WO2000006748A2 - Crystallizable farnesyl protein transferase compositions, crystals thereby obtained and methods for use - Google Patents

Abstract

The present invention relates to crystalline compositions comprising farnesyl protein transferase-like polypeptides in complex with substrates and inhibitors. Also disclosed are crystallization conditions for these compositions and their use for structural determination of FPT:FPP/FPP analog: peptide/inhibitor complexes.

Description

CRYSTALLIZABLE FARNESYL PROTEIN TRANSFERASE COMPOSITIONS- CRYSTALS THEREBY OBTAINED AND METHODS FOR USE

This application claims priority from United States Application Serial No. 09/126,163, filed July 30, 1998.

TECHNICAL FIELD OF INVENTION

The present invention relates to crystalline farnesyl protein transferase (FPT) and FPT in complex with substrates or inhibitors. This invention also relates to methods of using the structure coordinates of FPT to solve the structure of similar or homologous proteins or protein substrate or inhibitor complexes.

BACKGROUND OF THE INVENTION

The biological significance of the Ras oncogene, and the role of both Ras and the enzyme known as farnesyl protein transferase ("FPT") in the conversion of normal cells to cancer cells, are described in PCT International Publication Nos. WO95/00497 and WO95/10516. To undergo transforming potential, the precursor of the Ras oncoprotein must undergo farnesylation of the cysteine residue located in a carboxyl-terminal tetrapeptide. Farnesyl protein transferase catalyzes this modification. Inhibitors of this enzyme have therefore been suggested as anticancer agents for tumors in which RAS contributes to transformation.

Drug discovery efforts directed toward FPT inhibitors have been hampered by the lack of adequate structural information about FPT and its complex with substrates and inhibitors. The structure of FPT was first determined at Duke University using a crystalline form where the active site was blocked by the carboxy terminus of an adjacent molecule in the crystalline lattice. Beese et ah, 1997, Science 275:1800-1804. These crystals are not suited for drug discovery because, as reported therein, the active site is blocked by part of the crystal lattice. Another crystalline form of FPT was also reported in Dunten et al., 1998, Biochemistry 37(22):7907-7912. These crystals grow at pH 4.4 and are reported to only diffract to 2.8 A resolution. However, the authors point out that there are no substrates or peptide inhibitors bound due to the low pH of the crystallization. Thus these crystals are not suitable for structure-based drug design.

Structural information from FPT crystalline complexes would provide valuable information in discovery of FPT inhibitors. This information could be used to design more potent, selective and metabolically stable FPT inhibitors for use as drugs against cancer.

SUMMARY OF THE INVENTION

Applicants have solved this problem by providing, for the first time, a crystallizable composition comprising a farnesyl protein transferase (FPT) complexed with molecules that mimic its natural substrates. The invention also provides crystals of FPT complexed with FPP or an FPP analog and a peptide or an inhibitor. (These complexes are referred to throughout as FPT:FPP/FPP analog:Peptide/ Inhibitor complexes.) The invention also provides the structure coordinates of these complexes. Further provided are methods and reagents for soaking these crystalline complexes in the presence of an inhibitor, thereby efficiently forming a crystalline enzyme: inhibitor complex.

The invention also provides a method for determining at least a portion of the three-dimensional structure of molecules or molecular complexes which contain at least some structurally similar features to an FPT: substrate or FPT: inhibitor complex.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 depicts stereo ribbon diagrams of an FPT:αHFP:Ac-CVIM-COOH complex. The view is into the active site cavity of the enzyme.

Figure 2 lists the atomic structure coordinates for FPT in complex with ccHFP and CVIM as derived by X-ray diffraction from crystals of that complex. The following abbreviations are used in Figure 2.

"RES" refers to the amino acid, FPP, FPP analog, peptide or inhibitor that the atom belongs to. "Atom" refers to the element whose coordinates have been determined. Elements are defined by the first letter in the column except for zinc which is defined by the letters "ZIN", bromine which is defined by the letters "BR" and chlorine which is defined by the letters "CL".

"X, Y, Z" is the crystallographically determined atomic position determined for each atom.

"B" is a thermal factor that measures movement of the atom around its atomic center.

"C" refers to the part of the complex the atom belongs to. A = alpha subunit of FPT. B = beta subunit of FPT. Z = zinc atom. F = FPP, H = αHFP, I = FPT inhibitor; W = ordered solvent molecules, P = CVIM peptide.

Figure 3 lists the atomic structure coordinates for FPT in complex with FPP and the inhibitor SCH61180 as derived by X-ray diffraction from crystals of that complex. The abbreviations are the same that are used in Figure 2.

Figure 4 lists the atomic structure coordinates for FPT in complex with FPP and the inhibitor SCH44342 as derived by X-ray diffraction from crystals of that complex. The abbreviations are the same that are used in Figure 2.

Figure 5 shows a diagram of a system used to carry out the instructions encoded by the storage medium of Figure 7 and 8.

Figure 6 shows a cross section of a magnetic storage medium.

Figure 7 shows a cross section of a optically-readable data storage medium.

