cassette in the El region, along with
either a deleted (pBHGl 0) or wild type (pBHGE3) E3 region (Bett et ah,
1994). Table 1 presents the results of one experiment in which the relative efficiency of rescue of recombinant vectors was compared in 293 and 293LAP13 cells employing different plasmid combinations and using
standard protocols as outlined in Methods. After 12 days the number of
plaques on each dish were recorded. As can be seen from the table,
recombinant virus constructed from pMH5(I)Fx(o) in combination with
either pBHGlO or pBHGE3 could be efficiently rescued in 293 LAP 13 cells
whereas they could not be rescued in 293 cells. When the operator sequence was absent from the construct, rescue of virus was very inefficient as evidenced by only one AdMH5(I)E3Fx rescue in combination with pBHGE3
in 293LAP13 cells. These results agree with earlier, failed, attempts to rescue the pMH5(I)Fx construct in 293 cells in combination with either
pBHGlO or pBHGE3 as mentioned above. Table 1 presents the results of transfections in 293LAP13 cells alone which again demonstrate the higher efficiency of rescue, in this cell line, of vectors containing an operator
sequence compared to that lacking the operator.
In the studies detailed in Table 1, the relative efficiency of rescue of
adenovirus recombinants expressing rabies glycoprotein on 293LAP13 cells.
Monolayer cultures of 293LAP13 cells were cotransfected with plasmid pBHGE3 and one of pMH5(I)Fx, or pMH5(I)Fx(o) at the total DNA concentrations shown. The control plasmid pFG140 was also included. The
total number of plaques observed after 12 days was counted and is presented
in column 2 along with the number of dishes represented. The average
number of plaques per dish is presented in column 3. Some representative plaques were picked and the virus in these plaques was screened by restriction enzyme analysis to confirm the expected virus DNA structure as
shown in column 4. Table 1 : The relative efficiency of rescue of adenovirus recombinants with and without the operator sequence and expressing rabies glycoprotein on
293LAP13 cells.
Figure imgf000032_0001
The fact that vectors lacking the operator sequence could be rescued
in the 293LAP13 cell line was in contrast to an inability to do so in 293
cells. In addition to the recombinant plasmids, 293LAP13 cells also were tested for their ability to generate plaques from the infectious plasmid pFG140 which does not require a recombination event to generate El deleted adenovirus (Graham, 1984). As shown in Table 2, both 293 and 293LAP13 cell lines are equally capable of generating plaques from this
plasmid.
The studies detailed in Table 2 concern the relative efficiency of
rescue in 293 and 293LAP13 cells of recombinant adenoviruses expressing
rabies glycoprotein. Plasmids pMH5(I)Fx or pMH5(I)Fx(o) were
contransfected onto monolayers of 293 or 293LAP13 cells along with either
plasmid pBHGlO or pBHGE3 as described by Bett et ah, 1994. All plasmid
DNA was used at 5 μg per dish. As a control, cells also were transfected
with the infectious plasmid pFG140 but in this case only one μg of DNA
was used. The number of plaques observed after 12 days was counted and
the total number observed as well as (the number of dishes per experiment)
are presented in the table.
Table 2: Relative efficiency of rescue in 293 and 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein.
Figure imgf000034_0001
a: all plasmid DNA at 5 μg/dish except pFG140 which is at 1 μg/dish
EXAMPLE 10: Rabies glycoprotein expression in 293 and 293LAP13 cell lines To determine the kinetics of synthesis of rabies glycoprotein by the
vectors isolated as described above, 293LAP13 cells or 293 cells, infected at
2 pfu/ml, based on titrations in 293LAP13 cells, with AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) or with the control 'intron-less' virus
Ad5BHGE3MH5Fx, were labelled with 35S methionine at 8 to 10 or at 17 to 19 hours post infection. The infected culture was harvested at the end of the
labelling period and the expressed rabies glycoprotein was
immunoprecipitated and analyzed by SDS-PAGE, and the resultant
autoradiograms presented in Figure 4A. To conduct the study, approximately lxlO6 cells were infected with the indicated recombinant adenovirus (or PBS as a control) and at the indicated time post infection the media was supplemented with 35S labeled methionine. After two hours further incubation the cells were harvested and the radiolabeled rabies glycoprotein immunoprecipitated as previously
described (Graham and Prevec). When required, isopropylthio-β-
galactoside (IPTG), purchased from Gibco BRL, was used at final
concentration of 10 mM in medium and was added to cells 24 hours prior to
