WO1999041984A1 - INTERACTION BETWEEN THE MEC1-DEPENDENT DNA SYNTHESIS CHECKPOINT AND G1 CYCLIN FUNCTION IN $i(SACCAROMYCES CEREVISIAE) - Google Patents

Abstract

The completion of DNA synthesis in yeast is monitored by a checkpoint that requires MEC1 and RAD53. Overexpression of the S. cerevisiae G1 cyclin CLN1 results in genomic instability and lethality of mec1-1 checkpoint-deficient cells compared to cln1 cln2 mec1-1 cells. Here we show that overexpression of CLN2 or CLB5, but not CLN3, also killed mec1-1 strains. We identified RNR1, which encodes a subunit of ribonucleotide reductase, as a high-copy suppressor of the lethality of mec1-1 GAL1-CLN1. Northern analysis demonstrated that RNR1 expression is reduced by CLN1 or CLN2 overexpression. Since limiting RNR1 expression might decrease dNTP pools, CLN1 or CLN2 may cause lethality in mec1-1 strains by causing initiation of DNA replication with inadequate dNTP pools. In MEC1 strains, a delay of S phase due to the checkpoint would occur, but in mec1-1 strains lethality would result. Consistent with this model, CLN1 overexpression did result in a prolongation of S phase in a MEC1 background. In a cln1 cln2 background, a prolonged period of expression of genes turned on at the G1-S border has been observed. Thus deletion of CLN1 and CLN2 could function similarly to overexpression of RNR1 in suppressing mec1-1 lethality. While Mec1p has been proposed to act in a linear pathway upstream of Rad53p, rad53 lethality was rescued little by deletion of CLN1 and CLN2, suggesting that Rad53p has Mec1-independent activities.

Description

Interaction between the ECV-dependent DNA synthesis checkpoint and Gl cyclin function in Saccharomyces cerevisiae

This application claims the priority date of Provisional U.S. Application Serial No. 60/075,342, filed February 20, 1998, the disclosure of which is hereby incorporated by reference.

1. Field Of The Invention

The present invention relates to signal transduction, checkpoints and Gl cyclin function. The invention also relates to aspects of the genes RAD53, RNRl, CLN, MECl, (all of which are related to, or code for, phosphoinositide kinases) and replication. Methods for suppressing the lethality of adverse effects of certain mutations in MECl and its homologs are also described.

2. Background Of The Invention

Cyclins and cyclin-dependent kinases (CDKs) have been shown to play important roles in many eukaryotic cell cycle transitions. In the yeast, Saccharomyces cerevisiae, the cyclins, which normally control the Gl to S phase transition (START), are CLNl, CLN2 and CLN3. The B-type cyclin, CLB5, can functionally substitute for the CLNs if it is overexpressed (Epstein and Cross 1992; Schwob and Nasmyth 1993), or if the B- type cyclin inhibitor, SIC1, is deleted (Schneider, Yang and Futcher 1996; Tyers 1996). The Cln proteins, when complexed with the CDK encoded by CDC28, activate a number of pathways, including activation of B-type cyclins (CLBs), DNA replication, bud emergence and microtubule organizing center duplication (see Lew, Weinert and Pringle 1997 for a recent review).

Although redundant for viability in an otherwise wild-type strain, there are significant and qualitative differences between the CLNs as evidenced by their in vitro kinase activities, requirements for other gene products and ability to activate transcription of other genes (Benton et al. 1993; Cvrckova and Νasmyth 1993; Levine, Huang and Cross 1996; Tyers, G. and Futcher 1993; Vallen and Cross 1995). One specific difference between CLNl and CLN2 compared to CLN3 is CLN3's ability to act as a strong transcriptional activator of cell cycle-regulated genes containing promoter elements regulated by the transcription factors SBP and MBP (Dirick, Bohm and Νasmyth 1995; Tyers, Tokiwa and Futcher 1993). It is likely that the predominant role of CLΝ3 in the cell is the activation of transcription of these gene classes. CLN3 appears to be less potent an activator of most of the other pathways that are initiated at START (Levine, Huang and Cross 1996). Thus, in a wild-type CLN* strain, the three different cyclins complexed with Cdc28p may act together, leading to the coordinate activation of transcription and other START-associated processes.

ATM and ATR are members of the phosphatidylinositol 3-kinase (PIK)-like kinases and are active in regulating DNA damage-induced mitotic cell-cycle checkpoints. ATM and ATR also play a role in meiosis. For example, spermatogenesis in Atm-/- male mice is disrupted, with chromosome fragmentation leading to meiotic arrest; in human patients with ataxia-telangiectasia (AT), gonadal atrophy is common. Immuno-localization studies indicate that ATM is associated with sites along the synaptonemal complex (SC), the specialized structure along which meiotic recombination occurs. ATM and ATR share common primary sequences through the carboxy-terminal protein kinase domain, and their sequences bear similarities to the pi 10 lipid kinase subunit of PI3-kinase. FRAP (FKBP12 and rapamycin-binding protein kinase) participate in mitogenic and growth factor responses in Gl and may regulate specific RNA translation signals. DNA-PK (DNA-dependent protein kinase), ATM (ataxia telangiectasia mutated), and ATR (ataxia telangiectasia and Rad 3 related) are thought to participate in responses to nuclear cues that activate DNA rearrangements or cell cycle arrests.

A number of genes, which are required directly for DNA replication, have transcript levels that peak at or near the Gl to S phase transition. These genes are regulated by MBP (MCB-binding factor), having MCB (Mlul cell cycle box) elements upstream of their coding region (Mclntosh 1993). One such gene is RNRl, which shows about a 15-fold fluctuation in RNA levels across the cell cycle (Elledge and Davis 1990). RNRl encodes the large subunit of ribonucleotide reductase. Ribonucleotide reductase is a tetrameric enzyme of the structure α₂β₂, which catalyzes the formation of deoxyribonucleotides from ribonucleotides. Enzymatic activity of the complex has been demonstrated to be cell cycle regulated, peaking in early S phase (Lowden and Vitols 1973). Because RNA levels of the small subunit, encoded by RNR2, only vary approximately 2-fold during the cell cycle, it is likely that Rnrl levels are rate-limiting for enzymatic activity (Elledge and Davis 1990). Inhibition of ribonucleotide reductase activity by hydroxyurea (HU) leads to depletion of dNTP pools (Yarbro 1992) and results in cell cycle arrest in S phase in wild-type eukaryotic cells.

HU causes cell cycle arrest because there is a signaling pathway, or S phase checkpoint (Weinert and Hartwell 1989; Weinert, Kiser and Hartwell 1994), that monitors the completion of DNA replication and prevents mitosis until replication is completed. The incomplete replication and stalled replication forks caused by depletion of deoxyribonucleotide pools are likely sensed by DNA polymerase ε, Dpbl 1, or Rfc5 (Araki et al. 1995; Navas, Zhou and Elledge 1995; Sugimoto et al. 1996). The signal transduction pathway activated by HU and required for cell cycle arrest and the transcriptional induction of genes required for DNA synthesis and damage repair requires the kinases Meclp and Rad53p (Kiser and Weinert 1996). Activation of replication checkpoints by HU or DNA polymerase α mutants induces phosphorylation of Rad53p that is MEC1+ dependent (Sanchez et al. 1996; Sun et al. 1996). This, coupled with the observations that MECl is required for the damage-induced transcription of some genes that do not require RAD53 for transcriptional induction (Kiser and Weinert 1996), and that deletion of MECl is suppressed by overexpression of RAD53 (Sanchez et al. 1996), suggests that Mecl functions upstream of Rad53. However, genetic interactions suggest that RAD53 may have at least one role that is EC/-independent because rad53 radio double mutants show increased sensitivity to UV irradiation compared to either single mutant, while mecl radio double mutants do not show this synthetic phenotype (Kiser and Weinert 1996).

Although checkpoint genes were originally hypothesized to be required only in cells subjected to perturbation, both MECl and RAD53 genes are required for wild-type cell division (Paulovich et al. 1997; Zheng et al. 1993). Based on the requirements for RAD53 and MECl, it may be that cells need to inhibit progression through the cell cycle until the end of DNA replication actively in most cell cycles. Here we report that the essential requirement for MECl, but not RAD53, can be suppressed by deletion of the Gl cyclins CLNl and CLN2. mecl-1 mutant cells deleted for clnl and cln2 are killed by expression of CLNl, CLN2, or CLB5 but not by CLN3, from the strong, inducible GAL1 promoter. Wild-type levels of either CLNl or CLN2 also cause severe growth defects in mecl-1 strain; the presence of wild-type levels of both CLNl and CLN2 in mecl-1 strains may be lethal, consistent with previously reported results (Paulovich et al. 1997). Isolation and characterization of multicopy suppressors of the mecl-1 GAL1-CLN1 lethality suggests that deoxyribonucleotide pools may be limiting during replication, with lethal consequences to mecl-1 mutant strains that can not pause the cell cycle. Consistent with this hypothesis, cells containing GAL1-CLN1 have a longer S phase than wild-type cells or cells containing GAL1-CLN3, suggesting that although strains overexpressing CLNl transit through the Gl phase of the cell cycle rapidly, they must delay in S phase for accurate replication.

3. Summary of the Invention

According to the present invention, it has now been found that an increase in the cellular levels of ribonucleotide reductase protein, i.e., the presence of " extra" protein above normal amounts, counteracts or suppresses the negative effects of a MECl mutation. In certain eukaryotes, such as yeast, such mutations can give rise to lethality.

Hence, a method of arresting, alleviating, treating, counteracting, reversing, or preventing the negative effects of an undesirable mutation in the MECl gene or its homolog, wherein the mutation is harbored by a eukaryote, is disclosed, comprising increasing the amount of ribonucleotide reductase (RNR) protein in the eukaryote. In particular embodiments of the invention, the MECl homolog can be ATM1 or ATR1.

Generally, the negative effects of a mutation include, but are not limited to, neurological defects, cerebellar degeneration, immune deficiency, premature aging, an increased risk of developing cancer, sensitivity to radiation, dilation of blood vessels, or progressive mental retardation, to name a few.

The amount of RNR protein can be increased in the eukaryote in any number of ways. For example, one can introduce to the eukaryote a recombinant nucleic acid construct that increases the cellular levels of RNR protein by gene expression. Alternatively, the amount of said protein is increased in the eukaryote by administering to the eukaryote a compound that induces the expression of RNR protein in the eukaryote. Still another method may involve administering to the eukaryote exogenous RNR protein. The instant invention is also directed to a method of inhibiting or arresting the growth of or inducing cell death in a cell, which is overexpressing cyclin or cyclin-like protein. The method contemplated comprises contacting the affected cell with a growth inhibiting, growth arresting, or cell death inducing amount of an agent that inhibits the activity of phosphoinositide kinase (PIK) or PIK-related kinase. In a particular embodiment of the invention the agent is selected for its ability to inhibit the binding of

ATP to an active site of PIK or PIK-related kinase. Preferred agents include, but are not limited to, (±)- Palmitoylcarnitine Chloride; [Ala²⁸⁶]-Ca2+/Calmodulin Kinase II Inhibitor 281-301; 1-O-Hexadecy 1-2-0- methyl-rac-glycerol; 10-[3-(l-Piperazinyl)propyl]-2-trifluoromethylphenothiazine, Dimaleate; 5,6-Dichloro-l- b-D-ribofuranosylbenzimidazole; A3, Hydrochloride; Adenosine 3',5'-cyclic Monophosphorothioate, 8-Bromo-, Rp-Isomer, Sodium Salt; Adenosine 3',5'-cyclic Monophosphorothioate, Rp-Isomer, Triethylammonium Salt; AG 126 Apigenin; Autocamtide-2 Related Inhibitory Peptide; Bisindolylmaleimide I; Bisindolylmaleimide I, Hydrochloride; Bisindolylmaleimide II; Bisindolylmaleimide III, Hydrochloride; Bisindolylmaleimide IV; Bisindolylmaleimide V; Butyrolactone I; Ca2+/Calmodulin Kinase II Inhibitor 281-309; Cahnodulin Binding Domain; Calphostin C, Cladosporium cladosporioides; Cardiotoxin, Naja nigricollis; Cathepsin L Inhibitor; Chelerythrine Chloride; D-erythro-Sphingosine, Dihydro-; D-erythro-Sphingosine, Free Base, Bovine Brain; D- erythro-Sphingosine, N,N-Dimethyl-; ET-18-OCH₃; Go 6976; Go 6983; Go 7874, Hydrochloride; H-7, Dihydrochloride; H-8, Dihydrochloride; H-89, Dihydrochloride; H-9, Dihydrochloride; HA 100, Dihydrochloride; HA 1004, Dihydrochloride; HA 1077, Dihydrochloride; Hypericin; Iso-H-7, Dihydrochloride; JAK-3 Inhibitor; K-252a, Nocardiopsis sp.; K-252b, Nocardiopsis sp.; K-252c; KN-62; KN-92; KN-93; KT5720; KT5823; Lavendustin C; ML-7, Hydrochloride; ML-9, Hydrochloride; Myosin Light Chain Kinase Inhibitor Peptide 480-501; NGIC-I; Olomoucine; Olomoucine, Iso-; PD 169316; PD 98059; Phloretin; Polymyxin B Sulfate; Protein Kinase A Heat Stable Inhibitor, Isoform a, Rabbit, Recombinant, E. coli; Protein Kinase A Inhibitor 5-24; Protein Kinase A Inhibitor Amide 14-22, Cell-Permeable, Myristolyated; Protein Kinase C Inhibitor (19-27), Cell-Permeable, Myristoylated; Protein Kinase C Inhibitor Peptide 19-31; Protein Kinase C Inhibitor Peptide 19-36; Protein Kinase C Inhibitor, EGF-R Fragment 651-658, Myristolyated; Protein Kinase Cε Translocation Inhibitor Peptide; Pseudohypericin; Quercetin Dihydrate, Ro-31-8220; Ro-32-0432; Roscovitine; Rottlerin; Safingol; SB 202190; SB 202474; SB 203580; Staurosporine, Streptomyces sp.; Tamoxifen Citrate; Tamoxifen, 4-Hydroxy-, (Z)-; U0126; Vitamin E Succinate; LY-294002; or Wortmannin.

More preferably, the agent comprises ET-18-OCH₃; LY-294002; Quercetin Dihydrate; or Wortmannin. Hence, the present invention contemplates the administration of an agent that inhibits a kinase comprising the protein product of RAD53, RNRl, CLN, MECl, or their mammalian or human homologs. In particular, the kinase preferably comprises the protein product of ATM, ATR, or their mammalian or human homologs. In a specific application of the invention, the agent inhibits or arrests the growth of a tumor cell. More preferably, the agent induces the death of the tumor cell. Such tumor cells can be found, for example, in mammals afflicted with cancer, more likely, human cancer patients.

These and other object of the invention are apparent from the present disclosure.

4. Description of the Figures

Figure 1A. mecl-1 mutant cells die when CLNl, CLN2 or CLB5 is overexpressed. Strains 2507 5D (MECl) and 2620 12C (mecl-1) were transformed with the indicated CEN-based plasmids. Colonies were picked and grown to stationary phase in selective media containing 2% dextrose. Ten-fold serial dilutions were made from fresh stationary phase cultures of the strains indicated. Five microliter volumes were plated and incubated for 3-4 days at 30°C. DEX, dextrose (glucose); GAL, galactose. B. Wild-type levels of CLNl and CLN2 cause slow growth in mecl-1 mutant cells. Spores from a diploid strain formed by crossing CLNl CLN2

CLN3 MECl (1255 5C-1) and clnl cln2 CLN3 mecl-1 (2662 20C) were dissected and incubated at 30°C for 3 days. The mecl-1 genotype was assigned to spores on the basis of testing for hydroxyurea sensitivity. The CLNl and CLN2 genotypes were assigned by Northern blot analysis. MECl colonies were always large in size; mecl-1 colonies large in size were always clnl cln2, while mecl-1 colonies small in size were CLNl and/or

CLN2.

Figure 2. rad53 mutant cells are only partly suppressed by clnl cln2 and are less sensitive to GAL1-

CLN1 expression than mecl-1 mutants are. Ten-fold serial dilutions were made from fresh stationary phase cultures of strains with the indicated genotypes (GAL-CLNl RAD53; 2673 4C; RAD53, 2673 5C; GAL-CLNl rad53, 2673 6C and 3673 8A; rad53, 2673 6A and 2673 9C). Five microliter volumes were plated and incubated for 2-3 days at 30°C. DEX, detrose (glucose); GAL, galactose.

