WO1999064624A2 - Method of generating nucleic acid hybrids for mutation analysis - Google Patents

Method of generating nucleic acid hybrids for mutation analysis Download PDF

Info

Publication number
WO1999064624A2
WO1999064624A2 PCT/GB1999/001691 GB9901691W WO9964624A2 WO 1999064624 A2 WO1999064624 A2 WO 1999064624A2 GB 9901691 W GB9901691 W GB 9901691W WO 9964624 A2 WO9964624 A2 WO 9964624A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequences
primers
sense strand
linker
complementary
Prior art date
Application number
PCT/GB1999/001691
Other languages
French (fr)
Other versions
WO1999064624A3 (en
Inventor
Andrew Wallace
Original Assignee
Central Manchester Healthcare Nhs Trust
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central Manchester Healthcare Nhs Trust filed Critical Central Manchester Healthcare Nhs Trust
Priority to CA002330252A priority Critical patent/CA2330252A1/en
Priority to AU53775/99A priority patent/AU5377599A/en
Priority to EP99939503A priority patent/EP1086250A2/en
Priority to JP2000553614A priority patent/JP2002517258A/en
Publication of WO1999064624A2 publication Critical patent/WO1999064624A2/en
Publication of WO1999064624A3 publication Critical patent/WO1999064624A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules

Definitions

  • the present invention relates to a method of producing a DNA hybrid molecule comprised of a contiguous linear array of three or more sequences of interest (or potential interest) in predetermined relationship to each other.
  • a further application in which it may be desirable to provide a DNA hybrid molecule is DNA sequencing.
  • the amplified gene fragments from the separate PCR reactions are then purified, combined together and subjected to cycles of denaturing, reannealing and strand synthesis. As a result of these cycles, the complementary linker sequences hybridise to each other and are extended to produce a double stranded molecules which comprise the two gene fragments connected by the linker sequences.
  • the Gene splicing by overlap extension method requires fragments to b joined in a pairwise fashion thus including additional laborious steps of purification and re- amplification for the creation of constructs of more than two fragments. Furthermore, although the Gene Fusion method utilises Taq polymerase no account is taken in the primer design of the 3' dA overhangs introduced by Taq. Consequently with the primer design employed in US-A-5 023 171, the majority of fragments will have 3' mismatches leading to inefficient fusion of the two fragments.
  • a further technique for producing DNA hybride molecules is Gene Fusion as disclosed in Nucleic Acids Research, 17, 4895, (1989) (Yon & Freide) where a single linking primer is used to fuse the fragments. This is unlikely to be at all efficient for the fusion of more than two fragments since the PCR products themselves act as substitutes for primers for the whole of the fusion reaction leading to inefficient intermediate formation. Also with this published technique with only two fragments there is contamination by unfused products within the reaction.
  • WO- A-9215678 (Stratagene) which describes a PCR-based process for generating a library of dicistronic DNA molecules (comprising upstream and downstream cistrons) for producing antibodies.
  • the disclosure contemplates combining, in a single reaction vessel, (i) a repertoire of first polypeptide genes with a PCR primer pair therefor, one of the primers having a first 5 '-terminal non-priming portion providing a linking sequence; and
  • the first and second 5'-terminal portions are such that they are capable of hybridising to form a duplex encoding a double-stranded cistronic bridge for linking the upstream and downstream cistrons.
  • the library of dicistronic molecules is generated.
  • each of the first and second stage PCR reactions employs Taq as a thermostable polymerising enzyme.
  • those primers having linker sequences are designed such that their linker sequence is connected to their respective priming sequence via an adenosine residue. This takes account of the 3' adenine overhang added by Taq at the 3' end of an extended strand.
  • Primers incorporating the extra adenosine residue may of course be used both in conjunction with any other polymerising enzyme which adds a 3'-adenosine overhang at the end of an extended strand and those which do not.
  • thermostable polymerase which may or may not add a 3' adenine overhang to the end of an extended strand.
  • the invention enables a DNA hybrid molecule comprised of the sequences x,, x 2 x n (and their respective complements x,', x 2 ' x ⁇ ') in predetermined linked relationship to be produced in high yield from the respective individual sequences provided at diverse regions of the same or different DNA molecules.
  • the linker sequences which are used are independent of the sequences which are to be assembled into the intended hybrid molecule. Furthermore the incorporation of the additional adenosine residue for primers to be used in conjunction with Taq as the polymerising enzyme avoids 3' mismatches leading to inefficient fusion of fragments.
  • sequences x, x 2 x n may for example be exons which are separated by any distance (possibly of unknown sequence) along a particular DNA molecule whereas in the hybrid molecule produced by the method of the invention the sequences are spaced from each other by a relatively short, and known, sequence of, say, 20 to 30 bases.
  • Hybrid molecules produced in accordance with the method of the invention may for example be constructed for the purposes of mutation detection. More particularly, the hybrid molecule may comprise a plurality of exons (in which one or more mutations may be present) in a molecule having a length of up to 1.5 kb thus permitting mutation scanning of all of these exons using a technique such as CCM, EMC, NIRCA or PTT. A further possibility is a hybrid molecule comprised of a plurality of exons which may be constructed to enable more efficient sequencing of exons (as compared to their sequencing the exons at their locations in the endogenous DNA molecule).
  • a further possibility is that the method of the invention is used for the construction of hybrid genes.
  • the method of the invention involves two PCR reaction steps which allow the desired DNA hybrid molecule to be produced from the individual sequences xicide x 2 x n (and their complements x,', x 2 x n ) which are provided in a single reaction mixture. It will however be appreciated that, in certain circumstances, only one or other of the sets of complementary the sequences (x, x 2 x n ) or (x,' x 2 ' x-,') may initially be present at the start of the first PCR reaction, in which case the "missing" complementary sequences are generated in situ in the initial PCR reaction stage.
  • PCR primers for each set of complementary sequences (xicide x,'), (x 2 , x 2 ') (x n , x n ') which are to be present in the intended DNA hybrid molecule.
  • the primers hybridising to the 3' ends of the sequences x,' and x n may be "standard" PCR primers and may hybridise either to the sequences x,' or x n (as the case may be) or to a region external thereto (since the 3' ends of the sequences x and x n to be incorporated in the hybrid molecule are determined by the primers used in the second stage of the PCR reaction (see below)).
  • the other primers for the first stage of PCR reaction are in effect modified PCR primers and comprise a priming sequence (i.e. a sequence which will hybridise to the appropriate x or x' sequence in the manner of a standard PCR primer) attached to a linker sequence.
  • a priming sequence i.e. a sequence which will hybridise to the appropriate x or x' sequence in the manner of a standard PCR primer
  • linker primers are also referred to herein as "linker primers”
  • the linker sequences are such that the primers which hybridise to the 3' ends of any two sequences (x i5 x (i+1) )where i is 1 to (n-1) have linker sequences which are specifically complementary to each other, i.e. these linker sequences will hybridise to each other but not to any other sequences in the reaction mixture.
  • the manner in which the linker sequences function to provide for assembly of the required DNA hybrid molecule will be more fully appreciated from the description given below
  • the linker sequences may for example be comprised of 20 to 30 bases and are ideally such that they do not have any secondary structure (e.g. "hairpins"). It is preferred that the annealing temperature (Tm) of the complementary pairs are substantially the same and is 2-5°C higher than the annealing temperature of the primers to the x and x' sequences.
  • Tm annealing temperature
  • linker primers for the assembly (using PCR reactions employing Taq as the polymerising enzyme) of a hybrid DNA molecule comprised of five sequences x,_ 5 and their respective complements.
  • specific sequence is the priming portion of the linker primer.
  • the "a” represented in bold is an additional adenosine residue incorporated in the primer to take account of the 3' adenosine overhang added by Taq at the end of an extended strand.
  • the linker primers and preferably also the standard PCR primers for the 3' ends of the sequences x,' and x n , are provided in a limiting concentration.
  • a "limiting concentration” is a concentration of primers in a PCR reaction leading to inefficient amplification and such that an increase in concentration results in an increase in product yield.
  • the ratio of primers to single copy template in the limiting PCR reaction may typically be about 1 x 10 6 :1 to about 1 x 10 8 :1 (e.g. about 3 x 10 7 :1).
  • a standard limiting concentration may for example be 40nM. The limiting concentration may however readily be determined empirically for each set of primers used.
  • the first stage PCR reaction may be conducted under the conditions (e.g. polymerase enzyme, nucleotides, buffers, temperature cycling etc.) will be understood by those skilled in the art.
  • the temperature cycling may involve stages of denaturation at 90°C, hybridisation at 60°C, and strand synthesis at 72°C.
  • the polymerase enzyme which is used for the first stage reaction is one formulated so as to be activated by heat (e.g. at 90° to 95°C) so that there are no non-specific hybridisations being extended at low temperature.
  • Heat activated polymerase enzymes are know to those skilled in the art and examples of such enzymes which may be employed in the method of the invention include AmpliTaq Gold (ex Perkin Elmer) and Platinum Taq (ex Gibco BRL).
  • the product of the first stage PCR reaction is treated, prior to the second stage, to prevent the extension of unwanted non-stringent hybridisations between residual primers and the template DNA.
  • This ensures a proper "Hot Start" for the second stage PCR reaction.
  • This treatment may for example comprise an exonuclease digestion involving addition of exonuclease to the first stage reaction mixture followed by incubation of the mixture at 37°C (e.g. for 15 min) and then at 80°C (e.g. for 30 min) so as to remove any single stranded molecules.
  • the first stage reaction mixture is cooled, e.g. at -20°C, to inactivate residual DNA polymerase activity.
  • the second stage reaction there is employed an excess of two PCR primers one of which hybridises to the 3' end of sequence x,' and the other of which hybridises to the 3' end of the sequence x n (and which therefore respectively provide the 5' ends of the sense and anti-sense strands of the intended hybrid molecule).
  • the excess is a concentration of primers such that an increase in concentration does not produce an increase in yield.
  • the "excess" may readily be determined by a person skilled in the art and for a typical reaction might for example be 500nM.
  • Fresh polymerising enzyme is used for the second stage PCR reaction and this is preferably a heat activated polymerase enzyme as described for the first stage reaction.
  • the second stage reaction may be conducted under temperature cycling conditions as described for the first stage reaction.
  • Fig. 1 illustrates a DNA hybrid molecule and a "naturally occurring" DNA molecule from which it is produced
  • Fig. 2 illustrates steps in the conversion of the "naturally occurring" DNA molecule to the hybrid molecule.
  • Figs. 3 to 7 illustrate the results of the Examples.
  • the invention is described by way of example only with reference to the synthesis of a DNA hybrid molecule 1 (see Fig. 1) comprised of exons present in a naturally occurring DNA molecule 2 (see Fig. 1). More particularly, the molecule 2 is shown as being comprised of sense and anti-sense strands 3 and 4 respectively with the former incorporating exons x trench x 2 , x 3 x terrain of interest (e.g. for the purpose of mutation analysis). These sequences x,, x 2 , x 3 x n have their respective complementary sequences x,', x 2 ', x 3 ' x n ' in the anti-sense strand 4 shown and may for example be separated from each other by several hundred bases.
  • the hybrid molecule 1 is illustrated as having sense and anti-sense strands 5 and 6 respectively with the former incorporating the sequences x réelle x 2 , x 3 x n and the latter incorporating sequences x,', x 2 ', x 3 ' x_'.
  • sequences x, and x 2 are connected (reading in the 5' to 3' direction) by the sequence -t-L 12 -a " where a and t represent adenine and thymidine residues respectively and L 12 is a linker sequence (the subscript "12" indicating that the linker is between sequences x, and x 2 .
  • sequences x 2 and x 3 are connected by the sequence -t-L 23 -a and so forth.
  • Fig. 2 illustrates the manner in which molecule 1 is synthesised from molecule 2. More particularly, the synthesis involves a two stage PCR reaction employing heat activated Taq as the polymerising enzyme and in which the first stage utilises limiting concentrations of a plurality of pairs of modified PCR primers, one pair for each of sequences (xicide x,'), (x 2 , x 2 '), (x 3 , x 3 ')
  • the primer pair comprises
  • a first primer having a priming sequence which will specifically hybridise to the 3' region of the "sense sequence" x. and which is connected at its 5'-end to a linker sequence L'. _ 0+1) via an adenine residue ("a");
  • a second primer having a priming sequence which will specifically hybridise to the 3' region of the "antisense sequence" x,' connected at its 5'-end to a linker sequence L , via an adenine residue ("a").
  • the primer pair for sequence (x,, x,') comprises a primer as defined under (i) above (in which the linking sequence is L 12 ) and a conventional PCR primer (PI) specific for the 3' region of sequence x,'.
  • the primer pair for sequences x n , x n ' comprises a primer as defined under (ii) above (in which the linking sequence is L (n . 1) n ) and a conventional PCR (P2) primer specific for the 3' region of sequence x,..