DETAILED DESCRIPTION OF THE INVENTION

FPT-mediated prenylation of Ras involves formation of a ternary complex comprising farnesyl protein transferase (FPT), farnesyl diphosphate (FPP) and Ras (FPT:FPP:Ras), followed by transfer of the 15-carbon isoprenoid from FPP to a cysteine sidechain of Ras. The cysteine residue is part of a conserved carboxyl terminal Ca-a₂X sequence where X is a serine residue in H-Ras and methionine in N-Ras, K-Ras 4a, and K-Ras 4b isoforms. Applicants have for the first time discovered a crystalline form of farnesyl protein transferase (FPT) ideally suited for efficient structure-based drug design. This pre-formed protein crystal can be soaked in the presence of an inhibitor, thereby forming a protein/ compound complex and obviating the need to crystallize each individual protein/compound complex. The pre-formed crystals of FPT are grown by first complexing FPT with molecules that mimic the natural substrates. FPT is complexed with an FPP analog and a tetrapeptide substrate based on the carboxy terminus of Ras referred to herein as a Ca^X peptide. In preferred embodiments, the FPP analog used is α-hydroxyphosphonic acid

(αHFP) (Calbiochem-Novabiochem Corp.), and the Ca_αa₂X peptide is N-acetyl- Cys-Val-Ile-Met-COOH (CVIM) (SynPep Inc.).

Those skilled in the art will understand, of course, that other FPP analogs and other Ca_αa₂X peptides may be used in complexes of the invention. For example, methylene-farnesyl diphosphate [Davisson et al., 1986, /. Org. Chem.

51:4768-4779] can also be used in place of αHFP as an FPP analog, however any analog of FPP could be used. Likewise, many other Ca^X peptides may be used. In preferred embodiments, X is serine, methionine, cysteine, alanine or glutamine. See Reiss et al, 1991, PNAS 88:732-36. A variety of both natural and unnatural amino acids can be accommodated at the a_α position without loss of activity. Peptides having small apolar residues at a₂ are also good substrates, while those with aromatic sidechains at this position competitively inhibit binding of peptide substrates. Goldstein et al, }. Biol Chem 266:15575-15578. In more preferred embodiments, the Ca_αa₂X peptide is Ac-CVLS-COOH (SynPep Inc.), Ac-CVIM(Se)-COOH (AnaSpec Inc.), or Ac-CVIM-COOH (SynPep Inc.).

According to one embodiment of the invention, an FPT:αHFP:CVIM complex is crystallized from a well-defined solution. A solution for stabilizing the crystals (artificial mother liquor) has been discovered. To obtain the structure of FPT inhibitors complexed with FPT, the crystals of FPT:αHFP:CVIM are soaked in solutions of artificial mother liquor containing inhibitor and farnesyl diphosphate (FPP). The crystalline nature of FPT is retained during this procedure, only the molecules bound to the active site are altered.

The crystals of the FPT:FPP:inhibitor complex diffract to greater than 2.5A resolution. At this resolution, most atoms of the FPT:FPP:inhibitor complex can be visualized using x-ray crystallographic methods. The ability to form the FPT:FPP:inhibitor complexes in the crystalline state allows very rapid turnaround of structural information. A supply of the crystals of

FPT:αHFP:CVIM crystals is maintained. The inhibitor exchange process takes approximately 24 hours and on completion, x-ray data can be collected. On completion of data collection, determination of the structure takes about one day. Overall, following discovery of a new inhibitor, the structure of its complex with FPT can be obtained in 2-3 days. In contrast, 1 - 2 months are required to grow suitable crystals by forming the FPT:FPP:inhibitor complex in solution, followed by crystallization of the ternary complex.

The crystals of the FPT: αHFP:CVIM are grown using a novel form of FPT specifically engineered for crystallization. Thus, the invention further provides FPT constructs having the carboxy terminus truncated at various points. The terms "FPT-like polypeptide" and "FPT" are used interchangeably herein to include each of these novel forms. In preferred embodiments, at least 5 C- terminal amino acids are deleted. More preferably, from 5 to 20 C-terminal residues are deleted. Most preferably 5, 10 or 14 residues are deleted. In one preferred embodiment, a form having 10 residues removed was expressed in E. coli, purified and successfully used to grow crystals. X-ray diffraction data collected from these crystals can be analyzed and used to visualize the binding of FPT inhibitors of many structural classes.

The present invention provides the three-dimensional structure of (1) an

FPT:αHFP:CVIM peptide complex at 2.4 A resolution, (2) an FPT:FPP:SCH61180 complex at 2.3 A resolution, (3) an FPT:FPP:SCH44342 complex at 2.1 A resolution, and (4) an FPT:FPP:SCH220118 complex at 2.3 A resolution. Importantly, the crystalline structures of the present invention provide, for the first time, information about the shape and structure of the FPT active site containing both an isoprenoid and a peptide or inhibitor.

The three-dimensional structures of three FPT complexes of this invention are defined by a set of structure coordinates as set forth in Figures 2-4. The term "structure coordinates" refers to Cartesian coordinates derived from mathematical equations related to the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centers) of FPT:FPP/FPP analog:Peptide/ Inhibitor complexes in crystal form. The diffraction data are used to calculate an electron density map of the repeating unit of the crystal. The electron density maps are then used to establish the positions of the individual atoms of the FPT:FPP/FPP analog:Peptide/Inhibitor complexes.

Those of skill in the art will understand that a set of structure coordinates for an enzyme or an enzyme-complex or a portion thereof, is a relative set of points that define a shape in three dimensions. Thus, it is possible that an entirely different set of coordinates could define a similar or identical shape. Moreover, slight variations in the individual coordinates will have little effect on overall shape.

The variations in coordinates discussed above may be generated because of mathematical manipulations of the structure coordinates. For example, the structure coordinates set forth in Figures 2-4 could be manipulated by crystallographic permutations of the structure coordinates, fractionalization of the structure coordinates, rotation of the structure coordinates, integer additions or subtractions to sets of the structure coordinates, inversion of the structure coordinates or any combination of the above.