infection. The anti-rabies glycoprotein mouse monoclonal antibody (Mab)
used was kindly provided by Dr Alex Wandeler, Canadian Food Inspection
Agency, Napean, Ontario. Other such antibodies are readily attained by the person having skill in the art. The immune precipitated proteins were separated by SDS-PAGE, the gel dried and exposed for various time to
Kodak XAR5 X-ray film.
AdMH5(I)E3Fx and AdMH5(I)E3Fx(o) show comparable amounts of radiolabelled rabies glycoprotein in 293 cells at either 8-10 hours or 17-19
hours post infection. However, in 293LAP13 cells the expression of the
rabies glycoprotein by AdMH5(I)E3Fx(o) is markedly reduced compared to
AdMH5(I)E3Fx at 8-10 hours. Moreover, pre-treatment of the 293LAP13 cells with IPTG relieves this block on expression of rabies glycoprotein by
AdMH5(I)E3Fx(o) (Fig. 4B). This is consistent with the results of the transient transfection experiments, described above, using the plasmids from
which the recombinant adenoviruses were created. It is possible that the two, self-annealing palindromic operator sequences in the transcript mRNA ft encoding the rabies glycoprotein in this construct inhibits normal processing and translation. The other observation apparent from these results is that the presence of the intron sequence in AdMH5(I)E3Fx and AdMH5(I)E3Fx(o) allows increased rabies glycoprotein expression over that produced by the comparable but intron-less vector, Ad5BHGE3MH5Fx. Because the
293LAP13-derived titre was used as a standard in this experiment, as will be
seen below, the particle number of AdMH5(I)E3Fx is about six-fold higher
than that of the other viruses in this experiment, and direct quantitative
comparisons for this virus cannot be made. Nevertheless, comparisons between Ad5BHGE3MH5Fx and AdMH5(I)E3Fx(o), where the particle
numbers are not significantly different, show that this conclusion is valid.
EXAMPLE 11 : Rabies glycoprotein expression in non-complementing cell lines To determine if the presence of the intron increased protein
expression in non-complementing cell lines as well, purified virions were
used to infect human (MRC-5) and canine (MDCK) cells which cannot
complement the adenovirus El deletion defect present in the recombinant
viruses under study. Levels of expression achieved by viruses without (Ad5BHGE3MH5Fx) were compared to those with (AdMH5(I)E3Fx and
AdMH5(I)E3Fx(o)) an intron between the transcription start site and the start codon for the glycoprotein. The cells were infected at an m.o.i. of 20
pfu (based on titre in LAP 13 cells) and 8 hours later pulsed for 2 hours with
33S. As shown in Fig. 5, a comparison of rabies protein expression kinetics after infection with approximately equal numbers of virus particles of Ad5BHGE3MH5Fx or AdMH5(I)E3Fx(o), proves that the presence of the intron greatly increases the amount of rabies glycoprotein synthesized. While the level of rabies glycoprotein produced by the operator containing virus, AdMH5(I)E3Fx(o), appears to be less than that of AdMH5(I)E3Fx, a direct comparison is not possible since there are some six times as many
particles of the latter virus per infected cell. Nevertheless, it is clear that
expression of rabies glycoprotein can be achieved in non-complementing
cells, both human and canine, by the recombinant adenoviruses containing
the intron sequence.
EXAMPLE 12: Comparative plaguing efficiency on 293 cells and
293LAP 13 cells
It is believed that high level expression of the rabies glycoprotein
results in inhibition of virus replication and hence prevented efficient rescue
of vectors. To confirm whether this effect manifests during plaque
formation, the relative plaquing efficiency of the recombinant viruses was
measured on both 293 cells and 293LAP13 cells. Table 3 shows the results
of titrations on 293 and 293LAP13 cells of CsCl gradient banded viruses AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) and a control vector lacking the intron sequence, Ad5BHGE3MH5Fx. The particle to pfu ratios of the control vector and of the vector containing two Lac operons were essentially
identical on both 293 and 293LAP13 cells. Interestingly, as predicted, both
of the high level glycoprotein expressors, AdMH5(I)E3Fx and AdMH5(I)E3Fx(o), are an order of magnitude less efficient in inducing plaques on 293 cells, as measured by the inverse of particle to pfu ratio, than
is the control virus. More importantly, the AdMH5(I)E3Fx(o) vector, which contains the operator sequence, is as efficient on 293LAP13 cells as is the control virus. Thus decreasing the level of glycoprotein expression by this vector, through binding of the repressor present in 293LAP13 cells, results in a plaquing efficiency for this vector equal to that of control virus. Thus,