  • linker sequences which form part of the modified PCR primers are such that they do not have any internal secondary structure (e.g. "hairpins") and that two such complementary sequences have an annealing temperature (T m ) which slightly exceeds that of the priming sequence and its complement. Examples of suitable linker sequences have been given above.
  • the "starting" DNA molecule 2 is treated with the sets of primers as described together with a heat activated Taq polymerase (e.g. having an activation temperature of ca 94°C) in an appropriate buffer.
  • a heat activated Taq polymerase e.g. having an activation temperature of ca 94°C
  • all of the primers are present in limiting concentration.
  • the first stage is conducted under conditions of temperature cycling such that there is an initial, relatively high temperature, denaturation step (e.g. at 95°C), followed by a hybridisation step (e.g. at 60°C) followed by a strand synthesis step (e.g. at 72°C).
  • an initial, relatively high temperature, denaturation step e.g. at 95°C
  • a hybridisation step e.g. at 60°C
  • a strand synthesis step e.g. at 72°C.
  • a PCR reaction is effected resulting in the generation of the "short" products (see Fig. 2) in which the 3'- ends of all x and x' sequences (except x, and x n ') are connected to their respective linker sequences via an adenine residue "a" and the 5'-ends of all sequences (except x,' and x n ) are connected to their respective linker sequences via a thymidine residue "t". Furthermore, it will be noted that the 3 '-end of each of the short products has an adenine residue as added by the Taq polymerase.
  • a terminal linking sequence of such longer product so generated may be able to hybridise with a terminal linking sequence of a further "longer" product or of a short product so that further extension is possible to produce fragments of greater length.
  • the generation of the longer products may take place partly in the first stage reaction and partly in the second stage reaction (discussed below) although we do not wish to preclude the possibility that these products are formed wholly in either the first or second stage reaction. It is for this reason that the generation of the "longer” products is illustrated within the box defined by dashed lines and the first and second stages of the PCR reactions are connected by dashed arrows.
  • the reaction mixture is preferably frozen to -20°C to deactivate any residual polymerase activity.
  • flanking primers which define the 5' ends of the sense and anti-sense strands of the intended hybrid molecule are added to the reaction mixture.
  • Fig. 2 illustrates these flanking primers are illustrated as FP1 and FP 2 together with the locations at which they hybridise.
  • further polymerase which is activated only at elevated temperature together with buffers, nucleotides etc.
  • the reaction mixture is then subjected to temperature cycling as previously i.e. denaturation (e.g. at 95°C for 1 min), hybridisation e.g. at 60°C (e.g. for 1 min) and synthesis (e.g. at 72°C for 2 minutes).
  • the polymerase Since the polymerase is only activated at elevated temperature, it is ensured that any sequences which randomly hybridise during the initial heating of the reaction mixture become denatured before the temperature at which the polymerase is activated so that there are substantially no extension reactions resulting from these hybridisations. Put another way, the only hybridisations which occur above the activation temperature of the polymerase are those which are required for generation of the hybrid molecule 1 as explained more fully below.
  • primers p, and p 2 may be external to the sequences x 1 , and x n respectively.
  • a supplementary adenine residue was inserted between the genomic and 5' complementary segments of the self assembling primers in order to accommodate the 3' adenine overhangs added by Taq polymerase to the nascent DNA strand. All primers were checked for homology to Alu repeat sequences using the BLAST analysis program available at http://www.ncbi.nlm.nih.gov/cgi- bin/BLAST/nph-blast. Table 1 gives the sequences and T m s of the 12 primers used in the NF2 exon 6-10 array.
  • DNA was extracted from peripheral blood lymphocytes on an Applied Biosystems 380A DNA extractor.
  • PCR amplification of the self assembling DNA arrays was carried out in two stages. The primary reactions were carried out in 20 ⁇ l volumes using 50ng of genomic DNA, 40nmol.L ⁇ l of primers 1-10 (Table 1), 750 ⁇ mol.L"l of each dNTP, 0.6U Platinum Taq polymerase (GibcoBRL) in a lxPCR buffer comprising 67mM Tris-HCl (pH8.3 @ 25°C), 16.6mM ammonium sulphate, 3.7mM MgCl2 and
  • PCR amplification was carried out on Perkin-Elmer 2400 or 9600 thermal cyclers using the following parameters; initial denaturation 94°C (3 mins), 30 cycles of 94°C (1 min); 60°C (1 min); 72°C (2 mins) followed by a final synthesis of 72°C (10 mins). Immediately on completion of cycling the primary PCR reactions were frozen at -20°C to inactivate residual DNA polymerase activity.
  • Table 1 Primer sequences for amplification of NF2 exon 6-10 self-assembling array. Primers 2 through to 9 are all internal to the self assembling array and contain one of four pairs of complementary 5' termini which are highlighted in italics.
  • the extra adenine nucleotide incorporated to accommodate the 3' terminal adenine residue added by Taq polymerase to the nascent strand is underlined in bold type.
  • the melting temperature (T m ) of the respective genomic or linker portions of each of the primers is also indicated.
  • the secondary reactions were carried out in separate 20 ⁇ l volumes using 2 ⁇ L of the primary PCR, 500nmol.L ⁇ l of primers 11 and 12 (Table 1), 200 ⁇ mol.L ⁇ l of each dNTP, 0.6U Platinum Taq polymerase (GibcoBRL) in a lxPCR buffer comprising 50mM Tris-HCl (pH9.0 @ 25°C), 20mM ammonium sulphate and 1.5mM MgCl2- The thermal cycling conditions were identical to those used for the primary amplifications.
  • the internal primers (11 & 12) were either unlabelled (sequencing and CCM probe DNA) or 5' biotin labelled (CCM test DNA).
  • CCM test DNA 5' biotin labelled (CCM test DNA).
  • secondary PCRs were set up with primary PCRs from normal control DNA, with the addition of TAMRA labelled dCTP (Perkin-Elmer) to a final concentration of 800nmol.L " of secondary PCRs. Otherwise reaction conditions were identical to those described previously for secondary PCRs.
  • each sample was sequenced in both orientations using either primers 11 or 12 with BigDye terminator cycle sequencing kits (Perkin-Elmer, Applied Biosystems)). The manufacturer's protocols were followed with the exception that the annealing temperature for the cycle sequencing reaction was increased from 50°C to 55°C to reflect the high T m of primers 11 and 12. The sequencing reactions were then electrophoresed and collected on an Applied Biosystems 377 fluorescent sequencer using 48cm well to read plates.
  • Heteroduplexes were formed by heating equal quantities of unpurified biotinylated test DNA with unpurified internally TAMRA labelled normal control probe DNA at 94°C for 5 mins followed by annealing at 65°C for 12 hours.
  • the heteroduplexed DNA was purified by electrophoresing each sample through a 1% low gelling temperature agarose gel and cutting out the 1046bp band using a sterile scalpel.
  • the volume of gel slice was estimated by weighing and the gel slice equilibrated for 20 mins in an equal volume of 1 x ⁇ -Agarase buffer comprising lOmM Bis-Tris HC1 (pH6.5) and ImM EDTA.
  • the ⁇ -Agarase buffer was then removed and the gel slice heated at 70°C for 10 mins to liquefy the agarose followed by cooling to 37°C.
  • a further equal volume of 1 x ⁇ -Agarase buffer was added followed by 1U of ⁇ -Agarase I (USB Biochemical). The gel slice was then digested overnight at 37°C.
  • heteroduplexes were then left to complex with the beads for 1 hour at 42°C.
  • the samples were then placed on a magnet to separate the beads and the supernatant carefully removed using a pipette.
  • the beads with bound DNA were resuspended in 20 ⁇ L of a solution of ImM
  • the beads Prior to piperidine cleavage the beads were rinsed once with 50 ⁇ L of TE buffer. Then the beads were resuspended in 5 ⁇ L of a 1M solution of piperidine in deionised formamide to which Genescan 2500 Rox size standard (Perkin-Elmer) and dextran blue loading dye (Sigma) had been added. The samples were heated at 90°C for 30 mins to cleave the modified bases, snap chilled on ice and placed on a magnet to separate the beads from the unbound DNA now in the liquid phase.
  • Genescan 2500 Rox size standard Perkin-Elmer
  • dextran blue loading dye Sigma
  • Figs 4a and 4b show the product of step 1.1.2 sequenced from both termini.
  • Fig 5a shows sequencing in the forward orientation using primer 11.
  • Fig 4b shows sequencing in the reverse orientation using primer 12.
  • the positions of the intron exon boundaries, primer annealing sites and linker sequences are indicated on the electropherograms. The product was seen to comprise the expected exons in the correct orientations. No discernible degradation of sequence was observed across the transitions from one component to the next.
  • step 1.1.2 The procedure of step 1.1.2 was repeated for a range of genomic DNA samples and consistently yielded fragments of the expected size. Reaction yields were generally high ( ⁇ 500ng per lO ⁇ l) with low background (see Fig 5a).
  • products from a series of 7 heterozygotes for NF2 mutations spread throughout four of the five NF2 CR exons were directly sequenced to confirm that the genotype present in genomic DNA was correctly represented in the product.
  • the 7 mutant heterozygotes were as follows nt600-3OG (exon 7), nt676-7T>G (exon 8), nt713delC (exon 8), nt7840T (exon 8), nt855delT (exon 9), nt887delT (exon 10) and nt948G>T + nt949G>T (exon 10).
  • Fig 6 gives example data from four representative mutation heterozygotes.
  • 11 NF2 mutant heterozygotes were then retrospectively screened using a modified fluorescent solid-phase CCM method based on that of Rowley et al, as disclosed in Genomics 30, 574-582. The products were internally labelled using TAMRA dCTP in preference to end labelling. This method helps eliminate false positives resulting from background cleavage.
  • Cleavage of internally labelled products should result in two labelled fragments with a total molecular weight equal to the uncleaved product.
  • Mismatched cytosines were modified using hydroxylamine.
  • mismatched thymines were modified using the potassium permanaganate in preference to osmium tetroxide.
  • nt676-2A>T The mutation not detected by either condition, nt676-2A>T, is predicted to produce heteroduplexes detectable only by potassium permanganate modification (T:T/A:A mismatches). Furthermore, two other mutations producing heteroduplexes with mismatched thymines (nt784C>T and nt903C>T) had undetectable levels of cleavage after potassium permanganate modification. However, both these mutations also produce mismatched cytosines which were detected after hydroxylamine modification. All of the mutations predicted to produce heteroduplexes with mismatched cytosines produced visible cleavage products after hydroxylamine modification.
  • a supplementary unmatched adenine residue was inserted between the genomic and 5' linker segments of the self assembling primers in order to accommodate the 3' adenine overhangs added by Taq polymerase to the nascent DNA strand. All primers were checked for homology to Alu repeat sequences using the BLAST analysis program available at http://www.ncbi.nlm.nih.gov/cgi- bin/BLAST/nph-blast.
  • step 1.1.2 The procedure of step 1.1.2 was repeated for a range of genomic DNA samples and consistently yielded fragments of the expected size. Reaction yields were generally high ( ⁇ 500ng per lO ⁇ l) with low background (see Fig 5b).
  • Genomic sequences of NF2 exons 6-10 amplified by the self assembling array Exonic sequence is indicated by capitals, intronic sequence is in lower case.
  • the annealing sites of primers used in the primary PCR reaction to generate the five self assembling DNA fragments are marked in bold underlined sequence.
  • the annealing sites of the internal primer pair used during the secondary PCR to drive the array assembly are marked in underlined italics.
  • the primary and secondary primers for exon 10 reverse overlap, the region of overlap is marked in bold, underlined italics.
  • AAGCCCAGGC CAGGGAGGAG AAGGCTAGAA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method of producing a hybrid DNA molecule allowing the assembly of sequences x1, x2.....xn where n is greater than or equal to 3 (e.g. give sequences) from diverse locations into a hybrid molecule for the purpose of mutation analysis. The method comprising the steps of: (1) providing in a single reaction mixture: (a) the sequences x1, x2.......xn and their complementary sequences x1', x2'.........xn', to be assembled into the hybrid molecule; (b) for each pair of complementary sequences defined in (a) a respective pair of PCR primers each having a priming sequence and which are such that the primers hybridising to the 3' ends of any two sequences (xi, x'(i+1)), where i is 1 to (n-1), have specifically complementary linker sequences; (2) effecting a first stage PCR reaction in which those primers provided with linker sequences are present in limiting concentrations; and (3) effecting a second stage PCR reaction using a single pair of primers one of which provides the 5'-end of the sense strand and other of which provides the 3'-end of the anti-sense strand of the required hybrid molecule; whereby said hybrid molecule is generated.