Alternatively, modifications in the crystal structure due to mutations, additions, substitutions, and /or deletions of amino acids, or other changes in any of the components that make up the crystal could also account for variations in structure coordinates. If such variations are within an acceptable standard error as compared to the original coordinates, the resulting three-dimensional shape is considered to be the same. Various computational analyses are therefore necessary to determine whether a molecule or molecular complex or a portion thereof is sufficiently similar to all or parts of the FPT enzyme or enzyme complex as described above as to be considered the same. Such analyses may be performed using automated or manual tools in current software applications, such as those sold by Molecular Simulations Incorporated, and referred to as INSIGHT or QUANTA.

The Molecular Similarity application (Molecular Simulations Incorporated) permits comparisons between different structures, different conformations of the same structure, and different parts of the same structure. The procedure used in Molecular Similarity to compare structures is divided into four steps: 1) load the structures to be compared; 2) define the atom equivalencies in these structures; 3) perform a fitting operation; and 4) analyze the results.

Each structure is identified by a name. One structure is identified as the target (i.e., the fixed structure); all remaining structures are working structures (i.e., moving structures). Since atom equivalency within QUANTA is defined by user input, for the purpose of this invention we will define equivalent atoms as protein backbone atoms (N, Ca, C and O) for all conserved residues between the two structures being compared. We will also consider only rigid fitting operations.

When a rigid fitting method is used, the working structure is translated and rotated to obtain an optimum fit with the target structure. The fitting operation uses an algorithm that computes the optimum translation and rotation to be applied to the moving structure, such that the root mean square difference of the fit over the specified pairs of equivalent atom is an absolute minimum. This number, given in angstroms, is reported by QUANTA.

For the purpose of this invention, any molecule or molecular complex that has a root mean square deviation of conserved residue backbone atoms (N, Ca, C, O) of less than 2.5 A when superimposed on the relevant backbone atoms described by structure coordinates listed in any one of Figures 2-4 are considered identical. More preferably, the root mean square deviation is less than 1.0 A. The term "root mean square deviation" means the square root of the arithmetic mean of the squares of the deviations from the mean. It is a way to express the deviation or variation from a trend or object. For purposes of this invention, the "root mean square deviation" defines the variation in the backbone of a protein or protein complex from the relevant portion of the backbone of the FPT-like polypeptide portion of the complex as defined by the structure coordinates described herein.

Once the structure coordinates of a protein crystal have been determined they are useful in solving the structures of other crystals.

Thus, in accordance with the present invention, the structure coordinates of an FPT: FPP/ FPP analog: Ca^X peptide/Inhibitor complex, and in particular an FPT:αHFP:CVIM complex, and portions thereof are stored in a machine- readable storage medium. Such data may be used for a variety of purposes, such as drug discovery and X-ray crystallographic analysis of protein crystals.

Accordingly, in one embodiment of this invention is provided a machine- readable data storage medium comprising a data storage material encoded with the structure coordinates set forth in Figure 2, 3 or 4.

Figure 5 demonstrates one version of these embodiments. System 10 includes a computer 11 comprising a central processing unit ("CPU") 20, a working memory 22 which may be, e.g. RAM (random-access memory) or "core" memory, mass storage memory 24 (such as one or more disk drives or CD-ROM drives), one or more cathode-ray tube ("CRT") display terminals 26, one or more keyboards 28, one or more input lines 30, and one or more output lines 40, all of which are interconnected by a conventional bi-directional system bus 50.

Input hardware 36, coupled to computer 11 by input lines 30, may be implemented in a variety of ways. Machine-readable data of this invention may be inputted via the use of a modem or modems 32 connected by a telephone line or dedicated data line 34. Alternatively or additionally, the input hardware 36 may comprise CD-ROM drives or disk drives 24. In conjunction with display terminal 26, keyboard 28 may also be used as an input device. Output hardware 46, coupled to computer 11 by output lines 40, may similarly be implemented by conventional devices. By way of example, output hardware 46 may include CRT display terminal 26 for displaying a graphical representation of a binding pocket of this invention using a program such as INSIGHT as described herein. Output hardware might also include a printer 42, so that hard copy output may be produced, or a disk drive 24, to store system output for later use.

In operation, CPU 20 coordinates the use of the various input and output devices 36, 46, coordinates data accesses from mass storage 24 and accesses to and from working memory 22, and determines the sequence of data processing steps. A number of programs may be used to process the machine-readable data of this invention. Such programs are discussed in reference to the computational methods of drug discovery as described herein. Specific references to components of hardware system 10 are included as appropriate throughout the following description of the data storage medium.

Figure 6 shows a cross section of a magnetic data storage medium 100 which can be encoded with a machine-readable data that can be carried out by a system such as system 10 of Figure 5. Medium 100 can be a conventional floppy diskette or hard disk, having a suitable substrate 101, which may be conventional, and a suitable coating 102, which may be conventional, on one or both sides, containing magnetic domains (not visible) whose polarity or orientation can be altered magnetically. Medium 100 may also have an opening (not shown) for receiving the spindle of a disk drive or other data storage device 24.

The magnetic domains of coating 102 of medium 100 are polarized or oriented so as to encode in manner which may be conventional, machine readable data such as that described herein, for execution by a system such as system 10 of Figure 5.

Figure 7 shows a cross section of an optically-readable data storage medium 110 which also can be encoded with such a machine-readable data, or set of instructions, which can be carried out by a system such as system 10 of Figure 5. Medium 110 can be a conventional compact disk read only memory (CD-ROM) or a rewritable medium such as a magneto-optical disk which is optically readable and magneto-optically writable. Medium 100 preferably has a suitable coating 112, which may be conventional, usually of one side of substrate 111.

In the case of CD-ROM, as is well known, coating 112 is reflective and is impressed with a plurality of pits 113 to encode the machine-readable data. The arrangement of pits is read by reflecting laser light off the surface of coating 112. A protective coating 114, which preferably is substantially transparent, is provided on top of coating 112.