these results support a correlation between the level of glycoprotein
expression and the level of inactivation potential exhibited by the adenovirus
vectors. The vector lacking the operator sequence also had an increased plaquing efficiency on 293 LAP 13 cells of approximately three-fold compared to the result on 293 cells. This suggests that the small reduction in
rabies glycoprotein synthesis in the 293LAP13 cells compared to 293 cells,
as observed in Fig. 4, may be sufficient to allow adenovirus replication to
escape some of the inactivation potential associated with rabies glycoprotein
overexpression. Also consistent with this explanation is the finding (Table
3) that the vector containing the operator sequence was almost threefold
more efficient than the vector lacking this sequence when both are plaqued
on 293 cells. The presence of the nucleotides comprising the operator sequence near the transcription start site may reduce the level of expression of rabies glycoprotein from the former vector and thus allow more adenovirus synthesis. The studies detailed in Table 3 concern the relative plaque forming titre and particle to pfu ratios on 293 or 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein. The following recombinant adenoviruses: Ad5BHGE3MH5Fx, which lacks intron or operator sequences but is otherwise identical to the other vectors, AdMH5(I)E3Fx, which has the intron but no operator sequences, AdMH5(I)E3Fx(o), were grown in large scale cultures in 293LAP13 cells (except for
Ad5BHGE3MH5Fx, which was grown in 293 cells) and were purified on
CsCl density gradients. An estimate of the virus particle number in the
purified stock was obtained by OD o0 as described in the text. The virus was titrated in duplicate by standard plaque assay on monolayers of 293 or 293LAP13 cells and the plaques counted after 12 days. The particle to pfu ratio of each recombinant vector was determined for 293 cells and
293LAP13 cells from this data and the ratio of the relative titre on
293LAP 13 to that on 293 cells is presented in the last column.
Table 3: The relative plaque forming titres and particle to pfu ratios on 293 or 293LAP13 cells of recombinant adenoviruses expressing rabies glycoprotein.
Figure imgf000040_0001
EXAMPLE 13: Growth curves on 293LAP13 cells and 293 cells
In view of the effect on transfection and on plaque formation, studies
were made to determine whether the growth of these recombinant vectors
was substantially different in 293 or 293LAP13 cells. Figure 6 shows one
step growth curves for the two viruses AdMH5(I)E3Fx, AdMH5(I)E3Fx(o) grown on 293 and 293LAP13 cells with all virus yields assayed on
293LAP13 cells. As expected. AdMH5(I)E3Fx and AdMH5(I)E3Fx(o), that produce the highest levels of glycoprotein, also produced the lowest titres on
293 cells by 48 hours, a time at which cytopathic effect is essentially complete in the infected cell monolayer. On 293LAP13 cells the
AdMH5(I)E3Fx(o) vector attains a final yield some 20-fold higher than that obtained in 293 cells. The virus lacking the operator sequence,
AdMH5(I)E3Fx, also showed a ten fold greater virus yield on 293LAP13 cells compared to the parental 293 cell line. Assuming a comparable particle to pfu ratio as determined for gradient purified viruses, the amount of AdMH5(I)E3Fx virus and AdMH5(I)E3Fx(o) virus synthesized in
293LAP13 cells is approximately the same. It is believed that the enhanced
growth on 293LAP13 cells of viruses expressing excess rabies glycoprotein
whether the virus does or does not carry the lac operator sequence is due to
the relative reduction of rabies glycoprotein expression in the LAP348
expressing cell line.
Inhibition might be most pronounced during transfection with plasmids, permitting the generation of virus in co-transfected 293LAP13
cells and might be sufficiently strong early in virus replication to account for
the enhanced replication evident in Figure 6. As a consequence the 293LAP13 cell line may be preferred over 293 cells for rescue of transgenes
even without incoφoration of the operator, though presence of the latter in
the expression cassette clearly results in the highest efficiency of virus
rescue and growth.
It is to be understood that the description, specific examples, data, tables and figures, while indicating exemplary embodiments, are given by
way of illustration and are not intended to limit the invention in any manner. Various changes and modifications within the present invention *
will become apparent to the skilled person from the disclosure contained
herein, and thus are considered part of the invention.

