WO1999060011A1

WO1999060011A1 - Secretion of toxins by gram-negative bacteria

Info

Publication number: WO1999060011A1
Application number: PCT/US1999/011361
Authority: WO
Inventors: Olaf Schneewind; Deborah M. Anderson
Original assignee: The Regents Of The University Of California
Priority date: 1998-05-21
Filing date: 1999-05-21
Publication date: 1999-11-25
Also published as: AU4009599A; WO1999060011A9

Abstract

The discovery that a signal for type III secretion of proteins by Yersinia, and presumably by other Gram-negative pathogenic bacteria, is operative at the mRNA level provides a method of suppressing such secretion and thus enhancing host defenses against such bacteria by employing antisense oligonucleotides that bind specifically to this signal. Additionally, the invention includes a method for screening for compounds that block or inhibit the type III secretion.

Description

SECRETION OF TOXINS BY GRAM-NEGATIVE BACTERIA

GOVERNMENT RIGHTS

This work leading to this invention has been performed with funds from the National Institutes of Health of the United States Government. Therefore, the United States Government may have certain rights in this invention.

BACKGROUND OF THE INVENTION

This invention is directed to signals controlling toxin secretion by Gram- negative bacteria in general, such as Yersinia spp., Escherichia coli, Salmonella spp., Shigella spp., Psextdomonas spp., and Xanthomonas spp. especially Yersinia, and methods of blocking such toxin secretion by the application of antisense RNA therapy, as well as screening methods to detect compounds that can block such toxin secretion.

Secretion of Yop proteins during the pathogenesis of human or animal infections allows Yersinia species to evade phagocytic killing by macrophages (G. R. Cornelis and H. Wolf-Watz, Mol. Microbiol. 23, 861 (1997)). After establishing contact with specific host cells, Yersinia target some Yop proteins directly into the eukaryotic cytosol where these virulence factors exert their cytotoxic functions (R. Rosqvist, K.-E. Magnusson, H. Wolf-Watz, EMBO J. 13, 964 (1994); A. Boland, et al, EMBO J. 15, 5191 (1996); J. Petterson, et al, Science 273, 1231 (1996)). This type III secretion of Yop proteins is thought to occur as a continuous translocation of polypeptide across the inner and outer membranes of the bacterial envelope (P. Wattiau, S. Woestyn, G. R. Cornelis, Mol. Microbiol. 20, 255 (1996)). Yersinia export twelve different Yop proteins by this pathway (Cornelis & Wolf-Watz, (1994), supra), however no common secretion signal within the amino acid sequences of these polypeptides has been identified (T. Michiels and G. R. Cornelis, J. Bacleriol. 173, 1677 (1991); M.-P. Sory, A. Boland, I. Lambermont, G. R. Cornelis, Proc. Natl. Acad. Sci. U.S.A. 92, 11998 (1995)). This feature clearly distinguishes type III secretion from other export pathways in which the secretion signals of substrate proteins are readily apparent on the basis of common peptide sequences, structures or physical properties (S. A. Benson, M. N. Hall, T. J. Silhavy, Annu. Rev. Biochem. 54, 101 (1985); P. J. Schatz and J. Beckwith, Annu. Rev. Genet. 24, 215 (1990); A. P. Pugsley, Microbiol. Rev. 57, 50 (1993)). It is believed that other Gram-negative bacteria evade phagocytic killing by analogous mechanisms. This includes Gram-negative bacteria such as Salmonella spp., Shigella spp., Escherichia coli, Pseudomonas spp., and Xanthomonas spp. Many of these Gram-negative bacteria are important pathogens for humans and for other species.

Type III secretion mechanisms allow Gram-negative pathogens to establish disease in animals and plants by directing several different toxins into the extracellular milieu or into the cytosol of host cells. To accomplish all this, Type III mechanisms appear to require two distinct subunits, a secretion machine that translocates proteins across the bacterial envelope and an injection device that directs a subset of polypeptides into host cells. Identification of the elements required for each of the two functions is pursued by genetic analysis and by searching for supramolecular structures that can accomplish this task. Mapping and mutational analysis of secretion signals suggest at least two if not several different modes by which Type III mechanisms recognize export substrates. Presumably, each mode of substrate recognition determines the final destination of Type III exported polypeptides.

The Type III mechanisms have not only evolved to inject toxic proteins into eukaryotic cells, but also to deliver virulence factors into the extracellular milieu. One role of this delivery may be to modulate the host's immune response at a distance from the site of infection, undermining the host's natural immune defenses.

Understanding this variety of mechanisms is crucial to developing new and effective antibiotics that can be used to treat diseases caused by Gram-negative bacteria, particularly those resistant to presently available antibiotics.

Accordingly, there is a need to determine the mechanism of these secretion signals to develop methods to block the secretion of Yop proteins of Yersinia and other analogous proteins secreted by other species of Gram-negative bacteria in order to bolster phagocytic killing by macrophages and other host defenses against these bacteria. These methods could be used with conventional antibiotic and other treatments against such Gram-negative bacteria. There is a further need to develop screening methods that can identify compounds capable of blocking such Type III secretion.

SUMMARY

One aspect of the present invention is the preparation and use of antisense oligonucleotides to block the operation of the Yop secretion signal located within the mRNA. This represents a novel mechanism to suppress the virulence of Yersinia species and other Gram-negative species and to allow host defense mechanisms such as phagocytosis to kill these bacteria more efficiently. Among the bacteria against which host defenses can be bolstered by methods according to the present invention are Escherichia coli, Salmonella spp., Shigella spp., Pseudomonas spp., and Xanthomonas spp., in addition to Yersinia.

The antisense oligonucleotides useful in this aspect of the present invention bind at least a portion of the nucleotide sequence of the mRNA for YopE of YopN that encodes the first 15 amino acids of the YopE or YopN protein for Yersinia or the corresponding regions in analogous proteins for other Gram-negative bacteria. This sequence, in its wild-type state for Yersinia, is

AUGAAAAUAUCAUCAUUUAUUUCUACAUCACUGCCCCUGCCGGCAUCAGUGU CAGGA (SEQ ID NO: 1) for YopE and

AUGACGACGCUUCAUAACCUAUCUUAUGGCAAUACCCCGCUGCGUG for YopN.

(SEQ ID NO: 2). The portion of the molecule to which the antisense oligonucleotides according to the present invention binds preferably includes the first 15 nucleotides of the mRNA, encoding the first five amino acids.

Antisense oligonucleotides that bind to mutants of SEQ ID NO: 1 or SEQ ID NO. 2 are also within the scope of the present invention. Accordingly, one aspect of the present invention is a method of inhibiting Type III secretion of proteins by Yersinia comprising the steps of:

(1) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 15 amino acids of either the wild-type YopE or YopN protein; and

(2) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia.