Figure 3. mecl-1 GAL1-CLN2 mutants are suppressed by multicopy RNRl. Strain 2665 13A (mecl-1

GAL1-CLN2) was transformed with the indicated plasmids. Single colonies from two transformants were picked and grown to stationary phase in selective media containing 2% dextrose. Ten-fold serial dilutions were made from fresh stationary phase cultures of the strains indicated. Five microliter volumes were plated and incubated for 3-4 days at 30°C. DEX, dextrose (glucose); GAL, galactose.

Figure 4. Transcriptional regulation of MCB-containing genes RNRl and CLB5. clnl cln2 CLN3 MECl and clnl cln2 CLN3 mecl-1 strains with the indicated GAL1-CLN construct were grown to log phase in YEP-3% raffinose at 30°C. At time 0, galactose was added to the cultures to a final concentration of 3%. Samples were taken at 2-hour intervals and RNA was isolated. Blots were hybridized with RNRl (A and B), CLB5 (C and D), and TCM1 (used as a loading control). Quantification of mRNA was performed using a Molecular Dynamics phosphoimager and ImageQuant software. Data from two different experiments are shown; Northern blots were prepared and analyzed from samples five times with equivalent results. A and C, MECl, open squares (1238 16B); MECl GAL-CLNl, filled squares (2507 5B); mecl-1, open circles (2618 5B); mecl-1 GAL-CLNl, filled circles (2623 11D). B and D, MECl, open squares (1238 16B); MECl GAL-CLN2, filled squares (2671 5B); MECl GAL-CLN3, hatched squares (2670 8A); mecl-1, open circles (2671 5A); mecl-1 GAL-CLNl, filled circles (2671 1 IB); mecl-1 GAL-CLN3, hatched circles (2670 2D).

Figure 5. FACS analysis. Strains 2507 8C (clnl cln2 CLN3 GAL l:\CLNl), 2104 3D (clnl clnl CLN3 GAL1::CLN3), 2507 5D (clnl clnl CLN3) and 1255 5C (CLNl CLNl CLN3) were grown to log phase in YPGal media. Samples were fixed, stained with propidium iodide, and counted by using a FACS.

5. Detailed Description of the Preferred Embodiments

A the invention can be better appreciated by consideration of the following detailed description of the preferred embodiments. 5.1. Lethality of mecl-1 and CLNl, CLN2 and CLB5 Overexpression

We have shown previously that mecl-1 is lethal in clnl clnl CLN3 strains expressing GAL1- CLN1 (Vallen, 1995; see also Figure 1A). Expression of GAL1-CLN2 or GAL1-CLB5 is also lethal to mecl-1 mutant cells (Figure 1A). In all cases, there is about a 1000 to 10,000-fold decrease in plating efficiency of strains containing GAL1-CLN1, GAL1-CLN2, or GAL1-CLB5 compared to control mecl-1 mutant strains transformed with vector on galactose containing media. Overexpression of CLNl, CLN2 or CLB5 had no effect on the plating efficiency of the MECl strains. In contrast to the results with CLNl, CLN2 and CLB5, overexpression of CLN3 or the dominant activating allele of CLN3, CLN3-2, from the GAL1 promoter does not kill the mecl-1 mutant cells (Figure 1A). Colonies grow up slightly more slowly than the vector controls, but the plating efficiency of transformants is similar in the presence and absence of CLN3 overexpression, and comparable to the control strains with no GAL1-CLN construct. In addition, it is important to point out that there are no obvious differences between the mecl-1 clnl clnl CLN3 and MECl clnl clnl CLN3 strains on galactose media when strains are transformed with the vector, or any of the strains on dextrose where the CXNs are not overexpressed. In contrast to the results with CLNl, CLNl and CLB5, GAL1-CLB1 slowed cell growth and decreased plating efficiency similarly in both MECl and mecl-1 strains (data not shown).

To examine the phenotype of mecl-1 cells with wild-type levels of the Gl cyclins, we crossed mecl-1 clnl clnl CLN3 strains to MECl CLNl CLNl CLN3 strains (Figure IB). In crosses when mecl-1 was segregating in a clnl cln2 CLN3 background, it was impossible to distinguish the mecl-1 mutant spore colonies by colony size (data not shown). In contrast, in crosses when mecl-1 and CLNl and CLNl were segregating, many of the spore colonies ranged in size from small to tiny. When tetrads from the CLNl CLN2 CLN3 cross were scored for mecl-1 by HU sensitivity, the small and tiny colonies were always HU sensitive, demonstrating that they contained mecl-1. A subset of the colonies were scored for the presence of CLNl and CLN2 by Northern blotting. In 7/7 cases when the mecl-1 strains were scored as healthy (e.g. ID, 5A, 11C, 11D, 14D) the spore was clnl cln2 CLN3. Furthermore, in 6/7 cases when the mecl-1 strains were scored as sick (e.g. 3B, 9C, 10D, 15B, 22B), the spore was CLNl cln2 CLN3 or clnl CLN2 CLN3. In 1/7 case, the sick spore was CLNl CLN2 CLN3.

As all spores described in the cross above were CLN3, we wished to determine whether the slow growth phenotype observed with some mecl-1 spore colonies was due to an increase in cyclin dosage or specifically due to the presence of CLNl or CLN2. We crossed CLNl cln2 cln3 MECl strains with clnl cln2 CLN3 mecl-1 strains and, similarly crossed clnl CLN2 cln3 MECl and clnl cln2 CLN3 mecl-1 strains. Spore colonies were scored for size, HU sensitivity, and CLN genes as described above. In almost every case, small colony size correlated with the presence of CLNl or CLN2 and the mecl-1 mutation (Table 2). Strains that had CLN3 in addition to CLNl or CLN2 were not significantly different in size than those colonies which had only CLNl or CLN2. These results demonstrate that MECl is required for normal growth rates in cells with wild-type levels of CLNl and/or CLN2. Although originally reported to be necessary only in cells suffering from DNA damage (Weinert, Kiser and Hartwell 1994), these data demonstrate that MECl is essential for normal growth of CLN cells. This is consistent with the observations of Paulovich et al (1997) suggesting that mecl-1 containing strains are inviable in the A364a background in the absence of a suppressor locus, smll. Here, the essential requirement for MECl function is suppressed by deletion of CLNl and CLNl. The requirement for MECl function in the DNA damage checkpoint is not suppressed; strains containing clnl clnl mecl-1 are still sensitive to HU.

5.2. RAD53 is not completely suppressed by loss of CLNl and CLNl

Based on genetic and biochemical data, it has been suggested that MECl functions upstream of RAD53 and the kinase activity of Mecl is required to activate Rad53 (Kiser and Weinert 1996; Sanchez et al. 1996; Sun et al. 1996). RAD53 is an essential gene (Zheng et al. 1993). If RAD53's only role is transducing a signal from MECl, and loss of CLNl and CLNl suppress loss of MECl, loss of CLNl and CLNl should also suppress the essential role of RAD53. We backcrossed rad53::HIS3 strains against clnl clnl CLN3 strains multiple times. To cover the rad53 lethality, the checkpoint-defective rad53 allele, spkl-1, was present on a <7&43-containing plasmid. In contrast to the results seen with mecl, deletion of CLNl and CLNl did not completely suppress the requirement for RAD53; all the spore colonies that were His+Ura" (i.e., rad53::HIS3) were significantly smaller than His^" or His^TJra^"1" spore colonies. Cultures of the clnl clnl rad53 mutants grew to about 1/10 the density of clnl clnl RAD53 strains in rich liquid medium even after long times of incubation at 30°C (Figure 2). When cells from these cultures were plated on dextrose, the rad53::HIS3 strains formed colonies that were smaller than wild type. However, deletion of CLNl and CLNl did partially suppress rad53::HIS3 since viability of rad53 spores was higher in strains that were clnl clnl CLN3 compared to strains that were CLNl CLNl CLN3. We assayed strains containing GALl-CLNI rad53::HIS3 on galactose, and found that the presence of GALl-CLNI decreases plating efficiency less severely than it did for the mecl strains. There was approximately 10 to 100-fold decrease in plating efficiency oϊ rad53 GALl-CLNI strains compared to rad53::HIS3 strains without GALl-CLNI (Figure 2). These results were obtained using rad53 strains that had been backcrossed into the BF264-15D strain background four times; similar results were observed using strains that had been additionally backcrossed into this strain background (data not shown). Strains containing rad53::HIS3 and the checkpoint-defective rad53 allele spkl-1 on a plasmid, were not killed by expression of CLNl from the GAL1 promoter (data not shown).

5.3. Multicopy RNRl suppresses the lethality of mecl-1 GALl-CLNI and mecl-1 GALl-CLNI

To understand more completely the cause of the inviability of mecl-1 GALl-CLNI strains, we isolated multicopy plasmid suppressors of the lethal phenotype. Transformants (17,000) from a YEp24 library

(Carlson and Botstein, 1982) were screened for their ability to grow on galactose. Thirteen strong suppressors fell into three groups by restriction analysis and Southern blotting. Two plasmids contained MECl and eight plasmids contained TEL 1. Both of these classes were expected; the mecl-1 mutation is known to be recessive to MECl, and increased levels of TEL1 have previously been shown to suppress other phenotypes associated with the mecl-1 mutation (Morrow et al. 1995; Sanchez et al. 1996). The three remaining plasmids contained the RNRl gene. Transposon mutagenesis (Huisman et al. 1987) of the plasmid demonstrated that the suppression required an intact RNRl gene. Multicopy RNRl suppressed the lethality of mecl-1 GALl-CLNI strains about lOOOx compared to the vector controls (data not shown). This was similar to the plating efficiencies found with MECl plasmids, however the colony size of the mecl-1 GALl-CLNI strains with the multicopy RNRl plasmid was somewhat smaller at early times of incubation than that of the mecl-1 GALl-CLNI strains with the MECl plasmid. The RNRl plasmid also suppressed the lethality caused by overexpression of CLNl (Figure 3) or CLB5 (data not shown) in a mecl-1 strain.

In contrast, RNRl was unable to suppress the severe growth defect caused by deletion of rad53. A haploid clnl clnl CLN3 rad53::HIS3 strain containing the URA3-baseά spkl-1 plasmid was crossed to a clnl clnl CLN3 RAD53 strain. Diploids that had lost the spkl-1 plasmid were transformed with the multicopy URA3-bastά RNRl plasmids, sporulated and the resulting tetrads dissected. Tetrads contained two large, His" colonies and zero, one or two very small His⁺ colonies. Increased RNRl dosage did not affect the colony size; Ura⁺ His⁺ (RNRl -containing; rad53) and Ura^" His⁺ (rad53) colonies were similarly small (data not shown).

5.4. RNRl transcription levels are decreased in GALl-CLNI and GALl- CLNI strains As multicopy RNRl suppressed the lethality of the mecl-1 GALl-CLNI and GALl-CLNI strains, we analyzed the levels of RNRl transcript in these strains. Levels of RNRl are about 3-fold lower in mecl-1 GALl-CLNI or mecl-1 GALl-CLNI strains compared to mecl-1 with vector controls (Figure 4A and B). A similar decrease in RNRl transcription was found in MECl GALl-CLNI and MECl GALl-CLNI strains demonstrating that the decrease in RNRl levels was not due to the mecl-1 mutation (Figure 4A and B). The decrease in RNRl transcription was evident in both MECl and mecl-1 cells, but has lethal consequences only in the mecl-1 mutants. GAL1-CLN3 decreased transcription of RNRl to a level intermediate between that of GALl-CLNI or GALl-CLNI and the vector control (Figure 4B).

RNRl transcription has been previously shown to be cell cycle regulated (Elledge and Davis 1990) and the coding sequence is preceded by four MCB elements in the 500 nucleotides upstream of the AUG which starts the protein coding region. To determine whether GALl-CLNI and GALl-CLNI affected other MCB regulated genes, we analyzed the transcript levels of another MCB-containing gene, the B-type cyclin CLB5. CLB5 levels also decreased as a consequence of GALl-CLNI and GALl-CLNI expression (Figure 4C and D). It is likely that the decrease in RNA levels seen upon induction of the CLN genes is due to an alteration in the cell cycle distribution of the cell population, not to a direct repression of RNRl and CLB5 transcription. Because RNRl is also regulated by DNA damage (Elledge and Davis 1990), we wished to determine whether high levels of expression of the CLN genes from the GALl promoter affected DNA-damage inducible genes. We analyzed the levels of two damage-inducible genes, RNR3 and UBI4, in mecl-1 and MECl strains containing GALI-CLN constructs. DNA damage induces RNR3 transcription in a MECl dependent pathway and UBI4 transcription in a MECl independent pathway (Kiser and Weinert 1996). The levels of these transcripts were not altered upon GALI-CLN expression (data not shown).

5.5. Cell cycle size and distribution of strains with different CLNs

Strains deleted for CLNl and CLNl show no growth defects in the mecl mutant while strains with wild-type CLNl and/or CLNl show a requirement for MECl function. One possible reason for the observed phenotype is that the presence of CLNl and CLNl simply decrease cell size, resulting in lethality due to insufficient dNTP pools in the mecl mutant strains. This is unlikely because cell volume is not correlated with the requirement for MECl. Cells containing only CLN3 are approximately the same volume, or slightly smaller than cells containing only CLN2. In addition, cells containing only CLNl are larger than cells containing either CLNl or CLN3 (Lew, Marini and Reed 1992; Vallen and Cross, unpublished results) yet there is a significant difference in their requirement for MECl (Figure IB).

An alternative possibility is that while the size of the cells does not cause the requirement for MECl, the distribution of cells throughout the cell cycle is different between the different strains, and that difference results in the viability of the clnl clnl CLN3 mecl cells. Because CLN3 appears to be better able to activate transcription of some cell cycle regulated genes (Tyers, G. and Futcher 1993), it may be that cells containing CLN3 as their only Gl cyclin are better able to activate the transcription of cell cycle regulated genes relative to other START events. It has been previously reported that cell cycle length or doubling time does not change much in the presence of overexpressed CLN genes, but much less of the cell cycle is taken up by Gl since cells go through START at a smaller size (Cross 1988; Nash et al. 1988). Since doubling time is constant, the cells must be delayed at some other cell cycle stage. To analyze the distribution of cells in the cell cycle, we determined the α-factor and hydroxyurea execution points of cell populations (Table 3). Comparison of the clnl clnl CLN3 GALl-CLNI and clnl clnl CLN3 GAL1-CLN3 strains (rows 1 and 2) demonstrates that strains containing GALl-CLNI are delayed between the α-factor and HU-execution points relative to strains containing GAL1-CLN3. Cells containing GALl-CLNI pass through the α-factor execution point earlier than strains containing GAL1-CLN3 and then have a longer S phase (as measured by the time it takes cells to become insensitive to HU-mediated arrest). We attempted to analyze the length of S phase in strains containing only CLN3, but microscopic analysis of CLN3 strains on HU suggested that a sizable percentage (7-20%) of the cells lysed on HU. This led to overestimation of the time that these strains spend in S phase. Consequently, we were unable to measure length of time spent in S phase for the clnl clnl CLN3 strains by this method. To independently estimate the length of Gl, we performed FACS analysis on logarithmically growing cultures of cells (Figure 5). The percentage of cells in Gl was calculated from the FACS analysis (Slater, Sharrow and Gait 1977). Fourteen percent of cells of the genotype clnl cln2 CLN3 GALl-CLNI were in Gl compared to 19% of the cells with the genotype clnl clnl CLN3 GAL1-CLN3. For CLNl CLNl CLN3 cells, 37% were in Gl and for clnl clnl CLN3 cells, 45% were in Gl. Although the percentage of cells in Gl calculated in this way is slightly different than that calculated by measuring when cells become α-factor resistant (Table 3), overall the results are in quite reasonable agreement suggesting that the execution point experiments reflect the parameters of cells within the culture. These data are consistent with previous observations that high level expression of CLNl or CLN3 shorten the length of time cells spend in Gl. Because fewer cells in the GALl-CLNI culture were in Gl, it can be concluded that GALl-CLNI causes cells to transit Gl faster than does GAL1-CXN5 .

5.6. MECl is required in unperturbed wild-type cells, but not in clnl clnl cells

Although the mecl-1 mutation was originally identified as causing lethality specifically when

DNA damage was induced or replication slowed (Weinert, Kiser and Hartwell 1994), our results clearly show that Mecl is required in normally cycling wild-type cells. This is consistent with the observation that a suppressor locus, stnll, was present in the previously characterized mecl-1 strains (Weinert, pers. comm.; Paulovich et al. 1997). However, we showed previously (Vallen and Cross 1995) and confirm here that in a clnl clnl background, no additional suppressor is required for full viability and wild-type growth rate of mecl - 1 strains. Mecl has been shown to be required for slowing of S phase in response to DNA damage (Paulovich and Hartwell 1995). The present results therefore suggest that some Mecl -dependent slowing of S phase may be required even in unperturbed wild-type cell cycles; but that this slowing is not required in clnl clnl strains. The Mecl requirement for the DNA replication checkpoint is not bypassed in clnl clnl strains, however, as clnl cln2 mecl-1 strains are highly sensitive to lethality due to hydroxyurea inhibition of DNA synthesis. Therefore, we conclude that deletion of CLNl and CLN2 eliminates the Mecl requirement specifically in the unperturbed cell cycle.

5.7. CLNl and CLN2 function may lead to dNTP limitation and a requirement for the Mecl checkpoint clnl cln2 mecl-1 strains overexpressing Clnl (from the GALlv.CLNl construct) are inviable (Vallen and Cross 1995). RNRl is an efficient high-copy plasmid suppressor of this inviability, and we found that overexpression of either CLNl or CLN2 significantly lowered RNRl expression (similarly in mecl-1 and MECl backgrounds). These results combined led us to the following hypothesis to explain mecl-1 GALlv.CLNl lethality: if CLNl overexpression results in entry into S phase before a sufficient period for accumulation of Rnrl, cells may enter S phase with inadequate dNTP pools. If this happens in a MECl background, this results in the characterized Mecl -dependent slowing of S phase, consistent with full viability; but in a mecl-1 background this slowing of S phase would not occur, leading to mitosis without completion of replication and inviability of progeny. We showed previously that in diploid cells of the genotype mecl-1 GAL- CLNl, rare survivors showed signatures of DNA damage: 100-fold elevated chromosome loss and recombination frequencies, as would be expected from this hypothesis. Further, estimates of the hydroxyurea execution point in MEC1⁺ CL/W-overexpressing cells compared to wild-type suggested that DNA synthesis was indeed prolonged by CLNl overexpression, consistent with the hypothesis. Previous analysis of strains containing Clns with increased activity demonstrated that although the length of Gl was shortened, the length of the cell cycle did not change (Cross 1988; Nash et al. 1988). The data presented here suggest that the length of S phase is increased in these strains due to the function of MECl. However, because mecl-1 mutant cells fail to arrest in HU it is not possible to measure the length of S phase directly. Another prediction is that GALl- CLNI strains containing multicopy RNRl would have a shorter S phase. Consistent with this hypothesis, preliminary results suggest that more clnl cln2 CLN3 GALl-CLNI cells containing multicopy RNRl are past the HU execution point (accumulate at the 4 cell stage) than similar cells lacking multicopy RNRl. A surprising consequence of this hypothesis combined with the observation of semi- lethality or lethality of CLNl CLN2 CLN3 mecl-1 strains is that preparation for DNA replication, including dNTP accumulation, in wild-type cells may be barely adequate for completion of S phase, resulting in a significant requirement for Mecl function to restrain the rate of S phase progression. Wild-type cells may operate according to a 'just-in-time' principle, i.e., transit through START and entry into S phase may occur when there are usually just adequate materials for DNA replication. This would be highly efficient since it allows cells to transit through the cell cycle quickly, thus giving rise to more progeny, but it could impose a requirement for safeguards in case of shortages.

5.8. Deletion of CLNl and CLN2 may result in an unbalanced cell cycle with excess time for preparation for DNA synthesis, suppressing the Mecl requirement

Cln3 has been proposed to be specialized for transcriptional activation of SCB- and MCB- regulated genes at the Gl-S border; RNRl is one such gene (Dirick, Bohm and Nasmyth 1995; Koch and Nasmyth 1994; Levine, Huang and Cross 1996; Stuart and Wittenberg 1995; Tyers, G. and Futcher 1993). Clnl and Cln2, in contrast, directly trigger cell cycle Start, and lead to DNA replication (at least in part by activation of Clb-Cdc28 kinase complexes; reviewed by Cross 1995). Thus in a clnl cln2 background, a prolonged period of transcriptional activation of SCB- and MCB-dependent genes occurs before DNA synthesis (Dirick, Bohm and Nasmyth 1995; Stuart and Wittenberg 1995). Thus deletion of CLNl and CLN2 may suppress inviability due to mecl-1 by providing a longer period for preparation for DNA synthesis, including dNTP accumulation (for which our results suggest that RNRl may be limiting). This hypothesis may explain why CLN3 overexpression in a clnl clnl mecl-1 background is not lethal, even though time in Gl phase is reduced by CLN3 overexpression almost as much as by CLNl overexpression (Figure 5 and Table 3): CLN3 may drive expression of MCB-regulated genes strongly relative to its ability to activate replication. Similarly, although wild-type cells have a longer Gl phase than clnl clnl GAL1::CLN3 cells, these cells are not expressing MCB- regulated genes for most of the time they spend in Gl phase, until Cln3 activates this expression, as well as simultaneous expression of CLNl and CLNl, late in Gl (Dirick, Bohm and Nasmyth 1995). The results obtained may be due to quantitative functional differences between Cln3 and Clnl or Cln2, since the efficiency of cell cycle transit is lower in clnl cln3 strains than in clnl clnl strains (as measured by cell volume; Lew, Marini and Reed 1992) and yet the former but not the latter genotype is semi-inviable in combination with mecl-1. Intrinsic qualitative differences between Cln3 and Cln2 have been documented previously on other grounds (Levine, Huang and Cross 1996); such differences can be attributed to differences in efficiency of transcriptional activation by Cln3 compared to Cln2, consistent with the results here.

5.9. Rad53 cannot function solely downstream of Mecl

RAD53 is an essential gene that has been proposed to function in the same pathway as MECl. Analysis of the transcriptional induction of DNA-damage inducible genes suggests that MECl is upstream of RAD53 because it affects the transcription of more genes (Kiser and Weinert 1996). However, clnl clnl rad53 strains are inviable or else form tiny colonies in tetrad analysis, in contrast to the full health of clnl clnl mecl-1 strains. In addition, when spkl-1, a checkpoint-deficient allele of RAD53, is used, full viability is observed, and CLNl overexpression does not affect this viability. This contrast cannot be due to the fact that mecl-1 is a point mutation with residual function, as clnl clnl mecl-del strains are fully viable (T. Weinert, pers. comm.). Finally, overexpression of RNRl, which suppresses the lethality caused by GALl-CLNI mecl-1, does not increase the growth rate of rad53 strains. Taken together, this suggests that RAD53 has at least one MEC1- independent role which is not suppressed by loss of CLNl and CLNl, and is not exacerbated by CLNl overexpression. Consistent with this hypothesis, RAD53 and MECl show different genetic interactions with radlόΔ; rad53 radlόΔ mutants are significantly more UV sensitive than either single mutant, while mecl radlόΔ do not appear to have synthetic phenotypes (Kiser and Weinert 1996).

6. Examples

The following examples are provided as a further illustration of the invention.

6.1. Strains and Media

Media and genetic methods are as described elsewhere (Ausubel et al. 1987; Rose, Winston and Hieter 1990). The strains used in this study are listed in Table 1. All yeast strains were isogenic with BF264-15D (trpl-la leu -3,111 ura3 adel his ) unless otherwise noted. Mutant clnl cln2 and cln3 alleles, and the GALl-CLNI, GAL1-CLN2, GAL1-CLN3, GAL1-CLB5 cassettes have been described previously (Cross 1990; Cross and Blake 1993; Cross and Tinkelenberg 1991; Epstein 1992; Oehlen and Cross 1994; Richardson et al. 1989). The mecl-1 allele (Weinert, Kiser and Hartwell 1994) and rad53::HIS3 (Zheng et al. 1993) disruption were backcrossed multiple times to BF264-15D strains as indicated in the strain list; a few strains were examined for all phenotypes, and representative experiments are shown. The checkpoint defective spkl-1 allele of rad5 ^'3 was the gift of D. Stern (Fay, Sun and Stern 1997). Hydroxyurea (Sigma) was used in solid media at 0.2M. Nocodozole (Sigma) was used at a final concentration of 15ug/ml from a stock solution of lOmg/ml dissolved in dimethylsulfoxide (DMS), Sigma), α-factor (Sigma) was used in solid media at 0.3uM. 6.2. Plating Efficiency Assays

Tenfold serial dilutions in water were made from fresh stationary-phase cultures, and 5ul from each dilution was plated. Plates were incubated for 2-4 days at 30°C.

6.3. Northern (RNA) Analysis

RNA was isolated, probes were labeled, and Northern blots were performed as described elsewhere(McKinney et al. 1993; Oehlen and Cross 1994). Quantification of mRNA was performed by using a Molecular Dynamics phosphoimager and ImageQuant software, and mRNA loading was normalized by using TCM1 as a loading control. Probe fragments CLNl, CLN2, UBI4 and CLB5 are as described elsewhere (Cross and Tinkelenberg 1991; Epstein and Cross 1992; Kiser and Weinert 1996). The RNRl probe was a 2.3kb BstE -Xbal fragment purified from LB77, a plasmid from the YEp24 genomic library (Carlson and Botstein 1982) isolated in the course of this work as described below. The RNR3 probe was made by PCR amplification of a 1300bp fragment using primers of the sequence CTGCAAGCTATAATTTCGAGAG and GGTCTTAATACATACTAACG.

6.4. Determination of DNA Content by Fluorescence-Activated Cell Sorter (FACS)

Flow cytometric DNA quantitation was performed as described elsewhere (Epstein and Cross 1992; Slater, Sharrow and Gart 1977).

6.5. Determination of α-Factor and Hydroxyurea Execution Points

Cells in exponential phase in YPGal were plated onto YPGal, YPGal + 10^_o,M α-factor, and YPGal + 0.2M hydroxyurea, and incubated for 5 hr. Greater than 85% of the microcolonies on YPGal had five or greater cell bodies. Determination of execution points was performed as described (Epstein and Cross 1992).

6.6. Isolation and Characterization of Multicopy Plasmid Suppressors of GALl-CLNI mecl-1

Strain 2619 IB (mecl-1 GALl-CLNI) was transformed with a YEp24 genomic library (Carlson and Botstein 1982) . Transformants were screened for their ability to grow on SCGal-Ura plates. Putative Gal⁺ colonies were picked from SCDex-Ura plates, purified and retested. Plasmids were recovered from Gal⁺ strains (Hoffman and Winston 1987) and plasmid linkage of the Gal⁺ phenotype was tested after retransformation. Plasmids were analyzed by restriction mapping and Southern blotting.

For the RNRl containing plasmids, the region required for suppression was identified by the isolation and analysis of transposon insertions into the plasmid (Huisman et al. 1987). The ends of the genomic DNA insert were sequenced using primers complementary to the region flanking the BamKl site in YEp24. The location of transposon insertion was determined by restriction digestion analysis and sequence analysis from primers complementary to the transposon ends. Dideoxy sequencing with Sequenase 2.0 (US Biochemical) was performed according to the manufacturer's instructions). Sequences were then compared to the genomic DNA sequences in the Saccharomyces cerevisiae database using a BLAST search (http://genome- www2.stanford.edu:5555/cgi-bin/nph-blastsgd).

6.7 Inhibition of the kinase activity of ATM and ATR

Mammals are treated with known inhibitors of phosphoinositide kinases and the incidence of tumors observed. The inhibitors are chosen from the group including (±)-Palmitoylcarnitine Chloride; [Ala²⁸⁶]- Ca2+/Calmodulin Kinase II Inhibitor 281-301; l-O-Hexadecyl-2-O-methyl-rac-glycerol; 10-[3-(l- Piperazinyl)propyl]-2-trifluoromethylphenothiazine, Dimaleate; 5,6-Dichloro-l-b-D- ribofuranosylbenzimidazole; A3, Hydrochloride; Adenosine 3',5'-cyclic Monophosphorothioate, 8-Bromo-, Rp- Isomer, Sodium Salt; Adenosine 3',5'-cyclic Monophosphorothioate, Rp-Isomer, Triethylammonium Salt; AG 126 Apigenin; Autocamtide-2 Related Inhibitory Peptide; Bisindolylmaleimide I; Bisindolylmaleimide I, Hydrochloride; Bisindolylmaleimide II; Bisindolylmaleimide III, Hydrochloride; Bisindolylmaleimide IV; Bisindolylmaleimide V; Butyrolactone I; Ca2+/Calmodulin Kinase II Inhibitor 281-309; Cahnodulin Binding Domain; Calphostin C, Cladosporium cladosporioides; Cardiotoxin, Naja nigricollis; Cathepsin L Inhibitor; Chelerythrine Chloride; D-erythro-Sphingosine, Dihydro-; D-erythro-Sphingosine, Free Base, Bovine Brain; D- erythro-Sphingosine, N,N-Dimethyl-; ET-18-OCH₃; Gδ 6976; Go 6983; Gδ 7874, Hydrochloride; H-7, Dihydrochloride; H-8, Dihydrochloride; H-89, Dihydrochloride; H-9, Dihydrochloride; HA 100, Dihydrochloride; HA 1004, Dihydrochloride; HA 1077, Dihydrochloride; Hypericin; Iso-H-7, Dihydrochloride;

JAK-3 Inhibitor; K-252a, Nocardiopsis sp.; K-252b, Nocardiopsis sp.; K-252c; KN-62; KN-92; KN-93; KT5720; KT5823; Lavendustin C; ML-7, Hydrochloride; ML-9, Hydrochloride; Myosin Light Chain Kinase Inhibitor Peptide 480-501; NGIC-I; Olomoucine; Olomoucine, Iso-; PD 169316; PD 98059; Phloretin; Polymyxin B Sulfate;

Protein Kinase A Heat Stable Inhibitor, Isoform a, Rabbit, Recombinant, E. coli; Protein Kinase A Inhibitor 5- 24; Protein Kinase A Inhibitor Amide 14-22, Cell-Permeable, Myristolyated; Protein Kinase C Inhibitor (19- 27), Cell-Permeable, Myristoylated; Protein Kinase C Inhibitor Peptide 19-31; Protein Kinase C Inhibitor Peptide 19-36;

Protein Kinase C Inhibitor, EGF-R Fragment 651-658, Myristolyated; Protein Kinase Cε Translocation Inhibitor Peptide; Pseudohypericin; quercetin dihydrate, Ro-31-8220; Ro-32-0432; Roscovitine; Rottlerin; Safingol; SB 202190; SB 202474; SB 203580; Staurosporine, Streptomyces sp.; Tamoxifen Citrate; Tamoxifen, 4-Hydroxy-, (Z)-; U0126; Vitamin E Succinate; LY-294002; and Wortmannin. It should be apparent to those of ordinary skill from the descriptions provided that other embodiments of the invention can be contemplated that are not specifically disclosed herein but which nonetheless conform to the scope and spirit of the present invention. Thus, the present invention should not be construed as being limited in any way by the specific embodiments provided herein, which invention is limited solely by the claims that follow.

TABLES

Table 1. Yeast strains⁰

1227 2C MATa clnl CLN2 cln3 1238 11A MATa clnl cln2 CLN3 bαrl

1238 16A MATα clnl clnl CLN3 1238 16B MATα clnl cln2 CLN3

1239 18A MATa CLNl cln2 cln3 bαrl

1254 2B MATa clnl cln2 CLN3 bαrl leul :: GALl -CLNl :: LEW

1255 5C MATa CLNl CLNl CLN3 bαrl 1255 5C1 MATa CLNl CLNl CLN3 bαrl HIS1 1746 7B MATa CLNl CLNl CLN3 bαrl

2104 3D MATa clnl cln2 CLN3 bαrl leul:: GAL 1-CLN3::LEW

2104 75B MATα clnl clnl CLN3 bαrl leu :: GAL 1-CLN3:: LEW

2507 5B MATα clnl clnl CLN3 leul: :GAL1 -CLNl ::LEW

2507 5D MATα clnl clnl CLN3 2507 8C MATα clnl clnl CLN3 leul: .GALl-CLNI: .LEW

2618 5B MATα clnl clnl CLN3 mecl-l(5X backcross)

2619 IB MATα clnl clnl CLN3 mecl-1 leul: . GALl-CLNI: .LEW (5X backcross)

2620 12C MATa clnl clnl CLN3 mecl-l(5X backcross)

2623 1 ID MATα clnl clnl CLN3 mecl-1 leu ::GAL1 -CLN 1 r.LEW (5X backcross) 2662 20C MATα clnl clnl CLN3 mecl-lleu2::GALl-CLNl::LEW his3

2665 13A MATα clnl cln2 CLN3 mecl-1 trpl::GALl-CLNl::TRPl (6X backcross)

2670 2D MATα clnl clnl CLN3 mecl-1 leul :: GAL 1-CLN3:: LEW (6X backcross)

2670 8A MATα clnl clnl CLN3 leu2:. -GALI-CLN 3 r.LEW

2671 5 A MATα clnl clnl CLN3 mecl-1 (6X backcross) 2671 5B MATα clnl clnl CLN3 leu2::GALl -CLN2:: LEW

2671 1 IB MATα clnl cln2 CLN3 mecl-1 leu2::GALl-CLN2::LEW (6X backcross)

2673 4C MATa clnl cln2 CLN3 leu2::GALl-CLNl::LEW HIS2 his3

2673 5C MATa clnl cln2 CLN3 HIS2 his3

2673 6A MATa clnl cln2 CLN3 rαd53::HIS3 HIS2 his3 (4X backcross) 2673 6C MATa clnl cln2 CLN3 rαd53::HIS3 leu2: . GALl -CLNl: .LEW HIS1 his3 (4X backcross)

2673 8A MATa clnl clnl CLN3 rαd53::HIS3 leul: .GALl -CLN 1::LEW HIS1 his3 (4X backcross)

2673 9C MATa clnl clnl CLN3 rαd53::HIS3 HIS2 his3 (4X backcross)

All yeast strains were isogenic with BF264-15D (trpl-1 leu2-3,112 urα3 αdel his2) unless otherwise noted. The rαd53 and mecl-1 mutations were backcrossed the indicated number of times into this background. Some strains were made HIS2 by transformation; the his 3 allele was brought into the BF264-15D background by >11 backcrosses. Table 2. The mecl-1 mutation causes a growth defect in strains containing CLNl and/or CLNl.

