WO1999063062A1

WO1999063062A1 - Genetically manipulated entomopoxvirus

Info

Publication number: WO1999063062A1
Application number: PCT/AU1999/000416
Authority: WO
Inventors: David James Dall
Original assignee: Commonwealth Scientific And Industrial Research Organisation
Priority date: 1998-05-29
Filing date: 1999-05-28
Publication date: 1999-12-09
Also published as: AUPP380598A0

Abstract

Recombinant entomopoxviruses, particularly recombinant Heliothis armigera entomopoxvirus (HaEPV) are described wherein heterologous DNA is located in the genome within the intergenic region between the fusolin gene and the p68 gene. Such recombinant viruses are useful as biological insecticides and in the production of desired biologically-active proteins, polypeptides and peptides in cell culture.

Description

GENETICALLY MANIPULATED ENTOMOPOXVIRUS

Field of the Invention:

This invention relates to the production of recombinant entomopoxviruses (EPVs), particularly recombinant Heliothis armigera entompoxviruses (HaEPVs), capable of expressing heterologous DNA sequences. In one particular application, recombinant EPVs in accordance with the invention are used in methods to control the proliferation of pest insects.

Background of the Invention:

Entomopoxviruses are large, double-stranded DNA viruses of insects such as Lepidoptera and Coleoptera. The economic importance of these insect groups, together with the observation that individual EPVs generally exhibit a narrow host range, has led to the identification of EPVs as potential biological control agents. However, unfortunately, most EPVs do not exhibit levels of pathogenicity that make them suitable for this purpose.

In order to make EPVs more suitable for use as biological control agents, it is possible to introduce into the genome of the viruses heterologous DNA sequences encoding insecticidal agents (e.g. toxin proteins), such that following ingestion by an insect, the insecticidal agent will be produced in the infected cells. However, for such viruses to be effective, it is necessary that the heterologous DNA sequences be introduced into a "non-essential" region of the viral genome such that it does not interfere with infectivity. Suitable non-essential regions in EPV genomes have been previously described. For example, in the International Patent Application No. PCT/US92/00855 [WO 92/14818] recombinant Amsαcta moorei EPVs (AmEPVs) are described wherein heterologous DNA is located at the non- essential spheroidin locus. Spheroidin is a major component of EPV occlusion bodies (spheroids), but since occlusion is only required for horizontal viral transmission, and not the processes of viral replication, the spheroidin gene provides a suitable region for the introduction of heterologous DNA.

The present applicant has also previously identified and described non-essential regions of the HaEPV genome that are suitable for the introduction of heterologous DNA (see International Patent Application No. PCT/AU93/00284 [WO 93/25666]). These regions include the fusolin (spindle protein) gene, a region encoding a putative 11.5 kD protein (the pll.5 ORF), and an intergenic region between the fusolin gene and the pll.5 ORF. Intergenic regions, by their very name, suggest that they may be suitable non-essential regions for the introduction of heterologous DNA. However, commonly, intergenic regions include short open reading frames (ORFs) potentially encoding peptides of 40 - 60 amino acids (approximate M_r of 4500 - 6000) and, while these are likely to be non-functional, it is clearly preferable not to destroy such ORFs if it can be avoided.

The present invention stems from the applicant's identification of a further intergenic region of the HaEPV genome. This intergenic region, which separates the fLisolin gene and a gene encoding a 68 kD protein (the p68 gene), and which has been cloned as part of a 4.9 kb fig/H-generated DNA fragment (Dall et al., 1993; and Figure l[a]), appears to be particularly suitable for the introduction of heterologous DNA since it is devoid of ORFs encoding products of 35 amino acids or more, and is unusually large (771 nucleotides in length). The nucleotide sequence of this region has been deposited in GenBank as part of Accession U44841, and disclosed in Figure l[b] of Osborne et al. (1996).

Summary of the Invention:

Accordingly, in a first aspect, the invention provides an infectious, spindle body-producing recombinant entomopoxvirus wherein heterologous DNA is located in the genome within the intergenic region between the fusolin gene and the p68 gene.

The fusolin gene encodes a protein of approximately 40 kD that forms the spindle bodies of EPVs. Spindle bodies are believed to be involved in modulating the infectivity and/or pathogenicity of EPVs. The nucleotide sequence for the fusolin gene of HaEPV has been previously decribed in

International Patent Application No. PCT/AU93/00284 [WO 93/25666], the entire disclosure of which is to be regarded as incorporated herein by reference.

The p68 gene encodes a protein of approximately 68 kD essential for virion formation (more specifically, the protein is involved in diverting components of the intermediate compartment of host cell Golgi bodies for the formation of virion particle core structure). The gene is an EPV homologue of the vaccinia virus (W) p65 gene and, like the W p65 gene, encodes a protein that is essential to virus replication (Osborne et al., 1996). The gene is located within an approximately 11.5 kbXbol segment of the HaEPV genome (fragment Xhol Ε), and the N-terminal region of the gene (about

1300 bp) is located at the 3' end of the 4.9 kb Bglll HaEPV genomic fragment (Figure l[a]), 771 bp "downstream" of the HaEPV spindle protein (fusolin) gene. The nucleotide sequence for the p68 gene of HaEPV has been previously described in Osborne et al., (1996) and GenBank Accession U44841, the entire disclosures of which are to be regarded as incorporated herein by reference. It will be understood that homologues of the p68 gene of EPVs other than HaEPV may encode proteins that vary from the 68 kD size observed in HaEPV. The term "p68 gene" is therefore to be understood as referring to all EPV homologues of the HaEPV p68 gene and, especially, those EPV homolog ies showing > 50%, preferably > 75% and more preferably

> 95%, sequence homology to the nucleotide sequence of the HaEPV p68 gene wherein the homology is calculated by the BLAST program blastn as described by Altschul, S.F., et al., "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Research, Vol. 25, No. 17, pp 3389-3402 (1997).

Preferably, the recombinant entomopoxvirus is selected from the group consisting of Amsacta moorei EPV, Choristoneura biennis EPV, Choristoneura fumiferana EPV, Heliothis armigera EPV, Pseudaletia separata EPV, Aphodius tasmaniae EPV, Dermolepida albohirtum EPV, Melolontha melolontha EPV, Anomala cupraea EPV and Seήcesthis nigrolineata EPV. Most preferably, the recombinant entomopoxvims is Heliothis armigera EPV.

The heterologous DNA comprises a gene or other sequence of interest, preferably operably linked to a promoter sequence for expression. Where the heterologous DNA comprises a gene, the promoter sequence may be the gene's native promoter or another suitable promoter such as an entomopoxvims promoter. Preferred entomopoxvirus promoters include the fusolin gene promoter, the spheroidin gene promoter and the pll.5 ORF promoter (International Patent Application No. PCT/AU93/00284 [WO 93/25666]). The recombinant entomopoxviruses may, in addition, comprise heterologous DNA located within one or more other non-essential region(s) of the genome, particularly, within the fusolin and/or spheroidin genes.

Recombinant entomopoxviruses according to the invention may be used as biological control agents for insects optionally in admixture with an acceptable agricultural carrier. As such, the heterologous DNA may comprise a gene(s) or other sequence(s) which encode one or more substances that are deleterious to insects. Such substances include, for example, insecticidal toxins of heterologous origin (e.g. straw itch mite (Pyejiio.es tritici) insecticidal toxin (SIMT) (Tomalski, and Miller, 1991),

Bacillus thuringiensis δ-toxin (Possee, et al., 1990), insect neurohormones (Maeda, S., 1989) or proteins which interact with such hormones (O'Reilly and Miller, 1989; Hammock et al., 1990), insecticidal compounds from wasp or scorpion (e.g. North African Scorpion (Androctonus australis Hector) insecticidal toxin (AaHIT) (Stewart, L.M.D., et al., 1991)), or factors designed to attack and kill infected cells in such a way as to cause pathogenesis in the infected tissue (e.g. a ribozyme targeted against an essential cellular function).

Thus, in a second aspect, the present invention provides a method for controlling the proliferation of pest insects, comprising applying to an infested area an infectious, spindle body-producing recombinant entomopoxvirus wherein heterologous DNA encoding one or more substances that are deleterious to insects is located in the genome within the intergenic region between the fusolin gene and the p68 gene, optionally in admixture with an acceptable agricultural carrier.

Further, the recombinant entomopoxviruses according to the invention may be used for the production of desired, biologically-active proteins, polypeptides or peptides, for example cytokines such as interferon (e.g. IFN-δ, IFN-β, IFN-γ), tissue plasminogen activator (TPA), lymphotoxin (LT), macrophage activating factor (MAF), insulin, epithelial cell growth factor

(EGF), human growth hormone (hGH), antibodies and fragments thereof, etc.

Thus, in a third aspect, the present invention provides a method for producing a desired protein, polypeptide or peptide comprising infecting susceptible host cells with an infectious, spindle body-producing recombinant entomopoxvirus wherein heterologous DNA encoding said desired protein, polypeptide or peptide is located in the genome within the intergenic region between the fusolin gene and the p68 gene.

Suitable host cells for use in the method of third aspect include cultured Helicoverpa and Spodoptera cells. Preferred host cells are the Helicoverpa Hz-AMl line (Mclntosh and Ignoffo, 1981), the Spodoptera Sf9 line (ATCC CRL 1711), or similar cells.

In addition to the entomopoxvirus promoters mentioned above, the applicant has also identified further novel promoter sequences within the genome of HaEPV that might also be suitable for the expression of genes or other sequences of interest.

Thus, in a fourth aspect, the present invention provides an isolated

DNA molecule comprising a promoter sequence selected from the group consisting of:

TAAAATTTGAATTTTTATTTAAATAATATAAAAAATATTAAA (ATG) (SEQ ID NO: 1)

CCGCTATTAATAATTCATAATAAA (ATG) (SEQ ID NO: 2)

CAAAAATTGTTTATTAAATAA (ATG) (SEQ ID NO: 3)

GAAATAATATATAAATAATAAATATAAAT (ATG) (SEQ ID NO: 4) GTTTAAATTTAATAAATATTTATAATAATACGAAAT (ATG) (SEQ ID NO: 5)

CCGATAAATTTATATATAATTTTA (ATG) (SEQ ID NO: 6)

TTTTTTATATATTTATCTTGGGCTCTT (ATG) (SEQ ID NO: 7)

GTCTACATACAATAAATAATAAATAATAA (ATG) (SEQ ID NO: 8) GACAAAAATACAATTATATATA (ATG) (SEQ ID NO : 9) GGTTAGATAATTTATATATAGATACTAT (ATG) (SEQ ID NO: 10) and vaπants thereof showing > 75%, preferably > 90% and more preferably >

95% sequence homology, wherein the homology is calculated by the BLAST program blastn (Altschul, S.F., et al., 1997 supra).

The terms "comprise", "comprises" and "comprising" as used throughout the specification are intended to refer to the inclusion of a stated component, feature or step or group of components, features or steps with or without the inclusion of a further component, feature or step or group of components, features or steps. Detailed description of the Invention:

The invention will now be further described with reference to the accompanying figures and non-limiting examples.

Brief description of the accompanying figures:

Figure 1(a) provides the complete nucleotide sequence of the 4.9 kb BgHl-generated HaEPV genomic DNA fragment (SEQ ID NO: 44) containing the intergenic region discussed herein, together with conceptual translations of open reading frames encoding products of 50 or more amino acids (SEQ ID

NOS: 45-50).

Figure 1(b) provides the genomic nucleotide sequence for the HaEPV DNA polymerase gene and 5' and 3' flanking sequences (SEQ ID NO: 51). The putative amino acid sequence for the encoded DNA polymerase is also shown (SEQ ID NO: 52).

Figure 2 provides a diagram showing the construction of a viral transfer vector svύtable for introducing heterologoLis DNA into EPV genomes to produce recombinant EPVs according to the invention.

Figure 3(a) provides a schematic diagram for "Strategy 1" construction of viral transfer vectors that may be used to produce recombinant EPVs according to the invention.

Fig ire 3(b) provides a schematic diagram of "Strategy 2" construction of viral transfer vectors that may be used to produce recombinant EPVs according to the invention. Figure 4 provides a schematic diagram of the construction of viral transfer vector pHaTV397.2

Figure 5 provides a schematic diagram of the construction of viral transfer vector pHaTV698.1

Figure 6 provides a schematic diagram of the construction of viral transfer vector pHaTV397.1

Figure 7 provides a schematic diagram of the construction of viral transfer vector pHaTV597.1

Figure 8 provides a schematic diagram of the construction of viral transfer vector pHaTV597.3 Figure 9 provides a schematic diagram of the construction of viral transfer vector pHaTV397.4 Examples:

MATERIALS AND METHODS

(1) Construction of a viral transfer vector containing a multiple cloning site.

A sub-cloned derivative (pHaTV3) of a 4.9 kb Sg/II-generated fragment of the HaEPV genome (clone #36; Dall et al., 1993) was prepared using standard laboratory protocols (Sambrook et al., 1989), and specifically, by digesting the parental plasmid DNA wiύiXbal, end-filling with Klenow DNA polymerase, re-closing by blunt end ligation, and transforming competent E. coli cells. The subclone recovered from this procedm-e contained the 3' portion of the HaEPV fusolin gene, the 5' portion of the 68 kD "rifampicin resistance" gene and the complete intervening intergenic sequence. A custom synthesised oligonucleotide ("oligo"; TV3961C: Table 1) was then produced corresponding to nucleotides 3332-3361 of the intergenic region, as shown in Figure 1(a), to mutagenise base #3342 from a cytosine to a guanosine residue (as indicated in italics in the sequence of TV3961C, Table 1), and in doing so, create a novel and unique Spel restriction endonuclease recognition site in the intergenic sequence. Two further custom synthesised and partially complementary oligos (TV3SL1 and TV3SL2: Table 1) were then produced and annealed to each other, thereby producing a double-stranded (ds) DNA fragmeut with Spel compatible single-stranded (ss) overhanging ends, internal BamUI and bαl recognition sites, and a consensus poxvirus early transcription termination signal (ETTS: base sequence of 5'-T₅NT; Yuen & Moss, 1987). This annealed dsDNA sequence was subsequently inserted into the uniq ie Spel site of the plasmid described above, creating pHaTV3MCSl, which thus contains a multiple cloning site (MCS) comprising unique Spel, BαπiHI, and bαl sites immediately 5' to the ETTS (Figure 2). Note that while the 3' ssDNA overhang of the annealed TV3SL1/TV3SL2 hybrid is compatible with a Spel generated "sticky end", use of a thymidine residue as the 3' base in the annealed TV3SL1 sequence means that this region is no longer comprised of a Spel recognition sequence, thus maintaining the unique character of the Spel site at the 5' end of the MCS.

(2) Sources of elements for control of expression of heterologous genes from a novel intergenic site. Characterisation of various regions of the HaEPV genome has provided a number of nucleotide sequences, derived from upstream controlling/promoter elements of newly identified viral genes, that either are, or are expected to be, suitable for use in controlling expression of one or more heterologous genes inserted into the genome of recombinant forms of

HaEPV (recHaEPVs).

In one such example (Crnov & Dall, [1] in press), a 4183 bp stretch of contiguous HaEPV genomic DNA has been characterised from a region including and surrounding the junction of genomic Xhol fragments A and B (Sriskantha et al., 1997), approximately between map units 30 and 32 of the

HaEPV genome. This sequence contains one incomplete open reading frame (ORF) and six complete genes/ORFs (ORFs 2-7; Figure 1: Crnov and Dall [1] in press), and has been deposited as GenBank Accession AF022176. Two of the genes (ORFs 2 and 3) have been identified as encoding an HaEPV virion protein and the regulatory subunit of the viral poly(A) polymerase enzyme, respectively (Crnov and Dall, [1] in press), while the functions of other ORFs remains to be determined. The nucleotide sequences 5' ("upstream") of each of these ORFs, as disclosed in Table 2, have demonstrated or potential use in combination with, and as controlling or promoter elements for, heterologous genes inserted into the genomes of EPVs.

In a second example (Crnov and Dall, unpublished ms [2]), a 2606 bp stretch of contiguous HaEPV genomic DNA has been characterised comprising an EcoRI fragment contained within the Hindϊll B fragment (Sriskantha et al., 1997), and located approximately between map inits 95 and 120 of the HaEPV genome. This sequence contains two incomplete ORFs and 3 complete genes/ORFs. One of the ORFs (ORF 4, Figure 1, Crnov and Dall. unpublished ms [2]) has been identified as the only known EPV-derived and full length homologue of ORFs described, in an incomplete form, from granulosis viruses of Helicoverpa armigera, Pseudaletia unipunctata and Trichoplusia ni (Crnov and Dall, unpublished ms [2]; Hashimoto et al., 1991;

Roelvink et al., 1995). The nucleotide sequences 5' ("upstream") of each of these HaEPV ORFs, as disclosed in Table 2, have demonstrated or potential vise in combination with, and as controlling or promoter elements for, heterologous genes inserted into the genomes of EPVs. In a further example, the HaEPV DNA polymerase gene has been located and cloned. The full nucleotide sequence, including that immediately upstream of the gene (see Table 2), is shown at Figure 1(b). This upstream sequence, together with others based on it, but optimised for expression at higher levels and/or for longer temporal duration, is expected to be similarly useful in driving heterologous gene expression from recombinant EPVs.

Likewise the sequence immediately upstream of the HaEPV spheroidin gene, located at the rightwards end of genomic Xhol fragment D (Sriskantha et al., 1997), has been determined and used to demonstrate expression of heterologous genes inserted into the genomes of EPVs.

(3) Assembly of promoter/ gene constructs for insertion into a novel intergenic site.

Two strategies were used to assemble promoter/gene constructs into preferred arrangements in transfer vectors, for subsequent insertion in recombinant EPVs, each based on custom synthesised oligos and use of polymerase chain reaction (PCR).

The first of these ("Strategy 1"; see Figure 3[a]) employs;

(1) an "upstream" oligo that typically encodes a restriction endonuclease (REN) recognition site, a promoter sequence of interest, and a region corresponding to the 5' end of the gene of interest, and

(2) a "downstream" oligo complementary to the 3' end of the gene of interest, typically also containing a REN recognition site, which may be the same or different to that at the upstream end. As shown in Figure 3(a), PCR amplification (Step 1) then generates an amplicon (a) containing a desired promoter/gene combination in a form suitable for cloning into the MCS of a transfer vector (b), such as pHaTV3MCS 1 (Step 2).

As described in the following Examples 1 and 4, this strategy was used to insert an HaEPV 30 kD (VP8) protein promoter//αcZ marker gene complex into the MCS of pHaTV3MCSl, creating transfer vectors (pHaTV397.3 and pHaTV597.1), that were, in turn, subsequently used in production of b-gal- expressing recombinant HaEPVs. Similarly, it was used as part of the second strategy (see below) to insert an HaEPV spheroidin promoter/GFP marker gene complex into the MCS of pHaTV3MCSl, creating a transfer vector (pHaTV397.1) that was subsequently used in the production of GFP- expressing recombinant HaEPVs.

In the second strategy ("Strategy 2"; see Figure 3[b]), the gene of interest was seamlessly inserted behind a selected promoter that had previously been cloned in a natural genomic context, such that the gene of interest replaced the viral gene previously expressed from the locus, before being mobilised into the intergenic site. As shown in Figure 3(b), this assembly process involves several discrete steps, viz., Step (1). PCR synthesis of an amplicon comprising an "upstream" region of genomic DNA extending 5' from, but containing, a promoter of interest in its natural context. As shown in Figure 3(b), the oligo (2) encompassing all or part of the promoter element (e.g. TV497B) also contains two REN sites, one of which is that for an enzyme such as BsmBl, whose cleavage site is external to its recognition sequence and which can, accordingly, and subsequent to cloning of the amplicon into a plasmid vector, be Lised to cleave the DNA immediately 3' of the promoter sequence. The second REN site can be for any enzyme suitable for use in the cloning process described below. Optionally, PCR synthesis of a "downstream" amplicon, comprising the portion of the viral genome immediately 3' of the viral gene that is to be replaced by the gene of interest, can also be inckided at this stage.

Incorporation of this amplicon into the construct also means that the completed construct (see Step 3) can fLinction as a transfer vector without further mobilisation of the manipulated region, and that it can be used to replace any identified viral gene with any gene of interest, achieving expression of the latter from the promoter that naturally drives the former.

Step (2). PCR synthesis of the gene of interest, flanked at the 5' end by a REN recognition site compatible with the second site of the "upstream" amplicon described in Step (1) above, and an internal site for. for example, JE.SJ_.BI as discussed above, that can be used to cleave the DNA immediately 5' of, or at the 5' end of, the coding sequence of interest. At the 3' end the amplicon is typically flanked by a REN recognition site convenient for the specific cloning purpose.

Step (3). Assembly of the pieces of DNA described in Steps (1) and (2), followed by, for example, IfomBI digestion and re-ligation, to produce the desired "seamless" promoter/ gene arrangement. Step (4). A desired portion of this assembled arrangement, generally comprising the essential parts of the promoter element and the coding seqLience of the gene of interest, can then be amplified by PCR and mobilised into the cloning site of another transfer vector such as pHaTV3MCSl using the method described in "Strategy 1" above. In this context the gene of interest is driven by the selected promoter, which simultaneously drives expression of its natural product elsewhere in the genome. In some instances, it has been found that apparent instability of isolated genomic flanking sequences makes it desirable to change the order in which Steps (1) to (3) are performed, and/or to incorporate cloning of the optional downstream flanking region into the strategy (see Step 1), even though Step (4), for which it is not specifically required, is subsequently to be performed. Such an altered combination of steps does not, however, change the substantive nature of the process. As described in the following Examples 2 and 3, steps (1) to (3) have been used to insert the Aequorea victoria green fluorescent protein (GFP) marker gene behind the HaEPV fusolin and spheroidin promoters, in place of the fusolin and spheroidin genes, respectively.

Each of these transfer vectors may be used for construction of recombinant HaEPVs that express GFP from these loci, in place of each of the native gene products. In one embodiment (Examples 2 and 3), each of these manipulated promoter/GFP complexes may be mobilised into the intergenic region of pHaTV3MCSl and used to create recombinants of HaEPV that express GFP from the intergenic locus, in addition to each of the native gene products. In another embodiment (e.g., Example 4), Strategies 1 and 2 may be Lised in combination, together with pHaTV3MCSl, to create a transfer vector (e.g., pHaTV597.1) that contains both the HaEPV 30 kD protein promoter/iαcZ and the HaEPV spheroidin promoter/GFP complexes in the MCS, which may subsequently be used to create a recombinant HaEPV that co-expresses both marker genes.

Initial experiments showed that the wild-type GFP protein encoded by the gene from A victoria in plasmid pTU65 (Chalfie et al., 1994) was not bright enough to allow optimal detection by fluorescence activated cell sorting (FACS). Accordingly, an oligo GFFSLT (Table 1) has been used to introduce mutations (i.e. 64F65S to 64L65T) that have been shown to substantially increase emission brightness (Cormack et al., 1996), creating plasmid pGFP(RS) that was then used throughout the GFP expression experiments.

Table 1: Oligonucleotide sequences referenced in text.

Table 2: HaEPV promoter sequences

HaEPV gene/ ORF reference GenBank accession putative promoter sequence

DNA polymerase (DP) Sriskantha & Dall, NA taaaatttgaatttttatttaaataatataaaaaatattaaa(atg) (SEQ ID NO: 1) unpublished

DP01 artificial derivative of DP NA taaaatttgaaattttatttaaataatataaaaaatattaaa(atg) (SEQ ID NO: 39)

DP02 artificial derivative of DP NA taaaattt aatttttatttaaataatataaaaaatattaa.(atg) (SEQ ID NO: 40)

DP03 artificial derivative of DP NA taaaatttgaaattttatttaaataatataaaaaatattaa.(atg) (SEQ ID NO: 41)

ORF 2 (PAP2 Crnov & Dall. in press AF022176 ccgctattaataattcataataaa(al ) (SEQ ID NO: 2)

ORF 3 (30K/ VP8) caaaaaτtgtttattaaataa(arg) (SEQIDNO:3)

ORF 4 gaaataatatataaataataaatataaat(atg) (SEQ ID NO: 4)

ORF 5 gtttaaatttaataaatatttataataatacgaaat(atg) (SEQIDNO.-5)

ORF 6 ccgataaatttatatataatttta(atg) (SEQ ID NO: 6)

ORF 7 ttttttatatatttatcttgggctctt(atg) (SEQ ID NO: 7)

ORF2 Crnov & Dall, NA gtctacatacaataaataataaataataa(alg) (SEQ ID NO: 8) unpublished¹²¹

ORF3 gacaaaaatacaattatatata(atg) (SEQIDNO:9)

ORF4 (57K) ggttagataatttatatatagatactat(at ) (SEQ ID NO: 10) fusolin Dall et al., 1993 L08077 taaaccaaaatacaaaccaaagattaata (SEQ ID NO: 42) spheroidin Sriskantha et al. 1997 AF019224 ggactttttattttttatatattaataataalaa(atg) (SEQ ID NO: 43)

TBI nt shown in bold italics have been spcifically mutated

Example 1 (Strategy 1): The HaEPV 30 kD promoter driving β-galactosidase expression at the selected intergenic region. (Figure 4).

Oligos VP8-βgal and TV497K (Table 1) were designed and used, together with the template plasmid pGHlOl (Herman e_ al., 1986), to amplify a DNA product comprising alacZ coding sequence flanked at the 5' end by two "spacer" nucleotides, Xbal and BαmHI recognition sites, and a 21 nucleotide sequence identical to that immediately 5' of the 30 kD (VP8) gene of HaEPV (Table 2: Crnov and Dall, [1] in press) and hereinafter referred to as the HaEPV 30 kD promoter element. At the 3' end, the resulting product contained (internally - distally) a 5 nucleotide "spacer" region, anXbal site and two further spacer nucleotides. The product was then digested with Xbal. and cloned into identically digested pTV3MCSl to create pHaTV397.2. The resultant plasmid was grown in E. coli and pvirified using a commercially available methodology (Promega "Wizard Prep" system), after which the validity of the construct was checked by DNA sequencing. Plasmid DNA prepared as above was then transfected into Helicoverpa zea cells (Hz-AMl; Mclntosh and Ignoffo, 1981) in culture, 24 hrs prior to their infection with wild type HaEPV, and the natural process of homologous recombination was utilised for generation of HaEPV recombinants containing the lacZ gene. Culture medium from these cells, containing wild type and recombinant HaEPV in mixture, was then harvested and used to infect Spodoptera frugiperda (line Sf9; ATCC CRL 1711) cells in culture. Expression of the lacZ gene was then demonstrated by harvesting infected cells and incubating them in the presence of the substrate 5-bromo-4-chloro-3-indolyl- β-D-galactopyranoside ("X-gal"). This produced the characteristic blue colour that demonstrates the presence of the enzyme and which, in this case, indicates its production in active form by the recombinant HaEPV.

It is predicted that the isolation of recombinants of this virus could be achieved by serial passage of virus either from single plaques expressing the marker enzyme, or from virus selected by serial dilution and amplification protocols. It is also anticipated that the same strategy could be used with upstream oligos incorporating a variety of different promoters, examples of which are disclosed in Tables 1 and 2. and a variety of different genes encoding, for example, selectable marker proteins such as GFP and β-gal, proteins which can be used for selection of recombinant viruses in insect cells such as proteins conferring resistance to puromycin (pac) and other antibiotic or cytotoxic substances, and proteins of interest for commercial or research purposes.

Example 2 (Strategy 2): The HaEPV fusolin promoter driving GFP expression at the selected intergenic region. (Figure 5). Steps (1) & (2). Oligos TV2962A and TV697.1 (Table 1) were designed and used, together with the template plasmid clone 2B (2-12-93; a derivative of Bglll 4.9kb clone 36, Dall et al., 1993), to amplify an approx. 1.1 kb DNA product comprising a region immediately upstream of the sequence encoding the HaEPV fusolin protein. This amplicon contained an internal EcoRI site some 85bp from its 5' end, and was flanked at the 3' end by afismBI REN recognition site, positioned so as to enable use of the seamless cloning method described in Strategy 2 (above), anXliol site, and two "spacer" nucleotides. This amplicon was cloned into the Smαl site of pTZl9R to create pFusPR. A DNA fragment comprising the GFP(RS) coding sequence, and flanked at its 5' end byXliol and BsmBl REN recognition sites, and at its 3' end by an_YbαI recognition sequence, was then excised from plasmid pTV497-EGFP(I) (see Example 3 below), and cloned into pFusPR, "downstream" of the TV2962A/TV697.1 product. Finally, oligos TV2962C and TV2962D were used together with a plasmid template (pHaTV2963X:GFP[RS]) to amplify a 1.3kb amplicon comprising a sequence corresponding to HaEPV genomic sequence immediately 3' of the fusolin locus. This amplicon had_Ω>αI and Hindlll REN recognition sites at its 5' and 3' ends, respectively, and was cloned immediately downstream of the GFP(RS) coding sequence to create pTV698-I.

Step (3). Production of viral transfer vector pTV698.1 was then completed by digestion of pTV698-I with BsmBl, re-ligation and cloning in E. coli. This transfer vector has been used to generate recombinants of HaEPV that, in mixed infections with wild-type HaEPV, express the GFP marker protein in place of fusolin. It is expected that these recombinants could be isolated by serial passage of virus from single plaques expressing the marker protein, or from virus selected by serial dilution and amplification protocols. Step (4). Additionally, PCR may now be used to produce an amplicon comprising the fusolin promoter seamlessly joined to the GFP gene as illustrated schematically in Figure 3(b), by use of the construct pTV698.1 described in Step (3) above, and oligos TV697.2 and GFX2 (Table 1). This amplicon may be cloned into the intergenic site of a transfer vector such as pHaTV3MCSl, and the resultant construct may then be used to produce a recombinant HaEPV that expresses both the fusolin protein and the heterologous GFP protein under control of the fusolin promoter. Example 3 (Strategy 2): The HaEPV spheroidin promoter driving GFP expression at the selected intergenic region. (Figure 6). Step (1). Oligos TV497A and TV497B (Table 1) were designed and used, together with purified HaEPV genomic DNA, to amplify an approximately 0.8 kb DNA product comprising a region immediately upstream of the sequence encoding the HaEPV spheroidin protein. This amplicon is flanked at the 5' end by an EcoRI REN recognition site, and at the 3' end by a BsmBl REN recognition site, positioned so as to enable use of the seamless cloning method described in Strategy 2 (above); in addition downstream- /ioI and Bglll sites, and two "spacer" nucleotides were incorporated at the 3' end. Likewise, oligos TV497C and TV497D (Table 1) were designed and used, together with plasmid Bl (containing a 4.3 kb Xhol/Clal fragment of HaEPV genomic DNA: Sriskantha et al., 1997) to amplify an approximately 1.2 kb DNA product comprising a region immediately downstream of the sequence encoding the HaEPV spheroidin protein. This amplicon was flanked at the 5' end by an .Xbal REN recognition site, and at the 3' end by a Hindlll REN recognition site: 2 further "spacer" nucleotides were present at each end of the amplicon. The product of oligos TV497A/B was then blunt end cloned into the Smαl site of pTZl9R, producing pTV497-UI. from which the insert was subsequently excised by digestion with EcoRI and Bglll, and re-cloned directionally into pTZl9R prepared by digestion withEcoRI and BαjnHI and dephosphorylation, to give pTV497-UI2. Similarly, the product of oligos TV497C/D was blunt end cloned into the Smαl site of pTZlθR to give pTV497-DI. excised by digestion with_¥bαl and Hindϊll, and re-cloned directionally into pTV497-UI2, to produce pTV497-I. Step (2). Oligos GFXB4 and GFX2 (Table 1) were used together with the template plasmid pGFP(RS), to amplify an approximately 0.75 kb DNA product comprising the A victoria GFP marker gene, flanked at the 5' end by three "spacer" nucleotides, aXhoI site and a BsmBl site, positioned in reverse orientation to that located at the 3' end of the TV497A/B amplicon. At the 3' end the GFXB4/X2 amplicon was flanked by an_YbαI site and three "spacer" nucleotides. This amplicon was subsequently cloned into pTZl9R, producing pPCR/EGFP, from which the cloned amplicon was excised withXhoI and Xbal. This fragment was then cloned into pTV497-I which had been grown in E. coli, purified, cut wit Xliol and _XbαI, and dephosphorylated, producing pTV497-EGFP(I). Step (3). Plasmid pTV497-EGFP(I) was then digested with BsmBl, re-ligated, and re-cloned in E. coli, producing pTV497.GFP(RS), which contains a seamless junction between the natural spheroidin promoter sequence and the GFP-encoding sequence. [Construct pTV497.GFP(RS) was subsequently used as a transfer vector to generate recombinant HaEPVs (i.e. recHa497.GFP) in which the spheroidin gene was replaced by the modified GFP gene. These recombinants were selected and isolated by Lise of FACS and repeated single plaque purification. Virions of these recombinants showed normal morphology when examined by electron microscopy, and were infectious for Sf9 and Hz -AM 1 cells in culture, and for larvae of H. armigera and H. punctigera when administered per os. The GFP marker gene product was expressed by the virus both in in vitro and in vivo infections (J.A.Olszewski and D.J. Dall, unpublished data).

Step (4). Construct pTV497.GFP(RS) was also used as template for PCR amplification, together with oligos GFS5 and SSPHl (Table 1 ). The resulting approx. 780bp amplicon was inserted into the blunted Bα HI site in the MCS of pHaTV3MCSl to generate pHaTV397.1. BecaLise the amplicon insertion procedure was not directional in nature, two forms of pHaTV397.1 were produced: in the first of these the GFP gene is in the same orientation as the flanking fusolin and 68 kD genes (the " + " orientation: clones 5 and 6), in the other the GFP gene is in the opposite orientation ("-"; clones 3 and 7). Both forms of this construct were tested for transient GFP expression in the presence of wild type HaEPV, and both gave positive results. One form of the construct (the "+" form; clone 5) was used to generate GFP-expressing recombinant HaEPV by the process of homologous recombination, as described in Example 1. Tests have shown that this recombinant

(recHaEPV397.1), in combination with wild type HaEPV, is infectious for cultured Sf9 and Hz-AMl cells. Example 4 (Strategies 1 and 2 combined): Simultaneous expression of β-gal and GFP by the HaEPV 30 kD and spheroidin promoters, respectively, at the selected intergenic region. (Figure 7). pHaTV397.1 (clone 3, "-" orientation) as described above (Example 3), was used as the basis for construction of a further transfer vector

(pHaTV597.1) containing two heterologous genes inder control of two different promoters, both inserted at the intergenic MCS. As described above (Example 3), the starting plasmid for this work already contained the spheroidin promoter seamlessly linked to the modified GFP gene, and inserted into the BαmHI site of the MCS.

Strategy 1 was used with oligos VP8-βgal and TV497K (Table 1) and pGHlOl to produce an amplicon comprising the VP8 promoter seamlessly linked to the coding sequence of the lacZ gene, as described in Example 1. This amplicon was then inserted into the restricted and end-filled-Xbαl site in the MCS of pHaTV397.1 to give pHaTV597.1. Although the lack of directionality of the amplicon insertion process once again meant, in theory at least, that insertion could occur in either orientation, both of the clones (clones 4 and 9) that were characterised had the VP8//αcZ amplicon present in the " + " orientation. Clones 4 and 9 of this plasmid were grown in E. coli, purified, and used to create recombinant HaEPVs that, in the presence of wild-type HaEPV, simultaneously expressed both GFP and β-galactosidase. Example 5 (Strategies 1 and 2 combined): Simultaneous expression of an insecticidal toxin and GFP by the HaEPV 30K and spheroidin promoters, respectively, at the selected intergenic region. (Figure 8). In a further development of the strategy described in Example 4, pHaTV397.1 (clone 5, "+" orientation), prepared as described in Example 3, was used as the basis for construction of transfer vector pHaTV597.3. As in pTV597.1, this vector contained two heterologous genes under control of two different promoters, both inserted at the novel intergenic MCS. As described above (Example 3), pHaTV397.1 already contained the spheroidin promoter seamlessly linked to the modified GFP gene, and inserted into the BαmHI site of the MCS.

As shown in Figure 8, Strategy 1 was used with oligos VP8-SIMT and SIMT-R and plasmid pTox34 (Tomalski & Miller, 1991) to produce an amplicon comprising the VP8 promoter seamlessly linked to the coding sequence of the straw itch mite (Pyemotes tritici) insecticidal toxin (SIMT) gene, using methodology as described in Example 1. This amplicon was then inserted into the restricted and end-filled Xbal site in the MCS of pHaTV397.1, to give pHaTV597.3. Although the lack of directionality of the amplicon insertion process once again meant that insertion could occur in either orientation, the clones (clones 5 and 6) that were characterised had the

VP8/SIMT amplicon present in the " + " orientation. Clone 6 of this plasmid was grown in E.coli, purified, and used to create the recombinant HaEPV recHa597.3 that, in the presence of wild-type HaEPV, visibly expressed GFP and was also expected to produce the SIMT protein. We used FACS and repeated single plaque purification to selectively amplify isolates of recHa597.3, including an isolate designated "Passage 12/Plaque 6" (P12P6). This isolate (recHa597.3.P12P6) was expanded in Sf9 cells, where it stably expressed visible quantities of the GFP marker. This "cell-derived" virus was harvested and fed to 48 hr oldH. armigera larvae; subsequent examination of these larvae under ultra-violet light showed that they possessed fluorescence characteristic of the presence of GFP, indicating both that infection had been established by per os administration of the virus, and that the heterologous marker protein gene was being expressed. Other symptomotology observed to be correlated with the presence of disseminated fluorescence in larvae (and hence with well-established viral infection) included paralysis, failure to successfully complete the moulting process, and reduced time to death: each of these are symptoms that might be expected to result from expression of the SIMT.

Results of a bioassay of recHa597.3.Pl2P6 against 48 hr old H. armigera larave are shown in the Table 3 below. In this experiment larvae were fed either the recombinant virus or wild-type HaEPV at a dose of 50 spheroids/mm² diet, each applied in a solution of 0.1% fluorescent brightener (Calcofluor white M2R). A further group of the same cohort of larvae were raised with exposure to 0.1% brightener alone, without virus. As shown, observations of the larvae at 7, 9, 12 and 14 days post-treatment showed enhanced insecticidal activity of the recombinant virus, as compared to the wild-type "parental" isolate. Table 3: Enhanced biological activity of recombinant HaEPV isolate "recHa597.3.Pl2PG"

* includes larvae showing total or partial paralysis, or that appear otherwise moribund

Example 6 (Strategies 1 and 2 combined): Simultaneous expression of an insecticidal toxin and GFP by the HaEPV 30K and spheroidin promoters, respectively, at the selected intergenic region. (Figure 9).

In a further development of the strategy described in Example 4. transfer vector pTV597.4. encoding the GFP marker protein and the insecticidal toxin of the North African scorpion [Androctonus australis Hector) was constructed. As shown in Figure 9, Strategy 1 was used with oligos VP8-AAIT and

AAIT-R and template plasmid pl02.3 to produce an amplicon comprising the VP8 promoter seamlessly linked to a sequence encoding a secretion signal and the the coding sequence of the A. australis Hector insecticidal toxin (AaHIT) gene, using methodology as described in Example 1. This amplicon was then inserted into the restricted Xbal site in the MCS of pHaTV397.1

(clone 3, "-" orientation), to give pHaTV597.4. Although the lack of directionality of the amplicon insertion process once again meant that insertion could occur in either orientation, the clones (clones 1, 2 and 7) that were characterised had the VP8/AaH_T amplicon present in the "-" orientation. Clones 2 and 7 of this plasmid were grown in E. coli, purified, and used to create the recombinant forms of HaEPV (recHa597.4) that, in the presence of wild-type HaEPV, visibly expressed GFP and were also expected to produce the AaHIT protein.

We are using FACS and repeated single plaque purification to selectively amplify isolates of recHa597.4. These isolates have been expanded in Sf9 cells, where they stably express the GFP marker protein. It is now anticipated that selected isolates of this recombinant will be amplified in vitro, harvested, and fed to H. armigera and/or Spodoptera litura larvae; these are subsequently expected to display a symptomotology that includes GFP fluorescence, paralysis and reduced time to death.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

References:

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W., and Prasher, D.C. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802- 805. Dall, D.J., Sriskantha, A., Vera. A., Lai-Fook, J., and Symonds, T.

(1993). A gene encoding a highly expressed spindle body protein of Heliothis armigera entomopoxvirus. J. Gen. Virol. 74, 1811-1818.

Cormack, B.P., Valdivia, R.H. and Falkow, S. (1996). FACS-optimised mutants of the green fluorescent protein (GFP). Gene 173, 33-38. Crnov, R. and Dall, D.J. (1) Virus Genes (in press). Virions of Heliothis armigera entomopoxvirus contain a homologue of the vaccinia VP8 major core protein.

Crnov, R. and Dall, D.J. (2) unp iblished manuscript. An entomopoxvirus gene with homology to genomic sequences of three granulosis viruses.

Hammock, B.D., Bonning, B.C., Possee, R.D., Hanzlik, T.N. and Maeda, S. (1990). Expression and effects of the juvenile hormone esterase in a baculovirus vector. Nature 344, 458-461.

Hashimoto, Y., Corsaro, B.G and Granados, R.R. (1991). Location and nucleotide sequence of the gene encoding the viral enhancing factor of the

Trichoplusia ni granulosis virus. J. Gen. Virol. 76, 799-811.

Herman, G.E., O'Brien. W.E. and Beaudet, A.L. (1986). An E. coli b- galactosidase cassette suitable for study of eukaryotic expression. Nuci. Acids Res. 14, 7130. Maeda, S. (1989). Increased insecticidal effect by recombinant bac ilovirus carrying a synthetic dmretic hormone gene. Biochem. Biophys. Res. Comm. 165, 1177-1183.

Mclntosh, A. H., and Ignoffo, CM. (1981). Replication and infectivity of the singleembedded nuclear polyhedrosis virus, Baculovirus heliothis, in homologous cell lines. ). Invertebr. Pathol. 37, 258-264.

O'Reilly, D.R. and Miller, L.K. (1989). A baculovirus blocks insect moulting by producing ecdysteroid UDP-glucosyl transferase. Science 245, 1110-1112. Osborne, R.J., Symonds, T.M., Sriskantha, A., Lai-Fook, J., Fernon, C.A., and Dall, D.J. (1996). An entomopoxvirus homologue of the vaccinia virus Dl3L-encoded "rifampicin resistance" protein. J. Gen. Virol. 77, 839- 846. Possee, R.D., Merryweather, A.T., Weyer, U., Harris, M.P.G., Hirst, M. and Bishop, D.H.L. (1990). "The development and release of genetically engineered viral insecticides: A progress report 1986-1989" In: H.H. Hagedorn et al. (eds) Molecular Insect Science, Plenum Press pp 119-123. Roelvink, P.W., Corsaro, B.G. and Granados, R.R. (1995).

Characterisation of the Helicoverpa armigera and Pseudaletia unipunctata granulovirus enhancin genes. J. Gen. Virol. 76, 2693-2705.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edition. New York: Cold Spring Harbor Laboratory Press.

Sriskantha, A., Osborne, R.J., and Dall, D.J. (1997). Mapping of the Heliothis armigera entomopoxvirus (HaEPV) genome, and analysis of genes encoding the HaEPV spheroidin and nucleoside triphosphate phosphohydrolase I proteins. J. Gen. Virol. 78, 3115-3123. Stewart, L.M.D.. Hirst, M., Ferber, M.L., Merryweather, A.T.,

Cayley, P.J. and Possee, R.D. (1991). Construction of an improved baculovirus insecticide containing an insect-specific toxin gene. Nature 352, 85-88.