Claims

WHAT IS CLAIMED IS:
1. A eukaryotic cell capable of replicating a recombinant
expression vector that produces a heterologous protein, wherein the cell
comprises a polynucleotide encoding a repressor protein that is capable of
repressing production of the heterologous protein.
2. The cell according to claim 1, wherein the cell is a mammalian cell.
3. The cell according to claim 1, wherein the vector is an adenovirus.
4. The cell according to claim 1 , wherein the cell produces the protein
encoded by an El region.
5. The cell according to claim 4, wherein the vector is a defective
adenovirus.
6. The cell according to claim 5, wherein the adenovirus has a
functionally disrupted El region.
7. The cell according to claim 5, wherein the cell is derived from 293
cells.
8. The cell according to claim 7, wherein the polynucleotide encodes a *
lac repressor.
9. The cell according to claim 7, wherein the polynucleotide encodes a
lac repressor derivative.
10. The cell according to claim 9, wherein the polynucleotide includes a
portion of plasmid pHMCVLAP348.
11. Cell line 293Lapl0 (ATCC Accession No. CRL- 12586).
12. Cell line 293Lapl3 (ATCC Accession No. CRL- 12587).
13. A recombinant adenovirus comprising (i) a first polynucleotide
sequence encoding a heterologous protein and (ii) a second polynucleotide
sequence operably linked to the first polynucleotide in order to permit
repression of the expression of the first polynucleotide.
14. The recombinant adenovirus of claim 13, wherein the second
polynucleotide sequence is an operator that can be bound by a repressor.
15. The recombinant adenovirus of claim 13, wherein the adenovirus has
a functionally disrupted El region.
16. The recombinant adenovirus of claim 14, wherein the second * polynucleotide sequence is a lac operator sequence.
17. The recombinant adenovirus of claim 13, wherein the heterologous
protein product is rabies glycoprotein G.
18. The recombinant adenovirus of claim 13, wherein the adenovirus
comprises an intron sequence.
19. A eukaryotic cell capable of replicating a recombinant expression
vector that produces a heterologous protein, wherein the cell comprises a
polynucleotide encoding a repressor protein that is capable of repressing
production of the heterologous protein, and wherein the cell is transfected
with or infected by a recombinant adenovirus comprising (i) a first
polynucleotide sequence encoding a heterologous protein product and (ii) a
second polynucleotide sequence operably linked to the first polynucleotide
in order to permit repression of the expression of the first polynucleotide.
20. The cell of claim 19, wherein the second polynucleotide sequence is
an operator that can be bound by a repressor.
21. The cell of claim 19, wherein the adenovirus has a functionally
disrupted El region.
22. The cell of claim 19, wherein the second polynucleotide sequence is ΓÇ₧
a lac operator sequence.
23. The cell of claim 19, wherein the heterologous protein product is
rabies glycoprotein G.
24. A method of propagating an adenovirus vector encoding a
heterologous protein, comprising
transfecting or infecting eukaryotic cell with a recombinant
adenovirus comprising (i) a first polynucleotide sequence encoding a
heterologous protein and (ii) a second polynucleotide sequence operably
linked to the first polynucleotide in order to permit repression of the
expression of the first polynucleotide, wherein the eukaryotic cell comprises
a polynucleotide encoding a repressor protein that is capable of repressing
production of the heterologous protein.
harvesting recombinant adenovirus propagated in the eukaryotic
cells
25. The method of claim 24, wherein the adenovirus has a functionally
disrupted El region.
26. The method of claim 24, wherein the second polynucleotide
sequence is a lac operator sequence.
27. The method of claim 24, wherein the heterologous protein product is *
rabies glycoprotein G.
PCT/IB1999/001349 1998-07-30 1999-07-30 Repressor proteins producing cell lines for the propagation of vectors Ceased WO2000006751A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU49241/99A AU4924199A (en) 1998-07-30 1999-07-30 Repressor proteins producing cell lines for the propagation of vectors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US9468198P 1998-07-30 1998-07-30
US60/094,681 1998-07-30
US22382098A 1998-12-31 1998-12-31
US09/223,820 1998-12-31