Relevant genotype Healthy Sick mecl-1 clnl clnl CLN3 16 1 mecl-1 CLNl clnl cln3 0 9 mecl-1 CLNl clnl CLN3 0 6 mecl-1 clnl CLNl cln3 0 6 mecl-1 clnl CLNl CLN3 0 3

Spores from a diploid strain formed by crossing either CLNl clnl cln3 MECl (1239 18 A) or clnl CLNl cln3 MECl (1227 2C) and clnl clnl CLN3 mecl-1 (2623 11D), were dissected and incubated at 30°C for 3 days. Healthy and sick refer to spore colony size as can be seen in Figure IB. The mecl-1 genotype was assigned to spores on the basis of testing for hydroxyurea sensitivity. The CLNl and CLNl genotypes were assigned by Northern blot analysis.

Table 3. Expression of GALl-CLNI leads to a delay between the α-factor and HU execution points. Percentage of cells before event

(minutes after cell division that event occurs) α-factor HU time in Doubling execution execution S phase time Genotype point point (min) (min) clnl clnl CLN3 GALl-CLNI 11% (13) 37% (45) 32 154 clnl clnl CLN3 GALl -CLN3 17% (18) 35% (40) 22 144

CLNl CLNl CLN3 30% (331 45% (5 D 18 139

The data from 4 to 8 different execution point experiments were analyzed as described (Epstein and Cross 1992) to yield an estimate of the percentage of cells in an asynchronous population that are before a cell cycle event and the time after cell division that the indicated event occurs. Time in S phase was calculated as the time between the α-factor execution point and the HU execution point.

CITATION OF THE REFERENCES

Araki, H., S. H. Leem, A. Phongdara and A. Sugino, 1995 Dpbl l, which interacts with DNA polymerase IΙ(epsilon) in Saccharomyces cerevisiae, has a dual role in S-phase progression and at a cell cycle checkpoint. Proc Natl Acad Sci U S A 92: 11791-5. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and K. Struhl, 1987 Current protocols in molecular biology. Wiley Interscience, New York.

Benton, B. K., A. H. Tinkelenberg, D. Jean, S. D. Plump and F. R. Cross, 1993 Genetic analysis of Cln/Cdc28 regulation of cell morphogenesis in budding yeast. EMBO J 12: 5267-5275. Carlson, M., and D. Botstein, 1982 Two differentially regulated mRNA's with different 5' ends encode secreted and intracellular forms of yeast invertase. Cell 28: 145-154. Cross, F. R., 1988 DAFl, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mollecular and Cellular Biology 8: 4675-4684. Cross, F. R., 1990 Cell cycle arrest caused by CLN deficiency in Saccharomyces cerevisiae resembles START- I arrest and is independent of the mating-pheromone signalling pathway. Molecular and Cellular Biology 10: 6482-6490. Cross, F. R., 1995 Starting the cell cycle: what's the point? Curr Opin Cell Biol 7: 790-7.

Cross, F. R., and C. M. Blake, 1993 The yeast Cln3 protein is an unstable activator of Cdc28. Mol Cell Biol 13:

3266-71. Cross, F. R., and A. H. Tinkelenberg, 1991 A potential positive feedback loop controlling CLNl and CLN2 gene expression at the start of the yeast cell cycle. Cell 65: 875-83. Cvrckova, F., and K. Nasmyth, 1993 Yeast Gl cyclins CLNl and CLNl and GAP-like protein have a role in bud formation. EMBO Journal 12: 5277-5286. Dirick, L., T. Bohm and K. Nasmyth, 1995 Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J 14: 4803-13. Elledge, S. J., and R. W. Davis, 1990 Two genes differentially regulated in the cell cycle and by DNA- damaging agents encode alternative regulatory subunits of ribonucleotide reductase. Genes &

Development 4: 740-751. Epstein, C. B., 1992 . The Rockefeller University, New York.

Epstein, C. B., and F. R. Cross, 1992 CLB5: a novel B cyclin from budding yeast with a role in S phase. Genes & Development 6: 1695-1706. Fay, D. S., Z. Sun and D. F. Stern, 1997 Mutations in SPK1/RAD53 that specifically abolish checkpoint but not growth-related functions. Current Genetics 31: 97-105. Hoffman, C. S., and F. Winston, 1987 A ten minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of E. coli. Gene 57: 267-272. Huisman, O., W. Raymond, K. Froehlich, P. Errada, N. Kleckner, D. Botstein and M. A. Hoyt, 1987 A Tn 10- lacZ-kanR-URA3 gene fusion transposon for insertion mutagenesis and fusion analysis of yeast and bacterial genes. Genetics 116: 191-199. Kiser, G. L., and T. A. Weinert, 1996 Distinct roles of yeast MEC and RAD checkpoint genes in transcriptional induction after DNA damage and implications for function. Molecular Biology of the Cell 7: 703-718. Koch, C, and K. Nasmyth, 1994 Cell cycle regulated transcription in yeast. Curr Opin Cell Biol 6: 451-9. Levine, K., K. Huang and F. R. Cross, 1996 Saccharomyces cerevisiae Gl cyclins differ in their intrinsic functional specificities. Mol Cell Biol 16: 6794-803. Lew, D. J., N. J. Marini and S. I. Reed, 1992 Different Gl cyclins control the timing of cell cycle commitment in mother and daughter cells of the budding yeast S. cerevisiae. Cell 69: 317-327. Lew, D. J., T. Weinert and J. R. Pringle, 1997 Cell cycle control in S. cerevisiae. In The molecular and cellular biology of the yeast Saccharomyces, edited by J. R. Pringle, J. R. Broach and E. W. Jones, pp. 607-695. Cold Spring Harbor Press, Cold Spring Harbor. Lowden, M., and E. Vitols, 1973 Ribonucleotide reductase activity during the cell cycle of Saccharomyces cerevisiae. Archives of Biochemistry and Biophysics 158: 177-184. Mclntosh, E. M., 1993 MCB elements and the regulation of DNA replication genes in yeast. Current Genetics

24: 185-192. McKinney, J. D., F. Chang, N. Heintz and F. R. Cross, 1993 Negative regulation of FAR1 at the Start of the yeast cell cycle. Genes Dev 7: 833-43.

Morrow, D. M., D. A. Tagle, Y. Shiloh, F. S. Collins and P. Hieter, 1995 TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MECl. Cell 82: 831-40.

Nash, R., G. Tokiwa, S. Anand, K. Erickson and A. B. Futcher, 1988 The WHI⁺ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. EMBO J. 7: 4335-4346.