In the case of a magneto-optical disk, as is well known, coating 112 has no pits 113, but has a plurality of magnetic domains whose polarity or orientation can be changed magnetically when heated above a certain temperature, as by a laser (not shown). The orientation of the domains can be read by measuring the polarization of laser light reflected from coating 112. The arrangement of the domains encodes the data as described above.

For the first time, the present invention permits the use of structure-based or rational drug design techniques to design, select, and synthesize chemical entities, including inhibitory compounds that are capable of binding to the active site of FPT, or any portion thereof.

One particularly useful drug design technique enabled by this invention is iterative drug design. Iterative drug design is a method for optimizing associations between a protein and a compound by determining and evaluating the three-dimensional structures of successive sets of FPT:FPP or FPP analog:Peptide or Inhibitor complexes.

Those of skill in the art will realize that association of natural ligands or substrates with the binding pockets of their corresponding receptors or enzymes is the basis of many biological mechanisms of action. The term "binding pocket," as used herein, refers to a region of a molecule or molecular complex, that, as a result of its shape, favorably associates with another chemical entity or compound. Similarly, many drugs exert their biological effects through association with the binding pockets of receptors and enzymes. Such associations may occur with all or any parts of the binding pockets. An understanding of such associations will help lead to the design of drugs having more favorable associations with their target receptor or enzyme, and thus, improved biological effects. Therefore, this information is valuable in designing potential ligands or inhibitors of receptors or enzymes, such as inhibitors of FPT.

The term "associating with" refers to a condition of proximity between chemical entities or compounds, or portions thereof. The association may be non-covalent — wherein the juxtaposition is energetically favored by exclusively or a combination of hydrogen bonding or van der Waals and/or electrostatic interactions — or it may be covalent.

In iterative drug design, crystals of a series of protein /compound complexes are obtained and then the three-dimensional structure of each complex is solved. Such an approach provides insight into the association between the proteins and compounds of each complex. This is accomplished by selecting compounds with inhibitory activity, obtaining crystals of this new protein/compound complex, solving the three-dimensional structure of the complex, and comparing the associations between the new protein/ compound complex and previously solved protein /compound complexes. By observing how changes in the compound affected the protein /compound associations, these associations may be optimized.

In some cases, iterative drug design is carried out by forming successive protein-compound complexes and then crystallizing each new complex. Alternatively, a pre-formed protein crystal is soaked in the presence of an inhibitor, thereby forming a protein/ compound complex and obviating the need to crystallize each individual protein /compound complex. Advantageously, the FPT:FPP/FPP analog:Peptide/ Inhibitor complex crystals, and in particular the

FPT:αHFP:CVIM crystals, provided by this invention may be soaked in the presence of a compound or compounds, to provide FPT:FPP:inhibitor crystal complexes.

As used herein, the term "soaked" refers to a process in which the crystal is transferred to a solution containing the compound of interest. The structure coordinates set forth in Figures 2-4 can also be used to aid in obtaining structural information about another crystallized molecule or molecular complex. This may be achieved by any of a number of well-known techniques, including molecular replacement.

The structure coordinates set forth in Figures 2-4 can also be used for determining at least a portion of the three-dimensional structure of molecules or molecular complexes which contain at least some structurally similar features to FPT. In particular, structural information about another crystallized molecule or molecular complex may be obtained. This may be achieved by any of a number of well-known techniques, including molecular replacement.

Therefore, in another embodiment this invention provides a method of utilizing molecular replacement to obtain structural information about a crystallized molecule or molecular complex whose structure is unknown comprising the steps of: a) generating an X-ray diffraction pattern from said crystallized molecule or molecular complex; and b) applying at least a portion of the structure coordinates set forth in any one of Figures 2-4 to the X-ray diffraction pattern to generate a three- dimensional electron density map of the molecule or molecular complex whose structure is unknown.

Preferably, the crystallized molecule or molecular complex comprises a FPT:FPP/ FPP analog:Peptide/ Inhibitor complex. More preferably, the crystallized molecule or molecular complex is obtained by soaking a crystal of this invention in a solution.

By using molecular replacement, all or part of the structure coordinates of the FPT:FPP/FPP analog:Peptide/Inhibitor complexes provided by this invention (and set forth in Figure 3) can be used to determine the structure of a crystallized molecule or molecular complex whose structure is unknown more quickly and efficiently than attempting to determine such information ab initio.

Molecular replacement provides an accurate estimation of the phases for an unknown structure. Phases are a factor in equations used to solve crystal structures that can not be determined directly. Obtaining accurate values for the phases, by methods other than molecular replacement, is a time-consuming process that involves iterative cycles of approximations and refinements and greatly hinders the solution of crystal structures. However, when the crystal structure of a protein containing at least a homologous portion has been solved, the phases from the known structure provide a satisfactory estimate of the phases for the unknown structure.

Thus, this method involves generating a preliminary model of a molecule or molecular complex whose structure coordinates are unknown, by orienting and positioning the relevant portion of the complex according to any one of Figures 2-4 within the unit cell of the crystal of the unknown molecule or molecular complex so as best to account for the observed X-ray diffraction pattern of the crystal of the molecule or molecular complex whose structure is unknown. Phases can then be calculated from this model and combined with the observed X-ray diffraction pattern amplitudes to generate an electron density map of the structure whose coordinates are unknown. This, in turn, can be subjected to any well-known model building and structure refinement techniques to provide a final, accurate structure of the unknown crystallized molecule or molecular complex (E. Lattman, "Use of the Rotation and Translation Functions," in Meth. Enzymol.. 115, pp. 55-77 (1985); M. G. Rossmann, ed., "The Molecular Replacement Method," Int. Sci. Rev. Ser., No. 13, Gordon & Breach, New York (1972).

The structure of any portion of any crystallized molecule or molecular complex that is sufficiently homologous to any portion of the FPT:FPP/FPP analog:Peptide /Inhibitor complex can be solved by this method.

In a preferred embodiment, the method of molecular replacement is utilized to obtain structural information about a molecule or molecular complex, wherein the complex comprises an FPT:FPP/FPP analog:Peptide /Inhibitor complex.

The structure coordinates provided by this invention are particularly useful to solve the structure of crystals of FPT:FPP/FPP analog:Peptide /Inhibitor complexes, particularly FPT:FPP, co-complexed with a variety of chemical entities. This approach enables the determination of the optimal sites for interaction between chemical entities, including interaction of candidate FPT inhibitors with FPT or the FPT:FPP complex. For example, high resolution X-ray diffraction data collected from crystals exposed to different types of solvent allows the determination of where each type of solvent molecule resides. Small molecules that bind tightly to those sites can then be designed and synthesized and tested for their FPT inhibition activity.

All of the complexes referred to above may be studied using well-known X-ray diffraction techniques and may be refined versus 1.5-3 A resolution X-ray data to an R value of about 0.25 or less using computer software, such as XPLOR

[Yale University, ©1992; see, e.g., Blundell & Johnson, supra: Meth. Enzymol., vol. 114 and 115, H. W. Wyckoff et al, eds., Academic Press (1985)]. This information may thus be used to optimize known FPT inhibitors, and more importantly, to design new FPT inhibitors.

In order that this invention be more fully understood, the following examples are set forth. These examples are for the illustrative purposes only and are not to be construed as limiting the scope of this invention in any way.

EXAMPLE 1

Expression and Purification of FPT in E. Coli For Analog Complexes

Preparation of E. coli FPT Expression Constructs. The nucleotide sequence for the alpha and beta genes of rat FPT were obtained from two different plasmids deposited with the American Type Culture Collection (ATCC). ATCC

Number 63134 contains the α-subunit, and ATCC Number 63127 contains the β- subunit. These genes were inserted recombinantly into two pUC18 plasmids (pUClδratα, pUC18ratβ). Two plasmids suitable for expression of the His-tagged FPT (FPT(+His)) were constructed in T7-promoter based pET (Novagen) vectors with genes encoding two FPT subunits in the order of β-α (pZWFOl) or α-β (pZWF02) as shown in Table 1. Table 1. The inserted DNA sequence of the rat FTP two-cistron expression constructs

Plasrrid Inserted DNA sequence

pZWFOl CAT ATG ^{■ ■} • β ^■ • ^■ TGΛ ΛTTC AAG AA GGA G ATATACC ATG ^{■ ■ ■} _α- ^{■ ■} TA AGCTT GGΛTCC ■^*

Ndel EcoRΪ SD BamΑ pZWF02 CAT ATG - • • _n- ^{■ ■} TGΛ ΛTTC AAG AA GGA G ATATACC ATG ^• • • -β- • ^• TΛAGCTT Ndel EcoRl SD Hin dill

* (SEQ ID NO: 12) **(SEQ ID NO: 13)

All subcloning was performed in E. coli DH5α, while production of protein was carried out in E. coli BL21(DE3). Construction of plasmid pZWFOl was started with PCR reactions to obtain DNA fragments that encode the α and β- subunits, respectively. A pair of primers were designed to isolate the coding region of the β subunit from pUC18-ratβ. The starter F-1 had a unique Ndel site (underlined) incorporated 5' to the initiation codon (bold-faced):

(5'-GATTATTCCATATG GCTTCTTCGAGT TCCTTCACCTATTAT-3') (SEQ ID NO: l), and the end primer F-2 (antiparallel sequence) included a unique EcoRl site (underlined) right after the stop codon (bold-faced):

(5'-CGGGATCCαAAJTCAGTCAGTGGCAGGATCTGAGGTCAC-3') (SEQ ID NO: 2) for DNA subcloning. Another set of primers were designed to amplify the coding region of the α-subunit from plasmid pUC18-ratα. The start primer F3 contained a unique EcoRl site (underlined), the bacteriophage T7 gene 10 ribosome binding site (rbs) and translational spacer element (italics), and the beginning codons of the α subunit open reading frame (ORF):

(5'- CGGAAJTCΛΛGΛAGGΛGATATΛCCATGGCGGCCACTGAGGGTGTC

GGTGAATCTGCG-3') (SEQ ID NO: 3). The end primer F-4 (antiparallel sequence) added a unique BamHl site (underlined) after the stop codon (bold-faced): (S'-CGGGATCCAAGCTTA TACACTCGCCGGTATGTCACT-3') (SEQ ID NO: 4).

The resulting PCR product from primers F1/F2 was digested with Ndel /EcoRl, and the PCR product from primers F3/F4 was digested with EcoRI/BamHI. These two DNA fragments were then three-way ligated into a Ndel/BamHl- digested pET15β vector. The new plasmid, pZWFOl, was transformed into the production strain E. coli BL21(DE3).

Plasmid pZWF02 was constructed in a similar way as pZWFOl. A pair of primers were designed to prepare the α subunit coding region:

(F5: 5'-GATTATTCCATATGGCGGCCACTGAGGGTGTCGGTGAATCTG- 3' (SEQ ID NO: 5);

F6: 5'-CGGGATCCGAATTCATACACT CGCCGGTATGTCACT-3') (SEQ ID

NO: 6). Another pair of primers was used to amplify the β subunit ORF:

(F7: 5'-CGGAATTCAAGAAGGAGAT

ATACCATGGCTTCTTCGAGTTCCTTCACCTATTAT-3' (SEQ ID NO: 7);

F8: 5'-CGGGATCCAA GCTTAGTCAGTGGCAGGATCTGAGGT CAC-3') (SEQ ID NO: 8).