Publications (2)

Publication Number Publication Date
WO2000006751A2 true WO2000006751A2 (en) 2000-02-10
WO2000006751A3 WO2000006751A3 (en) 2000-05-04

Family

ID=26789139

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB1999/001349 Ceased WO2000006751A2 (en) 1998-07-30 1999-07-30 Repressor proteins producing cell lines for the propagation of vectors

Country Status (2)

Country Link
AU (1) AU4924199A (en)
WO (1) WO2000006751A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007134325A3 (en) * 2006-05-15 2008-04-03 Introgen Therapeutics Inc Methods and compositions for protein production using adenoviral vectors
WO2015092440A1 (en) * 2013-12-20 2015-06-25 Oxford Biomedica (Uk) Limited Viral vector production system
US11485957B2 (en) * 2017-10-10 2022-11-01 Nantbio, Inc. Modified EC7 cells having low toxicity to viral production payloads
JP2023504593A (en) * 2019-11-12 2023-02-06 オックスフォード バイオメディカ(ユーケー)リミテッド Production system
WO2025153852A1 (en) * 2024-01-17 2025-07-24 1. Revvity Gene Delivery Gmbh Production of viral vectors

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7081896A (en) * 1995-10-05 1997-04-28 Microbix Biosystems Inc. Rabies recombinant adenovirus
US5972650A (en) * 1997-06-26 1999-10-26 Brigham And Women's Hospital Tetracycline repressor regulated mammalian cell transcription and viral replication switch