The antisense oligonucleotide can be a naturally occurring oligonucleotide or a modified oligonucleotide. If a modified oligonucleotide, it can be selected from the group consisting of:

(1) modified oligonucleotides in which the phosphate backbone is replaced with phosphorothioates;

(2) modified oligonucleotides in which the phosphate backbone is replaced with phosphoramidates;

(3) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates; (4) modified oligonucleotides in which the phosphodiester groups are replaced with formacetals;

(5) modified oligonucleotides in which the phosphodiester groups are replaced with thioformacetals;

(6) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines;

(7) modified oligonucleotides in which the phosphodiester groups are replaced with oximes;

(8) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups; (9) modified oligonucleotides in which the phosphodiester groups are replaced with dimethylenesulfones;

(10) modified oligonucleotides in which the phosphodiester groups are replaced with silyl groups;

(1 1) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain; and

(12) modified oligonucleotides in which the entire phosphate- sugar backbone is replaced with a carbamate-linked morpholino chain.

Typically, the antisense oligonucleotide binds at least the first 15 nucleotides of either the mRNA encoding the Yersinia YopE protein or the mRNA encoding the Yersinia YopN protein. Typically, the antisense oligonucleotide is from 12 to 25 nucleotides in length.

In one preferred alternative, the antisense oligonucleotide hybridizes to AUGAAAAUAUCAUCAUUUAUUUCUACAUCACUGCCCCUGCCGGCAUCAGUGU CAGGA (SEQ ID NO: 1) with no mismatches under stringent conditions. In another preferred alternative, the antisense oligonucleotide includes therein the sequence TGATGATATTTTCAT (SEQ ID NO: 3).

In yet another preferred alternative, the antisense oligonucleotide hybridizes to AUGACGACGCUUCAUAACCUAUCUUAUGGCAAUACCCCGCUGCGUG (SEQ ID NO: 2) with no mismatches under stringent conditions. In still another preferred alternative, the antisense oligonucleotide includes therein the sequence ATCAAGCGTCGTCA (SEQ ID NO: 4).

In another embodiment of the present invention, antisense oligonucleotides that bind a mutant of the mRNA encoding the YopE or the YopN protein can be used. Specifically, this embodiment of the method comprises:

(a) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 15 amino acids of a mutant of either the YopE or YopN protein; and (b) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia, wherein the mutant varies from the naturally occurring mRNAs for YopE or YopN by up to 5 nucleotides in the mRNA sequences encoding the first 15 amino acids of the YopE or YopN proteins and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 10% of wild-type.

Preferably, the mutant varies by no more than two nucleotides from the naturally occurring mRNAs for YopE or YopN in the mRNA sequences encoding the first 15 amino acids of the YopE or YopN proteins and the mutant continues to provide a signal for secretion of proteins at a level of at least 25% of wild-type.

In this embodiment, the antisense oligonucleotides can be naturally occurring oligonucleotides or modified oligonucleotides, as described above.

Another aspect of the present invention uses an antisense oligonucleotide that binds mRNA encoding the Yersinia protein YopQ to inhibit Type III secretion. In general, this method comprises:

(1) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the first 10 amino acids of the YopQ protein; and

(2) introducing the antisense oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia.

Alternatively, the antisense oligonucleotide can bind a portion of the mRNA of a mutant of the YopQ protein, as described above with reference to YopE and YopN mutants.

In general, this embodiment of a method according to the present invention comprises:

(1) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 10 amino acids of a mutant of the YopQ protein; and

(2) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by

Yersinia, wherein the mutant varies from the naturally occurring mRNA for YopQ by up to 4 nucleotides in the mRNA sequence encoding the first 10 amino acids of the YopQ protein and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 10% of wild-type.

Typically, in this embodiment, the mutant varies by no more than two nucleotides from the naturally occurring mRNA for YopQ in the mRNA sequence encoding the first 10 amino acids of the YopQ protein and the mutant continues to provide a signal for secretion of proteins at a level of at least 25% of wild-type.

Analogously, the present invention also includes a method of inhibiting secretion of proteins by other Gram-negative bacteria by using antisense oligonucleotides that bind the corresponding portion of the mRNA of the analogous proteins of those bacteria. In general, such a method comprises:

(1) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the secretion signal of a secreted protein of a Gram-negative bacterium; and

(2) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the Type III secretion of proteins by the Gram-negative bacterium.

The Gram-negative bacterium can be selected from the group consisting of

Yersinia spp. , Escherichia coli, Salmonella spp. , Shigella spp. , Pseudomonas spp. , and Xanthomonas spp.

Similarly, as described above, the antisense oligonucleotide can bind a portion of the mRNA of a mutant of the secretion signal of the secreted protein, as described above with reference to YopE and YopN mutants of Yersinia. In general, this embodiment comprises:

(1) providing an antisense oligonucleotide that binds a portion of an mRNA encoding the secretion signal of a mutant of a secreted protein of a Gram-negative bacterium; and

(2) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the Type III secretion of proteins by the Gram-negative bacterium, wherein the mRNA of the mutant secreted protein has at least about 89% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and wherein the mutant protein is secreted at a level of at least 10% of wild-type secreted protein.

Typically, in this embodiment, the mRNA of the mutant secreted protein has at least about 96% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and the mutant protein is secreted at a level of at least 25% of wild-type secreted protein.

Another aspect of the present invention is methods for screening compounds for inhibitory activity against type III secretion by Yersinia and by other Gram-negative bacteria. In general, this method comprises:

(1) growing a first aliquot of a Gram-negative bacterium in growing conditions that are permissive for Type III secretion;

(2) adding a candidate compound to the first aliquot;

(3) allowing Type III secretion to occur;

(4) separating a protein secreted from the bacterium by Type III secretion from the cells and attaching the secreted protein to a solid support; (5) reacting the secreted protein on the solid support with a first antibody that specifically binds the secreted protein;

(6) reacting the secreted protein on the solid support reacted with the first antibody with an anti-idiotypic second antibody that specifically binds the first antibody, the second antibody being labeled with a detectable label, the detectable label producing a signal; and

(7) comparing the intensity of the signal produced in step (6) with a signal produced as the result of performing steps (1) and (3)-(6), but not (2), on a second aliquot of the Gram-negative bacterium to determine whether the candidate compound inhibits type III secretion.

In this screening method, the Gram-negative bacterium can be selected from the group consisting of Yersinia spp., Escherichia coli, Salmonella spp., Shigella spp., Pseudomonas spp. and Xanthomonas spp. Typically, the Gram-negative bacterium is Yersinia spp.

When the Gram-negative bacterium is Yersinia spp., the protein secreted from the bacterium is typically a Yop protein, such as YopD, YopE, YopN, or YopQ.

In one preferred embodiment, the label is an enzyme label. However, the use of other labels is possible.