Tomaiski. M.D. & Miller, L.K. (1991). Insect paralysis by baculovirus- mediated expression of a mite neurotoxin gene. Nat ire 352, 82-85. Yuen, L., and Moss. B. (1987). Oligonucleotide sequence signaling transcription termination of vaccinia virus early genes. Proc. Natl. Acad. Sci. USA. 84, 6417-6421.

Claims

Claims:

1. An infectious, spindle body-producing recombinant entomopoxvirus wherein heterologous DNA is located in the genome within the intergenic region between the fusolin gene and p68 gene.

2. The recombinant entomopoxvirus according to claim 1, wherein the entomopoxvirus is selected from the group consisting o╧èAmsacta moorei EPV, Choristoneura biennis EPV, Choristoneura fumiferana EPV, Heliothis armigera EPV, Pseudaletia separata EPV, Aphodius tasmaniae EPV,

Dermolepida albohirtum EPV, Melolontha melolontha EPV, Anomala cupraea EPV and Sericesthis nigrolineata EPV.

3. The recombinant entomopoxvirus according to claim 2, wherein the entomopoxvirus is Heliothis armigera EPV.

4. The recombinant entomopoxvirus according to any one of claims 1-3, wherein the heterologous DNA comprises at least one gene encoding a substance deleterious to insects operably linked to a promoter sequence.

5. The recombinant entomopoxvirus according to claim 4. wherein the said gene encodes a substance selected from the groLip consisting of insecticidal toxins, insect neurohormones and neuro hormonal-interacting proteins.

6. The recombinant entomopoxvirus according to claim 5, wherein the said gene encodes an insecticidal toxin selected from the group consisting of straw itch mite insecticidal toxin (SIMT), Bacillus thuringiensis ╬┤-toxin and Androctonus australis Hector insecticidal toxin (AaHIT).

7. The recombinant entomopoxvirus according to claim 5, wherein the said gene encodes juvenile hormone esterase.

8. A method for controlling the proliferation of pest insects, comprising applying to an infested area the recombinant entomopoxvirus according to any one of the preceding claims, optionally in admixture with an acceptable agricultural carrier.

9. The recombinant entomopoxvirus according to any one of claims 1-3, wherein the heterologous DNA comprises at least one gene encoding a desired biologically-active protein, polypeptide or peptide operably linked to a suitable promoter sequence.

10. The recombinant entomopoxvirus according to claim 9, wherein the said gene encodes a substance selected from the group consisting of: interferon, tiss ie plasminogen activator, lymphotoxin, macrophage activating factor, insulin, epithelial cell growth factor, human growth hormone, antibodies and antibody fragments.

11. A method for producing a desired biologically-active protein, polypeptide or peptide comprising infecting susceptible host cells with the recombinant entomopoxvirus according to claim 9 or 10.

12. The recombinant entomopoxvii'Lis according to any one of claims 1-7, 9 and 10, wherein the said suitable promoter sequence is an entomopoxvirus promoter sequence.

13. The recombinant entomopoxvii'Lis according to claim 12, wherein the entomopoxvirus promoter is the fusolin gene promoter, the spherodin gene promoter or the pll.5 ORF promoter.

14. An isolated DNA molecule comprising a promoter sequence selected from the group consisting of:

TAAAATTTGAATTTTTATTTAAATAATATAAAAAATATTAAA (ATG) (SEQ ID NO : 1)

CCGCTATTAATAATTCATAATAAA (ATG) (SEQ ID NO: 2)

CAAAAATTGTTTATTAAATAA (ATG) (SEQ ID NO: 3)

GAAATAATATATAAATAATAAATATAAAT (ATG) (SEQ ID NO : 4) GTTTAAATTTAATAAATATTTATAATAATACGAAAT (ATG) (SEQ ID NO: 5)

CCGATAAATTTATATATAATTTTA (ATG) (SEQ ID NO: 6) TTTTTTATATATTTATCTTGGGCTCTT (ATG) (SEQ ID NO: 7)

GTCTACATACAATAAATAATAAATAATAA (ATG) (SEQ ID NO: 8)

GACAAAAATACAATTATATATA (ATG) (SEQ ID NO: 9)

GGTTAGATAATTTATATATAGATACTAT (ATG) (SEQ ID NO: 10) and variants thereof showing > 75% sequence homology.

15. An isolated DNA molecule comprising a promoter sequence selected from the group consisting of:

TAAAATTTGAATTTTTATTTAAATAATATAAAAAATATTAAA (ATG) (SEQ ID NO: 1)

CCGCTATTAATAATTCATAATAAA (ATG) (SEQ ID NO: 2)

CAAAAATTGTTTATTAAATAA (ATG) (SEQ ID NO: 3)

CCGATAAATTTATATATAATTTTA (ATG) (SEQ ID NO: 6)

TTTTTTATATATTTATCTTGGGCTCTT (ATG) (SEQ ID NO: 7)

GTCTACATACAATAAATAATAAATAATAA (ATG) (SEQ ID NO: 8)

GACAAAAATACAATTATATATA (ATG) (SEQ ID NO: 9) GGTTAGATAATTTATATATAGATACTAT (ATG) (SEQ ID NO: 10) and variants thereof showing > 90% sequence homology.

16. An isolated DNA molecule comprising a promoter sequence selected from the group consisting of: TAAAATTTGAATTTTTATTTAAATAATATAAAAAATATTAAA

(ATG) (SEQ ID NO: 1)

CCGCTATTAATAATTCATAATAAA (ATG) (SEQ ID NO: 2)

CAAAAATTGTTTATTAAATAA (ATG) (SEQ ID NO: 3)

GAAATAATATATAAATAATAAATATAAAT (ATG) (SEQ ID NO : 4) GTTTAAATTTAATAAATATTTATAATAATACGAAAT

(ATG) (SEQ ID NO: 5)

CCGATAAATTTATATATAATTTTA (ATG) (SEQ ID NO: 6)

TTTTTTATATATTTATCTTGGGCTCTT (ATG) (SEQ ID NO: 7)

GTCTACATACAATAAATAATAAATAATAA (ATG) (SEQ ID NO : 8) GACAAAAATACAATTATATATA (ATG) (SEQ ID NO: 9) GGTTAGATAATTTATATATAGATACTAT (ATG) (SEQ ID NO: 10) and variants thereof showing > 95% sequence homology.