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007134325A3 (en) * 2006-05-15 2008-04-03 Introgen Therapeutics Inc Methods and compositions for protein production using adenoviral vectors
JP7340471B6 (en) 2013-12-20 2024-02-26 オックスフォード バイオメディカ(ユーケー)リミテッド Viral vector production system
JP7340471B2 (en) 2013-12-20 2023-09-07 オックスフォード バイオメディカ(ユーケー)リミテッド Viral vector production system
JP2017500870A (en) * 2013-12-20 2017-01-12 オックスフォード バイオメディカ(ユーケー)リミテッド Viral vector production system
US10544429B2 (en) 2013-12-20 2020-01-28 Oxford Biomedica (Uk) Limited Viral vector production system
EP3650548A1 (en) * 2013-12-20 2020-05-13 Oxford BioMedica (UK) Limited Viral vector production system
JP2020096609A (en) * 2013-12-20 2020-06-25 オックスフォード バイオメディカ(ユーケー)リミテッド Virus vector production system
CN106029891A (en) * 2013-12-20 2016-10-12 牛津生物医学(英国)有限公司 Viral vector production system
WO2015092440A1 (en) * 2013-12-20 2015-06-25 Oxford Biomedica (Uk) Limited Viral vector production system
JP2022091989A (en) * 2013-12-20 2022-06-21 オックスフォード バイオメディカ(ユーケー)リミテッド Viral vector production system
US11485957B2 (en) * 2017-10-10 2022-11-01 Nantbio, Inc. Modified EC7 cells having low toxicity to viral production payloads
JP2022180439A (en) * 2017-10-10 2022-12-06 ナントバイオ,インコーポレイテッド Modified ec7 cells having low toxicity to viral production payloads
AU2021261881B2 (en) * 2017-10-10 2024-09-26 Nantbio, Inc. Modified EC7 cells having low toxicity to viral production payloads
JP2023504593A (en) * 2019-11-12 2023-02-06 オックスフォード バイオメディカ(ユーケー)リミテッド Production system
JP7759318B2 (en) 2019-11-12 2025-10-23 オックスフォード バイオメディカ(ユーケー)リミテッド Production System
WO2025153852A1 (en) * 2024-01-17 2025-07-24 1. Revvity Gene Delivery Gmbh Production of viral vectors

Also Published As

Publication number Publication date
AU4924199A (en) 2000-02-21
WO2000006751A3 (en) 2000-05-04

Similar Documents

Publication Publication Date Title
Cai et al. Linker-insertion nonsense and restriction-site deletion mutations of the gB glycoprotein gene of herpes simplex virus type 1
EP1226264B1 (en) Cell lines and constructs useful in production of e1-deleted adenoviruses in absence of replication competent adenovirus
US5643579A (en) Oral vaccines
Redwood et al. Use of a murine cytomegalovirus K181-derived bacterial artificial chromosome as a vaccine vector for immunocontraception
RU2219241C2 (en) Defective recombinant adenoviral vector (variants)
US7025967B2 (en) Recombinant protein production in bovine adenovirus expression vector system
US20100008947A1 (en) Porcine adenovirus e1 and e4 regions
US20090274724A1 (en) Novel recombinant and mutant adenoviruses
WO2011130749A2 (en) Identification of mutations in herpes simplex virus envelope glycoproteins that enable or enhance vector retargeting to novel non-hsv receptors
Matthews et al. Development and use of a 293 cell line expressing lac repressor for the rescue of recombinant adenoviruses expressing high levels of rabies virus glycoprotein
USRE40930E1 (en) Porcine adenovirus type 3 genome
AU2002363489A1 (en) Porcine adenovirus E1 and E4 regions
CA2294649C (en) Bovine adenovirus type 3 genome
Jani et al. Generation, validation, and large scale production of adenoviral recombinants with large size inserts such as a 6.3 kb human dystrophin cDNA
Tan et al. Coexpression of double or triple copies of the rabies virus glycoprotein gene using a ‘self-cleaving’2A peptide-based replication-defective human adenovirus serotype 5 vector
AU780822B2 (en) Bovine cells expressing adenovirus essential functions for propagation of recombinant adenoviral vectors
Jelinek et al. Recombinant human adenoviruses containing hybrid adenovirus type 5 (Ad5)/Ad12 E1A genes: characterization of hybrid E1A proteins and analysis of transforming activity and host range
Baxi et al. Mutational analysis of early region 4 of bovine adenovirus type 3
CA2254444A1 (en) Cell line for producing repressor proteins
Tosoni-Pittoni et al. Complete characterization of the gene coding for the Epstein-Barr virus major membrane antigen gp 220340 and selective expression of a secreted form of gp 220
AU2002313129B2 (en) Bovine adenovirus type 3 genome
WO2000061773A1 (en) Recombinant and mutant adenoviruses derived of bovine adenovirus type 1
AU2004200229A1 (en) Porcine adenovirus type 3 genome
Dobric Permissivity of human HeLa cells to bovine adenovirus type 2 (BaV2 infection
HK1140790A (en) Porcine adenovirus type 3 genome

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase