WO1999038994A1 - PANCREATIC EUKARYOTIC TRANSLATION INITIATION FACTOR-2α KINASE - Google Patents

Abstract

The invention includes pancreatic eukaryotic translation initiation factor-2α kinase (PEK) and DNA sequences which encode them. Northern blot analysis shows that the gene is expressed in a wide variety tissues, with highest expression in pancreas. Human and rat PEK were expressed in Sf-9 insect cells and were shown to phosphorylate eukaryotic translation initiation factor-2α. Recombinant vectors and host cells containing PEK genes are disclosed, as are methods for recombinant production, anti-PEK antibodies and assay methods.

Description

- 1 -

PANCREATIC EUKARYOTIC TRANSLATION

INITIATION FACTOR-2α KINASE

Field of Invention The present invention relates to molecular biology as it applies to pharmaceutical research and development. The invention provides novel DNA sequences that encode a new pancreatic eukaryotic translation initiation factor-2α kinase (PEK) that was cloned from rat and human pancreatic islet DNA libraries.

Background of the Invention Protein biosynthesis in eukaryotes is generally believed to be controlled at the level of polypeptide chain initiation. Mammalian protein synthesis is promptly adjusted in response to variety of different environmental stimuli including nutrient starvation, heat shock, and viral infection (Hinnebusch, A. G. (1994) Seminars in Cell Biology 5(6), 417-26; de Haro, C, Mendez, R. , and Santoyo, J. (1996) FASEB J. 10(12), 1378-1387). One of the best studied mechanisms of translational regulation involves the phosphorylation of the α-subunit of eukaryotic initiation factor-2 (eIF-2α) (Hershey, J. . (1990) Enzyme 44(1-4), 17- 27; Samuel, C. E. (1993) J^". Biol . Chem. 268(11), 7603-7606; and Wek, R. C. (1994) Trend. Biochem. Sci . 19(11), 491-6). When translation is initiated, eIF-2 catalyzes the binding of the initiator, Met-tRNA, to the 40 S ribosomal subunit by hydrolyzing GTP to GDP. Once the reaction has been catalyzed, eIF-2 is released from the ribosome as an inactive binary complex bound to GDP (Merrick, W. C. (1994) -2- Biochimie 76(9), 822-30). The GDP bound eIF-2 is then converted to an active GTP bound form prior to the next round of translation initiation. Activation to the GTP bound form is carried out by a guanine nucleotide exchange factor eIF-2B which is present at a lower molar concentration in the cell. Phosphorylation of eIF-2α causes an inhibition of eIF-2B activity, reducing the rate of nucleotide exchange, which in turn decreases the rate of polypeptide chain initiation (Hershey, J. W. (1991) Ann . .Rev. Biochem . 60, 717-755; Merrick, W. C. (1992) Microbiol . Rev. 56, 291-315) .

To date, three serine/threonine protein kinases have been identified that phosphorylate eIF-2α. These include two mammalian eIF-2α kinases: the double-stranded RNA- dependent kinase (PKR) (Meurs, E., Chong, K. , Galabru, J., Thomas, N. S. B., Kerr, I. M., Williams, B. R. G. , and Hovanessian, A. G. (1990) Cell 62, 379-390; and Icely, P. L., Gros, P., Bergeron, J. J. M. , Devault, A., Afar, D. E. H., and Bell, J.C. (1991) J. Biol . Chem. 266, 16073-16077) and the heme-regulated inhibitor kinase (HRI) (Chen, J. J., Throop, M. S., Gehrke, L., Kuo, I., Pal, J. K. , Brodsky, M. , and London, I. M. (1991) Proc. Natl . Acad. Sci . USA 88(17), 7729-7733; and Mellor, H., Flowers, K. M., Kimball, S. R. , and Jefferson, L. S. (1994) J. Biol . Chem. 269(14), 10201- 10204). The third is the yeast GCN2 (Roussou, I., Thireos, G., and Hauge, B. M. (1988) Mol . Cell . Biol . 8, 2132-2139; and Wek, R. C, Jackson, B. M., and Hinnebusch, A. G. (1989) Proc. Natl . Acad. Sci . USA 86, 4579-4583) .

Despite their limited homology, each of these proteins has been demonstrated to phosphorylate Ser51 of eIF-2α (Wek, -3- R.C., Trend. Biochem. Sci . 1994). These kinases share similar structure within the kinase domain including the presence of a large insert sequence between domains III and V which distinguishes them from other serine/threonine kinases (Hanks, S. K., and Hunter, T. (1995) FASEB J. 9,

576-596) . Each of the eIF-2α kinases is regulated by unique regulatory domains. PKR is expressed at low levels in most mammalian cells and is inducible by interferon treatment. This kinase is believed to participate in the cellular defense mechanism against viral infection, as it can be activated by double-stranded RNA which is generated during the replicative cycle of certain viruses (Der, S. D., and Lau, A. S. (1995) Proc . Natl . Acad. Sci . USA 92(19), 8841- 8845) . PKR activation has also been shown to regulate cell growth and proliferation (Proud, C. G. (1995) Trend.

Biochem. Sci . 20(6), 241-6 Donze, O., Jagus, R. , Koromilas, A. E., Hershey, J. W. , and Sonenberg, N. (1995) EMBO J. 14(15), 3828-3834; and Der, S. D., Yang, Y. L., Weissmann, C, and Williams, B. R. (1997) Proc. Natl . Acad . Sci . USA 94(7), 3279-83). HRI was initially isolated from reticulocytes and is also expressed in a wide range of non- erythroid cells at much lower levels. Hemin is a potent inhibitor of the kinase. In contrast to PKR and HRI, phosphorylation of eIF-2α by GCN2 has been shown to specifically regulate translational control of GCN4 in yeast (Dever, T. E., Chen, J. J. , Barber, G. N., Cigan, A. M., Feng, L., Donahue, T.F., London, I. M., Katze, M. G. , and Hinnebusch, A. G. (1993) Proc. Natl . Acad . Sci . USA 90(10), 4616-4620; and Hinnebusch, A. G. (1993) Mol . Microb. 10(2), 21523) . -4- Because the true role of kinases in regulating protein synthesis is not fully understood, the present invention provides a valuable reagent for studying initiation and regulation of protein synthesis, especially in the phosphorylation of eukaryotic translation initiation factor- 2α. Moreover, various aspects of the claimed invention provide attractive targets and tools for drug discovery and development .

Brief Summary of the Invention

The present invention provides novel pancreatic islet- derived threonine kinases (PEK) that regulate protein synthesis and polynucleotide sequences which encode them. These novel substances are useful for constructing the claimed nucleic acid vectors and host cells of the invention and for preparing the claimed recombinant proteins and anti PEK antibodies. In particular, a human 4,325 base pair, full length cDNA is disclosed which codes for a 1,115 amino acid PEK cloned from a human islet library. Also, a 4,526 base pair, full length cDNA is disclosed which codes for an 1,108 amino acid PEK cloned from a rat islet library. Assays and purification methods relating to PEK are also disclosed.

Detailed Description of the Invention

In one embodiment, the invention relates to rat PEK. As deduced from the open reading frame, this protein is composed of 1108 amino acids with predicted molecular weight of approximately 125 kD. A hydropathy plot of the protein sequence indicates that rat PEK is composed of densely -5- populated hydrophilic regions. Located at the N-terminus between amino acids 6 to 45 is a signal peptide with high probability (99.5%) to be a transmembrane region or a leader sequence for secretion. Two consensus N-myristylation sites are localized within the signal sequences at residues 20 and 44. This protein also contains another highly hydrophobic region from residues 517 to 532 with the potential to be another transmembrane region.

Consistent with features commonly found among such kinases, the claimed PEK proteins contain eleven clearly identifiable kinase subdomains . Sequence comparison with the protein data bank revealed striking homologies with elF- 2α kinases in the eleven subdomains. The highest homology was found in domains I and VI, while the most variable regions are found in the spacing between domain III and V, a typical feature for this family of kinases. In comparison to three other members of this family, PEK encodes the longest inserts between the subdomains III and V. PEK also contains an unusually long N-terminus upstream from the kinase domain which shares very little homology with any sequence in the data bank.

The present invention also provides nucleic acids that code for the claimed PEK proteins . Such nucleic acid sequences may be either RNA or DNA. The ordinarily skilled artisan will readily recognize that such sequences may be spliced into nucleic acid vectors containing regulatory regions that either drive expression of the inserted coding region or serve to replicate the vector when introduced into a suitable host cell . - 6 -

In one embodiment, a genus of DNA sequences encoding rat PEK is claimed. In a preferred embodiment, a full length cDNA encoding rat PEK is claimed (SEQ ID N0:1) . In another embodiment, the encoded rat PEK protein is claimed (SEQ ID NO: 2) .

The start codon for the 3324 base pair open reading frame (ORF) that encodes rat PEK begins at position 213 and runs through position 3536, after which a TAG stop codon is found. In another preferred embodiment, the ORF of the rat cDNA is claimed.

In another embodiment, a genus of DNA sequences encoding the full length human PEK is claimed. In a preferred embodiment, a full length cDNA encoding human PEK is claimed (SEQ ID NO: 3) . In another embodiment, the encoded full length human PEK protein is claimed (SEQ ID NO: 4) .

The start codon for the 3345 base pair ORF that encodes full lenght human PEK begins at position 73 and runs through position 3417, after which a TAG stop codon is found. In another preferred embodiment, the ORF of the full length human cDNA is claimed.

In another embodiment, the invention includes a partial cDNA sequence of the corresponding human PEK gene lacking only a small percentage of the 5' coding region which ends at position 3204 of SEQ ID NO: 5.

The partial human cDNA encodes a partial human PEK amino acid sequence (SEQ ID NO: 6) which is lacking only a small percentage of the N-terminal amino acid residues and represents yet another embodiment of the invention. -7- Cloning and expression vectors represent other embodiments of the claimed invention which are useful for producing the claimed proteins. To effect the expression of a PEK protein, an engineered DNA sequence encoding a PEK protein is spliced into any appropriate recombinant DNA expression vectors or plasmids through the use of appropriate restriction endonucleases . The PEK coding sequence is designed to possess restriction endonuclease cleavage sites at either end of the transcript to facilitate isolation from and integration into these expression and amplification and expression plasmids. Those skilled in the art will recognize that the particular endonucleases employed will be dictated by the restriction endonuclease cleavage pattern of the parent expression vector employed. The choice of restriction sites are chosen so as to properly orient the coding sequence with control sequences to achieve proper in-frame reading and expression of the PEK protein. The coding sequence must be positioned so as to be in proper reading frame with the promoter and ribosome binding site of the expression vector, both of which are functional in the host cell in which the PEK protein is to be expressed.

To achieve efficient transcription, the gene must be operably associated with a promoter operator region. In the preferred practice of the invention, the promoter-operator region of the gene encoding the PEK protein placed in the same sequential orientation with respect to the ATG start codon of the gene as the promoter-operation occupies with respect to the ATG-start codon of the gene from which it was derived. Synthetic or modified promoter operator regions have been created and are well known in the art. When -8- employing such synthetic or modified promoter-operator regions they should be oriented with respect to the ATG- start codon of the gene .

In general , prokaryotes are used for cloning of DNA sequences in constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No. 31446) is particularly useful. Other microbial strains which may be used include E. coli B and E. coli X1776 (ATCC No. 31537) . These examples are illustrative rather than limiting. Prokaryotes also are used for expression.

The claimed proteins may also be produced recombinantly in eukaryotic expression systems. Preferred promoters controlling transcription in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40) , adenovirus, retroviruses, baculovirus, hepatitis-B virus or from heterologous mammalian promoters. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers, et al . , Nature, 273:113

(1978) . The entire SV40 genome may be obtained from plasmid pBRSV, ATCC 45019. The immediate early promoter of the human cytomegalovirus may be obtained from plasmid pCMBb (ATCC 77177) . Of course, endogenous PEK promoters from the host cell or related species also are useful herein.

Transcription of DNA by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10- 300 bp, that act on a promoter to increase its transcription. Enhancers are relatively oriented and -9- positioned independently and have been found 5' (Laimins, L. et al . , PNAS 78:993 (1981)) and 3' (Lusky, M. L., et al . , Mol . Cell Bio. 3:1108 (1983)) to the transcription unit, within an intron (Banerji, J. L. et al . , Cell 33:729 (1983)) as well as within the coding sequence itself (Osborne, T. F., et al . , Mol . Cell Bio. 4:1293 (1984)). Many enhancer sequences are now known from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, a-fetoprotein and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers .

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding protein. The 3' untranslated regions also include transcription termination sites.

Expression vectors may contain a selection gene, also termed a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR, which may be derived from the Bglll/Hindlll restriction fragment of pJOD-10 [ATCC 68815] ) , thymidine kinase (herpes simplex virus thymidine kinase is contained on the BamHI fragment of vP-5 clone [ATCC 2028] ) or neomycin (G418) resistance genes (obtainable from pNN414 yeast artificial chromosome vector [ATCC 37682] ) . When such -10- selectable markers are successfully transferred into a mammalian host cell, the transfected mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow without a supplemented media. Two examples are: CHO DHFR^" cells (ATCC CRL-9096) and mouse LTK- cells (L-M(TK-) ATCC CCL-2.3) . These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine . Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in nonsupplemented media. The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J^". Molec. Appl . Genet . 1: 327 (1982) , mycophenolic acid, Mulligan, R. C. and Berg, P. Science 209:1422 (1980), or hygromycin, Sugden, B. et al . , Mol Cell . Biol . 5:410-413 (1985). The three examples given -11- above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin) , xgpt (mycophenolic acid) or hygromycin, respectively. Host cells may be transformed with the expression vectors and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The techniques of transforming cells with the aforementioned vectors are well known in the art and may be found in such general references as Maniatis, et al . , Molecular Cloning: A LaJboratory Manual , Cold Spring Harbor Press, Cold Spring

Harbor Laboratory, Cold Spring Harbor, New York (1989) , or Current Protocols in Molecular Biology (1989) and supplements .

Suitable host cells for expressing the vectors encoding the claimed proteins in higher eukaryotes include : African green monkey kidney line cell line transformed by SV40 (COS- 7, ATCC CRL-1651) ; transformed human primary embryonal kidney cell line 293, (Graham, F. L. et al . , J. Gen Virol . 36:59-72 (1977), Virology 77 : 319-329 , Virology 86 : 10-21) ; baby hamster kidney cells (BHK-21 (C-13) , ATCC CCL-10,

Virology 16:147 (1962)); Chinese hamster ovary cells CHO-

DHFR- (ATCC CRL-9096) , mouse Sertoli cells (TM4, ATCC CRL- 1715, Biol . Reprod. 23:243-250 (1980)); african green monkey kidney cells (VERO 76, ATCC CRL-1587) ; human cervical epitheloid carcinoma cells (HeLa, ATCC CCL-2) ; canine kidney -12- cells (MDCK, ATCC CCL-34) ; buffalo rat liver cells (BRL 3A, ATCC CRL-1442); human diploid lung cells (WI-38, ATCC CCL- 75); human hepatocellular carcinoma cells (Hep G2, ATCC HB- 8065) ;and mouse mammary tumor cells (MMT 060562, ATCC CCL51) .

In addition to prokaryotes, unicellular eukaryotes such as yeast cultures may also serve as host cells. S. cerevisiae, or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available. For expression in

Saccharomyces, the plasmid YRp7, for example, (ATCC-40053, Stinchcomb, et al . , Nature 282:39 (1979); Kingsman et al . , Gene 7:141 (1979); Tschemper et al . , Gene 10:157 (1980)) is commonly used. This plasmid already contains the trp gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC no. 44076 or PEP4-1 (Jones, Genetics 85:12 (1977)).

Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (found on plasmid pAP12BD ATCC 53231 and described in U.S. Patent No. 4,935,350, June 19, 1990) or other glycolytic enzymes such as enolase (found on plasmid pACl ATCC 39532) , glyceraldehyde-3 -phosphate dehydrogenase (derived from plasmid pHcGAPCl ATCC 57090, 57091), zymomonas mobilis (United States Patent No. 5,000,000 issued March 19, 1991), hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3 -phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. -13- Other yeast promoters, which contain inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein (contained on plasmid vector pCL28XhoLHBPV ATCC 39475, United States Patent No. 4,840,896), glyceraldehyde 3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose (GAL1 found on plasmid pRY121 ATCC 37658) utilization. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al . , EP 073 657A. Yeast enhancers such as the UAS Gal from S. cerevisiae (found in conjunction with the CYC1 promoter on plasmid YEpsec-- hllbeta ATCC 67024) , also are advantageously used with yeast promoters .

Another embodiment of the invention relates to antibodies that specifically bind to PEK. Anti-PEK antisera was raised using synthetically prepared peptides that matched amino acid residues 879-908 and the 20 C-terminal residues of the claimed rat PEK (SEQ ID NO: 2) .

Antibodies specific for PEK may be raised by conventional methods that are well known in the art. Repeated injections into a host of choice over a period of weeks or months generally elicits an immune response and results in significant serum titers. Preferred hosts are mammalian species and more highly preferred species are rabbits, goats, sheep and mice. The most preferred species is rabbit. Blood drawn from such immunized animals may be processed by established methods to obtain antiserum -14- (polyclonal antibodies) reactive with PEK. The antiserum may then be affinity purified by adsorption to the immunogen according to techniques known in the art. Affinity purified antiserum may be further purified by isolating the immunoglobulin fraction within the antiserum using procedures known in the art. The resulting material will be a heterogeneous population of immunoglobulins that specifically bind to PEK.

Antibodies of interest may also be generated by preparing a semi-synthetic immunogen consisting of a PEK fragments bound to an immunogenic carrier. Many suitable immunogenic carriers such as bovine serum albumin, ovalbumin, and keyhole limpet hemocyanin are also well known in the art as are techniques for coupling the two proteins . Once the semi-synthetic immunogen has been constructed, the procedure for making antibodies is identical to those used for making antibodies to unconjugated proteins.

Monoclonal antibodies (mabs) specific for PEK my be produced which have been practiced for over 15 years and are well known to those of ordinary skill in the art. Repeated intraperitoneal or subcutaneous injections of immunogen in adjuvant will elicit an immune response in most animals. Hyperimmunized B-lymphocytes are removed from the animal and fused with a suitable fusion partner cell line capable of being cultured indefinitely. Preferred animals whose B- lymphocytes may be hyperimmunized and used in the production of mabs are mammals. More preferred animals are rats and mice and most preferred is the BALB/c mouse strain.

Numerous mammalian cell lines are suitable fusion partners for the production of hybridomas. Many such lines -15- are commercially available from the ATCC and commercial suppliers. Preferred fusion partner cell lines are derived from mouse myelomas and the HL-l^λ Friendly myeloma-653 cell line (Ventrex, Portland, ME) is most preferred. Once fused, the resulting hybridomas are cultured in a selective growth medium for one to two weeks. Two well known selection systems are available for eliminating unfused myeloma cells, or fusions between myeloma cells, from the mixed hybridoma culture. The choice of selection system depends on the strain of mouse immunized and myeloma fusion partner used. The AAT selection system, described by Taggart and Samloff, Science 219, 1228 (1982) , may be used; however, the HAT (hypoxanthine, aminopterin, thymidine) selection system, described by Littlefield, Science 145, 709 (1964) , is preferred because of its compatibility with the preferred mouse strain and fusion partner mentioned above.

Spent growth medium is then screened for immunospecific mab secretion. Enzyme linked immunosorbant assay (ELISA) procedures are best suited for this purpose; though, radioimmune assays adapted for large volume screening are also acceptable. Multiple screens designed to consecutively pare down the considerable number of irrelevant or less desired cultures should be performed. Cultures that secrete mabs reactive with the immunogen should be screened for cross-reactivity with other proteins such as the immunogenic carrier. Mabs that preferentially bind to the immunogen of interest may be isotyped using commercially available assays. Binding constants may also be determined by well known methods such a Scatchard analysis. Those skilled in the art will then be able to choose a particular antibody in -16- light of these characteristics based on the intended use for the mab.

Hybridoma cultures which secrete the sought-after mabs should be sub-cloned several times to establish monoclonality and stability. Well known methods for sub- cloning eukaryotic, non-adherent cell cultures include limiting dilution, soft agarose and fluorescence activated cell sorting techniques the latter of which is exemplified in U.S. Patent No. 4,264,341. After each sub-cloning, the resultant cultures must be re-assayed for antibody secretion and isotype to ensure that a stable antibody-secreting culture has been established.

The claimed antibodies are essential reagents for preparing an immunoaffinity surface necessary to practice the isolation method of the invention. The immunoaffinity surface is formed by immobilizing a claimed antibody to a substance so that at least some of the antibody binding site remains exposed and capable of binding its antigen. Substances ranging from porous polysaccharide based beads to plastic polymers to inorganic materials are substances to which the antibodies may be immobilized. Preferred substances are those which provide a maximal surface area to volume ratio and do not adversely affect the antibodies or protein fragment . Polysaccharide matrices formed into various sized beads are more highly preferred because they are porous, provide high surface area to volume ratios, are easy to handle and are well known and understood in the biochemical purification art. See, Affinity Chromatography Principles & Methods, Pharmacia Fine Chemicals, (1983) . -17- A wide assortment of schemes for immobilizing antibodies has developed over the past few decades. Immobilization can be accomplished by covalently coupling the antibody directly to the desired substance or by bridging the antibody to the substance .

CNBr and carbodiimide coupling of antibodies to polysaccharide based beads such as Sepharose^® (Pharmacia, Pistcataway, NJ) are illustrative of direct coupling schemes that are consistent with the invention. Direct couplings generally do not orient the antibodies in any particular fashion; however, some types of direct couplings are able to reproducibly orient the antibody on the immobilizing substance .

Preferred coupling schemes orient the antibody such that its antigen binding regions remain exposed. One such scheme utilizes the natural carbohydrate found on the heavy chains of the antibody. By first oxidizing the carbohydrate moieties to the corresponding aldehydes then reacting the aldehyde with a primary amino group on the surface, it is possible to link the antibody in an advantageous orientation.

Many types of bridges are possible and include small organic linkers which covalently bind the antibody to the immobilizing substance. Such spacer arms are acceptable and preferably should not interact with proteins once the bridge has been formed.

Larger multivalent molecules bound to the immobilizing substance and which are capable of binding several antibodies describe another type of bridge. Specific immunoadsorbants bound to the immobilizing surface and which -18- are capable of non-covalently binding the antibody represents yet another type of bridge. Protein-A is an example of a specific immunoadsorbant that is capable of orienting the antibody. By chemically bonding Protein-A to an immobilizing surface then allowing the antibodies to bind to it, the Fab antibody portions will be oriented away from the immunoaffinity surface resulting in a favorable configuration.

The above discussion is in no way meant to limit the scope of the invention. Numerous other well known schemes for linking antibodies to immobilizing substances are consistent with the invention.

Once the immunoaffinity surface has been prepared, the stream containing the protein fragment to be purified must be contacted with the surface. Batch methods are adequate, though column chromatography is preferable. Batch mode separation can be accomplished by filtering, centrifuging or decanting. When using column chromatography, a simple washing step serves to separate the mixture from the immobilized antibodies.

Removing the PEK from the immunoaffinity surface can be accomplished by subjecting the surface-bound complex to a solution capable of disrupting the interactions between the antibody and peptide of interest. The solution preferably will not adversely affect the immunoaffinity surface or the peptide. More preferred solutions are buffered, isotonic, salt solutions at near neutral pH which contain millimolar concentrations of 2-ME.

It is well known that antibodies labeled with a reporting group can be used to identify the presence of -19- antigens in a variety of milieus. Antibodies labeled with radioisotopes have been used for decades in radioimmune assays to identify, with great precision and sensitivity, the presence of antigens in a variety of biological fluids. More recently, enzyme labeled antibodies have been used as a substitute for radio-labeled antibodies in the popular ELISA.

Antibodies of the present invention can be bound to an immobilizing substance such as a polystyrene well or particle and used in immunoassays to determine whether PEK is present in a test sample. In this embodiment of the invention, a sample is contacted with the immunoaffinity surface and allowed to incubate. After a washing step, the PEK that has bound to the immunoaffinity surface is detected by contacting the surface with another antibody of the invention labeled with a reporting group.

In another mode of the assay embodiment, a test sample suspected of containing a protein fragment of interest is dried onto a surface, forming an immobilized test sample. A labeled antibody of the invention is then contacted with the immobilized test sample and allowed to incubate. If the sample contains a PEK, the labeled antibody will bind to the immobilized fragment. This method can also be done using an unlabeled antibody of the invention followed by a labeled secondary antibody that binds to an antibody of the invention which has already bound to PEK. After washing, the immobilized test sample is measured to detect the presence of any reporting groups .

Reporting groups are typically enzymes such as alkaline phosphatase, horseradish peroxidase or beta-D-galactosidase. -20- Suitable substrates produce a color change when reacted with the enzyme. In so doing, measurements of the color intensity can be quantitated using a spectrophotometer . If the reporting group is a radioisotope, an appropriate gamma or beta ray detecting instrument can be used to quantitate the reporting group. The intensity of the reporting group directly correlates, with the amount of PEK in the test sample .

The principles, preferred embodiments and modes of operation of the present invention have been described in the foregoing specification. The invention which is intended to be protected herein, however, is not to be construed as limited to the particular forms disclosed, since they are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit of the invention.

Example 1 Isolation of human cDNA and Genomic Clones

A 2.4 kb human PEK cDNA fragment was generated by PCR amplification using cDNA prepared from human testis (Clontech, Palo Alto, CA) and oligo nucleotide primers (5'- ACAACAAGAATATCCGCAAAA-3 ' (SEQ ID NO: 7) and 5'- CCAAATGGATTGATTTCAGAA-3' SEQ ID NO: 8)). The 2.4 kb DNA fragment was labled by [α-³²P]dCTP using a random primer labeling kit (Gibco-BRL, Gaithersburg, MD) , and used as a probe to screen cDNA Uni-Zap XR libraries (Stratagene, La Jolla, CA) prepared with mRNA from human liver, pancreas, and testis. Plaque hybridization and purification was -21- carried out according to a protocol recommended by Stratagene. After purification by two subsequent rounds of screening, the cDNA inserts from positive plaques were subcloned into plasmid pBluescript-SK by in vivo excision from the lambda phages as described by Stratagene.

A 740 bp cDNA fragment was labeled labled by [α-

³²P]dCTP using a random primer labeling kit (Gibco-BRL, Gaithersburg, MD) , and was used as a probe to screen a human genomic library (Stratagene, La Jolla, CA) according to a protocol recommended by Stratagene on plaque hybridization and purification. The 740 bp cDNA fragment was generated by PCR amplification using oligo nucleotide primers (5'- GTGACTGTGGAGGACGCTGAGG-3' (SEQ ID NO: 9) and 5'- AATGCCATAACTTTCCAGTCA-3 ' SEQ ID NO: 10)) derived from the 5'- end of the PEK cDNA, and using plasmid pESTO .9 as DNA template. Isolation and purification of genomic clones were carried out using a Wizard⁸ lambda DNA purification system (Promega, Madison, WI) according manufacture's instruction. Restriction site mapping and Southern blot analyses of the genomic clones were carried out essentially as described by Sambrook et al . , (1989) Molecular Cloning: A Laboratory Manual , 2^nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Briefly, lambda genomic DNAs were digested with a combination of restriction enzymes including Sst I, Sst JJ, and Kpn I, and the genomic DNA fragments were separated by agarose gel electrophoresis . After denaturation in 1.5 M NaCI, 0.5% N NaOH and neutralization with 1 M Tris-HCl (pH7.4), 1.5 M NaCI, the genomic DNA fragments were transferred to a nylon membrane by using a Turboblotter (Schleicher & Schuell, Keene, NH) and probed with an oligo -22- nucleotide ( 5 ' -GCCGCTGCTCCCACCTCAGCGACGCGAGTACCGGCGGCG- 3 ' )

(SEQ ID NO: 11) labeled by [γ-³²P]ATP and T4 polynucleotide kinase (Giboco, BRL) . DNA hybridization and washing of the membrane were carried out using the same conditions used in cDNA library screening. A 3.0 kb Sst I genomic DNA fragment was subcloned into the Sst J site of pBluescript-KS and the resulting plasmid was named pBluescript-hPEK3.0.

Example 2 Assembly of Full Length cDNA

A 4.3 kb cDNA containing the full length coding region of human PEK and the 5'- and 3'-UTRs was constructed by subcloning a 200 bp Sst l/Not I fragment isolated from pBluescript-hPEK3.0 and a 1.6 kb iVot l/EcoR V fragment from pEST4.0 into the Sst I and EcoR I sites of pBS-hPITK3.7.

The 200 bp, 1.6 kb, and the plasmid pBS-hPITK3.7 carries the 5' -end including the 5'-UTR, the middle coding region, and the 3 '-end including the 3'-UTR of the human PEK respectively. The resulting plasmid was named pBluescript- hPEK.

Example 3 Baculoviral Expression of Human PEK The 4.3 kb insert produced in Example 2 was released from the plasmid by restriction digestion with Sst J and Kpn I and inserted into the corresponding sites in baculoviral expression vector pFastBac⁸ (Gibco-BRL) . The resulting plasmid was named pFastBac-hPEK.

Generation of a recombinant baculoviral clone that expressed wild type PEK was carried out using a Bac-to-Bac^* -23- baculovirus expression system (Gibco-BRL) by transforming the DHlOBac competent E. coli (Gibco-BRL) with pFastBac-hPEK for the wild type PEK. Culture of the Sf-9 insect cells, propagation of recombinant baculovirus, and expression of PEK in Sf-9 cells was carried according to the protocol provided by the manufacturer.

Example 4 Northern Blot Analysis Human multiple tissue northern blots (2 μg per lane) were purchased from Clontech laboratories (Palo Alto, CA) . A 2.4 kb human PEK cDNA fragment from PCR amplification was labled by [α-³²P]dCTP using a random prime labeling kit from Gibco-BRL (Gaithersburg, MD) and was used in the Northern blot analyses. Hybridization were carried out in hybridization buffer (2x SSC, 0.5% SDS, 0.1% BSA, 0.1% polyvinylpyrolidone, 0.1% ficoll, 100 mg/ml heparin, and 1 mM EDTA) at 60 °C over night, followed by washing three times at 60 °C in 2x SSC buffer with 0.1% SDS. Expression levels of PEK relative to β-actin were quantified using a Phosphorlmager"⁸ (Molecular Dynamics, Sunnyvale, CA) .

Example 5 Production of anti-PEK Antisera Two polyclonal PEK antibodies, PITK-217 and PITK-289, were developed by immunizating rabbits with synthetic peptides derived from two regions of the predicted rat PEK protein sequence in accordance with the general teachings provided in the specification. The PITK-217 antibody was directed to the peptide sequence (SEQ ID NO: 12) in the -24- kinase subdomain V, and the PITK-289 antibody was directed to the peptide sequence (SEQ ID NO: 13) in the C-terminus of rat PEK.

Example 6

Immunofluorescence Microscopy PITK-217 (diluted 1:400) and PITK-289 (diluted 1:200) were used for immunocytochemistry along with the following atibodies: somatostatin (mouse monoclonal, diluted 1:100, Biogenesis, Sandown, NH) , glucagon (rabbit polyclonal, diluted 1:400, Novocastra Lab Ltd., UK), insulin (mouse monoclonal, diluted 1:400, Biogenex, San Ramon, CA) , swine anti-rabbit FITC-conjugated immunoglobulins (diluted 1:100, DAKO Corporation, Carpinteria, CA) , and rabbit anti-mouse TRITC-conjugated immunoglobulins (diluted 1:100, DAKO Corporation, Carpinteria, CA) . Isolated rat and human tissues were immersed in 10% formalin for 2 h, and embeded in paraffin. Tissue sections were deparaffinized, rehydrated and then immersed in 0.1% hydrogen peroxide (H₂0₂) in absolute methanol for 30 minutes to quench endogenous peroxidase activity. Immunohistochemical stains were performed using the Elite avidin-biotin immunoperoxidase complex kit (Vector Laboratories, Burlingame, CA) . The sections were rinsed briefly in PBS, blocked with nonspecific serum, and incubated for 60 min at room temperature with rabbit PEK polyclonal antibodies PITK- 217 or PITK-289 alone, or together with each of the antibodies to somatostatin, glucagon, or insulin respectively in the co-localization studies. After rinse briefly for three times with PBS, the sections were -25- incubated with secondary antibodies including swine anti- rabbit FITC-conjugated antibodies and rabbit anti-mouse TRTIC-conjugated antibodies at room temperature for 60 min. The sections were rinsed three times in PBS and examined by fluorescent microscopy.

Example 7 Rat cDNA Isolation Rat cDNAs encoding antiphosphothreonine immunoreactive proteins were isolated from a λZap-Express library generated from poly (A) -selected RNA from rat pancreatic islets.

Library screening was carried out by using a picoBlue™ Immunoscreening Kit from Stratagene (La Jolla, CA) according to manufacturer's instructions. A total of 5 x 10⁵ plaques were screened by infecting XLl-Blue MRF' bacterial strain with the phage library. Following incubation at 42 °C for 4-5 hours, plates were overlayed with filters pre-soaked with 10 mM isopropylthio-β-D-galactoside (IPTG) , and incubated for an additional 3.5 hours . Upon removal of the first membrane, a duplicate nitrocellulose membrane pre- soaked with 10 mM IPTG was overlaid and incubated over night at 37 °C. The membranes were incubated with blocking solutions containing rabbit antiphosphothreonine antibody, washed three times with washing solutions, followed by incubation with alkaline phosphotase conjugated goat anti- rabbit secondary antibody. Positive plaques were detected using Nitro Blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma) . Following purification by two rounds of screening, the cDNA inserts from positive plaques were subcloned into pBK-CMV plasmid by in vivo excision from the -26- λ phages as described by Stratagene (La Jolla, CA) . Additional rounds of screening were carried out to isolate full length cDNA clones using [α-³²P]dCTP labeled DNA insert from the plasmid as a probe to rescreen the library, according to a protocol recommended by Stratagene on plaque hybridization and purification.

Example 8 Northern Blot Analysis Rat multiple tissue northern blots (2 μg per lane) and mRNA from rat pancreas were purchased from Clontech laboratories (Palo Alto, CA) . To add information on distribution of PEK in pancreas which is not included in the multiple tissue Northern blot, a separate blot was prepared by loading same amount of mRNA from rat pancreas and the blot was hybridized under the same conditions. [α-³²P]dCTP probes were prepared using a random prime labeling kit from Gibco-BRL (Gaithersburg, MD) . Hybridization were carried out in buffer (2x SSC, 0.5% SDS, 0.1% BSA, 0.1% polyvinylpyrolidone, 0.1% ficoll, 100 mg/ml heparin, and 1 mM EDTA) at 60 °C over night, followed by washing three times at 60 °C in 2x SSC buffer with 0.1% SDS. Expression levels of PEK relative to β-actin were quantified by using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) .

Example 9 Bacterial Expression of Human eIF-2α and Rat PEK The human eIF-2α coding region was amplified by PCR reactions using anchored primers and Marathon Ready human testis cDNAs (Clontech) . The primers -27- ( 5 ' GCTAGAGCTCATGCCGGGTCTAAGTTGTAGATT 3 ' , (SEQ ID NO : 14 ) and 5 'AGTCGAATTCAAATTGGACTCTGTTTCCCACAA 3' (SEQ ID NO: 15)) contained an Xhol site at the 5 ' end and an EcoRI site at the 3 ' end to facilitate direct cloning into the same sites of the E. coli expression vector pTrcHis A (Invitrogen, San Diego, CA) . The resulting plasmid was named pTrcHis-hIF2α. Expression of PEK fusion protein in TOP10 E. coli cells (Invitrogen, San Diego, CA) was carried out by using the plasmid pBK-RK3 rescued by in vivo excision from the phages during antiphosphothreonine screen. The plasmid pBK-RK3 carries the full length coding region plus 150 bp of the 5' untranslated sequences subcloned into the EcoRI and Xhol sites of the expression vector pBK-CMV (Stratagene) . In addition to the 5' untranslated sequences, part of the polylinker sequences upstream from the EcoRI site have been expressed in frame as peptide sequence in the fusion protein.

Example 10 Baculoviral Expression of

Human eIF-2α and Rat PEK For baculoviral expression in Sf-9 cells, a 4.5 kb DNA fragment containing the entire coding region and the 5 ' end untranslated sequences of rat PEK was subcloned from plasmid pBK-RK3 into the EcoRI and Xho I sites of the baculoviral expression vector pFastBac (Gibco-BRL) . Human eIF-2α was subcloned from plasmid pTrcHis-hIF2α into the BamHI and Hindlll sites of the baculoviral expression vector pFastBacHTb (Gibco-BRL) to generate a recombinant protein with six histidines at the N-terminus to facilitate direct -28- purification. Selection of recombinant virus and expression recombinant rat PEK and human eIF-2α in Sf-9 cells were carried out according to a protocol provided by Gibco-BRL. Purification of human eIF-2α was carried out by using a Xpress Purification Kit from Invitrogen under native conditions according to manufacturer's protocols. Recombinant eIF-2α was purified on a ProBond"⁸ column containing nickel chelation resin that binds to the polyhistidine tag of the fusion protein, and the column washed twice with native binding buffer (20 mM Na2HP04, pH 7.8, 500 mM NaCI, 0.5 mg/ml Leupeptin) and three times with native wash buffer (Na2HP04, pH 5.5, 500 mM NaCI). The fusion protein was eluted by successive application of native wash buffer containing 50, 200, 350, and 500 mM imidizole. Combined fractions containing the fusion protein were concentrated and desalted on a Centricon" (Amicon, Beverly, MA) with 10, 000 MW cutoff, and washed once with kinase buffer (20 mM HEPES, pH 7.5, 50 mM NaCI, 10% v/v glycerol) . Protein concentrations were determined using BCA* protein assay reagents from Pierce (Rockford, IL) .

Example 11 Immunoprecipitation Kinase Assay The activity of recombinant rat PEK from Sf-9 cell lysate was assessed in immune-complexed kinase assays using recombinant eIF-2α as a substrate. Frozen pellets of Sf-9 cells expressing the rat PEK or an unrelated protein were resuspended in cell lysis buffer (10 mM HEPES, pH 7.4, 1 mM EGTA, 1 mM MgC12, 1 mM 2-aminoethylisothiouronium bromide, 1 x CompleteTM (Boehringer Mannheim, Indianapolis, IN)), -29- followed by centrifugation at 10,000 x g for 10 min to eliminate insoluble material. The supernatants were precleared with 20 ml of rabbit preimmune serum, followed by immunoprecipitation with 20 ml of polycolonal rabbit anti- PEK peptide antibodies at 4 °C for 90 min on a rocker. The polyclonal antibodies were developed by immunizing rabbits with synthetic peptides containing the last 30 amino acids of the C-terminus. After incubation with 100 ul of protein A-Sepharose beads at 4 °C for 1 hour with rocking, the immune complexes were washed twice with wash buffer (10 mM HEPES, pH 7.4, 10 mM Benzamidine, 150 mM NaCI, 0.5 mM methionine, 0.1 mg/ml BSA, 5 mM EDTA) and twice with kinase buffer (20 mM Tris-HCl, pH 7.9, 50 mM NaCI, 10 mM MgC12, 0.1 mM ATP, 1 mM DTT) . The eIF-2α kinase assay was carried out by addition of 1, 2, and 4 mg of purified human eIF-2α and 20 mCi of [γ-³²P]ATP to the bead slurry and incubation at 37 oC for 30 min. Reactions were terminated by boiling with equal volume of 2 x SDS-PAGE sample buffer for 3 min and analyzed by SDS-PAGE. The gels were dried and subjected to autoradiography at -70 °C.

Example 12 Autophosphorylation Immunoblot Assay Protein extracts from Sf-9 cells and E. coli . cells were separated by SDS-PAGE and transferred to PVDF membranes (Bio-Rad) . After blocking with 0.2% casein for 60 min in TBST buffer (25 mM Tris pH 7.5, 137 mM NaCI, 2.6 mM KCI, 0.1% Tween-20) , the PVDF membranes were incubated with 1 μg/ml rabbit anti-phosphothreonine antibodies for 60 min in the TBST buffer. Following brief wash in TBST buffer, -30- the membranes were incubated for 60 min with 0.3-0.5 μg/ml horseradish peroxidase-goat anti-rabbit IgG (Zymed) in TBST buffer. Detection of phosphorylated proteins on the membrane was carried out using the ECL detection system (Amersham) .

Example 13 Expression and Autophosphorylation of PEK in E. coli and insect cells A rat PEK expression plasmid rescued from antiphosphothreonine antibody screen was initially used to express PEK as a fusion protein in E. coli cells. In addition to the full length PEK peptide, the fusion protein also contains peptide sequences translated from part of the polylinker sequences upstream of EcoR I site of the expression vector pKB-CMV (Stratagene) and part of the 5'untranslated sequence of the PEK cDNA. Additionally, a recombinant baculoviral expression system designed to express only the coding region of the cDNA was prepared. Expression by either method yielded very little protein due possibly to toxic effects or instability of the proteins.

Western immunoblot analysis using antiphosphothreonine antibodies detected multiple phosphorylated bands from lysate of Sf-9 cells transfected with recombinant baculoviruses expressing either PEK or an unrelated protein. The analysis also detected several high molecular weight bands that were only present when using lysate of Sf-9 cells expressing PEK, but not lysate from the control Sf-9 cells expressing an unrelated protein. The high molecular weight bands corresponded to the estimated sizes of the full length -31- and the partially degraded PEK proteins. Similarly, the analysis also detected multiple phosphorylated bands from lysate of E. coli cells expressing the PEK fusion protein, while no signal was detected from the control . Thus the results confirm that PEK is autophosphorylated at threonine residue (s) when expressed either in E. coli or in Sf-9 insect cells. The autophosphorylation was not abolished by attachment of peptide sequences from the polylinker and the 5' untranslated sequences of PEK cDNA when expressed in E. coli .

Example 14 Isolation of cDNA Encoding PEK In an effort to identify cellular targets of threonine kinases, antiphosphothreonine antibodies to screen a λZap- Express cDNA library prepared with mRNA isolated from rat pancreatic islets were used. Since there is no detectable threonine kinase activity in bacteria, any positive signal would be expected to come from the expression of introduced cDNA clones. From the screening of 5 x 105 recombinant plaques 6 distinct clones encoding fusion proteins which reacted with the polyclonal antiphosphothreonine antibodies were identified. The cDNA inserts were subcloned into the pBK-CMV plasmid by in vivo excision from the λ phage and were subjected to sequence analysis. While the majority of the inserts encoded known threonine kinases, such as lyn and pim-1 , one clone encoding a novel threonine kinase which did not match sequences of any known kinases in the data bank was identified. To verify that the PEK cDNA clone encoded the full length sequence, the inserts were used as ³²P-labeled cDNA probes to isolate additional clones from the -32- same library. Among more than 24 positive clones from the second round of screening, one clone which contained additional 65 bases carrying an in-frame stop codon at -153 upstream of the first AUG was identified. The sequence flanking the first AUG (GCCGCTGATGG) showed homology with the consensus sequence GCCA/GCCATGG for translation initiation sites (Kozak, M. (1986) Cell 44, 283-292) indicating that the full length coding sequences for rat PEK was identified.

Example 15 Analysis of PEK Kinase Activity Rat PEK proteins were immunoprecipitated from lysate of Sf-9 cells expressing the protein using polyclonal anti-PEK antibodies. PEK expressed from Sf-9 cells was used instead of the fusion protein expressed from E. coli cells to eliminate the possible effects of non-PEK portion of the fusion protein on the kinase activity. As a negative control for the kinase assay, immunoprecipitation was also carried out using lysate from Sf-9 cells infected with recombinant baculovirus expressing an unrelated protein. Addition of 1, 2, 4 mg of purified eIF-2α and [γ-32P]ATP respectively to the immunoprecipitates from PEK expressing Sf-9 cell lysate resulted in dose dependent phosphorylation of eIF-2α. In contrast, no phosphorylation of eIF-2α was detected in immunoprecipitates from lysate of the control Sf-9 cells. The recombinant PEK proteins appeared to be fully autophosphorylated prior to addition of [γ-32P]ATP during the kinase assay, as no additional phosphorylation of PEK was detectable. • 33 *

Example 16 Tissue Distribution Analysis The expression of rat PEK mRNA in various rat tissues was examined by Northern blot analysis of poly (A) + RNA using a cDNA probe corresponding to the entire coding region of

PEK. This probe detected a single -5.2 kb mRNA transcript in all the tissues examined. No apparent isoforms were detected in any of the tissues. PEK message was readily detected in pancreas, spleen, lung, brain, kidney, and heart, with low expression in skeletal muscle and testis. Normalization to the levels of β-actin within each tissue revealed that PEK is most abundant in pancreas with levels of expression 10-20 fold higher than in liver, kidney, lung, brain and spleen. Thus, PEK may play an important role in regulating pancreatic function, such as glucose induced- insulin synthesis.

Claims

-34- Claims I claim:

1. An isolated polynucleotide consisting of a nucleic acid sequence that encodes a protein comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

2. The isolated polynucleotide of Claim 1 that is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, nucleic acid residues 213 through 3536 of SEQ ID NO:l, nucleic acid residues 73 through 3417 of SEQ ID NO: 3, and nucleic acid residues 1 through 3204 of SEQ ID NO: 5.

3. A recombinant DNA vector comprising a polynucleotide of any one of Claims 1 to 2.

4. A host cell comprising a vector of Claim 3.

5. The host cell of Claim 4 wherein the host cell is selected from the group consisting of E. coli and Sf-9 cells .

6. A method for producing PEK comprising culturing a host cell of any one of Claims 4 to 5 in a nutrient medium under conditions suitable for expressing PEK and recovering the expressed PEK from the cell or the nutrient medium.

7. A pancreatic eukaryotic translation initiation factor-2╬▒ kinase (PEK) comprising an amino acid sequence -35- selected from the group consisting of SEQ NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6.

8. The PEK of Claim 7 wherein one or more threonine residues are phosphorylated.

9. A purified antibody that specifically binds to a PEK as claimed in any one of Claims 7 to 8.

10. An antibody of Claim 9 selected from the group consisting of PITK 217 and PITK 289.

11. A method of using an antibody of any one of Claims 9 to 10 for isolating a PEK, said method comprising: a) immobilizing the antibody onto a surface; b) contacting the immobilized antibody with a mixture containing a PEK; c) separating the immobilized antibody bound to the PEK from the mixture, and; d) recovering the PEK by removing the antibody-bound protein of step c) from the immoblized antibody.

12. A method of using an antibody of any one of Claims 9 to 10 for identifying the presence of a PEK in a biological fluid or sample; said method comprising: a) immobilizing the antibody onto an assay surface; b) contacting the assay surface with the biological fluid and washing the assay surface with a suitable solution; - 36 - c) contacting the assay surface with an antibody of any one of Claims 9 to 10 labeled with a reporting group and washing the assay surface with a suitable solution, and; d) detecting the presence of the reporting group.

13. A method of using an antibody of any one of Claims 9 to 10 for identifying the presence of a PEK; said method comprising: a) immobilizing a sample suspected of containing a PEK onto an assay surface; b) contacting the assay surface with an antibody of any one of Claims 9 to 10 directly or indirectly labeled with a reporting group and washing the assay surface with a suitable solution, and; c) detecting the presence of the reporting group.

14. A method of using an antibody as claimed in any one of Claims 9 to 10 to quantitate an amount of a PEK in a biological fluid; said method comprising: a) radio-labelling the PEK; b) mixing the antibody with the biological fluid; c) adding a known amount of the labelled PEK to the mixture of step b) ; d) separating bound antibody from free antibody, and; e) quantitating the amount of radio-label in the bound fraction.