The resulting PCR products were digested with appropriate restriction enzymes, and were ligated into a Ndel/H dlll-digested ρET28b vector. The new plasmid, pZWF02, was transformed into E. coli BL21(DE3) for production of FPT.

The DNA inserts in pZWFOl and pZWF02 were sequenced to ensure that no mutations occurred during the PCR and cloning procedures.

Construction of FPT β Subunit C-terminal Truncation Mutants. The β- subunit C-terminal truncation mutants were prepared in pZWF02 by replacing the full-length β-subunit ORF with a shorter DNA fragment encoding a truncated β- subunit ORF. A truncated ORF was synthesized by PCR reaction with start primer F7 and an end primer corresponding to a truncated C-terminal end. The antiparallel sequences of end primers are

5'-CGGGATCCAAGCTTATGAGGTCACCGCATCTTCGCATTC-3' (SEQ ID

NO: 9) for the Δ5 mutant,

5'-CGGGATCCAAGCTTATTCGCATTCCTCAAAGCCTGGGAC-3' (SEQ ID

NO: 10) for the Δ10 mutant, and

5'-CGGGATCCAAGCTTAAAAGCCTGGGACCGGCTTCTGCAG-3' (SEQ ID

NO. 11) for the Δ14 mutant. The resulting PCR product was double digested with EcoRl /Hindlll. Plasmid pZWF02 was double digested with EcoRl/Hindlll to remove the β-subunit ORF, and then ligated with the digested PCR product. The resulting plasmid, containing a shorter β-subunit ORF, was transformed into the production strain E. coli BL21(DE3). All three mutants were expressed in E. coli, and purified in the same way as the full-length FPT as described below. The inserted β- subunit DNA fragments were sequenced to confirm the C-terminal truncation.

Purification of His-tagged FPT from E. coli. Protein purification was conducted at 4 °C. At each stage of the purification, the eluted proteins were detected by absorbance at 280 nM, and the enzyme fractions were assayed as described below. Twelve liters of E. coli BL21(DE3) containing one of the plasmids encoding FPT (described above), were grown at 37 °C to an absorbance of 3 at 595 nm in Terrific Broth containing kanamycin (25 μg/ml). IPTG was added to a final concentration of 0.8 mM to induce FPT expression. Cells were grown for an additional 5 hrs post-induction, and were harvested by centrifugation at 10,000g for 10 min. The cell pellet was resuspended in 300 ml homogenization buffer containing 50 mM Tris, pH 7.5, 1 μg/ml E-64, 2 μg/ml aprotinin, 0.7 μg/ml pepstatin, 0.1 mM leupeptin, 1 mM Pefabloc^® SC and 2 mM β-mercaptoethanol (BME). The resuspended cells were disrupted by two passages through a French press at 16,000 psi. Cell debris was removed by ultracentrifugation at 100,000g for 1 hr. Supernatant was then loaded onto a Fast Flow Q-Sepharose column (5 x 10 cm). The column was washed with 1.2 liter of 20 mM Tris, pH 7.5, 100 mM NaCl and 5 mM BME, followed by a salt gradient of 100 to 600 mM NaCl. FPT activity eluted at about 300 mM NaCl. The FPT fractions were pooled, adjusted to 25 m M imidazole, and loaded onto a Ni-NTA chelating column (3 x 10 cm). The column was washed with 500 ml of 20 mM Tris, pH 7.5, 200 mM NaCl, 25 mM imidazole and 10 mM BME, followed by a gradient of 25 to 250 mM imidazole. FPT eluted at 100 mM imidazole. The active fractions were pooled and dialyzed three times against buffer containing 20 mM Tris, pH 7.7, 20 mM KCl, 10 mM ZnCl₂ and 1 mM DTT to remove the imidazole from the protein solution. The resulting protein solution was stored at -80 °C until use.

Western blotting during protein purification was carried out according to a standard protocol using a BCIP/NBT kit (Kirkegaard & Perry Laboratories, Gaithersburg, MD) with an anti-α subunit polyclonal antibody raised against two peptide sequences of FPT α-subunit and an anti-β-subunit polyclonal antibody obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The molecular weight of FPT was determined by MALDI mass spectroscopy with sinapinic acid as the matrix on a Voyager DE TOF mass spectrometer (PerSeptive Biosystem, Framingham, MA). FPT concentrations were determined either by using a Bio- Rad assay kit with bovine serum albumin (BSA) as a standard or using UV absorption at 280 nm with a molar extinction coefficient of 5.6 x IO⁴ M^{' "1}.

EXAMPLE 2

Co-Crystallization of Δ10 FPT:αHFP:Peptide Complexes

Purified Δ10 rat FPT, engineered for crystallization (Example 1), was dialyzed against 20 mM Tris pH 7.7, 1 mM DTT, 20 mM KCl, 10 μM ZnCl₂ and concentrated to 0.27 mM (25 mg/mL) and stored at -30°C prior to crystallization.

The CVIM:αHFP:FPT ternary complex was prepared by incubating 108 μM FPT (10 mg/ml) with 150 μM αHFP (Calbiochem-Novabiochem Corporation) for about 15 minutes prior to adding 150 μM Ac-Cys-Val-Ile-Met-COOH (AnaSpec Inc.). The ternary mixture was incubated at 4°C for approximately 4.0 hours. Vapor diffusion crystallization experiments were conducted using the hanging drop method. Crystals formed when the reservoir contained KCl and sodium acetate. Crystals most suitable for structure determination grew when the droplet contained 4 μl of the αHFP:CVIM:FPT complex and 4 μl of the reservoir solution (0.1 M KCl, 0.1 M sodium acetate, pH 5.0). Crystallization trays were incubated at 4°C and after 2-3 weeks, hexagonal rods (0.1 mm X 0.3 mm) appeared. Crystals have also be grown with the following combination of FPP analogs and Ca-a₂X peptides.

Many other combinations will also yield crystals.

EXAMPLE 3 Co-crystallization of Δ10 FPT: FPPTnhibitor Complexes

Cocrystals of Δ10 FPT:FPP:Inhibitor complexes were grown as described above by substituting FPP for αHFP and the inhibitor for the CVIM peptide. The following are examples of inhibitors that have been used to form FPT:FPP:Inhibitor co-crystals:

Many FPT inhibitors that are not listed will also be able to be used to form crystals.

EXAMPLE 4 Formation of Δ10 FPT: FPPTnhibitor Complexes by Soaking Preformed

Peptide Co-Crystals

The cocrystals of FPT with αHFP and the CVIM peptide described above were used to soak FPT inhibitors. Crystals were harvested into the reservoir solution at 4° C. For each new inhibitor, crystals measuring about 100 x 100 x 300 μm were transferred into reservoir solution supplemented with 10 μM ZnCl₂, 2 mM DTT, 100 μM FPP and 100 μM inhibitor. The complex was allowed to form for about 24 hours at 4°C. In the presence of FPP and inhibitors, the FPP analog and peptide are both displaced allowing structure determination of the inhibitor:FPP:FPT complex. The following inhibitors are examples of inhibitors that have been soaked according to this Example:

EXAMPLE 5 Formation of FPT: FPPTnhibitor Complexes by Soaking Preformed

Inhibitor Co-Crystals

The cocrystals of FPT with FPP and an FPT inhibitor SCH32227 described above can be used to soak FPT inhibitors. Crystals are harvested into the reservoir solution at 4° C. For each new inhibitor, crystals measuring about 100 x 100 x 300 μm are transfered into reservoir solution supplemented with 10 μM ZnCl₂, 2 mM DTT, 100 μM FPP and 100 μM inhibitor. The complex is allowed to form for about 24 hours at 4°C. In the presence of FPP and inhibitors, the inhibitor is displaced allowing structure determination of the new inhibitor:FPP:FPT complex EXAMPLE 6 Data Collection

X-ray diffraction data were collected on FPT complexes formed by co- crystallization and soaking of preformed crystals. Prior to data collection, crystals were taken from the crystallization droplet or soaking solution and flash frozen in liquid propane using a cryoprotectant consisting of 0.1 M KCl, 0.1 M sodium actetate (pH 5.0) and 40% (v/v) glycerol. Crystals belong to space group P6_r The unit cell parameters vary less than 2% between crystals and are approximately a = b = 171.5 A, c = 69.2 A, α = β = 90°, γ = 120°. Most of the crystals diffract beyond 2.5 A resolution, with some showing diffraction beyond 2.0 A resolution.

Data were acquired by oscillation photography on several devices. These include (1) Rigaku R-AXIS EC phosphor imaging area detector mounted on a Rigaku RU200 rotating anode generator (Molecular Structure Corp.), operating at 50kV and 100mA (2) Briiker 2x2 Mosaic CCD area detector on beamline 17-ID at the Advanced Photon Source at Argonne National Laboratory. Measured intensities were integrated, scaled and merged using the HKL software package (Z. Otwinowski and W. Minor). Statistics from three selected crystals are shown in Table 2, below:

TABLE 2 Data and Refinement Statistics

EXAMPLE 7 Phasing, Model Building and Refinement The structure of the crystal form described in examples 1-4 was solved by molecular replacement, as implemented in XPLOR [Yale University, ©1992, distributed by Molecular Simulations, Inc.; see, e.g., Blundell & Johnson, supra: Meth. Enzymol, vol. 114 and 115, H. W. Wyckoff et al, eds., Academic Press (1985)], using a 2.5 A resolution model of unliganded FPT as the search model. The structure of one FPT:FPP:inhibitor complex was highly refined and used as the starting point for further structure determinations. After rigid body refinement using XPLOR, the refinement of each additional structure started from a model of FPT retaining the bound FPP, but with the inhibitor and its associated waters removed. The inhibitors or peptides were built using INSIGHT and QUANTA and fit into the initial omit electron density with CHAIN [J. Sack, /. Molecular Graphics 6:224-225]. The structure was refined by several cycles of model building and positional refinement using XPLOR. Positions of discrete water molecules were taken from positive 2.4σ (Fo-Fc),α_calc difference density peaks if a hydrogen bonding pattern to protein, peptide, inhibitors or solvent atoms could be established.

EXAMPLE 8 Structure Determination of FPT:αHFP: CVIM Co-crystals

Co-crystals of FPT:αHFP:CVIM were grown as described in Example 2. Data on these crystals was collected as decribed in Example 6 and the structure determined as described in Example 7. The structure clearly showed the position of αHFP and the CVIM peptide. Refinement statistics are shown in Table 2 and the coordinates are shown in Figure 2.

EXAMPLE 9

Structure determination of FPT:FPP:SCH61180 Co-crystals

Co-crystals of FPT:FPP:SCH61180 were grown as described in Example 3. Data on these crystals was collected as decribed in Example 6 and the structure determined as described in Example 7. The structure clearly showed the positions of FPP and SCH61180. Refinement statistics are shown in Table 2 and the coordinates are shown in Figure 3. EXAMPLE 10 Structure determination of FPT:FPP:SCH44342 by Soaking into

FPT:αHFP:Ac-CVIM-COOH Co-crystals Formation of the FPT:FPP:SCH44342 by soaking into preformed FPT: αHFP: Ac-CVIM-COOH co-crystals was described in Example 4. Data on these crystals were collected as decribed in Example 6 and the structure determined as described in Example 7. The structure clearly showed the positions of FPP and SCH44342. Refinement statistics are shown in Table 2 and the coordinates are shown in Figure 4.