Navas, T. A., Z. Zhou and S. J. Elledge, 1995 DNA polymerase ε links the DNA replication machinery to the S phase checkpoint. Cell 80: 29-39. Oehlen, L. J. W. M., and F. R. Cross, 1994 Gl cyclins CLNl and CLNl repress the mating factor response pathway at Start in the yeast cell cycle. Genes & Development 8: 1058-1070. Paulovich, A. G., and L. H. Hartwell, 1995 A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell 82: 841-7. Paulovich, A. G., R. U. Margulies, B. M. Garvik and L. H. Hartwell, 1997 RAD9, RAD 17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage. Genetics 145: 45-62. Richardson, H. E., C. Wittenberg, F. Cross and S. I. Reed, 1989 An essential Gl function for cyclin-like proteins in yeast. Cell 59: 1127-1133. Rose, M. D., F. Winston and P. Hieter, 1990 Methods in yeast genetics. Cold Spring Harbor Laboratory Press,

Cold Spring Harbor. Sanchez, Y., B. A. Dessany, W. J. Jones, Q. Liu, B. Wang and S. J. Elledge, 1996 Regulation of RAD53 by the ATM-like kinases MECl and TEL1 in yeast cell cycle checkpoint pathways. Science 271: 357-360. Schneider, B. L., Q. H. Yang and A. B. Futcher, 1996 Linkage of replication to start by the Cdk inhibitor Sicl. Science 272: 560-2. Schwob, E., and K. Nasmyth, 1993 CLB5 and CLB6, a new pair of B cyclins involved in DNA replication in

Saccharomyces cerevisiae. Genes & Development 7: 1160-1175. Slater, M. L., S. O. Sharrow and J. J. Gait, 1977 Cell cycle of Saccharomyces cerevisiae in populations growing at different rates. Proceedings of the National Academy of Sciences 74: 3850-3854.

Stuart, D., and C. Wittenberg, 1995 CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells. Genes Dev 9: 2780-94. Sugimoto, K, T. Shimomura, K. Hashimoto, H. Araki, A. Sugino and K. Matsumoto, 1996 Rfc5, a small subunit of replication factor C complex, couples DNA replication and mitosis in budding yeast. Proc Natl Acad Sci U S A 93: 7048-52.

Sun, Z., D. S. Fay, F. Marini, M. Foiani and D. F. Stern, 1996 Spkl/Rad53 is regulated by Mecl -dependent protein phosphorylation in DNA replication and damage checkpoint pathways. Genes & Development 10: 395-406. Tyers, M., 1996 The cyclin-dependent kinase inhibitor p40SICl imposes the requirement for Cln Gl cyclin function at Start. Proc Natl Acad Sci U S A 93: 7772-6.

Tyers, M., T. G. and B. Futcher, 1993 Comparison of the Saccharomyces cerevisiae Gl cyclins: Cln3 may be an upstream activator of Clnl, Cln2 and other cyclins. EMBO Journal 12: 1955-1968. Vallen, E. A., and F. R. Cross, 1995 Mutations in RADII define potential link between Gl cyclins and DNA replication. Molecular and Cellular Biology 15: 4291-4302. Weinert, T. A., and L. H. Hartwell, 1989 Controls that ensure the order of cell cycle events. Science 246: 629- 634. Weinert, T. A., G. L. Kiser and L. H. Hartwell, 1994 Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes & Development 8: 652-665. Yarbro, J. W., 1992 Mechanism of action of hydroxyurea. Semin Oncol 19: 1-10. Zheng, P., D. S. Fay, J. Burton, H. Xiao, J. L. Pinkham and D. F. Stern, 1993 SPK1 is an essential S-phase- specific gene of Saccharomyces cerevisiae that encodes a nuclear serine/threonine/tyrosine kinase. Molecular and Cellular Biology 13: 5829-5842.

Claims

What is claimed is:

1. A method of arresting, alleviating, treating, counteracting, reversing, or preventing the negative effects of an undesirable mutation in the MECl gene or its homolog, which mutation is harbored by a eukaryote, comprising increasing the amount of ribonucleotide reductase (RNR) protein in said eukaryote.

2. The method of claim 1 in which the MECl homolog is selected from A TM1 or A TR1.

3. The method of claim 1 in which the negative effects of said mutation include neurological defects, cerebellar degeneration, immune deficiency, premature aging, an increased risk of developing cancer, sensitivity to radiation, dilation of blood vessels, or progressive mental retardation.

4. The method of claim 1 in which the amount of said protein is increased in said eukaryote above it normal cellular levels.

5. The method of claim 1 in which the amount of said protein is increased in said eukaryote by introducing to said eukaryote a recombinant nucleic acid construct that increases the cellular levels of said protein by gene expression.

6. The method of claim 1 in which the amount of said protein is increased in said eukaryote by administering to said eukaryote a compound that induces the expression of said protein in said eukaryote.

7. The method of claim 1 in which the amount of said protein is increased in said eukaryote by administering to said eukaryote exogenous RNR protein.

8. A method of inhibiting or arresting the growth of or inducing cell death in a cell, which is overexpressing cyclin or cyclin-like protein, comprising contacting the cell with a growth inhibiting, growth arresting, or cell death inducing amount of an agent that inhibits the activity of phosphoinositide kinase (PIK) or PIK-related kinase.

9. The method of claim 8 in which said agent inhibits the ability of ATP to bind to PIK or PIK- related kinase.

10. The method of claim 8 in which said agent is selected from the group consisting of (┬▒)-

Palmitoylcarnitine Chloride; [Ala²⁸⁶]-Ca2+/Calmodulin Kinase II Inhibitor 281-301; l-O-Hexadecyl-2-O- methyl-rac-glycerol; 10-[3-(l-Piperazinyl)propyl]-2-trifluoromethylphenothiazine, Dimaleate; 5,6-Dichloro-l- b-D-ribofuranosylbenzimidazole; A3, Hydrochloride; Adenosine 3',5'-cyclic Monophosphorothioate, 8-Bromo-, Rp-Isomer, Sodium Salt; Adenosine 3',5'-cyclic Monophosphorothioate, Rp-Isomer, Triethylammonium Salt; AG 126 Apigenin; Autocamtide-2 Related Inhibitory Peptide; Bisindolylmaleimide I; Bisindolylmaleimide I, Hydrochloride; Bisindolylmaleimide II; Bisindolylmaleimide III, Hydrochloride; Bisindolylmaleimide IV; Bisindolylmaleimide V; Butyrolactone I; Ca2+/Calmodulin Kinase II Inhibitor 281-309; Cahnodulin Binding Domain; Calphostin C, Cladosporium cladosporioides; Cardiotoxin, Naja nigricollis; Cathepsin L Inhibitor; Chelerythrine Chloride; D-erythro-Sphingosine, Dihydro-; D-erythro-Sphingosine, Free Base, Bovine Brain; D- erythro-Sphingosine, N,N-Dimethyl-; ET-18-OCH₃; G╬┤ 6976; G╬┤ 6983; G╬┤ 7874, Hydrochloride; H-7, Dihydrochloride; H-8, Dihydrochloride; H-89, Dihydrochloride; H-9, Dihydrochloride; HA 100, Dihydrochloride; HA 1004, Dihydrochloride; HA 1077, Dihydrochloride; Hypericin; Iso-H-7, Dihydrochloride; JAK-3 Inhibitor; K-252a, Nocardiopsis sp.; K-252b, Nocardiopsis sp.; K-252c; KN-62; KN-92; KN-93; KT5720; KT5823; Lavendustin C; ML-7, Hydrochloride; ML-9, Hydrochloride; Myosin Light Chain Kinase Inhibitor Peptide 480-501; NGIC-I; Olomoucine; Olomoucine, Iso-; PD 169316; PD 98059; Phloretin; Polymyxin B Sulfate; Protein Kinase A Heat Stable Inhibitor, Isoform a, Rabbit, Recombinant, E. coli; Protein Kinase A Inhibitor 5-24; Protein Kinase A Inhibitor Amide 14-22, Cell-Permeable, Myristolyated; Protein Kinase C Inhibitor (19-27), Cell-Permeable, Myristoylated; Protein Kinase C Inhibitor Peptide 19-31; Protein Kinase C Inhibitor Peptide 19-36; Protein Kinase C Inhibitor, EGF-R Fragment 651-658, Myristolyated; Protein Kinase C╬╡ Translocation Inhibitor Peptide; Pseudohypericin; Quercetin Dihydrate, Ro-31-8220; Ro-32-0432; Roscovitine; Rottlerin; Safingol; SB 202190; SB 202474; SB 203580; Staurosporine, Streptomyces sp.; Tamoxifen Citrate; Tamoxifen, 4-Hydroxy-, (Z)-; U0126; Vitamin E Succinate; LY-294002; or Wortmannin.

11. The method of claim 8 in which said agent is selected from the group consisting of ET-18-

OCH₃; LY-294002; Quercetin Dihydrate; or Wortmannin.

12. The method of claim 8 in which said kinase comprises the protein product of RAD53, RNRl,

CLN, MECl, or homologs thereof.

13. The method of claim 8 in which said kinase comprises the protein product of ATM, ATR, or homologs thereof.

14. The method of claim 8 in which said cell comprises a tumor cell.

15. The method of claim 14 in which said cell is found in a human cancer patient.