Description

NUCLEIC ACIDS
The present invention relates to a method of producing a DNA hybrid molecule comprised of a contiguous linear array of three or more sequences of interest (or potential interest) in predetermined relationship to each other.
There are a number of applications in which it would be desirable to provide a DNA hybrid molecule comprising sequences of (potential) interest in predetermined relationship to each other. One such application is in mutation detection where many mutation scanning techniques which provide positional information are capable of scanning up to 1.5kb at a time e.g. CCM, EMC, NIRCA, PTT. However, most genes are organised into short coding sequences (exons) which are dispersed over comparatively large distances. As a result, mutation scanning techniques are not used to their full potential and consequently cost vs benefit considerations have limited their usefulness and favoured less sensitive, size constrained techniques like SSCP and HA. Other alternative methods of circumventing these problems such as RT-PCR are fraught with problems of working with RNA and mutant allele loss in autosomal conditions.
A further application in which it may be desirable to provide a DNA hybrid molecule is DNA sequencing.
Various techniques are already known for producing DNA molecules comprising exons present at diverse locations in the same or different DNA molecule(s). One such technique is Gene "splicing" by overlap extension (SOE) as disclosed in US-A-5 023 171 (see also Horton et al, 1989. Gene, 77, 61-68). In this technique, two gene fragments to be "spliced" together are initially amplified in separate PCR reactions. For each PCR reaction, one of the two primers has a "linker" sequence which is attached to the 5' end of the genomic specific sequence of the primer and which is designed to be complementary to the linker sequence on a primer of the other PCR reaction.
The amplified gene fragments from the separate PCR reactions are then purified, combined together and subjected to cycles of denaturing, reannealing and strand synthesis. As a result of these cycles, the complementary linker sequences hybridise to each other and are extended to produce a double stranded molecules which comprise the two gene fragments connected by the linker sequences.
The Gene splicing by overlap extension method requires fragments to b joined in a pairwise fashion thus including additional laborious steps of purification and re- amplification for the creation of constructs of more than two fragments. Furthermore, although the Gene Fusion method utilises Taq polymerase no account is taken in the primer design of the 3' dA overhangs introduced by Taq. Consequently with the primer design employed in US-A-5 023 171, the majority of fragments will have 3' mismatches leading to inefficient fusion of the two fragments.
A further technique for producing DNA hybride molecules is Gene Fusion as disclosed in Nucleic Acids Research, 17, 4895, (1989) (Yon & Freide) where a single linking primer is used to fuse the fragments. This is unlikely to be at all efficient for the fusion of more than two fragments since the PCR products themselves act as substitutes for primers for the whole of the fusion reaction leading to inefficient intermediate formation. Also with this published technique with only two fragments there is contamination by unfused products within the reaction.
A further technique for producing DNA hybrid molecules is disclosed in WO- A-9215678 (Stratagene) which describes a PCR-based process for generating a library of dicistronic DNA molecules (comprising upstream and downstream cistrons) for producing antibodies. The disclosure contemplates combining, in a single reaction vessel, (i) a repertoire of first polypeptide genes with a PCR primer pair therefor, one of the primers having a first 5 '-terminal non-priming portion providing a linking sequence; and
(ii) a repertoire of second polypeptide genes with a PCR primer pair therefor, one of the primers having a second 5'-terminal non-priming portion.
The first and second 5'-terminal portions are such that they are capable of hybridising to form a duplex encoding a double-stranded cistronic bridge for linking the upstream and downstream cistrons.
Under the conditions of denaturation, reannealing and strand synthesis employed in the reaction, the library of dicistronic molecules is generated.
According to a first aspect of the present invention there is provided a method of producing a hybrid DNA molecule having a sense strand and an anti-sense strand and in which, reading in the 5' to 3' direction, the sense strand has the sequences x,, x2 xn, where n is greater than or equal to 3, the method comprising the steps of
(i) providing in a single reaction mixture
(a) the sequences x,, x2 xn and their complementary sequences x,', x2' xn', to be assembled into the hybrid molecule,
(b) for each pair of complementary sequences defined in (a) a respective pair of PCR primers each having a priming sequence and which are such that the primers hybridising to the 3' ends of any two sequences (x„ x' +1)), where i is 1 to (n-1), have specifically complementary linker sequences (2) effecting a first stage PCR reaction in which those primers provided with linker sequences are present in limiting concentrations, and
(3) effecting a second stage PCR reaction using a single pair of primers one of which provides the 5'-end of the sense strand and other of which provides the 3 '-end of the anti-sense strand of the required hybrid molecule
whereby said hybrid molecule is generated.
In a preferred embodiment of the invention, each of the first and second stage PCR reactions employs Taq as a thermostable polymerising enzyme. In this case, those primers having linker sequences are designed such that their linker sequence is connected to their respective priming sequence via an adenosine residue. This takes account of the 3' adenine overhang added by Taq at the 3' end of an extended strand. Primers incorporating the extra adenosine residue may of course be used both in conjunction with any other polymerising enzyme which adds a 3'-adenosine overhang at the end of an extended strand and those which do not.
This constitutes an important feature of the present invention according to a second aspect of which there is therefore provided a method of producing a hybrid DNA molecule having a sense strand and an anti-sense strand and in which, reading in the 5' to 3' direction, the sense strand has the sequences x,, x2 xn, where n is greater than or equal to 3, the method comprising the steps of
(i) providing in a single reaction mixture
(a) the sequences x,, x2 xn and their complementary sequences x,', x2' xn', to be assembled into the hybrid molecule, (b) for each pair of complementary sequences defined in (a) a respective pair of PCR primers each having a priming sequence and which are such that the primers hybridising to the 3' ends of any two sequences (xi5 x'(i+1)), where i is 1 to (n-1), have specifically complementary linker sequences connected to their respective priming sequences via an adenine residue, and
(2) effecting a PCR reaction using a thermostable polymerase which may or may not add a 3' adenine overhang to the end of an extended strand.
The invention enables a DNA hybrid molecule comprised of the sequences x,, x2 xn (and their respective complements x,', x2' xπ') in predetermined linked relationship to be produced in high yield from the respective individual sequences provided at diverse regions of the same or different DNA molecules. The linker sequences which are used are independent of the sequences which are to be assembled into the intended hybrid molecule. Furthermore the incorporation of the additional adenosine residue for primers to be used in conjunction with Taq as the polymerising enzyme avoids 3' mismatches leading to inefficient fusion of fragments.
The sequences x, x2 xn may for example be exons which are separated by any distance (possibly of unknown sequence) along a particular DNA molecule whereas in the hybrid molecule produced by the method of the invention the sequences are spaced from each other by a relatively short, and known, sequence of, say, 20 to 30 bases.
Hybrid molecules produced in accordance with the method of the invention may for example be constructed for the purposes of mutation detection. More particularly, the hybrid molecule may comprise a plurality of exons (in which one or more mutations may be present) in a molecule having a length of up to 1.5 kb thus permitting mutation scanning of all of these exons using a technique such as CCM, EMC, NIRCA or PTT. A further possibility is a hybrid molecule comprised of a plurality of exons which may be constructed to enable more efficient sequencing of exons (as compared to their sequencing the exons at their locations in the endogenous DNA molecule).
A further possibility is that the method of the invention is used for the construction of hybrid genes.
The method of the invention involves two PCR reaction steps which allow the desired DNA hybrid molecule to be produced from the individual sequences x„ x2 xn (and their complements x,', x2 xn) which are provided in a single reaction mixture. It will however be appreciated that, in certain circumstances, only one or other of the sets of complementary the sequences (x, x2 xn) or (x,' x2' x-,') may initially be present at the start of the first PCR reaction, in which case the "missing" complementary sequences are generated in situ in the initial PCR reaction stage.
For the first stage of PCR reaction, there is a pair of PCR primers for each set of complementary sequences (x„ x,'), (x2, x2') (xn, xn') which are to be present in the intended DNA hybrid molecule. The primers hybridising to the 3' ends of the sequences x,' and xn may be "standard" PCR primers and may hybridise either to the sequences x,' or xn (as the case may be) or to a region external thereto (since the 3' ends of the sequences x and xn to be incorporated in the hybrid molecule are determined by the primers used in the second stage of the PCR reaction (see below)).