BRIEF DESCRIPTION OF THE DRAWINGS

These and other features, aspects, and advantages of the present invention will become better understood with reference to the following description, appended claims, and accompanying drawings where:

Figure 1 shows secretion signals located within codons 1 through 15 of YopE and YopN; with a schematic diagram of hybrid proteins consisting of YopN, YopE or their truncated derivatives with fused neomycin phosphotransferase (Npt); all constructs were expressed from their wild-type promoter (YopN or YopE) in Y. enterocolitica; numbers refer to the respective codon positions; secretion was measured by immunoblotting of the medium and cell pellet of induced Yersinia cultures and is reported as the percentage of total protein that is secreted; the relative synthesis of polypeptides [X]/[YopH] was analyzed by comparing immunoprecipitated substrates after pulse-labelling with the amount of immunoprecipitated YopH; NT, not tested; Figure 2 shows frame shift mutations of the secretion signals of YopN and

YopE; translational reading frame shifts were constructed by either deleting (-1, -2) or inserting nucleotides (A or G) (+1, +2) immediately following the AUG start codon of YopEi-15-Npt (A) or YopNι.i₅-Npt (B); the correct reading frame was restored by a reciprocal change at the fusion site with Npt; secretion was measured by immunoblotting and is indicated as the percentage of secreted protein; Npt alone expressed from the YopE or YopN promoter was not secreted; [X]/[YopH] indicates relative levels of polypeptide synthesis as measured by pulse labelling and immunoprecipitation; the altered peptide sequences of the frame shift mutants are compared with those encoded by the wild-type secretion signals (C); and

Figure 3 shows predicted RNA structures of the YopE and YopN secretion signals compared with that of the Npt mRNA. RNA sequences were subjected to folding analysis by the method of Zuker (M. Zuker, Science 244, 48 (1989)); the displayed structures show an area encompassing the Shine/Dalgarno ribosome binding site (filled squares), start codon (AUG, boxed) and downstream sequence of the YopE and YopN secretion signals [ΔG values of -21.4 kcal (YopE) and -24.6 kcal (YopN)]; mutations that abolished synthesis and secretion of reporter proteins are shadowed; suppressor mutations that restore secretion are indicated in bold.

DESCRIPTION

DEFINITIONS

As used herein, the terms defined below have the following meanings unless otherwise indicated:

"Nucleic Acid Sequence": the term "nucleic acid sequence" includes both

DNA and RNA unless otherwise specified, and, unless otherwise specified, includes both double-stranded and single-stranded nucleic acids. Also included are hybrids such as DNA- RNA hybrids. In particular, a reference to DNA includes RNA that has either the equivalent base sequence except for the substitution of uracil and RNA for thymine in DNA, or has a complementary base sequence except for the substitution of uracil for thymine, complementarity being determined according to the Watson-Crick base pairing rules. Reference to nucleic acid sequences can also include modified bases as long as the modifications do not significantly interfere either with binding of a ligand such as a protein by the nucleic acid or with Watson-Crick base pairing. Terms such as "oligonucleotide" and "polynucleotide" are subject to the same qualifications as "nucleic acid sequence" unless otherwise limited. "Antibody": as used herein the term "antibody" includes both intact antibody molecules of the appropriate specificity, and antibody fragments (including Fab, F(ab'), Fv, and F(ab')₂), as well as chemically modified intact antibody molecules and antibody fragments, including hybrid antibodies assembled by in vitro reassociation of subunits. Also included are single-chain antibody molecules generally denoted by the term sFv and humanized antibodies in which some or all of the originally non-human constant regions are replaced with constant regions originally derived from human antibody sequences. Both polyclonal and monoclonal antibodies are included unless otherwise specified. Additionally included are modified antibodies or antibodies conjugated to labels or other molecules that do not block or alter the binding capacity of the antibody.

I. USE OF ANTISENSE OLIGONUCLEOTIDES TO BLOCK OPERATION OF

Yop SECRETION SIGNAL

One aspect of the present invention is the use of antisense oligonucleotides to block the operation of the Yop secretion signal located within the mRNA. This represents a novel mechanism to suppress the virulence of Yersinia species and other Gram-negative bacteria, such as Escherichia coli, Salmonella spp., Shigella spp., Pseudomonas spp., and Xanthomonas spp., and to allow host defense mechanisms such as phagocytosis to kill these bacteria more efficiently.

In general, for Yersinia, a method for inhibiting Type III secretion comprises the steps of: (1) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 15 amino acids of either the wild-type YopE or YopN protein; and

(2) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia. The antisense oligonucleotides useful in this aspect of the present invention, for Yersinia, bind at least a portion of the nucleotide sequence of the mRNA for YopE of YopN that encodes the first 15 amino acids of the YopE or YopN protein. This sequence, in its wild-type state, is AUGAAAAUAUCAUCAUUUAUUUCUACAUCACUGCCCCUGCCGGCAUCAGUGU CAGGA (SEQ ID NO: 1) for YopE and

AUGACGACGCUUCAUAACCUAUCUUAUGGCAAUACCCCGCUGCGUG for YopN (SEQ ID NO: 2). Preferably, this binding is with no mismatches under stringent conditions. The use of stringent conditions is well known in the art and includes high temperature, low ionic strength, and high concentrations of a denaturant such as formamide.

For example, for YopE, the antisense oligonucleotide sequence can include therein TGATGATATTTTCAT (SEQ ID NO: 3). Similarly, for YopN, the antisense oligonucleotide sequence can include therein the sequence ATCAAGCGTCGTCA (SEQ ID NO: 4). The portion of the molecule to which the antisense oligonucleotides according to the present invention binds preferably includes the first 15 nucleotides of the mRNA, encoding the first five amino acids. For other Gram-negative bacteria, antisense oligonucleotides useful in the present invention bind the corresponding regions of the mRNA for analogous proteins in these bacteria.

Typically, the antisense oligonucleotides are from 12-25 nucleotides long.

The principles for the construction and use of antisense oligonucleotides to inhibit the translation of mRNA are well understood in the art and need not be described further here in detail. They are set forth, for example, in E. Uhlmann & A. Peyman, "Antisense Oligonucleotides, Structure and Function of in Molecular Biology and Biotechnology: A Comprehensive Desk Reference (R.A. Meyers, ed., VCH Publishers, New York, 1995), pp. 38-45; and C. Lichtenstein & W. Nellen, "Antisense Technology: A Practical Approach" (IRL Press, Oxford, 1997), both of which are hereby incorporated by this reference. Among the modifications made to naturally occurring nucleotide structures in antisense oligonucleotides are modifications of the phosphate backbone, including phosphorothioates, phosphoramidates, and methylphosphonates. Other modifications include the production of "dephospho" oligonucleotides in which the phosphodiester group has been replaced completely, such as with formacetals, thioformacetals, methylhydroxamines, oximes, methylenedimethylhydrazo groups, dimethylenesulfones, and silyl groups. In still other modifications, the entire phosphate-sugar backbone of naturally occurring nucleotides is replaced with a peptide chain or a carbamate-linked morpholino chain. Therefore, the use of at least the following modified antisense oligonucleotides is within the scope of the present invention:

(I) modified oligonucleotides in which the phosphate backbone is replaced with phosphorothioates; (2) modified oligonucleotides in which the phosphate backbone is replaced with phosphoramidates;

(3) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates;

(4) modified oligonucleotides in which the phosphodiester groups are replaced with formacetals;

(6) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines; (7) modified oligonucleotides in which the phosphodiester groups are replaced with oximes;

(8) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups;

(9) modified oligonucleotides in which the phosphodiester groups are replaced with dimethylenesulfones;

(I I) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain; and (12) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a carbamate-linked morpholino chain. Still other modifications of oligonucleotides are possible and are known in the art.

In addition to antisense oligonucleotides that bind the naturally-occurring YopE and YopN mRNAs, the present invention also encompasses antisense oligonucleotides that bind mutations of the naturally-occurring YopE and YopN mRNAs that vary from the naturally occurring mRNAs by up to 5 nucleotides in the mRNA sequences encoding the first 15 amino acids but continue to provide a signal for secretion of the proteins at a level of at least 10% of wild-type. Preferably, the mutations vary by no more than two nucleotides from the naturally occurring sequences and continue to provide a signal for secretion of the proteins at a level of at least 25% of wild-type.

The secretion of other Yop proteins is controlled by other secretion signals, which can be expressed at the mRNA level. For example, the Type III secretion of YopQ of Y. enterocolitica is controlled by a signal that is located within the mRNA and is located within the first ten codons of the translated portion of the YopQ mRNA. This signal is absolutely necessary for the secretion of the polypeptide and for the translational repression of yopO mRNA in the presence of calcium. This signal is functional at the mRNA level, because at least some frameshift mutations preserve secretory activity.

Accordingly, within the scope of the present invention are methods employing antisense oligonucleotides that bind the YopQ mRNA or that bind mutations of the naturally-occurring YopQ mRNA that vary from the naturally occurring mRNA by up to 4 nucleotides in the mRNA sequences encoding the first 10 amino acids but continue to provide a signal for secretion of the protein at a level of at least 10% of wild-type. Preferably, the mutations vary by no more than two nucleotides from the naturally occurring sequences and continue to provide a signal for secretion of the protein at a level of at least 25%) of wild-type.

Accordingly, one aspect of the present invention is a method of inhibiting secretion of proteins by Yersinia comprising the steps of:

(1) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the first 15 amino acids of the YopE or YopN proteins; and

(2) introducing the antisense oligonucleotide into Yersinia to detectably inhibit the secretion of proteins by Yersinia.

Another aspect of the present invention is a method of inhibiting secretion of proteins by Yersinia comprising the steps of:

These antisense oligonucleotides can bind mRNA that encodes mutations of the YopE, YopN, or YopQ proteins as discussed above.

Analogously, the present invention also encompasses antisense oligonucleotides that bind mutations of the naturally occurring secretion signals in other Gram-negative bacteria, with analogous criteria being used to define those mutations subjected to inhibition by binding of antisense oligonucleotides.

Analogously, the present invention also includes a method of inhibiting secretion of proteins by other Gram-negative bacteria by using antisense oligonucleotides that bind the corresponding portion of the mRNA of the analogous proteins of those bacteria.

In general, for such Gram-negative bacteria, the method comprises:

(2) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the

Type III secretion of proteins by the Gram-negative bacterium. When the antisense oligonucleotide used is homologous to a mutant of such a protein in Gram-negative bacteria, the method, in general, comprises:

(2) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the Type III secretion of proteins by the Gram-negative bacterium, wherein the mRNA of the mutant secreted protein has at least about 89%o sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and wherein the mutant protein is secreted at a level of at least 10% of wild-type secreted protein.

Preferably, the mRNA of the mutant secreted protein has at least about 96% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and the mutant protein is secreted at a level of at least 25% of wild-type secreted protein.

The secretion of proteins by Yersinia, and by other Gram-negative bacteria, can be assayed as set forth in the Example. Other methods for assaying the secretion of proteins are known in the art and can be used.

Although the use of antisense oligonucleotides is described with particular detail for Yersinia, the use of such antisense oligonucleotides is also practical with other Gram-negative bacteria, such as Escherichia coli, Salmonella spp., Shigella spp., Pseudomonas spp., and Xanthomonas spp., and the use of antisense oligonucleotides to block type III secretion for these bacteria is also an aspect of the present invention as set forth above.

In general, this method comprises: (1) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the secretion signal of a secreted protein of a Gram-negative bacterium; and (2) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the Type III secretion of proteins by the Gram-negative bacterium.

The antisense oligonucleotide can be a naturally occurring oligonucleotide or a modified oligonucleotide, as described above.

Alternatively, the antisense oligonucleotide can bind a portion of an mRNA encoding the secretion signal of a mutant of a secreted protein of a Gram-negative bacterium. In this version of the embodiment, the method comprises:

Type III secretion of proteins by the Gram-negative bacterium. In this version of the embodiment, the mRNA of the mutant secreted protein has at least about 89% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and the mutant protein is secreted at a level of at least 10%> of wild-type secreted protein. Preferably in this version of the embodiment, the mRNA of the mutant secreted protein has at least about 96% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and the mutant protein is secreted at a level of at least 25% of wild-type secreted protein.

II. METHODS OF SEARCHING FOR PHARMACEUTICAL COMPOUNDS

THAT INHIBIT TYPE III SECRETION BY YERSINIA AND OTHER GRAM NEGATIVE BACTERIA

Another aspect of the present invention is methods of searching for compounds that inhibit Type III secretion by Yersinia and by other Gram-negative bacteria. These methods allow screening of compounds to determine whether they inhibit Type III secretion.

In general, such methods comprise:

(2) adding a candidate compound to the first aliquot;

(3) allowing Type III secretion to occur;

Specifically, in a preferred method employing Yersinia, Yersinia (either Y. enterocolitica, Y, pestis, or Y. pseudotuberculosis) or other Gram-negative bacteria, such as Escherichia coli, Salmonella spp. , Shigella spp. , Pseudomonas spp. , and Xanthomonas spp., are grown in small aliquots (200 μl) in an ELISA reader plate (96 wells) at 26°C. For bacteria other than Yersinia, the temperature and the culture conditions can be adjusted as required so that the initial period of growth occurs under nonpermissive conditions for type III secretion. Once the cultures reach an optical density at 600 nm (OD₆oo) of 0.4, the bacteria are placed at 37°C to induce the Type III secretion machinery and expression of Yop export substrates, for Yersinia, or analogous export substrates, for other Gram- negative bacteria, and incubated for another 3 hours. For bacteria other than Yersinia, these conditions may be adjusted to ensure optimum occurrence of type III secretion during this period. During this time, the compound to be screened is added to the culture to determine whether or not it interferes with type III secretion by the bacterium being cultured. The cultures are then centrifuged in a swinging bucket rotor to sediment the bacterial cells. Yop proteins, or other proteins secreted by the Gram-negative bacteria as the result of type III secretion, that have been secreted into the culture supernatant are separated from the sediment (cell pellet) and placed into a vacuum manifold that allows for filtration of the 96 supernatants through a nitrocellulose or PVDF filter. This filter then contains bound proteins (Yops or other secreted proteins) that had been secreted by the bacteria into the culture supernatant. The filter is then removed from the manifold and incubated in skim milk or another blocking agent to block all other protein binding sites on the nitrocellulose or PVDF membrane. The filter is then incubated first with an antibody raised against purified YopD, any other Yop protein, or a protein secreted by another Gram-negative bacterial species. Typically, rabbit antibodies are employed; however, antibodies raised in other species, such as sheep, goats, or other mammals, can be used with equal efficiency. Antibody binding to YopD or other proteins that have been secreted and which may be present or absent in blotted culture supernatants are then detected via the binding of an anti-idiotypic antibody, i.e., the antibody present in an antiserum raised against the conserved Fc portion of the, for example, rabbit antibodies. Such anti-idiotypic antibodies are commercially available. These anti-idiotypic antibodies are coupled to a detectable label capable of producing a signal. Preferably, the detectable label is an enzyme label, such as alkaline phosphatase, horseradish peroxidase, β-galactosidase, or another enzyme that produces a detectable product. If an enzyme label is used, the binding of the anti-idiotypic activity is easily measured by measuring the enzymatic activity. Alternatively, other labels known in the art, such as a radioactive label, a fluorescent label, a chemiluminescent label, or a particulate label, can be used in place of the enzyme label. Finally, the assay is evaluated by inspecting the blot measuring type III secretion of YopD, any other Yop, or analogous proteins secreted by other Gram-negative bacteria, and searching for those cultures in which type III secretion is prevented or inhibited by the addition of the compound to be screened.

This screening can be used to find compounds that are capable of inhibiting, blocking, or modulating type III secretion carried out by Gram-negative bacteria, including Yersinia spp. , Escherichia coli, Salmonella spp. , Shigella spp. , Pseudomonas spp. , and Xanthomonas spp. These compounds then can be tested for antibiotic activity against one or more species of Gram-negative bacteria, and can then be subject to chemical modification, such as derivatization, to provide a range or family of compounds for further testing.

The proteins that can be employed in such a screening assay include the Yop proteins of Yersinia, including YopD, YopE, YopN, and YopQ. Other analogous proteins secreted by Type III mechanisms in other Gram-negative bacteria, including Escherichia coli, Salmonella spp., Shigella spp., Pseudomonas spp. and Xanthomonas spp., can be used in the screening assay.

EXAMPLES

The invention is illustrated by the following Examples. These Examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any manner.

Example 1

Characterization of the Secretion Pathway for YopE and YopQ

To determine whether Yop proteins are marked for secretion by a covalent post-translational modification, we purified, sequenced and measured the mass of secreted YopE. The results indicated that YopE is not modified upon export by the Yersinia type III machinery. YopE was purified from the culture supernatant of f. enterocolitica O:8 strain 8081 (D.A. Portnoy et al., Infect. Immun. 31, 775 (1981)) by ammonium sulfate precipitation (46 %). The precipitate was solubilized in 6 M guanidine hydrochloride, 0.05 M phosphate buffer, 0.01 M dithiothreitol, pH 7.5 and separated by reverse phase HPLC on C8 column (BDS Hypersil, 4.6 x 250 mm) with a linear gradient of acetonitrile from 5 to 95%o (1%/min) in 0.1% TFA. The NH2-terminal sequence of purified YopE was confirmed by Edman degradation and the molecule was subjected to electrospray ionization mass spectrometry. An average compound mass of 23,018.75 (m/z 1212, 1280, 1355, 1440, 1645, 1772, 1 19) was observed and this measurement is in agreement with a calculated compound mass of 23,016.10, given a standard error rate of 0.01% (± 2 Da).

Several other Gram-negative pathogens also target their cytotoxic proteins into eukaryotic host cells (M. Russel, Science 265, 612 (1994)). Bacterial contact with the target cell induces expression of the otherwise tightly regulated export machinery and secretion substrates (J. Petterson et al. (1996), supra). Many components of the type III machinery are highly conserved among Gram-negative bacteria (J. E Galan, Mol. Microbiol. 20, 263 ( 1996)). Substrate proteins from one organism can be exported by heterologous pathogens, suggesting a universal mechanism for secretion (R. Rosqvist, S. Hakansson, A. Forsberg, H. Wolf-Watz, EMBO J. 14, 4187 (1995)) The NH₂-terminal 15 to 17 amino acids of Yop proteins have been proposed to function as a secretion signal, however in the absence of a common peptide property it has been unclear how these signals can be universally recognized (M.-P. Sory, A. Boland, I. Lambermont, G. R. Cornelis,

Proc. Natl. Acad. Sci. U.S.A. 92, 1 1998 (1995); K. Schesser, E. Fritzh-Lindsten, H. Wolf- Watz, J. Bacleriol. 178, 7227 (1996)).

We therefore sought to characterize the secretion signal through genetic and biochemical means. We studied two type III secretion substrates, YopE and YopN, in Yersinia enterocolitica by analyzing translational fusions to cytoplasmic neomycin phosphotransferase (Npt). (B. Reiss, R. Sprengel, H. Schaller, EMBO J. 3, 3317 (1984)).

To identify the minimal secretion signal of YopN, NH₂-terminal coding sequences were fused to Npt. Two plasmids were present in Y. enterocolitica W22703, the virulence plasmid (pYV227) and a low-copy-number plasmid expressing type III secretion substrates. The yopE and yopN genes were amplified with the polymerase chain reaction (PCR) from the virulence plasmid as three separate DNA fragments, one containing the promoter and upstream untranslated sequences, a middle fragment specifying the open reading frame and a downstream fragment harboring a putative transcriptional terminator. All fragments were assembled as cassettes and inserted into pHSG575 (S. Takeshita et al., Gene 61, 63 (1987)). To generate NH₂- or COOH-terminal fusions, we replaced the central Ndel to BamHl cassette with two fragments joined at a Kpnl site. The npt gene (E. Beck et al., Gene 19, 327 (1982)) was PCR amplified with abutted Kpnl and BamHl sites. The YopE and YopN fusions were amplified with flanking Ndel and Kpnl sites. Fusions harboring the first ten or fifteen codons of Yop mRNA were created by annealing oligonucleotides with overlapping ends for cloning between the Ndel and Kpnl sites. All constructs were verified by DNA sequencing.

Secretion of the hybrid proteins was measured by immunoblot analysis of the sedimented cells or medium of Yersinia cultures induced by temperature shift (37°C) and low-calcium. Overnight cultures of f. enterocolitica were diluted 1 :50 into fresh M9 medium with casamino acids and grown for 2 hours at 26°C before incubation for 3 hours at 37°C. A portion of the induced culture (ODgoo of 0.5), 30 ml was centrifuged at 17,000g for 13 min and 20 ml of supernatant was removed and precipitated with 5% trichloroacetic acid (TCA). The remainder of the supernatant was discarded and the sedimented material was suspended in water (750 μl). A portion (500 μl) of this suspension was precipitated with ice-cold 10% TCA (500 μl). All TCA precipitates were washed in acetone, dissolved in sample buffer, and analyzed by immunoblotting with rabbit antiserum. Immunoreactive species were identified as a chemiluminescent signal and quantitated by laser densitometry scanning of developed X-ray films. Immunoblotting for cytoplasmic chloramphenicol acetyl-transferase served as an internal control for correct fractionation of Yersinia cultures.

As reported for YopE (M.-P. Sory et al. (1995), supra; K. Schesser et al. (1996), supra), the first fifteen codons of YopN still allowed secretion of the fused reporter protein, while truncating this signal to ten codons abolished secretion (Fig. 1). Relative rates of polypeptide synthesis were analyzed by pulse labelling and compared to those of another type III secretion substrate, YopH. Overnight cultures of Yersinia were diluted 1 :20 into 20 ml of M9 minimal medium, grown for 2 hours at 26°C and induced for 3 hours by temperature shift to 37°C. One ml of culture was labeled with 100 μCi of Pro-Mix™ for 1 min and precipitated with ice-cold TCA. The SDS-solubilized samples were immunoprecipitated with antiserum to purified YopH or Npt, separated by SDS- polyacrylamide gel electrophoresis (PAGE) and quantified by phosphorimager.. Truncating the YopE signal to ten codons caused a reduction in synthesis of the fusion protein. This reduction was apparently caused by an inhibition of translation because the relative amount of mRNA for this fusion protein was similar to that observed for the Npt hybrid containing the first fifteen codons of YopE. Portions of induced

Yersinia cultures (1.5 ml) were centrifuged and sedimented cells were lysed in 0.1 ml 1 mM EDTA, 5 mg/ml lysozyme. RNA was purified using the RNeasy kit according to manufacturer's protocol (Qiagen). Total RNA (lOμg) was separated by formaldehyde containing agarose gel electrophoresis and transferred to nylon membrane. The filter was hybridized with [³²P]CTP labelled DNA sequences prepared by random primer labelling of restriction fragments corresponding to the full length open reading frame of either npt or yopH.

We asked if the secretion signal of YopE functioned when moved from the NH₂-terminus by constructing a hybrid Npt protein which contained YopE fused to its COOH-terminal end. This hybrid was not secreted indicating that the secretion signal is only functional when located at the translational start (Fig. 1).

To determine if single amino acid residues of the YopE and YopN signals were critically important for secretion, codons 2 to 15 were individually replaced with GCA or GCU which both specify alanine. The alanyl substitutions had little effect on secretion of the hybrid Npt proteins (Table 1). However, as measured by pulse labelling, YopE signal mutants with substitutions at positions 2 and 15 were synthesized at lower rates (less than 50%>) and GCA replacement at codon 4 (YopE₄s-_A-Npt) completely abolished translation. We also individually mutagenized codons 2 to 15 of the YopE signal by substitution with GAG encoding glutamic acid. Substitution of hydrophobic or positively charged amino acids with this strongly acidic residue did not affect secretion of the mutant proteins, but replacement of codons 2, 3, 4, 10 or 12 caused a reduction in polypeptide synthesis (less than 50%). Table 1. Scanning mutagenesis of the secretion signal of YopEι_ι₅-Npt (pDA46) and YopNι.i₅-Npt (pDA85). Individual codons of the wild-type sequence were replaced with those encoding either alanine or glutamic acid. The secretion data were collected by separating culture medium from sedimented cells and immunoblotting with anti-Npt. The relative amount of synthesized fusion protein [X] was measured by pulse labeling and is reported as the ratio to another type III secreted protein [YopH], ND, not determined.

We sought to identify mutations that abolished substrate recognition of the type III machinery by drastically modifying the polypeptide sequence of the secretion signals. We constructed frame shift mutations by inserting or deleting nucleotides immediately after the AUG start codon. The correct reading frame was restored by reciprocal nucleotide insertions or deletions at the fusion site with Npt. The secretion signals of both YopE and YopN tolerated several frame shift mutations and the altered polypeptides were still secreted (Fig. 2). For YopE, deleting one nucleotide (-1) or adding two nucleotides (+2) did not prevent the secretion of hybrid proteins. In contrast, mutations shifting to the third reading frame (+1, -2) abolished secretion, and the Npt hybrids remained in the cytoplasm. This reading frame encodes a very hydrophobic NH2- terminal peptide, a physical property that may interfere with its secretion by the type III machinery (Fig. 2C). For YopN, the +1, -1, +2, and -2 reading frame mutants all allowed secretion. To test whether frame shift mutations resulted in altered amino acid sequences, we purified one mutant protein (YopE -1) from the medium of Yersinia cultures and confirmed the predicted sequence by Edman degradation. Hybrid Npt proteins were purified with a fused COOH-terminal 6 His tag from the supernatant of induced Yersinia cultures. Briefly, protein from one liter culture supernatant was precipitated with 46% ammonium sulfate, collected by centrifugation, dissolved and purified by chromatography on nickel sepharose. The NH2-terminal amino acid sequence was determined by Edman degradation.

Because several frame shift mutations resulted in proteins that were secreted, we considered that the secretion signal might be located within the mRNA sequence. If this were true, nucleotide changes at the third position of codons that do not alter the protein sequence (F. H. C. Crick, L. Barnett, S. Brenner, R. J. Watts-Tobin, Nature 192, 1227 (1961)) might have an effect on either secretion or translation of the hybrid Npt proteins. We tested codons 2 to 4 of YopN because these positions were sensitive to mutation in the secretion signal of YopE. Single nucleotide changes at position 2, 3, or 4 of the YopN signal did not affect either translation or secretion (Table 2). However, combined mutations at codons 2 and 4 reduced the amount of mRNA translation, which was restored to wild-type amounts when the mutant RNA contained all three altered codons (Table 2). The reduced concentration of the mRNA with mutations at codons 2 and 4 is likely caused by its increased degradation rather than by an effect on transcription (Table 2).

Table 2. Nucleotide changes at the third position of codon triplets that do not alter the protein sequence of the secretion signal were introduced into YopN ₅-Npt. Secretion was measured by immunoblotting of culture supernatant and cell sediment. The relative amount of synthesized fusion protein [X] was measured by pulse labeling and is reported as the ratio to another type III secreted protein, [YopH]. [x]/[yopH] indicates relative levels of mRNA that were observed by RNA blot hybridization.

Several mutations in the secretion signals of YopE and YopN either reduced or abolished synthesis of the recombinant proteins. These mutations may hinder Yop translation, for example by interfering with ribosome binding or translational initiation. Alternatively, this mutational phenotype could represent a defect in the recognition of an mRNA signal that ultimately leads to the secretion of Yop proteins. Suppressor mutations that restore a translational defect of the YopE4S-A-Npt mutant (pDA54, GCA replacing TCA at codon 4) should alter the mutant codon, whereas mutations that suppress a signal recognition defect could also be located at other positions involved in contacting the secretion machinery. Spontaneous mutants were selected by plating Yersinia enterocolitica harboring pDA54 on agar medium containing neomycin. W22703 cells (pYV227, pDA54 (YopE4S-A-Npt)) (2 x 10¹⁰), grown in Luria broth (LB) supplemented with 20 μg/ml chloramphenicol at 28°C were plated on tryptic soy broth (TSB) agar plates containing 50 μg/ml neomycin, 20 μg/ml chloramphenicol, and 5 mM EGTA. After 48 hours of growth at 30°C, nitrocellulose filters were placed on the surface of the plates, incubated for 30 min at room temperature, and probed with antibodies to Npt. Neomycin-resistant revertants arose at a frequency of 10"⁹ and were picked from the plates and patched onto fresh TSB agar supplemented with neomycin, chloramphenicol and EGTA. Nitrocellulose filters were placed directly on the colonies and incubated in 1% SDS and lysozyme for 10 min. Colonies that reacted with antibodies to Npt were subsequently analyzed by immunoblotting for secretion of the Npt hybrid. Plasmid was isolated and transformed into W22703 to determine the linkage of the suppressor mutations to this DNA. Mutations were identified by DNA sequencing.

Nine independent mutants were analyzed by immunoblotting; each of them synthesized and secreted the Npt fusion protein in a manner similar to that observed for the wild-type construct. These isolates were intragenic suppressors that contained mutations located at codons 2 through 6 and 12 (Table 3). Transversion of the nucleotide at the third position of codon 12 (CCC to CCA) restored translation and thus secretion of the hybrid protein without an alteration of its amino acid sequence. This mutation was found in every suppressor isolate and was sometimes combined with mutations at codons 2, 4, or 5 or a deletion of codon 6. Although these results do not permit a definitive explanation, we think it is more likely that the mutational change at codon 4 abolished the recognition of an mRNA signal rather than causing a hindrance of translational initiation.

Table 3. Spontaneous suppressor mutations of YopE₄s-A-Npt were selected by plating Y. enterocolitica harboring plasmid pDA54

) on tryptic soy agar plates with neomycin (50 μg/ml). Plasmid was purified from individual colonies and transformed into W22703, and plasmid transformants were selected on chloramphenicol plates. Individual isolates were tested for resistance to neomycin [minimal inhibitory concentration (MIC) for 10⁵ cells], relative concentration of mRNA ([x]/[yopH]), synthesis ([x]/[yopH]), and secretion of hybrid Npt proteins. Mutational changes of the suppressors were determined by DNA sequencing. ND, not determined.

Other secretion or protein targeting signals do not tolerate such drastic mutational changes without a loss of function. The reason for this difference may reflect the mode of substrate recognition by the type III machinery. RNA may be the carrier of a signal that ultimately leads to the export of encoded Yop proteins. One possible mechanism is that the mRNA signals co-translational secretion by the type III machinery. In support of this hypothesis, pulse chase experiments of Y. enterocolitica cultures revealed that YopE was secreted during a short pulse with [³⁵S]methionine but not after the addition of unlabeled methionine, suggesting that secretion occurred during the ribosomal synthesis of YopE (L.W. Cheng, D M Anderson, O. Schneewind, Mol. Microbiol. 24, 757 (1997)).

Yop translation might be inhibited by an intrinsic property of the mRNA which can be relieved by its interaction with the secretion apparatus. Most mutations that affect recognition of an RNA signal would therefore abolish both secretion and translation. An uncoupling of secretion from translation might result from larger deletions of the signal that destroy its structure. We have incorporated some of the mutations described here in predicted RNA structures of the YopE and YopN secretion signals (M. Zuker, Science 244, 48 (1989)) (Fig. 3). Common to both structures is a stem loop that buries the AUG translational start in a base paired duplex while positioning codons 2 to 4 within a loop. Mutations that abolished translation are located either within the predicted loop or its adjacent base pairs, that is at positions typically recognized by RNA binding proteins (C. G. Burd and G. Dreyfuss, Science 265, 615 (1994)). Such an RNA structure would have to undergo dynamic changes as it would have to first assume an untranslatable fold, which could then be relieved by specific interaction with components of the secretion machinery.

ADVANTAGES OF THE PRESENT INVENTION

The present invention provides a new pathway for the screening and production of antibiotics that can be used to treat Gram-negative bacterial infections, particularly those caused by Yersinia. The present invention therefore provides a route to the identification and development of antibiotics that operate against a pathway of bacterial virulence hitherto unexploited for antibiotic activity. The present invention also provides a method of inhibiting secretion of proteins by Gram-negative bacteria by employing antisense oligonucleotides.

Although the present invention has been described with considerable detail, with reference to certain preferred versions thereof, other versions and embodiments are possible. Therefore, the scope of the present invention is determined by the following claims.

Claims

What is claimed is

1 A method of inhibiting Type III secretion of proteins by Yersinia comprising the steps of (a) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 15 amino acids of either the wild-type YopE or YopN protein, and

(b) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia

2 The method of claim 1 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides

3 The method of claim 2 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide

4 The method of claim 2 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of

(a) modified oligonucleotides in which the phosphate backbone is replaced with phosphorothioates,

(b) modified oligonucleotides in which the phosphate backbone is replaced with phosphoramidates, (c) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates,

(d) modified oligonucleotides in which the phosphodiester groups are replaced with formacetals,

(e) modified oligonucleotides in which the phosphodiester groups are replaced with thioformacetals,

(f) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines, (g) modified oligonucleotides in which the phosphodiester groups are replaced with oximes;

(h) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups; (i) modified oligonucleotides in which the phosphodiester groups are replaced with dimethylenesulfones;

(j) modified oligonucleotides in which the phosphodiester groups are replaced with silyl groups;

(k) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain; and

(1) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a carbamate-linked morpholino chain.

5. The method of claim 1 wherein the antisense oligonucleotide binds at least the first 15 nucleotides of either the mRNA encoding the Yersinia YopE protein or the mRNA encoding the Yersinia YopN protein.

6. The method of claim 1 wherein the antisense oligonucleotide is from 12 to 25 nucleotides in length.

7. The method of claim 6 wherein the antisense oligonucleotide hybridizes to

AUGAAAAUAUCAUCAUUUAUUUCUACAUCACUGCCCCUGCCGGCAUCAGUGU CAGGA (SEQ ID NO: 1) with no mismatches under stringent conditions.

8. The method of claim 7 wherein the antisense oligonucleotide includes therein the sequence TGATGATATTTTCAT (SEQ ID NO: 3).

9. The method of claim 6 wherein the antisense oligonucleotide hybridizes to AUGACGACGCUUCAUAACCUAUCUUAUGGCAAUACCCCGCUGCGUG (SEQ

ID NO: 2) with no mismatches under stringent conditions.

10. The method of claim 9 wherein the antisense oligonucleotide includes therein the sequence ATCAAGCGTCGTCA (SEQ ID NO: 4).

11. A method of inhibiting Type III secretion of proteins by Yersinia comprising the steps of:

(a) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 15 amino acids of a mutant of either the YopE or YopN protein; and

(b) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by

Yersinia, wherein the mutant varies from the naturally occurring mRNAs for YopE or YopN by up to 5 nucleotides in the mRNA sequences encoding the first 15 amino acids of the YopE or YopN proteins and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 10% of wild-type.

12. The method of claim 1 1 wherein the mutant varies by no more than two nucleotides from the naturally occurring mRNAs for YopE or YopN in the mRNA sequences encoding the first 15 amino acids of the YopE or YopN proteins and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 25% of wild-type.

13. The method of claim 1 1 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides.

14. The method of claim 13 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide.

15. The method of claim 13 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of:

(a) modified oligonucleotides in which the phosphate backbone is replaced with phosphorothioates; (b) modified oligonucleotides in which the phosphate backbone is replaced with phosphoramidates;

(c) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates; (d) modified oligonucleotides in which the phosphodiester groups are replaced with formacetals;

(e) modified oligonucleotides in which the phosphodiester groups are replaced with thioformacetals;

(f) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines;

(g) modified oligonucleotides in which the phosphodiester groups are replaced with oximes;

16. The method of claim 11 wherein the antisense oligonucleotide is from 12 to 25 nucleotides in length.

17. A method of inhibiting Type III secretion of proteins by Yersinia comprising the steps of:

(a) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the first 10 amino acids of the YopQ protein; and

(b) introducing the antisense oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia.

18 The method of claim 17 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides

19 The method of claim 18 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide

20 The method of claim 18 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of

(f) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines,

(g) modified oligonucleotides in which the phosphodiester groups are replaced with oximes, (h) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups,

(i) modified oligonucleotides in which the phosphodiester groups are replaced with dimethylenesulfones,

(j) modified oligonucleotides in which the phosphodiester groups are replaced with silyl groups,

(k) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain, and (1) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a carbamate-linked morpholino chain

21 The method of claim 17 wherein the antisense oligonucleotide is from 12 to 25 nucleotides in length

22 A method of inhibiting Type III secretion of proteins by Yersinia comprising the steps of

(a) providing an antisense oligonucleotide that binds at least a portion of the mRNA encoding the first 10 amino acids of a mutant of the YopQ protein, and

(b) contacting the Yersinia with the oligonucleotide to introduce the oligonucleotide into Yersinia to detectably inhibit the Type III secretion of proteins by Yersinia, wherein the mutant varies from the naturally occurring mRNA for YopQ by up to 4 nucleotides in the mRNA sequence encoding the first 10 amino acids of the YopQ protein and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 10% of wild-type

23 The method of claim 22 wherein the mutant varies by no more than two nucleotides from the naturally occurring mRNA for YopQ in the mRNA sequence encoding the first 10 amino acids of the YopQ protein and wherein the mutant continues to provide a signal for secretion of proteins at a level of at least 25% of wild-type

24 The method of claim 22 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides

25 The method of claim 24 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide

26 The method of claim 24 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of

(b) modified oligonucleotides in which the phosphate backbone is replaced with phosphoramidates,

(c) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates,

(e) modified oligonucleotides in which the phosphodiester groups are replaced with thioformacetals, (f) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines,

(g) modified oligonucleotides in which the phosphodiester groups are replaced with oximes,

(h) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups,

(j) modified oligonucleotides in which the phosphodiester groups are replaced with silyl groups, (k) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain, and

(1) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a carbamate-linked morpholino chain

27 The method of claim 22 wherein the antisense oligonucleotide is from

12 to 25 nucleotides in length

28 A method of inhibiting Type III secretion of proteins by a Gram- negative bacterium comprising the steps of (a) providing an antisense oligonucleotide that binds a portion of the mRNA encoding the secretion signal of a secreted protein of a Gram-negative bacterium, and (b) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the Type III secretion of proteins by the Gram-negative bacterium.

29. The method of claim 28 wherein the Gram-negative bacterium is selected from the group consisting of Yersinia spp., Escherichia coli, Salmonella spp., Shigella spp. , Pseudomonas spp. , and Xanthomonas spp.

30. The method of claim 28 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides.

31. The method of claim 30 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide.

32. The method of claim 30 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of:

(c) modified oligonucleotides in which the phosphate backbone is replaced with methylphosphonates;

(d) modified oligonucleotides in which the phosphodiester groups are replaced with formacetals;

(f) modified oligonucleotides in which the phosphodiester groups are replaced with methylhydroxamines; (g) modified oligonucleotides in which the phosphodiester groups are replaced with oximes;

(h) modified oligonucleotides in which the phosphodiester groups are replaced with methylenedimethylhydrazo groups;

(i) modified oligonucleotides in which the phosphodiester groups are replaced with dimethylenesulfones;

33. The method of claim 28 wherein the antisense oligonucleotide is from 12 to 25 nucleotides in length.

34. A method of inhibiting Type III secretion of proteins by a Gram- negative bacterium comprising the steps of:

(a) providing an antisense oligonucleotide that binds a portion of an mRNA encoding the secretion signal of a mutant of a secreted protein of a Gram-negative bacterium; and

(b) contacting the Gram-negative bacterium with the oligonucleotide to introduce the oligonucleotide into the Gram-negative bacterium to detectably inhibit the

Type III secretion of proteins by the Gram-negative bacterium, wherein the mRNA of the mutant secreted protein has at least about 89%) sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and wherein the mutant protein is secreted at a level of at least 10% of wild-type secreted protein.

35. The method of claim 34 wherein the mRNA of the mutant secreted protein has at least about 96% sequence identity with the mRNA of the wild-type secreted protein in the sequence encoding the secretion signal, and wherein the mutant protein is secreted at a level of at least 25% of wild-type secreted protein.

36. The method of claim 34 wherein the antisense oligonucleotide is selected from the group consisting of naturally occurring oligonucleotides and modified oligonucleotides.

37. The method of claim 36 wherein the antisense oligonucleotide is a naturally occurring oligonucleotide.

38. The method of claim 36 wherein the antisense oligonucleotide is a modified oligonucleotide selected from the group consisting of:

(k) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a peptide chain; and (1) modified oligonucleotides in which the entire phosphate-sugar backbone is replaced with a carbamate-linked morpholino chain.

39. The method of claim 34 wherein the antisense oligonucleotide is from 12 to 25 nucleotides in length.

40. A method for screening a compound for inhibition of Type III secretion by a Gram-negative bacterium comprising the steps of:

(a) growing a first aliquot of a Gram-negative bacterium in growing conditions that are permissive for Type III secretion;

(b) adding a candidate compound to the first aliquot;

(c) allowing Type III secretion to occur; (d) separating a protein secreted from the bacterium by Type III secretion from the cells and attaching the secreted protein to a solid support;

(e) reacting the secreted protein on the solid support with a first antibody that specifically binds the secreted protein;

(f) reacting the secreted protein on the solid support reacted with the first antibody with an anti-idiotypic second antibody that specifically binds the first antibody, the second antibody being labeled with a detectable label, the detectable label producing a signal; and

(g) comparing the intensity of the signal produced in step (f) with a signal produced as the result of performing steps (a) and (c)-(f), but not (b), on a second aliquot of the Gram-negative bacterium to determine whether the candidate compound inhibits type III secretion.

41. The method of claim 40 wherein the Gram-negative bacterium is selected from the group consisting of Yersinia spp., Escherichia coli, Salmonella spp., Shigella spp. , Pseudomonas spp. and Xanthomonas spp.

42. The method of claim 40 wherein the Gram-negative bacterium is Yersinia spp.

43. The method of claim 42 wherein the protein secreted from the bacterium is a Yop protein.

44. The method of claim 43 wherein the protein secreted from the bacterium is selected from the group consisting of YopD, YopE, YopN, and YopQ.

45. The method of claim 39 wherein the detectable label is an enzyme label.