WO1999037776A1

WO1999037776A1 - Methods for modulating angiogenesis

Info

Publication number: WO1999037776A1
Application number: PCT/US1999/001623
Authority: WO
Inventors: Nan Zhang; Paul B. Fisher
Original assignee: Genquest, Inc.
Priority date: 1998-01-26
Filing date: 1999-01-26
Publication date: 1999-07-29
Also published as: WO1999037776A9; AU2343299A

Abstract

Compositions and methods for modulating angiogenesis are diclosed. The compounds provided are progression-associated proteins, and portions and variants thereof, as well as polynucleotides that encode such polypeptides, antibodies that bind to such polypeptides and other agents that modulate expression of such polypeptides. Vaccines and pharmaceutical compositions comprising such compounds are also provided and may be used, for example, to inhibit angiogenesis in vivo.

Description

METHODS FOR MODULATING ANGIOGENESIS

TECHNICAL FIELD

The present invention relates generally to methods for modulating angiogenesis. The invention is more particularly related to the use of polypeptide and nucleotide sequences associated with tumor progression, antibodies that bind to such polypeptides and agents that modulate the expression of such polypeptides for inhibiting angiogenesis.

BACKGROUND OF THE INVENTION The carcinogenic process involves a series of sequential changes in the phenotype of a cell resulting in the acquisition of new properties or a further elaboration of transformation-associated traits by the evolving tumor cell. Although extensively studied, the precise genetic mechanisms underlying tumor cell progression during the development of most human cancers remain enigmas. Possible factors contributing to tumor progression include: activation of cellular genes that promote the cancer cell phenotype (i.e., oncogenes); activation or modification of genes that regulate genomic stability (i.e., DNA repair genes); loss or inactivation of cellular genes that function as inhibitors of the cancer cell phenotype (i.e., tumor suppressor genes); and/or combinations of these genetic changes in the same tumor cell. However, to develop improved diagnostic and therapeutic methods for cancer, it is necessary to identify genetic mechanisms leading to tumor progression.

Angiogenesis, the growth of new capillary blood vessels from preexisting vessels, is a fundamental process that is required for carcinogenesis. Under normal circumstances, angiogenesis is a tightly regulated process that facilitates wound healing, tissue repair, reproduction, growth and development. However, many disease states, including the growth of solid tumors, are dependent upon the persistence of angiogenesis. Therapies involving the administration of agents that inhibit angiogenesis are potentially powerful strategies in the treatment and prevention of such diseases.

Accordingly, there is a need in the art for the identification of anti- angiogenic agents for use in the treatment of diseases such as cancer. The present invention fulfills this need, and further provides other related advantages.

SUMMARY OF THE INVENTION

Briefly stated, the present invention provides compositions and methods for modulating angiogenesis. Within certain aspects, the present invention provides methods for modulating angiogenesis in an organism, comprising administering to an organism an agent that alters expression and/or activity of a progression-associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l, SEQ ID NO:2 or a variant of one of the foregoing sequences. Agents include, but are not limited to, antisense polynucleotides, antibodies and antigen-binding fragments thereof. Within further aspects, the present invention provides methods for modulating angiogenesis, comprising contacting a cell capable of undergoing angiogenesis with an agent that alters expression and/or activity of a progression- associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, or a variant of one of the foregoing sequences, and thereby modulating angiogenesis. For example, an agent may inhibit expression of the progression-associated protein. Such agents may comprise an antisense polynucleotide or an antibody or antigen-binding fragment thereof.

The present invention further provides, within other aspects, methods for determining whether an agent modulates angiogenesis. One such method comprises the steps of: (a) contacting a candidate agent with a polypeptide comprising a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, or a portion or variant of one of the foregoing sequences, under conditions and for a time sufficient to allow the candidate agent and polypeptide to interact; and (b) determining the effect of the candidate agent on the ability of the polypeptide to induce angiogenesis, and therefrom determining whether the agent modulates angiogenesis.

Another method for determining whether an agent modulates angiogenesis comprises the steps of: (a) contacting a candidate agent with a cell transformed or transfected with a reporter gene under the control of an endogenous promoter or regulatory element of a progression-associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, under conditions and for a time sufficient to allow the candidate agent to interact with the promoter or regulatory element; and (b) determining the effect of the candidate agent on the level of reporter protein produced by the cell, and therefrom identifying determining whether the agent modulates angiogenesis.

These and other aspects of the present invention will become apparent upon reference to the following detailed description and attached drawings. All references disclosed herein are hereby incorporated by reference in their entirety as if each was incorporated individually.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 is a Northern blot illustrating PEG-3 expression in Ad5- transformed RE cells displaying different stages of transformation progression. Fifteen μg of cellular RNA isolated from the indicated cell types, were electrophoresed, transferred to nylon membranes and hybridized with an -700 bp 3' region of the PEG-3 gene (top) and then stripped and probed with GAPDH (bottom).

Figure 2 is a Northern blot illustrating PEG-3 expression in gamma irradiated and oncogene transformed CREF cells. The experimental procedure was as described in the legend to Fig. 1. CREF cells were gamma irradiated with 10 Gy and

RNA was isolated 4 and 24 hr later. Fifteen μg of cellular RNA isolated from the indicated cell types, were electrophoresed, transferred to nylon membranes and hybridized with an -700 bp 3' region of the PEG-3 gene (top) and then stripped and probed with GAPDH (bottom). Figures 3A and 3B show the predicted amino acid sequences of the rat

PEG-3, gadd34 and MyDl 16 proteins. Sequences shared by the three genes are shaded.

PEG-3 encodes a putative protein of 457 aa (MW of ~5OkDa), the gadd34 gene encodes a putative protein of 589 aa (MW ~65kDa) and the MyDl 16 gene encodes a putative protein of 657 aa (MW of ~72kDa).

Figure 4 shows the results of in vitro translation of the rat PEG-3 gene. Lane Luciferase is the in vitro translation of the luciferase gene (-61 kDa), positive control. The blank lane contains the same reaction mixture without mRNA, negative control. Lane PEG-3 contains the translated products of this cDNA. Rainbow protein standards (Amersham) were used to determine the sizes of the in vitro translated products.

Figure 5 is an autoradiogram illustrating the transcription of the rat PEG- 3, gadd34 and MyDl 16 genes as a function of DNA damage and transformation progression. Nuclear run-on assays were performed to determine comparative rates of transcription. Nuclei were isolated from CREF cells treated with MMS (100 μg/ml for 2 hr followed by growth for 4 hr in complete medium) or gamma irradiation (10 Gy followed by 2 hr growth in complete medium). DNA probes include, PEG-3 (1), MyDl 16 (2), gadd34 (3), GAPDH (4) and pBR322 (5).

Figure 6 is a histogram illustrating the effect of transfection with PEG-3, mda-1 and p21 (mda-6) on colony formation of El 1 and El 1-NMT cells in monolayer culture. Target cells were transfected with 10 μg of a Zeocin vector (pZeoSV), the PEG-3 gene cloned in pZeoSV (PEG-3), the pREP4 vector, the mda-1 gene cloned in pREP4 (mda-1) and the mda-6 (p21) gene cloned in pREP4 (p21 (mda-6)), as indicated. Data represents the average number of Zeocin or hygromycin (pREP4 transfection) resistant colonies + S.D. for 4 plates seeded at 1 X 10⁵ cells/6-cm plate.

Figure 7 is a histogram illustrating the effect of stable PEG-3 expression on anchorageindependent growth of El 1 cells. Agar cloning efficiency of El 1 , Zeocin resistant pZeoV (vector) transfected El l and Zeocin resistant pZeoPEG transfected El 1 cells. Average number of colonies developing in 4 replicate plates + S.D. Figure 8 is an autoradiogram illustrating the expression of PEG-3, Ad⁵

El A and GAPDH RNA in pZeoPEG transfected El 1 cells. The experimental procedure was as described in the legend to Fig. 1. Blots were probed sequentially with PEG-3

(top), Ad⁵ El A (middle) and GAPDH (bottom). The El 1-ZeoPEG clones are the same clones analyzed for anchorage-independence in Fig. 7.

Figure 9 is an autoradiogram showing PEG-3 expression in normal human melanocyte and melanoma cell lines. Fifteen μg of cellular RNA isolated from the indicated cell types, were electrophoresed, transferred to nylon membranes and hybridized with an -700 bp 3' region of the PEG-3 gene (top) and then stripped and probed with GAPDH (bottom). Cell types include: FM516-SV, normal human melanocyte immortalized with the SV40 T-antigen; MeWo, WM239, C8161, FO-1 and Ho-1, metastatic human melanoma; WM35, early radial growth phase (RGP) primary human melanoma; and WM278, early vertical growth phase (VGP) primary human melanoma. Figure 10 is an autoradiogram showing the effect of treatment with DNA damaging agents on PEG-3 expression in human melanoma cells. The indicated cell type was exposed to methyl methanesulfonate (MMS) (100 μg/ml for 2 hr and then grown in medium lacking MMS for 2 hr) or gamma irradiation (JR) (10 gy and cells were grown for 4 or 24 hr in medium) prior to RNA isolation. Fifteen μg of cellular RNA isolated from the indicated cell types and conditions, were electrophoresed, transferred to nylon membranes and hybridized with an -700 bp 3' region of the PEG-3 gene (top) and then stripped and probed with GAPDH (bottom). HO-1 and F0-1 cells express wild-type p53 protein (p53 wt) and SK MEL 110 expresses a mutant p53 (p53 mut). Figure 11 presents the nucleotide sequence of rat Progression Elevated

Gene-3 (PEG-3). The initiation and termination codons are underlined.

Figure 12 presents the amino acid sequence of rat Progression Elevated Gene-3 (PEG-3). PEG-3 protein contains 457 amino acids and with M.W. of approximately 50kDa. Figures 13A-13C present the sequence of a human PEG-3 cDNA. DETAILED DESCRIPTION OF THE INVENTION

As noted above, the present invention is generally directed to compositions and methods for modulating angiogenesis. The compositions described herein may include one or more agents that alter the expression and/or activity of a progression-associated protein. Such agents include progression-associated polypeptides, nucleic acid sequences (such as antisense oligonucleotides), antibodies and other compounds that may be identified as described herein. Progression- associated polypeptides generally comprise at least a portion of a tumor progression- associated protein, or a variant thereof. Nucleic acid sequences of the subject invention generally comprise a DNA or RNA sequence that encodes such a polypeptide, or that is complementary to such a coding sequence. Antibodies are generally immune system proteins, or antigen-binding fragments thereof, that are capable of binding to a portion of a polypeptide as described above.

The present invention is based, in part, on the identification of certain cDNA molecules that correspond to progression-associated mRNA molecules. As used herein, a "progression-associated" mRNA is a mRNA whose expression correlates with tumor cell progression (i.e., the level of RNA is at least 2-fold higher in progressing tumor cells). A progression-associated cDNA molecule comprises the sequence of a progression-associated mRNA (and/or a complementary sequence). Similarly, a progression-associated protein or polypeptide comprises a sequence encoded by a progression-associated mRNA, where the level of protein or polypeptide correlates with tumor cell progression (i.e., the level of protein is at least 2-fold higher in progressing tumor cells). Progression-associated sequences described herein are also called "progression elevated" genes (PEG).

PROGRESSION-ASSOCIATED POLYNUCLEOTIDES

Any polynucleotide that encodes a progression-associated polypeptide, or a portion or variant thereof as described herein, is encompassed by the present invention. Such polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be DNA (genomic, cDNA or synthetic) or RNA molecules. Additional non-coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.

Progression-associated polynucleotides may be prepared using any of a variety of techniques. For example, such a polynucleotide may be amplified from human genomic DNA, from tumor cDNA or from cDNA prepared from any of a variety of tumor-derived cell lines (typically cell lines characterized by a progression phenotype), via polymerase chain reaction (PCR). For this approach, sequence-specific primers may be designed based on the sequences provided herein, and may be purchased or synthesized. An amplified portion may then be used to isolate a full length gene from a human genomic DNA library or from a tumor cDNA library, using well known techniques, as described below. Alternatively, a full length gene can be constructed from multiple PCR fragments. cDNA molecules encoding a native progression-associated protein, or a portion thereof, may also be prepared by screening a cDNA library prepared from mRNA of a cell that is in progression, such as El 1-NMT or MCF-7 cells, as described herein. Such libraries may be commercially available, or may be prepared using standard techniques (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989, and references cited therein). A library may be a cDNA expression library and may, but need not, be subtracted using well known subtractive hybridization techniques.

There are many types of screens that may be employed, including any of a variety of standard hybridization methods. For initial screens, conventional subtractive hybridization techniques may be used. A progression-associated cDNA molecule may be sequenced using well known techniques employing such enzymes as Klenow fragment of DNA polymerase I, Sequenase® (US Biochemical Corp., Cleveland OH) Taq polymerase (Perkin Elmer, Foster City CA), thermostable T7 polymerase (Amersham, Chicago, IL) or combinations of recombinant polymerases and proofreading exonucleases such as the ELONGASE Amplification System (Gibco BRL, Gaithersburg, MD). An automated sequencing system may be used, using instruments available from commercial suppliers such as Perkin Elmer and Pharmacia.

The sequence of a partial cDNA may be used to identify a polynucleotide sequence that encodes a full length progression-associated protein using any of a variety of standard techniques. Within such techniques, a library (cDNA or genomic) is screened using one or more polynucleotide probes or primers suitable for amplification. Preferably, a library is size-selected to include larger molecules. Random primed libraries may also be preferred for identifying 5' and upstream regions of genes. Genomic libraries are preferred for obtaining introns and extending 5' sequence.

For hybridization techniques, a partial sequence may be labeled (e.g., by nick-translation or end-labeling with ³²P) using well known techniques. A bacterial or bacteriophage library is then screened by hybridizing filters containing denatured bacterial colonies (or lawns containing phage plaques) with the labeled probe (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989). Hybridizing colonies or plaques are selected and expanded, and the DNA is isolated for further analysis. cDNA clones may be analyzed to determine the amount of additional sequence by, for example, PCR using a primer from the partial sequence and a primer from the vector. Restriction maps and partial sequenced may be generated to identify one or more overlapping clones. The complete sequence may then be determined using standard techniques, which may involve generating a series of deletion clones. The resulting overlapping sequences are then assembled into a single contiguous sequence. A full length cDNA molecule can be generated by ligating suitable fragments, using well known techniques. Alternatively, there are numerous amplification techniques for obtaining a full length coding sequence from a partial cDNA sequence. Within such techniques, amplification is generally performed via PCR. Any of a variety of commercially available kits may be used to perform the amplification step. Primers may be designed using, for example, software well known in the art. Primers are preferably 22-30 nucleotides in length, have a GC content of at least 50% and anneal to the target sequence at temperatures of about 68°C to 72°C. The amplified region may be sequenced as described above, and overlapping sequences assembled into a contiguous sequence.

One such amplification technique is inverse PCR (see Triglia et al., Nucl. Acids Res. 76:8186, 1988), which uses restriction enzymes to generate a fragment in the known region of the gene. The fragment is then circularized by intramolecular ligation and used as a template for PCR with divergent primers derived from the known region. Within an alternative approach, sequences adjacent to a partial sequence may be retrieved by amplification with a primer to a linker sequence and a primer specific to a known region. The amplified sequences are typically subjected to a second round of amplification with the same linker primer and a second primer specific to the known region. A variation on this procedure, which employs two primers that initiate extension in opposite directions from the known sequence, is described in WO 96/38591. Additional techniques include capture PCR (Lagerstrom et al., PCR Methods Applic. 7:111-19, 1991), walking PCR (Parker et al, Nucl. Acids. Res. 79:3055- 60,1991) and rapid amplification of cDNA end (RACE) procedures (see Jiang et al., Oncogene 70:1855-1864, 1995; Jiang et al., Oncogene 77:2477-2486, 1995). Other methods employing amplification may also be employed to obtain a full length cDNA sequence. In certain instances, it is possible to obtain a full length cDNA sequence by analysis of sequences provided in an expressed sequence tag (EST) database, such as that available from GenBank. Searches for overlapping ESTs may generally be performed using well known programs (e.g., NCBI BLAST searches), and such ESTs may be used to generate a contiguous full length sequence. Nucleic acid sequences of cDNA molecules corresponding to the rat and human homologs of the progression-associated gene Progression Elevated Gene-3 (PEG-3) are provided in Figures 11 (rat) and 13 (human). Rat PEG-3 was identified based on elevated expression in progressed Ad5 -transformed cells (spontaneous, oncogene-induced and growth factor-related, gene-induced) versus unprogressed cells (parental Ad5 -transformed, AZA-suppressed, and suppressed hybrids) using subtraction hybridization (Jiang et al., Mol. Cell. Different. 7:285-299, 1993). Transfection of PEG-3 into unprogressed parental Ad5 -transformed cells induces the progression phenotype, without significantly altering colony formation in monolayer culture or affecting cell growth. PEG-3 expression is also elevated following DNA damage and oncogenic transformation of CREF cells by various oncogenes. Sequence analysis indicates that rat PEG-3 has 73 and 68% nucleotide (nt) and 59 and 72% amino acid (aa) similarities, respectively, with the gadd34 and MyDl 16 genes. However, unlike gadd34 and MyDl 16 that encode proteins of -65 and -72 kDa, respectively, PEG-3 encodes a protein of -50 kDa with only -28 and -40% aa similarities to gadd34 and Mydll6, respectively, in its carboxyl terminus. Moreover, a direct correlation only exists between expression of PEG-3, and not gadd34 or Mydllό, and the progression phenotype in transformed rodent cells. These results indicate that PEG-3 represents a new member of the gadd34/MyDl 16 gene family with distinct properties.

The human PEG-3 cDNA molecule described herein was isolated from a MCF-7 cDNA library, based on hybridization to a rat PEG-3 probe. Human PEG-3 is generally expressed in cells that are in progression, including most human tumor cell lines. These sequences are expressed at a lower level, or undetectably, in normal tissues examined by Northern blot analysis. The polynucleotides specifically recited herein, as well as full length polynucleotides comprising such sequences, other portions of full length polynucleotides, and sequences complementary to all or a portion of such full length molecules, are specifically encompassed by the present invention. PEG-3 homologs from other species are specifically provided, and may generally be prepared as described herein for the human homolog.

Variants of the recited polynucleotide sequences are also provided herein. Polynucleotide variants may contain one or more substitutions, deletions, insertions and/or modifications such that the antigenic, immunogenic and/or biological properties of the encoded polypeptide are not diminished. The effect on the properties of the encoded polypeptide may generally be assessed as described herein. Preferred variants contain nucleotide substitutions, deletions, insertions and/or modifications at no more than 20%, preferably at no more than 10%, of the nucleotide positions. Certain variants are substantially homologous to a native gene, or a potion or complement thereof. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA sequence encoding a progression- associated protein (or a complementary sequence). Suitable moderately stringent conditions include prewashing in a solution of 5 X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridizing at 50°C-65°C, 5 X SSC, overnight; followed by washing twice at 65° C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1% SDS. Such hybridizing DNA sequences are also within the scope of this invention.

It will be appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode a polypeptide as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention. As noted above, antisense polynucleotides and portions of any of the above sequences are also contemplated by the present invention. Such polynucleotides may generally be prepared by any method known in the art, including chemical synthesis by, for example, solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro or in vivo transcription of DNA sequences encoding a progression-associated protein, or a portion thereof, provided that the DNA is incorporated into a vector downstream of a suitable RNA polymerase promoter (such as T3, T7 or SP6). Large amounts of RNA probe may be produced by incubating labeled nucleotides with a linearized Progression Elevated Gene-3 fragment downstream of such a promoter in the presence of the appropriate RNA polymerase. Certain portions of a PEG-3 polynucleotide may be used to prepare an encoded polypeptide, as described herein. A portion of a sequence complementary to a coding sequence (i.e., an antisense polynucleotide) may also be used to modulate gene expression. Such portions are preferably at least 10 nucleotides in length, more preferably at least 12 nucleotides in length and still more preferably at least 15 nucleotides in length. cDNA constructs that can be transcribed into antisense RNA may also be introduced into cells of tissues to facilitate the production of antisense RNA.

Any polynucleotide may be further modified to increase stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages in the backbone; and/or the inclusion of nontraditional bases such as inosine, queosine and wybutosine, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine and uridine.

Nucleotide sequences as described herein may be joined to a variety of other nucleotide sequences using established recombinant DNA techniques. For example, a polynucleotide may be cloned into any of a variety of cloning vectors, including plasmids, phagemids, lambda phage derivatives and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors and sequencing vectors. In general, a vector will contain an origin of replication functional in at least one organism, convenient restriction endonuclease sites and one or more selectable markers. Additional initial, terminal and/or intermediate DNA sequences that, for example, facilitate construction of readily expressed vectors may also be present. For example, regulatory elements required for expression include promoter sequences to bind RNA polymerase and transcription initiation sequences for ribosome binding. A bacterial expression vector may include a promoter such as the lac promoter and for transcription initiation the ShineDalgarno sequence and the start codon AUG. Similarly, a eukaryotic expression vector may include a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome. Such vectors may be obtained commercially or assembled from the sequences described by methods well-known in the art, for example, the methods described above for constructing vectors in general. Other elements that may be present in a vector will depend upon the desired use, and will be apparent to those of ordinary skill in the art.

For example, insert and vector DNA can both be exposed to a restriction enzyme to create complementary ends on both molecules which base pair with each other and are then ligated together with DNA ligase. Alternatively, linkers can be ligated to the insert DNA which correspond to a restriction site in the vector DNA, which is then digested with the restriction enzyme which cuts at that site. Other means are also available and known to an ordinary skilled practitioner. In one embodiment, a rat PEG-3 sequence is cloned in the EcoRI site of a pZeoSV vector. The resulting plasmid, designated pPEG-3, was deposited on March 5, 1997 with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, U.S.A. under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure.

Vectors as described herein may generally be transfected into a suitable host cell, such as a mammalian cell, by methods well-known in the art. Such methods include calcium phosphate precipitation, electroporation and microinjection.

PROGRESSION-ASSOCIATED POLYPEPTIDES

Polypeptides within the scope of the present invention comprise at least a portion of a progression-associated protein or variant thereof, where the portion or variant thereof is immunologically and/or biologically active. A polypeptide may further comprise additional sequences, which may or may not be derived from a native progression-associated protein. Such sequences may (but need not) possess immunogenic or antigenic properties and/or a biological activity.

A polypeptide is "immunologically active," within the context of the present invention if it is recognized (i.e., specifically bound) by a B-cell and/or T-cell surface antigen receptor. Immunological activity may generally be assessed using well known techniques, such as those summarized in Paul, Fundamental Immunology, 3rd ed., 243-247 (Raven Press, 1993) and references cited therein. Such techniques include screening polypeptides derived from the native polypeptide for the ability to react with antigen-specific antisera and/or T-cell lines or clones, which may be prepared using well known techniques. An immunologically active portion of a progression-associated protein reacts with such antisera and/or T-cells at a level that is not substantially lower than the reactivity of the full length polypeptide (e.g., in an ELISA and/or T-cell reactivity assay). Such screens may generally be performed using methods well known to those of ordinary skill in the art, such as those described in Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. B-cell and T- cell epitopes may also be predicted via computer analysis.

Similarly, a polypeptide is "biologically active" if it possesses one or more structural, regulatory and/or biochemical functions of the native progression- associated protein. For example, a polypeptide may induce progression in cells at levels comparable to the level of native protein. Appropriate assays designed to evaluate the activity may then be designed based on existing assays known in the art, and on the assays provided herein.

As noted above, polypeptides may comprise one or more portions of a variant of an endogenous protein, where the portion is immunologically and/or biologically active (i.e., the portion exhibits one or more antigenic, immunogenic and/or biological properties characteristic of the full length protein). Preferably, such a portion is at least as active as the full length protein within one or more assays to detect such properties. A polypeptide "variant," as used herein, is a polypeptide that differs from a native protein in substitutions, insertions, deletions and/or amino acid modifications, such that the antigenic, immunogenic and/or biological properties of the native protein are not substantially diminished. A variant preferably retains at least 80%) sequence identity to a native sequence, more preferably at least 90% identity, and even more preferably at least 95% identity. Guidance in determining which and how many amino acid residues may be substituted, inserted, deleted and/or modified without diminishing immunological and/or biological activity may be found using any of a variety of computer programs known in the art, such as DNAStar software. Properties of a variant may generally be evaluated by assaying the reactivity of the variant with antisera and/or T-cells as described above and/or evaluating a biological property characteristic of the native protein.

Preferably, a variant contains conservative substitutions. A "conservative substitution" is one in which an amino acid is substituted for another amino acid that has similar properties, such that one skilled in the art of peptide chemistry would expect the secondary structure and hydropathic nature of the polypeptide to be substantially unchanged. Amino acid substitutions may generally be made on the basis of similarity on polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; and serine, threonine, phenylalanine and tyrosine. Other groups of amino acids that may represent conservative changes include: (1) ala, pro, gly, glu, asp, gin, asn, ser, thr; (2) cys, ser, tyr, thr; (3) val, ile, leu, met, ala, phe; (4) lys, arg, his; and (5) phe, tyr, tip, his. A variant may also, or alternatively, contain nonconservative changes.

Variants within the scope of this invention also include polypeptides in which the primary amino acid structure of a native protein is modified by forming covalent or aggregative conjugates with other polypeptides or chemical moieties such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives may be prepared, for example, by linking particular functional groups to amino acid side chains or at the N- or C-termini. The present invention also includes polypeptides with or without associated native-pattern glycosylation. Polypeptides expressed in yeast or mammalian expression systems may be similar to or slightly different in molecular weight and glycosylation pattern than the native molecules, depending upon the expression system. Expression of DNA in bacteria such as E. coli provides non-glycosylated molecules. N- glycosylation sites of eukaryotic proteins are characterized by the amino acid triplet Asn-Aj-Z, where A_j is any amino acid except Pro, and Z is Ser or Thr. Variants having inactivated N-glycosylation sites can be produced by techniques known to those of ordinary skill in the art, such as oligonucleotide synthesis and ligation or site-specific mutagenesis techniques, and are within the scope of this invention. Alternatively, N- linked glycosylation sites can be added to a polypeptide. As noted above, polypeptides may further comprise sequences that are not related to an endogenous progression-associated protein. For example, an N- terminal signal (or leader) sequence may be present, which co-translationally or post- translationally directs transfer of the polypeptide from its site of synthesis to a site inside or outside of the cell membrane or wall (e.g., the yeast α-factor leader). The polypeptide may also comprise a linker or other sequence for ease of synthesis, purification or identification of the polypeptide (e.g., poly-His or hemagglutinin), or to enhance binding of the polypeptide to a solid support. Fusion proteins capped with such peptides may also be resistant to intracellular degradation in E. coli. Protein fusions encompassed by this invention further include, for example, polypeptides conjugated to an immunoglobulin Fc region or a leucine zipper domain as described, for example, in published PCT Application WO 94/10308. Polypeptides comprising leucine zippers may, for example, be oligomeric, dimeric or trimeric. All of the above protein fusions may be prepared by chemical linkage or as fusion proteins, as described below.

Also included within the present invention are alleles of a progression- associated protein. Alleles are alternative forms of a native protein resulting from one or more genetic mutations (which may be amino acid deletions, additions and/or substitutions), resulting in an altered mRNA. Allelic proteins may differ in sequence, but overall structure and function are substantially similar.

Progression-associated polypeptides, variants and portions thereof may generally be prepared from nucleic acid encoding the desired polypeptide using well known techniques. To prepare an endogenous protein, an isolated cDNA may be used. To prepare a variant polypeptide, standard mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis may be used, and sections of the DNA sequence may be removed to permit preparation of truncated polypeptides. Briefly, host cells of a vector system containing a PEG-3 sequence under suitable conditions permitting production of the polypeptide may be grown, and the polypeptide so produced may then be recovered. In general, any of a variety of expression vectors known to those of ordinary skill in the art may be employed to express recombinant polypeptides of this invention. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a DNA sequence that encodes a recombinant polypeptide. Suitable host cells include prokaryotes, yeast, insect cells and animal cells. Preferably, the host cells employed are E. coli, yeast, primary mammalian cells or a mammalian cell line such as COS, Vero, HeLa, fibroblast NIH3T3, CHO, Ltk^' or CV1. Following expression, supernatants from host/vector systems which secrete recombinant protein or polypeptide into culture media may be first concentrated using a commercially available filter. Following concentration, the concentrate may be applied to a suitable purification matrix such as an affinity matrix or an ion exchange resin. One or more reverse phase HPLC steps can be employed to further purify a recombinant polypeptide.

Portions and other variants having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may also be generated by synthetic means, using techniques well known to those of ordinary skill in the art. For example, such polypeptides may be synthesized using any of the commercially available solid- phase techniques, such as the Merrifield solid-phase synthesis method, where amino acids are sequentially added to a growing amino acid chain. See Merrifield, J. Am. Chem. Soc. 55:2149-2146, 1963. Various modified solid phase techniques are also available (e.g., the method of Roberge et al., Science 169:202-204, 1995). Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Applied BioSystems, Inc. (Foster City, CA), and may be operated according to the manufacturer's instructions. In general, polypeptides and polynucleotides as described herein are isolated. An "isolated" polypeptide or polynucleotide is one that is removed from its original environment. For example, a naturally-occurring protein is isolated if it is separated from some or all of the coexisting materials in the natural system. A polynucleotide is considered to be isolated if, for example, it is cloned into a vector that is not a part of the natural environment. ANTIBODIES AND FRAGMENTS THEREOF

The present invention further provides antibodies, and antigen-binding fragments thereof, that specifically bind to a progression-associated protein. As used herein, an antibody, or antigen-binding fragment, is said to "specifically bind" to a progression-associated protein if it reacts at a detectable level (within, for example, an ELISA) with a progression-associated protein or a portion or variant thereof, and does not react detectably with unrelated proteins. For certain embodiments, antibodies that inhibit PEG-3 induced progression are preferred. Antibodies may be prepared by any of a variety of techniques known to those of ordinary skill in the art. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. In general, antibodies can be produced by cell culture techniques, including the generation of monoclonal antibodies as described herein, or via transfection of antibody genes into suitable bacterial or mammalian cell hosts, in order to allow for the production of recombinant antibodies. Alternatively, monoclonal antibodies may be produced by in vitro techniques known to a person of ordinary skill in the art.

Polypeptides comprising specific portions of a PEG-3 protein may be selected for the generation of antibodies using methods well known in the art. In general, hydrophilic regions are more immunogenic than the hydrophobic regions. Such hydrophilic portions may be preferred for the generation of antibodies.

In one such technique, an immunogen comprising the polypeptide is initially injected into any of a wide variety of mammals (e.g., mice, rats, rabbits, sheep or goats). In this step, the polypeptides of this invention may serve as the immunogen without modification. Alternatively, particularly for relatively short polypeptides, a superior immune response may be elicited if the polypeptide is joined to a carrier protein, such as bovine serum albumin or keyhole limpet hemocyanin. The immunogen is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and the animals are bled periodically. Polyclonal antibodies specific for the polypeptide may then be purified from such antisera by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.

Monoclonal antibodies specific for the antigenic polypeptide of interest may be prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol. 6:511-519, 1976, and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the polypeptide of interest). Such cell lines may be produced, for example, from spleen cells obtained from an animal immunized as described above. The spleen cells are then immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngeneic with the immunized animal. A variety of fusion techniques may be employed. For example, the spleen cells and myeloma cells may be combined with a nonionic detergent for a few minutes and then plated at low density on a selective medium that supports the growth of hybrid cells, but not myeloma cells. A preferred selection technique uses HAT (hypoxanthine, aminopterin, thymidine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and their culture supernatants tested for binding activity against the polypeptide. Hybridomas having high reactivity and specificity are preferred.

Monoclonal antibodies may be isolated from the supernatants of growing hybridoma colonies. In addition, various techniques may be employed to enhance the yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies may then be harvested from the ascites fluid or the blood. Contaminants may be removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and extraction. The antibodies of this invention may be used in the purification process in, for example, an affinity chromatography step. Antibodies with a high degree of specificity for PEG-3 may then be selected. Such antibodies may be used, for example, to detect the expression of PEG-3 in living animals, in humans, or in biological tissues or fluids isolated from animals or humans. Within certain embodiments, the use of antigen-binding fragments of antibodies may be preferred. Such fragments include Fab fragments, which may be prepared using standard techniques. Briefly, immunoglobulins may be purified from rabbit serum by affinity chromatography on Protein A bead columns (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988) and digested by papain to yield Fab and Fc fragments. The Fab and Fc fragments may be separated by affinity chromatography on protein A bead columns.

METHODS FOR IDENTIFYING MODULATING AGENTS The present invention further provides methods for identifying compounds that modulate the activity of a progression-associated protein. Such agents may generally be identified by contacting a polypeptide as provided herein with a candidate compound or agent under conditions and for a time sufficient to allow interaction with the polypeptide. Any of a variety of well known binding assays may then be performed to assess the ability of the candidate compound to bind to the polypeptide, and assays for a biological activity of the polypeptide may be performed to identify agents that modulate (i.e., enhance or inhibit) the biological activity of the protein. Depending on the design of the assay, a polypeptide may be free in solution, affixed to a solid support, present on a cell surface or located intracellularly. Large scale screens may be performed using automation.

Alternatively, compounds may be screened for the ability to modulate expression (e.g., transcription) of a progression-associated protein, such as PEG-3. For such assays a promoter for PEG-3 may be isolated using standard techniques. The present invention provides nucleic acid molecules comprising such a promoter or a cis- or trans-acting regulatory element thereof. Such regulatory elements may activate or suppress expression of PEG-3.

One method for identifying a promoter region uses a PCR-based method to clone unknown genomic DNA sequences adjacent to a known cDNA sequence (e.g., a human PromoterFinder™DNA Walking Kit, available from Clontech). This approach may generate a 5' flanking region, which may be subcloned and sequenced using standard methods. Primer extension and/or RNase protection analyses may be used to verify the transcriptional start site deduced from the cDNA.

To define the boundary of the promoter region, putative promoter inserts of varying sizes may be subcloned into a heterologous expression system containing a suitable reporter gene without a promoter or enhancer may be employed. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase or the Green Fluorescent Protein gene, and may be generated using well known techniques. Internal deletion constructs may be generated using unique internal restriction sites or by partial digestion of non-unique restriction sites. Constructs may then be transfected into cells that display high levels of PEG-3 expression (e.g., El 1-NMT). In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the PEG-3 gene promoter.

Once a functional PEG-3 promoter is identified, cis- and trans-acting elements may be located. Cis-acting sequences may generally be identified based on homology to previously characterized transcriptional motifs. Point mutations may then be generated within the identified sequences to evaluate the regulatory role of such sequences. Such mutations may be generated using site-specific mutagenesis techniques or a PCR-based strategy. The altered promoter is then cloned into a reporter gene expression vector, as described above, and the effect of the mutation on reporter gene expression is evaluated. Trans-acting factors that bind to cis-acting sequences may be identified using assays such as gel shift assays. Proteins displaying binding activity within such assays may be partially digested, and the resulting peptides separated and sequenced. Peptide sequences may be used to design degenerate primers for use within RT-PCR to identify cDNAs encoding the trans-acting factors.

To evaluate the effect of a candidate agent on PEG-3 expression, a promoter or regulatory element thereof may be operatively linked to a reporter gene as described above. Such a construct may be transfected into a suitable host cell, such as El l-NMT or transfected forms of CREF Trans 6, including CREF-Trans 6:4NMT (expressing PTI-1), T24 (expressing ras), CREF-src (expressing src) and CREF-HPV (expressing HPV). It has been found, within the context of the present invention, that the PEG-3 promoter is constitutively expressed in tumor cell lines, but not in normal cells. Clones that constitutively express high levels of reporter protein may be selected and used within a variety of screens. Such clones are encompassed by the present invention.

Within one preferred screen, cells may be used to screen a combinatorial small molecule library. Briefly, cells are incubated with the library (e.g., overnight). Cells are then lysed and the supernatant is analyzed for reporter gene activity according to standard protocols. Compounds that result in a decrease in reporter gene activity are inhibitors of PEG-3 transcription, and may be used to inhibit angiogenesis.

This invention further provides methods for identifying agents capable of inducing angiogenesis. Briefly, candidate compounds may be tested as described above, except that the cells employed (which comprise a PEG-3 promoter or regulatory element thereof operatively linked to a reporter gene) are not in progression. For example, CREF-Trans 6 cells may be employed. Within such assays, an increase in expression of the reporter gene after the contact indicates that the compound is capable of inducing angiogenesis.

PHARMACEUTICAL COMPOSITIONS AND VACCINES Within certain aspects, compounds such as polypeptides, antibodies, nucleic acid molecules and/or other agents that modulate PEG-3 expression or activity may be incorporated into pharmaceutical compositions or vaccines. Pharmaceutical compositions comprise one or more such compounds and a physiologically acceptable carrier. Certain vaccines may comprise one or more polypeptides and an immune response enhancer, such as an adjuvant or a liposome (into which the compound is incorporated). Pharmaceutical compositions and vaccines may additionally contain a delivery system, such as biodegradable microspheres which are disclosed, for example, in U.S. Patent Nos. 4,897,268 and 5,075,109. Pharmaceutical compositions and vaccines within the scope of the present invention may also contain other compounds, which may be biologically active or inactive. A pharmaceutical composition or vaccine may contain DNA encoding an antisense polynucleotide or a polypeptides as described above, such that the polynucleotide or polypeptide is generated in situ. The DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacteria and viral expression systems. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal). Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette-Guerriή) that expresses an immunogenic portion of the polypeptide on its cell surface. In a preferred embodiment, the DNA may be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus. Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill in the art. The DNA may also be "naked," as described, for example, in Ulmer et al., Science 259:1745-1749, 1993 and reviewed by Cohen, Science 259:1691-1692, 1993. The uptake of naked DNA may be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells.

While any suitable carrier known to those of ordinary skill in the art may be employed in the pharmaceutical compositions of this invention, the type of carrier will vary depending on the mode of administration. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, saline and buffered media. Compositions of the present invention may be formulated for any appropriate manner of administration, including for example, topical, oral, nasal, intravenous, intracranial, intraperitoneal, subcutaneous or intramuscular administration. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. For parenteral administration, such as subcutaneous injection, the carrier preferably comprises water, saline, alcohol, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, a fixed oil, a fat, a wax or a buffer. For oral administration, any of the above carriers or a solid carrier, such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, and magnesium carbonate, may be employed. Biodegradable microspheres (e.g., polylactate polyglycolate) may also be employed as carriers for the pharmaceutical compositions of this invention. For certain topical applications, formulation as a cream or lotion, using well known components, is preferred.

Such compositions may also comprise buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide) and/or preservatives. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like. Compositions of the present invention may also be formulated as a lyophilizate. Compounds may also be encapsulated within liposomes using well known technology.

Any of a variety of adjuvants may be employed in the vaccines of this invention to nonspecifically enhance the immune response. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a stimulator of immune responses, such as lipid A, Bortadella pertussis or Mycobacteήum tuberculosis derived proteins. Suitable adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, MI), Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ), alum, biodegradable microspheres, monophosphoryl lipid A and quil A. Cytokines, such as GM-CSF or interleukin-2, -7, or -12, may also be used as adjuvants.

The compositions described herein may be administered as part of a sustained release formulation (i.e., a formulation such as a capsule or sponge that effects a slow release of compound following administration). Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Sustained-release formulations may contain a polypeptide, polynucleotide or antibody dispersed in a carrier matrix and/or contained within a reservoir surrounded by a rate controlling membrane. Carriers for use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of cyclic peptide release. The amount of active compound contained within a sustained release formulation depends upon the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented. Compositions may also be administered within a targeted drug delivery system. For example, a liposome may be coated with a tumor-specific antibody, resulting in targeting to specific tumor cells and selective uptake by the targeted cells. Other mechanisms for targeting a specific cell type will be apparent to those of ordinary skill in the art.

MODULATION OF ANGIOGENESIS

It has been found, within the context of the present invention, that PEG-3 is an inducer of angiogenesis. Accordingly, pharmaceutical compositions comprising an agent that inhibits PEG-3 expression and/or activity function to inhibit angiogenesis. Such agents include antisense polynucleotides, ribozymes and small molecule inhibitors, which may generally be identified as described herein. One preferred method for inhibiting the expression of PEG-3 comprises providing an effective amount of antisense RNA in the cell. Such antisense technology can generally be used to control gene expression through triple-helix formation, which compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors or regulatory molecules (see Gee et al., In Huber and Carr, Molecular and Immunologic Approaches, Futura Publishing Co. (Mt. Kisco, NY; 1994). Alternatively, an antisense molecule may be designed to hybridize with a control region of a gene (e.g., promoter, enhancer or transcription initiation site), and block transcription of the gene; or to block translation by inhibiting binding of a transcript to ribosomes. In general, expression of PEG-3 may be eliminated by deleting the gene or introducing mutation(s) into the gene.

Compounds and compositions provided herein may generally be used to modulate angiogenesis within any of a variety of contexts. To confirm the ability of a compound to modulate angiogenesis, any suitable assay known in the art may be used. For example, the effect of a compound on expression of a known angiogenic factor (e.g., VEGF) may be assessed. Such assays may be performed using any well known technique, and may involve evaluating the effect on (1) the level of mRNA encoding the angiogenic factor (e.g., via standard hybridization or PCR assays), (2) the rate of transcription of mRNA encoding the angiogenic factor (e.g., via nuclear run on studies) and/or (3) the amount of angiogenic factor secreted by the cells. In general, within such assays, cells treated with the candidate compound (or transfected with a candidate polynucleotide) are compared to untreated or untransfected cells. Compounds and compositions that result in a statistically significant change in expression of an angiogenic factor are considered modulators of angiogenesis.

Other assays that may be employed include assays that directly evaluate the effect of a compound on the number of microvessels in, for example, a tumor. Such assays may be performed using standard techniques, such as immunohistological studies, which may be confirmed by immunostaining for markers such as CD31 and/or Factor VII.

To modulate angiogenesis in vitro, cells are generally contacted with an agent as described herein under conditions and for a time sufficient to effect modulation of angiogenesis. To modulate angiogenesis in vivo, an agent as described herein may be administered to a patient. Within such aspects, the compounds (which may be polypeptides, antibodies, nucleic acid molecules or other modulating agents) are preferably incorporated into pharmaceutical compositions, as described above. A suitable patient for therapy may be any warm-blooded animal, preferably a human. A patient may or may not be afflicted with cancer, as determined by standard diagnostic methods. Accordingly, the above pharmaceutical compositions and vaccines may be used to prevent the development of cancer or to treat a patient afflicted with cancer. Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The route, duration and frequency of administration will be determined by such factors as the condition of the patient, the type and severity of the patient's disease and the method of administration. Routes and frequency of administration may vary from individual to individual, and may be readily established using standard techniques. In general, the pharmaceutical compositions and vaccines may be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration), rectally or orally. Alternatively, a composition may be administered in a local, rather than systemic manner (e.g., by injection into a solid tumor). Preferably, between 1 and 10 doses may be administered over a 52 week period. Preferably, 6 doses are administered, at intervals of 1 month, and booster vaccinations may be given periodically thereafter. Alternate protocols may be appropriate for individual patients.

In general, an appropriate dosage and treatment regimen provides the active compound(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (e.g., an amount capable of inhibiting tumor cell angiogenesis). Such a benefit should results in an improved clinical outcome (e.g., more frequent remissions, complete or partial, or longer disease-free survival) in treated patients as compared to non-treated patients. Appropriate dosages of polypeptides, polynucleotides, antibodies and modulating agents may generally be determined using experimental models and/or clinical trials. In general, the use of the minimum dosage that is sufficient to provide effective therapy is preferred. Patients may generally be monitored for therapeutic effectiveness using assays suitable for the condition being treated or prevented, which will be familiar to those of ordinary skill in the art. Suitable dose sizes will vary with the size of the patient, but will typically range from about 0.1 mL to about 5 mL.

CANCER THERAPY

In further aspects of the present invention, the compounds described herein may be used for therapy of cancer. Within such aspects, the compounds (which may be polypeptides, antibodies, nucleic acid molecules or other modulating agents) are preferably incorporated into pharmaceutical compositions or vaccines, as described above. Suitable patients for therapy may be any warm-blooded animal, preferably a human. A patient may or may not be afflicted with cancer, as determined by standard diagnostic methods. Accordingly, the above pharmaceutical compositions and vaccines may be used to prevent the development of cancer or to treat a patient afflicted with cancer.

Within certain aspects, cells may be protected from therapeutic damage (e.g., due to chemotherapy or a physical agent such as gamma-irradiation) and/or rendered resistant to progression by inhibiting or eliminating the expression and/or activity of PEG-3 in the cells. One preferred method for inhibiting the expression of PEG-3 comprises providing an effective amount of antisense RNA in the cell. Such antisense technology can generally be used to control gene expression through triple- helix formation, which compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors or regulatory molecules (see Gee et al., In Huber and Carr, Molecular and Immunologic Approaches, Futura Publishing Co. (Mt. Kisco, NY; 1994). Alternatively, an antisense molecule may be designed to hybridize with a control region of a gene (e.g., promoter, enhancer or transcription initiation site), and block transcription of the gene; or to block translation by inhibiting binding of a transcript to ribosomes. In general, the expression of PEG-3 may be eliminated by deleting the gene or introducing mutation(s) into the gene.

Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The route, duration and frequency of administration will be determined by such factors as the condition of the patient, the type and severity of the patient's disease and the method of administration, as discussed above. In general, an appropriate dosage and treatment regimen provides the active compound(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (e.g., an amount capable of inhibiting tumor cell angiogenesis). Such a benefit should results in an improved clinical outcome (e.g., more frequent remissions, complete or partial, or longer disease-free survival) in treated patients as compared to non-treated patients.

CANCER DETECTION, DIAGNOSIS AND MONITORING Polypeptides, polynucleotides and antibodies, as described herein, may be used within a variety of methods for detecting a cancer, determining whether a cancer is in progression, and monitoring the progression and/or treatment of a cancer in a patient. Within such methods, any of a variety of methods may be used to detect PEG-3 activity or the level of PEG-3 mRNA or protein in a sample. Suitable biological samples include tumor or normal tissue biopsy, mastectomy, blood, lymph node, serum or urine samples, or other tissue, homogenate or extract thereof obtained from a patient.

Methods involving the use of an antibody may detect the presence or absence of PEG-3 in any suitable biological sample. There are a variety of assay formats known to those of ordinary skill in the art for using an antibody to detect polypeptide markers in a sample. See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. For example, the assay may be performed in a Western blot format, wherein a protein preparation from the biological sample is submitted to gel electrophoresis, transferred to a suitable membrane and allowed to react with the antibody. The presence of the antibody on the membrane may then be detected using a suitable detection reagent, as described below.

In another embodiment, the assay involves the use of antibody immobilized on a solid support to bind to the polypeptide and remove it from the remainder of the sample. The bound polypeptide may then be detected using a second antibody or reagent that contains a reporter group. Alternatively, a competitive assay may be utilized, in which a polypeptide is labeled with a reporter group and allowed to bind to the immobilized antibody after incubation of the antibody with the sample. The extent to which components of the sample inhibit the binding of the labeled polypeptide to the antibody is indicative of the reactivity of the sample with the immobilized antibody, and as a result, indicative of the concentration of polypeptide in the sample. The solid support may be any material known to those of ordinary skill in the art to which the antibody may be attached. For example, the solid support may be a test well in a microtiter plate or a nitrocellulose filter or other suitable membrane. Alternatively, the support may be a bead or disc, such as glass, fiberglass, latex or a plastic material such as polystyrene or polyvinylchloride. The support may also be a magnetic particle or a fiber optic sensor, such as those disclosed, for example, in U.S. Patent No. 5,359,681.

The antibody may be immobilized on the solid support using a variety of techniques known to those in the art, which are amply described in the patent and scientific literature. In the context of the present invention, the term "immobilization" refers to both noncovalent association, such as adsorption, and covalent attachment (which may be a direct linkage between the antigen and functional groups on the support or may be a linkage by way of a cross-linking agent). Immobilization by adsorption to a well in a microtiter plate or to a membrane is preferred. In such cases, adsorption may be achieved by contacting the antibody, in a suitable buffer, with the solid support for a suitable amount of time. The contact time varies with temperature, but is typically between about 1 hour and 1 day. In general, contacting a well of a plastic microtiter plate (such as polystyrene or polyvinylchloride) with an amount of antibody ranging from about 10 ng to about 1 μg, and preferably about 100-200 ng, is sufficient to immobilize an adequate amount of polypeptide.

Covalent attachment of antibody to a solid support may also generally be achieved by first reacting the support with a bifunctional reagent that will react with both the support and a functional group, such as a hydroxyl or amino group, on the antibody. For example, the antibody may be covaiently attached to supports having an appropriate polymer coating using benzoquinone or by condensation of an aldehyde group on the support with an amine and an active hydrogen on the binding partner using well known techniques.

In certain embodiments, the assay for detection of polypeptide in a sample is a two-antibody sandwich assay. This assay may be performed by first contacting an antibody that has been immobilized on a solid support, commonly the well of a microtiter plate, with the biological sample, such that the polypeptide within the sample are allowed to bind to the immobilized antibody. Unbound sample is then removed from the immobilized polypeptide-antibody complexes and a second antibody (containing a reporter group) capable of binding to a different site on the polypeptide is added. The amount of second antibody that remains bound to the solid support is then determined using a method appropriate for the specific reporter group.

More specifically, once the antibody is immobilized on the support as described above, the remaining protein binding sites on the support are typically blocked. Any suitable blocking agent known to those of ordinary skill in the art, such as bovine serum albumin or Tween 20™ (Sigma Chemical Co., St. Louis, MO). The immobilized antibody is then incubated with the sample, and polypeptide is allowed to bind to the antibody. The sample may be diluted with a suitable diluent, such as phosphate-buffered saline (PBS) prior to incubation. In general, an appropriate contact time (i.e., incubation time) is that period of time that is sufficient to detect the presence of polypeptide within a sample obtained from an individual with cancer. Preferably, the contact time is sufficient to achieve a level of binding that is at least 95% of that achieved at equilibrium between bound and unbound polypeptide. Those of ordinary skill in the art will recognize that the time necessary to achieve equilibrium may be readily determined by assaying the level of binding that occurs over a period of time. At room temperature, an incubation time of about 30 minutes is generally sufficient.

Unbound sample may then be removed by washing the solid support with an appropriate buffer, such as PBS containing 0.1% Tween 20™. The second antibody, which contains a reporter group, may then be added to the solid support. Preferred reporter groups include enzymes (such as horseradish peroxidase), substrates, cofactors, inhibitors, dyes, radionuclides, luminescent groups, fluorescent groups and biotin. The conjugation of antibody to reporter group may be achieved using standard methods known to those of ordinary skill in the art.

The second antibody is then incubated with the immobilized antibody- polypeptide complex for an amount of time sufficient to detect the bound polypeptide. An appropriate amount of time may generally be determined by assaying the level of binding that occurs over a period of time. Unbound second antibody is then removed and bound second antibody is detected using the reporter group. The method employed for detecting the reporter group depends upon the nature of the reporter group. For radioactive groups, scintillation counting or autoradiographic methods are generally appropriate. Spectroscopic methods may be used to detect dyes, luminescent groups and fluorescent groups. Biotin may be detected using avidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups may generally be detected by the addition of substrate (generally for a specific period of time), followed by spectroscopic or other analysis of the reaction products.

To determine whether cells are in progression, expression of PEG-3 in the cells is evaluated and compared with the level of expression in cells that are not in progression. Briefly, the signal detected from the reporter group that remains bound to the solid support is generally compared to a signal that corresponds to a predetermined cut-off value established from cells that are not in progression. In one preferred embodiment, the cut-off value is the average mean signal obtained when the immobilized antibody is incubated with samples from cells that are not in progression. In general, a sample generating a signal that is three standard deviations above the predetermined cut-off value may be considered positive for progression. In an alternate preferred embodiment, the cut-off value is determined using a Receiver Operator Curve, according to the method of Sackett et al., Clinical Epidemiology: A Basic Science for Clinical Medicine, p. 106-7 (Little Brown and Co., 1985). Briefly, in this embodiment, the cut-off value may be determined from a plot of pairs of true positive rates (i.e., sensitivity) and false positive rates (100%-specificity) that correspond to each possible cut-off value for the diagnostic test result. The cut-off value on the plot that is the closest to the upper left-hand corner (i.e., the value that encloses the largest area) is the most accurate cut-off value, and a sample generating a signal that is higher than the cutoff value determined by this method may be considered positive. Alternatively, the cutoff value may be shifted to the left along the plot, to minimize the false positive rate, or to the right, to minimize the false negative rate. In general, a sample generating a signal that is higher than the cut-off value determined by this method is considered positive for progression.

In a related embodiment, the assay is performed in a flow-through or strip test format, wherein the antibody is immobilized on a membrane, such as nitrocellulose. In the flow-through test, the polypeptide within the sample bind to the immobilized antibody as the sample passes through the membrane. A second, labeled antibody then binds to the antibody-polypeptide complex as a solution containing the second antibody flows through the membrane. The detection of bound second antibody may then be performed as described above. In the strip test format, one end of the membrane to which antibody is bound is immersed in a solution containing the sample. The sample migrates along the membrane through a region containing second antibody and to the area of immobilized antibody. Concentration of second antibody at the area of immobilized antibody indicates the presence of cells in progression. Typically, the concentration of second antibody at that site generates a pattern, such as a line, that can be read visually. The absence of such a pattern indicates a negative result. In general, the amount of antibody immobilized on the membrane is selected to generate a visually discernible pattern when the biological sample contains a level of polypeptide that would be sufficient to generate a positive signal in the two-antibody sandwich assay, in the format discussed above. Preferably, the amount of antibody immobilized on the membrane ranges from about 25 ng to about 1 μg, and more preferably from about 50 ng to about 1 μg. Such tests can typically be performed with a very small amount of biological sample.