The other primers for the first stage of PCR reaction are in effect modified PCR primers and comprise a priming sequence (i.e. a sequence which will hybridise to the appropriate x or x' sequence in the manner of a standard PCR primer) attached to a linker sequence. (For convenience, primers incorporating linker sequences are also referred to herein as "linker primers"). The linker sequences are such that the primers which hybridise to the 3' ends of any two sequences (xi5 x(i+1))where i is 1 to (n-1) have linker sequences which are specifically complementary to each other, i.e. these linker sequences will hybridise to each other but not to any other sequences in the reaction mixture. The manner in which the linker sequences function to provide for assembly of the required DNA hybrid molecule will be more fully appreciated from the description given below in relation to the drawing.
Adopting this type of primer design, it is possible to employ linker sequences which are independent of the x and x, sequences to be incorporated in the desired hybrid molecule so that it is not necessary to ensure that the linker will hybridise to a part of an x or x' sequence to be linked into the hybrid molecule. This design of the linkers is thus not constrained.
The linker sequences may for example be comprised of 20 to 30 bases and are ideally such that they do not have any secondary structure (e.g. "hairpins"). It is preferred that the annealing temperature (Tm) of the complementary pairs are substantially the same and is 2-5°C higher than the annealing temperature of the primers to the x and x' sequences.
Purely by way of example, there is set out below complementary sets of complementary linker sequences which may be incorporated in linker primers for the assembly (using PCR reactions employing Taq as the polymerising enzyme) of a hybrid DNA molecule comprised of five sequences x,_5 and their respective complements. In the following, the term "specific sequence" is the priming portion of the linker primer.
5'tcatattagccgctgcattgcc-a-specific seq 3' 5'ggcaatgcagcggctaatatga-a-specific seq 3' 'agccactacccaaactcctgt-a-specific seq 3' 'acaggagtttgggtagtggct-a-specific seq 3'
5'tgtctcactgaacctgcctacct~a-specific seq 3' 5'aggtaggcaggttcagtgagaca-a-specifιc seq 3'
5'cctcattaccggctgtcagactg-a-specifιc seq 3' 5'cagtctgacagccggtaatgagg-a-specific seq 3'
In the above sequences, the "a" represented in bold is an additional adenosine residue incorporated in the primer to take account of the 3' adenosine overhang added by Taq at the end of an extended strand.
In the first stage PCR reaction, the linker primers, and preferably also the standard PCR primers for the 3' ends of the sequences x,' and xn, are provided in a limiting concentration. A "limiting concentration" is a concentration of primers in a PCR reaction leading to inefficient amplification and such that an increase in concentration results in an increase in product yield. The ratio of primers to single copy template in the limiting PCR reaction may typically be about 1 x 106:1 to about 1 x 108:1 (e.g. about 3 x 107:1). A standard limiting concentration may for example be 40nM. The limiting concentration may however readily be determined empirically for each set of primers used.
Subject to the use of limiting primer concentrations as outlined above, the first stage PCR reaction may be conducted under the conditions (e.g. polymerase enzyme, nucleotides, buffers, temperature cycling etc.) will be understood by those skilled in the art. For example, the temperature cycling may involve stages of denaturation at 90°C, hybridisation at 60°C, and strand synthesis at 72°C. It is particularly preferred that the polymerase enzyme which is used for the first stage reaction is one formulated so as to be activated by heat (e.g. at 90° to 95°C) so that there are no non-specific hybridisations being extended at low temperature.
Heat activated polymerase enzymes are know to those skilled in the art and examples of such enzymes which may be employed in the method of the invention include AmpliTaq Gold (ex Perkin Elmer) and Platinum Taq (ex Gibco BRL).
In a preferred embodiment of the method of the invention, the product of the first stage PCR reaction is treated, prior to the second stage, to prevent the extension of unwanted non-stringent hybridisations between residual primers and the template DNA. This ensures a proper "Hot Start" for the second stage PCR reaction. This treatment may for example comprise an exonuclease digestion involving addition of exonuclease to the first stage reaction mixture followed by incubation of the mixture at 37°C (e.g. for 15 min) and then at 80°C (e.g. for 30 min) so as to remove any single stranded molecules. Alternatively, and more preferably, the first stage reaction mixture is cooled, e.g. at -20°C, to inactivate residual DNA polymerase activity.
In the second stage reaction there is employed an excess of two PCR primers one of which hybridises to the 3' end of sequence x,' and the other of which hybridises to the 3' end of the sequence xn (and which therefore respectively provide the 5' ends of the sense and anti-sense strands of the intended hybrid molecule). The excess is a concentration of primers such that an increase in concentration does not produce an increase in yield. The "excess" may readily be determined by a person skilled in the art and for a typical reaction might for example be 500nM.
Fresh polymerising enzyme is used for the second stage PCR reaction and this is preferably a heat activated polymerase enzyme as described for the first stage reaction. The second stage reaction may be conducted under temperature cycling conditions as described for the first stage reaction.
The invention is further described with reference to the accompanying drawings, in which:
Fig. 1 illustrates a DNA hybrid molecule and a "naturally occurring" DNA molecule from which it is produced; and
Fig. 2 illustrates steps in the conversion of the "naturally occurring" DNA molecule to the hybrid molecule.
Figs. 3 to 7 illustrate the results of the Examples.
The invention is described by way of example only with reference to the synthesis of a DNA hybrid molecule 1 (see Fig. 1) comprised of exons present in a naturally occurring DNA molecule 2 (see Fig. 1). More particularly, the molecule 2 is shown as being comprised of sense and anti-sense strands 3 and 4 respectively with the former incorporating exons x„ x2, x3 x„ of interest (e.g. for the purpose of mutation analysis). These sequences x,, x2, x3 xn have their respective complementary sequences x,', x2', x3' xn' in the anti-sense strand 4 shown and may for example be separated from each other by several hundred bases.
The hybrid molecule 1 is illustrated as having sense and anti-sense strands 5 and 6 respectively with the former incorporating the sequences x„ x2, x3 xn and the latter incorporating sequences x,', x2', x3' x_'. As shown, sequences x, and x2 are connected (reading in the 5' to 3' direction) by the sequence -t-L12-a" where a and t represent adenine and thymidine residues respectively and L12 is a linker sequence (the subscript "12" indicating that the linker is between sequences x, and x2. Similarly sequences x2 and x3 are connected by the sequence -t-L23-a and so forth. Reference is now made to Fig. 2 which illustrates the manner in which molecule 1 is synthesised from molecule 2. More particularly, the synthesis involves a two stage PCR reaction employing heat activated Taq as the polymerising enzyme and in which the first stage utilises limiting concentrations of a plurality of pairs of modified PCR primers, one pair for each of sequences (x„ x,'), (x2, x2'), (x3, x3')
(xn,xn') to be incorporated in the hybrid molecule. For each such sequence (x., x.') (where j is 2 to (n-1) which is to be an internal sequence in the hybrid molecule 1 (i.e. all sequences except (x,, x,') and (xn, xn')) the primer pair comprises
(i) a first primer having a priming sequence which will specifically hybridise to the 3' region of the "sense sequence" x. and which is connected at its 5'-end to a linker sequence L'. _0+1) via an adenine residue ("a"); and
(ii) a second primer having a priming sequence which will specifically hybridise to the 3' region of the "antisense sequence" x,' connected at its 5'-end to a linker sequence L , via an adenine residue ("a").
The primer pair for sequence (x,, x,') comprises a primer as defined under (i) above (in which the linking sequence is L12) and a conventional PCR primer (PI) specific for the 3' region of sequence x,'. The primer pair for sequences xn, xn' comprises a primer as defined under (ii) above (in which the linking sequence is L(n. 1) n) and a conventional PCR (P2) primer specific for the 3' region of sequence x,..
The manner in which the described primers are intended to hybridise to the starting DNA molecule 2 (when denatured into its component strands) is as illustrated in Fig. 2.
The linker sequences which form part of the modified PCR primers are such that they do not have any internal secondary structure (e.g. "hairpins") and that two such complementary sequences have an annealing temperature (Tm) which slightly exceeds that of the priming sequence and its complement. Examples of suitable linker sequences have been given above.
In the first stage PCR reaction, the "starting" DNA molecule 2 is treated with the sets of primers as described together with a heat activated Taq polymerase (e.g. having an activation temperature of ca 94°C) in an appropriate buffer. In this first stage, all of the primers are present in limiting concentration.
The first stage is conducted under conditions of temperature cycling such that there is an initial, relatively high temperature, denaturation step (e.g. at 95°C), followed by a hybridisation step (e.g. at 60°C) followed by a strand synthesis step (e.g. at 72°C).