While we have described a number of embodiments of this invention, it is apparent that our basic examples may be altered to provide other embodiments which utilize the products and processes of this invention. Therefore, it will be appreciated that the scope of this invention is to be defined by the appended claims rather than by the specific embodiments which have been represented by way of example.

Claims

CLAIMSWe claim:

1. A composition comprising a farnesyl protein transf erase-like (FPT- like) polypeptide complexed with a farnesyl diphosphate (FPP) analog and a Ca a₂X peptide.

2. The composition of claim 1, wherein the FPP analog is ╬▒- hydroxyphosphonic acid (╬▒HFP).

3. The composition of claim 1, wherein the Ca^-X tetrapeptide is N- acetyl-Cys-Val-Ile-Met-COOH (CVIM).

4. The composition of claim 1, wherein the FPT-like polypeptide contains a carboxy terminal deletion of at least about 5 amino acid residues.

5. The composition of claim 4, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 5 to 20 amino acid residues.

6. The composition of claim 5, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 5, 10 or 14 amino acid residues.

7. The composition of claim 6, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 10 amino acid residues, and wherein said polypeptide is complexed with ╬▒HFP and CVIM.

8. A composition comprising a farnesyl protein transferase-like (FPT- like) polypeptide complexed with farnesyl diphosphate (FPP) and an FPT inhibitor.

9. The composition of claim 8, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of at least about 5 amino acid residues.

10. The composition of claim 9, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 5 to 20 amino acid residues.

11. The composition of claim 10, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 5, 10 or 14 amino acid residues.

12. The composition of claim 11, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 10 amino acid residues, and wherein said polypeptide is complexed with FPP and an FPT inhibitor.

13. A crystal comprising a farnesyl protein transferase-like (FPT-like) polypeptide complexed with a farnesyl diphosphate (FPP) analog and a Ca^X peptide.

14. The crystal of claim 13, wherein the FPP analog is ╬▒-hydroxyphosphonic acid (╬▒HFP).

15. The crystal of claim 13, wherein the Ca a₂X tetrapeptide is N-acetyl- Cys-Val-Ile-Met-COOH (CVIM).

16. The crystal of claim 13, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of at least about 5 amino acid residues.

17. The crystal of claim 16, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 5 to 20 amino acid residues.

18. The crystal of claim 17, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 5, 10 or 14 amino acid residues.

19. The crystal of claim 18, wherein the ╬▓-subunit of the FPT-like polypeptide contains a carboxy terminal deletion of 10 amino acid residues and wherein the FPT-like polypeptide is complexed with ╬▒HFP and Ac-CVIM-COOH (CVIM).

20. A crystal comprising a farnesyl protein transferase-like (FPT-like) polypeptide complexed with farnesyl diphosphate (FPP) and an FPT inhibitor.

21. The crystal of claim 20, wherein the FPT-like polypeptide contains a carboxy terminal deletion of at least about 5 amino acid residues.

22. The crystal of claim 21, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 5 to 20 amino acid residues.

23. The crystal of claim 22, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 5, 10 or 14 amino acid residues.

24. The crystal of claim 18, wherein the FPT-like polypeptide contains a carboxy terminal deletion of 10 amino acid residues and wherein the FPT-like polypeptide is complexed with an FPT inhibitor.

25. A method of preparing a crystal of claim 13 comprising equilibrating a solution containing a ternary mixture of an FPT-like polypeptide, an FPP analog and a Ca-a₂X peptide against a reservoir solution containing potassium chloride and sodium acetate under conditions in which crystallization will occur.

26. A method of preparing a crystal of claim 20 comprising equilibrating a solution containing a ternary mixture of an FPT-like polypeptide, FPP and an FPT inhibitor against a reservoir solution containing potassium chloride and sodium acetate under conditions in which crystallization will occur.

27. A method of preparing a crystal of claim 20 comprising:

(a) harvesting a crystal of claim 13 into a reservoir solution at 4 ┬░ C;

(b) transferring the crystals of step (a) into a reservoir solution in the presence of FPP and an inhibitor under conditions in which displacement will occur.

28. A machine-readable data storage medium, comprising a data storage material encoded with machine readable data, wherein the data is defined by the structure coordinates of a complex according to Figure 2, 3 or 4, or a homologue of said complex, wherein said homologue comprises backbone atoms that have a root mean square deviation from the backbone atoms that have a root mean square deviation from the backbone atoms af the complex of not more than 2.5

A.

29. A machine-readable data storage medium comprising a data storage material encoded with a first set of machine readable data comprising a Fourier transform of at least a portion of the structural coordinates for a complex according to Figure 2, 3 or 4, which, when combined with a second set of machine readable data comprising an X-ray diffraction pattern of a molecule or molecular complex of unknown structure, using a machine programmed with instructions for using said forst set of data and said second set of data, can determine at least a portion of the structure coordinates corresponding to the second set of machine readable data, said first set of data and said second set of data.

30. A method of obtaining structural information about a molecule or a molecular complex of unknown structure by using the structure coordinates set forth in Figure 2, 3 or 4, comprising the steps of: a. generating X-ray diffraction data from said crystallized molecule or molecular complex; b. applying at least a portion of the structure coordinates set forth in Figure 3 to said X-ray diffraction pattern to generate a three-dimensional electron density map of at least a portion of the molecule or molecular complex.

31. The method according to claim 30, wherein the molecule or molecular complex of unknown structure comprises a polypeptide selected from an FPT polypeptide in complex with a substrate, substrate analog or inhibitor.