As a result of this series of temperature cycling steps, a PCR reaction is effected resulting in the generation of the "short" products (see Fig. 2) in which the 3'- ends of all x and x' sequences (except x, and xn') are connected to their respective linker sequences via an adenine residue "a" and the 5'-ends of all sequences (except x,' and xn) are connected to their respective linker sequences via a thymidine residue "t". Furthermore, it will be noted that the 3 '-end of each of the short products has an adenine residue as added by the Taq polymerase.
Whilst we do not wish to be limited by any particular mechanistic interpretation, we believe that the first stage PCR reaction also results in a degree of formation of "longer" products. The manner in which such "longer" products will form from selected ones of the short products is illustrated in those steps of the reaction illustrated within the dashed box. More particularly, complementary linker sequences are able to hybridise to each other and it will be noted that their flanking "t" and "a" residues respectively hybridise to the "a" and "t" residues which flank the complementary linker sequence. Thus "self-primed" constructs are generated and extension can occur in the direction of the arrows to produce the "longer" products. Moreover it will be appreciated that a terminal linking sequence of such longer product so generated may be able to hybridise with a terminal linking sequence of a further "longer" product or of a short product so that further extension is possible to produce fragments of greater length. (It should be noted that the generation of the longer products may take place partly in the first stage reaction and partly in the second stage reaction (discussed below) although we do not wish to preclude the possibility that these products are formed wholly in either the first or second stage reaction. It is for this reason that the generation of the "longer" products is illustrated within the box defined by dashed lines and the first and second stages of the PCR reactions are connected by dashed arrows.
At the end of the first stage reaction, the reaction mixture is preferably frozen to -20°C to deactivate any residual polymerase activity.
For the second stage of the reaction, an excess of flanking primers which define the 5' ends of the sense and anti-sense strands of the intended hybrid molecule is added to the reaction mixture. Fig. 2 illustrates these flanking primers are illustrated as FP1 and FP 2 together with the locations at which they hybridise. Also provided for the second stage reaction is further polymerase which is activated only at elevated temperature together with buffers, nucleotides etc. The reaction mixture is then subjected to temperature cycling as previously i.e. denaturation (e.g. at 95°C for 1 min), hybridisation e.g. at 60°C (e.g. for 1 min) and synthesis (e.g. at 72°C for 2 minutes).
Since the polymerase is only activated at elevated temperature, it is ensured that any sequences which randomly hybridise during the initial heating of the reaction mixture become denatured before the temperature at which the polymerase is activated so that there are substantially no extension reactions resulting from these hybridisations. Put another way, the only hybridisations which occur above the activation temperature of the polymerase are those which are required for generation of the hybrid molecule 1 as explained more fully below.
As a result of the second stage reaction there is produced the intended hybrid molecule.
It should be appreciated that a number of modifications may be made to the illustrated protocol. For example, at least some of the sequences x, x2....xn may initially be provided on separate chromosomes.
Furthermore, the primers p, and p2 may be external to the sequences x1, and xn respectively.
The invention is further described by the following non-limiting Example.
Example 1 1. 1 MATERIALS AND METHODS 1.1.1 Primer design
A set of primers were designed to amplify exons 6, 7, 8, 9 and 10 of the Neurofibromatosis type 2 (NF2) gene (see Appendix A). These five exons comprise approximately the middle third of the coding sequence of the gene. Primers were designed with the assistance of the Oligo v 4.1 program (MedProbe, Postboks 2640, St. Hanshaugen, N-0131, Oslo, Norway). The genomic specific segments of the primers were selected to have closely equivalent Tms (average Tm = 62.3°C @
180mM salt concn.). The complementary 5' termini of the self assembling primers were designed with randomly selected sequence of approximately 50% GC content, with no internal secondary structure and to have Tms that exceeded those of the genomic specific seqments in order to favour self assembly (average Tm = 64.9°C @
180mM salt concn.). A supplementary adenine residue was inserted between the genomic and 5' complementary segments of the self assembling primers in order to accommodate the 3' adenine overhangs added by Taq polymerase to the nascent DNA strand. All primers were checked for homology to Alu repeat sequences using the BLAST analysis program available at http://www.ncbi.nlm.nih.gov/cgi- bin/BLAST/nph-blast. Table 1 gives the sequences and Tms of the 12 primers used in the NF2 exon 6-10 array.
Primers were all synthesised at 0.05 μM scale and were reverse phase cartridge and HPLC purified (MWG Biotech).
1.1.2 Amplification of self assembling arrays
DNA was extracted from peripheral blood lymphocytes on an Applied Biosystems 380A DNA extractor.
PCR amplification of the self assembling DNA arrays was carried out in two stages. The primary reactions were carried out in 20μl volumes using 50ng of genomic DNA, 40nmol.L~l of primers 1-10 (Table 1), 750μmol.L"l of each dNTP, 0.6U Platinum Taq polymerase (GibcoBRL) in a lxPCR buffer comprising 67mM Tris-HCl (pH8.3 @ 25°C), 16.6mM ammonium sulphate, 3.7mM MgCl2 and
0.085mg.mL"l BSA. PCR amplification was carried out on Perkin-Elmer 2400 or 9600 thermal cyclers using the following parameters; initial denaturation 94°C (3 mins), 30 cycles of 94°C (1 min); 60°C (1 min); 72°C (2 mins) followed by a final synthesis of 72°C (10 mins). Immediately on completion of cycling the primary PCR reactions were frozen at -20°C to inactivate residual DNA polymerase activity. Table 1: Primer sequences for amplification of NF2 exon 6-10 self-assembling array. Primers 2 through to 9 are all internal to the self assembling array and contain one of four pairs of complementary 5' termini which are highlighted in italics. The extra adenine nucleotide incorporated to accommodate the 3' terminal adenine residue added by Taq polymerase to the nascent strand is underlined in bold type. The melting temperature (Tm) of the respective genomic or linker portions of each of the primers is also indicated.
Figure imgf000018_0001
The secondary reactions were carried out in separate 20μl volumes using 2μL of the primary PCR, 500nmol.L~l of primers 11 and 12 (Table 1), 200μmol.L~l of each dNTP, 0.6U Platinum Taq polymerase (GibcoBRL) in a lxPCR buffer comprising 50mM Tris-HCl (pH9.0 @ 25°C), 20mM ammonium sulphate and 1.5mM MgCl2- The thermal cycling conditions were identical to those used for the primary amplifications.
1.1.3 Labelling of DNA
Depending upon the final application the internal primers (11 & 12) were either unlabelled (sequencing and CCM probe DNA) or 5' biotin labelled (CCM test DNA). For the production of internally labelled fluorescent CCM probe DNA, secondary PCRs were set up with primary PCRs from normal control DNA, with the addition of TAMRA labelled dCTP (Perkin-Elmer) to a final concentration of 800nmol.L" of secondary PCRs. Otherwise reaction conditions were identical to those described previously for secondary PCRs.
1.1.4 Cycle Sequencing
For sequencing the remainder of the product was then electrophoresed on a preparative 1% agarose gel and the 1046bp band was excised and purified using a QiaQuick gel purification kit (Qiagen) according to the manufacturer's protocol with the modification that the dissolved gel slice was passed through the column three times during the binding stage in order to maximise recovery efficiency. The purified sample was then eluted off the column by the addition of 40μL of lOmM Tris.HCl (pH 8.0).
40-60ng of each sample was sequenced in both orientations using either primers 11 or 12 with BigDye terminator cycle sequencing kits (Perkin-Elmer, Applied Biosystems)). The manufacturer's protocols were followed with the exception that the annealing temperature for the cycle sequencing reaction was increased from 50°C to 55°C to reflect the high Tm of primers 11 and 12. The sequencing reactions were then electrophoresed and collected on an Applied Biosystems 377 fluorescent sequencer using 48cm well to read plates.
1.1.5 Chemical Cleavage of Mismatches (CCM)
Heteroduplexes were formed by heating equal quantities of unpurified biotinylated test DNA with unpurified internally TAMRA labelled normal control probe DNA at 94°C for 5 mins followed by annealing at 65°C for 12 hours.
The heteroduplexed DNA was purified by electrophoresing each sample through a 1% low gelling temperature agarose gel and cutting out the 1046bp band using a sterile scalpel. The volume of gel slice was estimated by weighing and the gel slice equilibrated for 20 mins in an equal volume of 1 x β-Agarase buffer comprising lOmM Bis-Tris HC1 (pH6.5) and ImM EDTA. The β-Agarase buffer was then removed and the gel slice heated at 70°C for 10 mins to liquefy the agarose followed by cooling to 37°C. A further equal volume of 1 x β-Agarase buffer was added followed by 1U of β-Agarase I (USB Biochemical). The gel slice was then digested overnight at 37°C.
30μL of each digested heteroduplex DNA sample was then combined with 10 μg of Dynabeads M-280 Streptavidin (Dynal), freshly washed according to the manufacturer's instructions and resuspended in 30μL of a binding and washing buffer comprising 2M NaCl, lOmM Tris.HCl (pH8.0), O.lmM EDTA and 0.4% Tween 20.
The heteroduplexes were then left to complex with the beads for 1 hour at 42°C. The samples were then placed on a magnet to separate the beads and the supernatant carefully removed using a pipette.
1.1.6 Hydroxylamine modification The beads with bound DNA were resuspended in 20μL of a solution of 4M hydroxylamine, 2.3M diethylamine and incubated at 37°C for 2 hours. The samples were then placed on a magnet to separate the beads and the supernatant was carefully removed using a pipette. Piperidine cleavage of modified bases was then immediately carried out.
1.1.7 Potassium permanganate modification
The beads with bound DNA were resuspended in 20μL of a solution of ImM
K_Mnθ4, 3M tetraethylammonium chloride and incubated at 25°C for 10 mins. The samples were then placed on a magnet to separate the beads and the supernatant was removed using a pipette. Piperidine cleavage of modified bases was then immediately carried out.
1.1.8 Piperidine cleavage
Prior to piperidine cleavage the beads were rinsed once with 50μL of TE buffer. Then the beads were resuspended in 5μL of a 1M solution of piperidine in deionised formamide to which Genescan 2500 Rox size standard (Perkin-Elmer) and dextran blue loading dye (Sigma) had been added. The samples were heated at 90°C for 30 mins to cleave the modified bases, snap chilled on ice and placed on a magnet to separate the beads from the unbound DNA now in the liquid phase.
1.1.9 Fluorescent fragment analysis
The supernatant was loaded onto a 24cm well to read 4% denaturing polyacrylamide gel on an Applied Biosystems 373XL fluorescent analyser. The gel was electrophoresed at 2500V, 30mA and 35W for 12 hours and data was collected with filter set A. After electrophoresis each lane was tracked and size calling performed using the internal size standard as a reference. Test samples were then compared with the normal control sample for the presence of novel cleavage products by overlaying using Genescan software. 1.2 Results
1.2.1 A 2μl portion of the product of step 1.1.2 applied to a 1% agarose gel confirmed the presence of the expected 1046bp fragment.
1.2.2 PCR amplification of each individual exon from the product of step 1.1.2 under common amplification conditions gave a single fragment of the expected size, confirming the integrity of the primer syntheses and the compatibility of the primer pairs, (see Fig 3a.)
1.2.3. Figs 4a and 4b show the product of step 1.1.2 sequenced from both termini. Fig 5a shows sequencing in the forward orientation using primer 11. Fig 4b shows sequencing in the reverse orientation using primer 12. The positions of the intron exon boundaries, primer annealing sites and linker sequences are indicated on the electropherograms. The product was seen to comprise the expected exons in the correct orientations. No discernible degradation of sequence was observed across the transitions from one component to the next.
1.2.4 The procedure of step 1.1.2 was repeated for a range of genomic DNA samples and consistently yielded fragments of the expected size. Reaction yields were generally high (~500ng per lOμl) with low background (see Fig 5a).
Example 2
In order to test the suitability of the products obtained by the procedure of the invention for downstream applications like mutation scanning, products from a series of 7 heterozygotes for NF2 mutations spread throughout four of the five NF2 CR exons were directly sequenced to confirm that the genotype present in genomic DNA was correctly represented in the product. The 7 mutant heterozygotes were as follows nt600-3OG (exon 7), nt676-7T>G (exon 8), nt713delC (exon 8), nt7840T (exon 8), nt855delT (exon 9), nt887delT (exon 10) and nt948G>T + nt949G>T (exon 10). All 7 mutations were clearly visible in the heterozygote state. Fig 6 gives example data from four representative mutation heterozygotes. We have also obtained heterozygote sequencing data of comparable quality on products that have not been gel-purified (data not shown). Thus, the gel purification step may be omitted in many protocols. 11 NF2 mutant heterozygotes were then retrospectively screened using a modified fluorescent solid-phase CCM method based on that of Rowley et al, as disclosed in Genomics 30, 574-582. The products were internally labelled using TAMRA dCTP in preference to end labelling. This method helps eliminate false positives resulting from background cleavage. Cleavage of internally labelled products should result in two labelled fragments with a total molecular weight equal to the uncleaved product. Mismatched cytosines were modified using hydroxylamine. However, on the grounds of safety and convenience mismatched thymines were modified using the potassium permanaganate in preference to osmium tetroxide.
The results are shown in Fig 6 Cleavage products are clearly visible in the lanes containing products from the following mutation heterozygotes Lane 3 - nt600- 30G (exon 7); Lane 6 - nt713delC (exon 8); Lane 8 - nt678insC (exon 8); Lane 10 - nt770delC (exon 8); Lane 11 - nt676-7T>G (exon 8) and Lane 12 - nt948G>T + nt949G>T (exon 10). The remaining samples are normal controls or from mutations that are expected to give mismatches unaffected by hydroxylamine modification.
Of the 11 mutations, 10 were detectable using either hydroxylamine or potassium permanganate modification (see Table 2). Table 2: Detection of 11 NF2 mutation heterozygotes by fluorescent solid-phase CCM. The predicted mismatched bases/pairs of bases are given for each mutation. Positive cleavage after the two modifications is indicated as either Yes - clear cleavage, (Yes) - weak but reproducible cleavage, No - no detectable cleavage.
Figure imgf000024_0001
The mutation not detected by either condition, nt676-2A>T, is predicted to produce heteroduplexes detectable only by potassium permanganate modification (T:T/A:A mismatches). Furthermore, two other mutations producing heteroduplexes with mismatched thymines (nt784C>T and nt903C>T) had undetectable levels of cleavage after potassium permanganate modification. However, both these mutations also produce mismatched cytosines which were detected after hydroxylamine modification. All of the mutations predicted to produce heteroduplexes with mismatched cytosines produced visible cleavage products after hydroxylamine modification. Example 3
3.1 Procedure
The procedure of steps 1.1.1 and 1.1.2 (see Example 1) was repeated to amplify exons 8, 9, 10, 11 and 12 of the Human mismatch repair, hMLHl gene. The primers are as shown in Table 3.
The genomic specific segments of the primers were selected to have closely equivalent Tms (set average Tm = 60.8°C at a salt concentration of 180mM). The complementary 5' termini or linker segments of the primers were designed with random sequence of approximately 50% GC content, with no internal secondary structure and to have Tms that exceeded those of the genomic specific seqments in order to favour self assembly (set average Tm = 65.4°C, both at a salt concentration of 180mM). A supplementary unmatched adenine residue was inserted between the genomic and 5' linker segments of the self assembling primers in order to accommodate the 3' adenine overhangs added by Taq polymerase to the nascent DNA strand. All primers were checked for homology to Alu repeat sequences using the BLAST analysis program available at http://www.ncbi.nlm.nih.gov/cgi- bin/BLAST/nph-blast.
Table 3
Figure imgf000026_0001
Figure imgf000026_0002
3.2 Results
3.2.1 A 2μl portion of the product of step 1.1.2 applied to a 1% agarose gel confirmed the presence of the expected 1247bp fragment.
3.2.2 PCR amplification of each individual exon from the product of step 1.1.2 under common amplification conditions gave a single fragment of the expected size, confirming the integrity of the primer syntheses and the compatibility of the primer pairs, (see Fig 3b.)
3.2.3 The procedure of step 1.1.2 was repeated for a range of genomic DNA samples and consistently yielded fragments of the expected size. Reaction yields were generally high (~500ng per lOμl) with low background (see Fig 5b).
APPENDIX A
Genomic sequences of NF2 exons 6-10 amplified by the self assembling array. Exonic sequence is indicated by capitals, intronic sequence is in lower case. The annealing sites of primers used in the primary PCR reaction to generate the five self assembling DNA fragments are marked in bold underlined sequence. The annealing sites of the internal primer pair used during the secondary PCR to drive the array assembly are marked in underlined italics. The primary and secondary primers for exon 10 reverse overlap, the region of overlap is marked in bold, underlined italics.
NF2 Exon 6 (SEQ ID NO. 25) tctgtgtgac tactcctggt gtagctttaa aatagcttta ctgtttgtaa aatgatgcat 60 aattataaaa gtggcaaaca ataccaaatt tacttcafcgt qtaggt t tt t ta tt t tqctc 120 tattttttgg tagGTAATAA ATCTGTATCA GATGACTCCG GAAATGTGGG AGGAGAGAAT 180
TACTGCTTGG TACGCAGAGC ACCGAGGCCG AGCCAGgtga ggcccattca ttgttggttt 240 acattccttt atgggc 256
NF2 Exon 7 (SEQ ID NO. 26) gaatgcttga tttggtggcc cacccgctct ccacccatct cacttagctc caatgacagt 60 gtcttccgtt ctccccacag GGATGAAGCT GAAATGGAAT ATCTGAAGAT AGCTCAGGAC 120
CTGGAGATGT ACGGTGTGAA CTACTTTGCA ATCCGGgtgt gttgaaacct ctctgagctc 180 cttgtgtagt agacagagac tgagtgaggg ccaggactqc taaaatggtt acttcttcat 240
NF2 Exon 8 (SEQ ID NO. 27) tctgtggacc tgctgaactg cacatgtgac agtgtgtgcc agattctttg gaaggttgaa 60 taaaatttt qagcctcagct ggcgcttaca gtagctgttc ttattggatc cacagAATAA 120
AAAGGGCACA GAGCTGCTGC TTGGAGTGGA TGCCCTGGGG CTTCACATTT ATGACCCTGA 180
GAACAGACTG ACCCCCAAGA TCTCCTTCCC GTGGAATGAA ATCCGAAACA TCTCGTACAG 240
TGACAAGGAG gtaggacatg tqtqtactgc agatgggtcc agcagatctt tccctgtctg 300 cccccctcac tggagcctcc ccagccaggg catctccttg ttattcatag agtcctttaa 360 ttcccaggct ttgagggtgt ggttgtt 387 NF2 Exon 9 ( SEQ ID NO . 28 ) gacttggtgc tcctaattcc ctgaggttta gtgcctggat actgggaagc cagnacaagg 60 gcataacntc atgctggtct gtggccagtg tggttgcgca tttgtggaat tnccaattgc 120 tggtaacatt ccaggctgtc ggactgaaac tgtqttctgc ttcattcttc cagTTTACTA 180
TTAAACCACT GGATAAGAAA ATTGATGTCT TCAAGTTTAA CTCCTCAAAG CTTCGTGTTA 240
ATAAGCTGGT AAGTTGAGAT CCTGgtaagt tgagatcctg gttttcatta ctgataatgg 300 tagcttttct gagaa 315
NF2 Exon 10 (SEQ ID No. 29) tgctacctgc aagagctcaa actgctatgg cactagtggg ccagta ggcagtgaagtaaa 60 tttgtggata ttaacctttt tgtctgcttc tgtggccaca gATTCTCCAG CTATGTATCG 120
GGAACCATGA TCTATTTATG AGGAGAAGGA AAGCCGATTC TTTGGAAGTT CAGCAGATGA 180
AAGCCCAGGC CAGGGAGGAG AAGGCTAGAA AGCAGgtgag cacaaccttg ttttaactga 240 tgatgtcact gtgtggtcag tcctggcct 269

Claims

1. A method of producing a hybrid DNA molecule having a sense strand and an anti-sense strand and in which, reading in the 5' to 3' direction, the sense strand has the sequences x„ x2 xn, where n is greater than or equal to 3, the method comprising the steps of
(i) providing in a single reaction mixture
(a) the sequences x,, x2 xn and their complementary sequences x,', x2' xn', to be assembled into the hybrid molecule,
(b) for each pair of complementary sequences defined in (a) a respective pair of PCR primers each having a priming sequence and which are such that the primers hybridising to the 3' ends of any two sequences (xi3 x'(i+n). where i is 1 to (n-1), have specifically complementary linker sequences
(2) effecting a first stage PCR reaction in which those primers provided with linker sequences are present in limiting concentrations, and
(3) effecting a second stage PCR reaction using a single pair of primers one of which provides the 5'-end of the sense strand and other of which provides the 3 '-end of the anti-sense strand of the required hybrid molecule
whereby said hybrid molecule is generated.
2. A method as claimed in claim 1 wherein the polymerising enzyme adds a 3' adenosine overhang to an extended strand and those primers incorporating linker sequences have their priming sequences connected to their respective linker sequences via an adenine residue.
3. A method as claimed in claim 2 wherein the polymerising enzyme is Taq.
4. A method as claimed in any one of claims 1 to 3 wherein the annealing temperature (Tm) of the linker sequences is greater than that of the priming sequences to the x and x' sequences.
5. A method as claimed in claim 4 wherein the annealing temperature of the linker sequences is 2 to 5°C greater than that of the priming sequences to the x and x' sequences.
6. A method as claimed in any one of claims 1 to 5 wherein the linker sequences do not have intrinsic secondary structure.
7. A method as claimed in any one of claims 1 to 6 wherein between the first and second stage PCR reactions the reaction mixture is frozen to deactivate residual PCR activity.
8. A method as claimed in any one of claims 1 to 6 wherein between the first and second stage PCR reactions the reaction mixture is treated with an exonuclease I to digest single stranded molecules.
9. A method as claimed in any one of claims 1 to 8 wherein each of the first and second stage PCR reactions utilise a thermally activated polymerase.
10. A method of mutation analysis wherein the analysis is effected on a DNA hybrid molecule produced in accordance with the method of any one of claims 1 to 9,
1. A set of primers incorporating the following sequences.
'tcatattagccgctgcattgcc-a-3 ' 'ggcaatgcagcggctaatatga-a- 3'
'agccactacccaaactcctgt-a-3' 'acaggagtttgggtagtggct-a-3'
'tgtctcactgaacctgcctacct~a-3' 5'aggtaggcaggttcagtgagaca-a-3'
5'cctcat taccggctgtcagactg-a-3' 5 ' cagtctgacagccggtaatgagg-a-3 '
12. A method of producing a hybrid DNA molecule having a sense strand and an anti-sense strand and in which, reading in the 5' to 3' direction, the sense strand has the sequences x„ x2 xn, where n is greater than or equal to 3, the method comprising the steps of
(i) providing in a single reaction mixture
(a) the sequences x,, x2 xn and their complementary sequences x,', x2' xn', to be assembled into the hybrid molecule,
(b) for each pair of complementary sequences defined in (a) a respective pair of PCR primers each having a priming sequence and which are such that the primers for the 3' ends of any two sequences (xi5 x'(i+1)), where i is 1 to (n-1), have specifically complementary linker sequences connected to their respective priming sequences via an adenine residue, and (2) effecting a PCR reaction using a polymerase which adds a 3' adenine overhang to the end of an extended strand
PCT/GB1999/001691 1998-06-12 1999-06-14 Method of generating nucleic acid hybrids for mutation analysis WO1999064624A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002330252A CA2330252A1 (en) 1998-06-12 1999-06-14 Method of generating nucleic acid hybrids for mutation analysis
AU53775/99A AU5377599A (en) 1998-06-12 1999-06-14 Nucleic acids
EP99939503A EP1086250A2 (en) 1998-06-12 1999-06-14 Method of generating nucleic acid hybrids for mutation analysis
JP2000553614A JP2002517258A (en) 1998-06-12 1999-06-14 Methods for generating nucleic acid hybrids for mutation analysis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9812674.1 1998-06-12
GBGB9812674.1A GB9812674D0 (en) 1998-06-12 1998-06-12 Nucleic acids

Publications (2)

Publication Number Publication Date
WO1999064624A2 true WO1999064624A2 (en) 1999-12-16
WO1999064624A3 WO1999064624A3 (en) 2000-09-14

Family

ID=10833627

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/001691 WO1999064624A2 (en) 1998-06-12 1999-06-14 Method of generating nucleic acid hybrids for mutation analysis

Country Status (6)

Country Link
EP (1) EP1086250A2 (en)
JP (1) JP2002517258A (en)
AU (1) AU5377599A (en)
CA (1) CA2330252A1 (en)
GB (1) GB9812674D0 (en)
WO (1) WO1999064624A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2295603A1 (en) * 2000-06-06 2011-03-16 Life Technologies Corporation Method and devices for multiplexing amplification reactions
EP2351853A1 (en) * 2000-06-06 2011-08-03 Life Technologies Corporation Method and devices for multiplexing amplification reactions
US8304214B2 (en) 2000-06-06 2012-11-06 Applied Biosystems, Llc Methods for multiplexing amplification reactions
US8323897B2 (en) 2002-12-04 2012-12-04 Applied Biosystems, Llc Multiplex amplification of polynucleotides
WO2013093530A1 (en) 2011-12-20 2013-06-27 Kps Orvosi Biotechnológiai És Egészségügyi Szolgáltató Kft. Method for determining the sequence of fragmented nucleic acids

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023171A (en) * 1989-08-10 1991-06-11 Mayo Foundation For Medical Education And Research Method for gene splicing by overlap extension using the polymerase chain reaction
WO1992015678A1 (en) * 1991-03-01 1992-09-17 Stratagene Pcr generated dicistronic dna molecules for producing antibodies
WO1999016904A1 (en) * 1997-09-29 1999-04-08 City Of Hope Efficient linking of nucleic acid segments

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5023171A (en) * 1989-08-10 1991-06-11 Mayo Foundation For Medical Education And Research Method for gene splicing by overlap extension using the polymerase chain reaction
WO1992015678A1 (en) * 1991-03-01 1992-09-17 Stratagene Pcr generated dicistronic dna molecules for producing antibodies
WO1999016904A1 (en) * 1997-09-29 1999-04-08 City Of Hope Efficient linking of nucleic acid segments

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NEWTON ET AL: "PCR, 2. Auflage" 1997 , SPEKTRUM AKADEMISCHER VERLAG , HEIDELBERG XP002134140 Kapitel 4. Klonierung und Modifizierung von PCR-Produkten, pages 69-85 page 79-81 *
SANDHU ET AL: "Dual assymetric PCR: One-step construction of synthetic genes" BIOTECHNIQUES, vol. 12, no. 1, 1992, pages 14-16, XP002134139 *
See also references of EP1086250A2 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9481907B2 (en) 2000-06-06 2016-11-01 Applied Biosystems, Llc Methods for multiplexing amplification reactions
EP2351853A1 (en) * 2000-06-06 2011-08-03 Life Technologies Corporation Method and devices for multiplexing amplification reactions
US8304214B2 (en) 2000-06-06 2012-11-06 Applied Biosystems, Llc Methods for multiplexing amplification reactions
EP2295603A1 (en) * 2000-06-06 2011-03-16 Life Technologies Corporation Method and devices for multiplexing amplification reactions
US10106845B2 (en) 2000-06-06 2018-10-23 Applied Biosystems, Llc Methods for multiplexing amplification reactions
US8815546B2 (en) 2000-06-06 2014-08-26 Applied Biosystems, Llc Methods for multiplexing amplification reactions
EP2949757A1 (en) * 2000-06-06 2015-12-02 Life Technologies Corporation Methods and devices for multiplexing amplification reactions
US9206475B2 (en) 2000-06-06 2015-12-08 Applied Biosystems, Llc Methods for multiplexing amplification reactions
US8323897B2 (en) 2002-12-04 2012-12-04 Applied Biosystems, Llc Multiplex amplification of polynucleotides
US9822405B2 (en) 2002-12-04 2017-11-21 Applied Biosystems, Llc Multiplex amplification of polynucleotides
US10689695B2 (en) 2002-12-04 2020-06-23 Applied Biosystems, Llc Multiplex amplification of polynucleotides
US11667964B2 (en) 2002-12-04 2023-06-06 Applied Biosystems, Llc Multiplex amplification of polynucleotides
WO2013093530A1 (en) 2011-12-20 2013-06-27 Kps Orvosi Biotechnológiai És Egészségügyi Szolgáltató Kft. Method for determining the sequence of fragmented nucleic acids

Also Published As

Publication number Publication date
AU5377599A (en) 1999-12-30
JP2002517258A (en) 2002-06-18
CA2330252A1 (en) 1999-12-16
WO1999064624A3 (en) 2000-09-14
EP1086250A2 (en) 2001-03-28
GB9812674D0 (en) 1998-08-12

Similar Documents

Publication Publication Date Title
Pogulis et al. In vitro recombination and mutagenesis by overlap extension PCR
US5759822A (en) Method for suppressing DNA fragment amplification during PCR
US5834252A (en) End-complementary polymerase reaction
JP6374964B2 (en) Sequence capture method using a special capture probe (HEATSEQ)
US5525493A (en) Cloning method and kit
US20030207279A1 (en) Amplification of DNA to produce single-stranded product of defined sequence and length
US6846626B1 (en) Method for amplifying sequences from unknown DNA
WO2007123742A2 (en) Methods and compositions for increasing the fidelity of multiplex nucleic acid assembly
US20040091923A1 (en) Linked linear amplification of nucleic acids
EP0854935B1 (en) Method for contiguous genome sequencing
CA2001110A1 (en) Compositions and process for amplifying and detecting nucleic acid sequences
WO1991018114A1 (en) Polynucleotide amplification
WO2003033718A1 (en) Synthesis of oligonucleotides on solid support and assembly into doublestranded polynucleotides
Buzdin et al. GREM, a technique for genome-wide isolation and quantitative analysis of promoter active repeats
JP2002535999A (en) Genome analysis method
Moss History and development of molecular biology
US6335184B1 (en) Linked linear amplification of nucleic acids
WO1999064624A2 (en) Method of generating nucleic acid hybrids for mutation analysis
EP3237635B1 (en) Method for generating sequence ready fragments by the use of "bubble primers"
JP4455335B2 (en) Nucleic acid amplification method and single nucleotide polymorphism detection method
EP3759243B1 (en) Methods and compositions for enriching nucleic acids
CN113913493A (en) Rapid enrichment method for target gene region
JP4681129B2 (en) Asymmetric modification of nucleic acid terminal region
KR100844010B1 (en) Method for Simultaneous Amplification of Multi-gene
WO2023081373A1 (en) Using hairpin formation to identify dna and rna sequences having a target nucleic acid sequence

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

ENP Entry into the national phase in:

Ref document number: 2330252

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1999939503

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999939503

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09719362

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 1999939503

Country of ref document: EP