The presence or absence of cells in progression in a patient may also be determined by evaluating the level of mRNA encoding PEG-3 within the biological sample (e.g., a biopsy, mastectomy and/or blood sample from a patient) relative to a predetermined cut-off value. Such an evaluation may be achieved using any of a variety of methods known to those of ordinary skill in the art such as, for example, in situ hybridization and amplification by polymerase chain reaction. Probes and primers for use within such assays may generally be designed based on the sequences provided herein, or on similar sequences identified in other individuals. Probes may be used within well known hybridization techniques, and may be labeled with a detection reagent to facilitate detection of the probe. Such reagents include, but are not limited to, radionuclides, fluorescent dyes and enzymes capable of catalyzing the formation of a detectable product. Primers may generally be used within detection methods involving polymerase chain reaction (PCR), such as RT-PCR, in which PCR is applied in conjunction with reverse transcription. Typically, RNA is extracted from a sample tissue and is reverse transcribed to produce cDNA molecules. PCR amplification using specific primers generates a progression-associated cDNA molecule, which may be separated and visualized using, for example, gel electrophoresis. Amplification is typically performed on samples obtained from matched pairs of tissue (tumor and non- tumor tissue from the same individual) or from unmatched pairs of tissue (tumor and non-tumor tissue from different individuals). The amplification reaction may be performed on several dilutions of cDNA spanning two orders of magnitude. A two-fold or greater increase in expression in several dilutions of the tumor sample as compared to the same dilutions of the non-tumor sample is typically considered positive.

Within certain specific embodiments, expression of PEG-3 may be detected in a sample that contains cells by: (a) obtaining RNA from the cells; (b) contacting the RNA so obtained with a labeled (e.g., radioactively) probe of PEG-3 under hybridizing conditions permitting specific hybridization of the probe and the RNA; and (c) determining the presence of RNA hybridized to the molecule. As noted above, mRNA may be isolated and hybridized using any of a variety of procedures well-known to a person of ordinary skill in the art. The presence of mRNA hybridized to the probe may be determined by gel electrophoresis or other methods known in the art. By measuring the amount of the hybrid formed, the expression of the PEG-3 protein by the cell can be determined. Alternatively, RNA obtained from the cells may be amplified by polymerase chain reaction (PCR) with appropriate primers derived from a known PEG-3 sequence. The presence of specific amplified DNA following PCR is an indicative of PEG-3 expression in the cells. Certain in vivo diagnostic assays may be performed directly on the tumor. One such assay involves contacting tumor cells with an antibody or fragment thereof that binds to a progression-associated protein. The bound antibody or fragment may then be detected directly or indirectly via a reporter group. Such antibodies may also be used in histological applications.

Within related aspects, the present invention provides methods for diagnosing the aggressiveness of cancer cells. Such methods are performed as described above, wherein an increase in the amount of the expression indicates that a cancer cell is more aggressive. In other aspects of the present invention, the progression and/or response to treatment of a cancer may be monitored by performing any of the above assays over a period of time, and evaluating the change in the level of the response (i.e., the amount of polypeptide or mRNA detected). For example, the assays may be performed every month to every other month for a period of 1 to 2 years. In general, a cancer is progressing in those patients in whom the level of the response increases over time. In contrast, a cancer is not progressing when the signal detected either remains constant or decreases with time.

The present invention further provides kits for use within any of the above diagnostic methods. Such kits typically comprise two or more components necessary for performing the assay. Such components may be compounds, reagents and/or containers or equipment. For example, one container within a kit may contain a monoclonal antibody or fragment thereof that specifically binds to a progression- associated polypeptide. Such antibodies or fragments may be provided attached to a support material, as described above. One or more additional containers may enclose elements, such as reagents or buffers, to be used in the assay. Such kits may also contain a detection reagent (e.g., an antibody) that contains a reporter group suitable for direct or indirect detection of antibody binding. TRANSGENIC ORGANISMS

The present invention also provides transgenic nonhuman living organism expressing PEG-3 protein. In an embodiment, the living organism is animal. One means available for producing a transgenic animal, with a mouse as an example, is as follows: Female mice are mated, and the resulting fertilized eggs are dissected out of their oviducts. The eggs are stored in an appropriate medium. PEG-3 DNA or cDNA is purified from a vector by methods well-known in the art. Inducible promoters may be fused with the coding region of the DNA to provide an experimental means to regulate expression of the trans-gene. Alternatively or in addition, tissue specific regulatory elements may be fused with the coding region to permit tissue- specific expression of the trans-gene. The DNA, in an appropriately buffered solution, is put into a microinjection needle (which may be made from capillary tubing using a pipes puller) and the egg to be injected is put in a depression slide. The needle is inserted into the pronucleus of the egg, and the DNA solution is injected. The injected egg is then transferred into the oviduct of a pseudopregnant mouse (a mouse stimulated by the appropriate hormones to maintain pregnancy but which is not actually pregnant), where it proceeds to the uterus, implants, and develops to term. As noted above, microinjection is not the only method for inserting DNA into the egg cell, and is used here only for exemplary purposes.

From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims. EXAMPLES

Example 1 Identification and Characterization of Rat PEG-3 This Example illustrates the cloning of PEG-3, which is associated with transformation progression in virus and oncogene transformed rat embryo cells.

A. Cell Lines, Culture Conditions and Anchorage-Independent Growth Assays

The isolation, properties and growth conditions of the El l, El l-NMT, El 1-NMT X CREF somatic cell hybrids, Ell X Ell-NMT somatic cell hybrids and the El l-NMT AZA clones have been described (Fisher, P. B. in T.J. Slaga, ed., Tumor Promotion and Cocarcinogenesis In vitro, Mechanisms of Tumor Promotion, ed. (CRC Press, Boca Raton, FL), pp. 57-123, 1984; Fisher et al., Cancer Res. 39:3051-3057, 1979; Fisher et al., Nature 257:591-594, 1979; Fisher et al., Ce/7 18:695-105, 1979; Babiss et al, Science 225:1099-1101, 1985; Duigou et al., Mol. Cell. Biol. 10:2027- 2034, 1990; Duigou et al., Oncogene (5:1813-1824, 1991; Reddy et al., in K.W. Adolph, ed., Chromosome and Genetic Analysis, Methods in Molecular Genetics (Academic, Orlando, FL), Vol. 1, pp. 68-102, 1993). Ell-rαs R12 and El 1-HPV E6/E7 clones were isolated by transfection with the Ha-ras or the HPV-18 E6/E7 genes, respectively. The isolation, properties and growth conditions of CREF, CREF-H5hrl A2, CREF-rαs, the CREF-ras/Krevl Bl, Bl T and Bl M and the CREF-rαs/Krevl B2, B2 T, and B2 M clones have been described (Su et al., Oncogene 5:309-318, 1993). CREF-src and CREF-HPV 18 clones were isolated by transfection with the v-src and HPV-18 E6/E7 genes, respectively. All cells were grown in Dulbecco's modified Eagle's minimum essential medium supplemented with 5% fetal bovine serum at 37°C in a 5% CO₂ plus 95% air humidified incubator. Anchorage independence assays were performed by seeding various cell densities in 0.4% Noble agar on a 0.8% agar base layer both of which contain growth medium (Fisher et al., Cancer Res. 39:3051-3057, 1979).

In the Ad5 transformed RE cell culture model system, enhanced anchorage-independent growth and in vivo tumorigenic aggressiveness, i.e., markers of the progression phenotype, are stable traits that can be induced spontaneously or by gene transfer (oncogenes and growth factor-related genes) (Table 1).

TABLE 1

Expression of PEG-3 in Ad5 -transformed RE cells directly correlates with expression of the progression phenotype

"Cell line descriptions can be found within the text.

A Anncchhoorraaggee--iinnddeeppeennddeenntt ggrroowwtthh wwaass ddeetteerrmmiinneedd bbjy seeding variable numbers of cells in 0.4% agar on a 0.8% agar base layer. Results are the average number of colonies from 4 replicate plates + S.D. ^cTumorigenicity was determined by injecting nude mice with 2 X 10⁶ or 1 X 10⁷ (RE, CREF and CREF X El 1-NMT hybrids). Results are the number of animals with tumors per number of animals injected and the number in parentheses indicate average latency time in days, i.e., first appearance of a palpable tumor. N.T. = not tested. Prog^" = progression phenotype is not expressed; Prog⁺ = progression phenotype is expressed.

Upon treatment of progressed cells with AZA, the progression phenotype can be stably reversed. A reversion of progression also occurs following somatic cell hybridization of progressed cells with unprogressed Ad5 -transformed cells or with normal CREF cells. A further selection of these unprogressed Ad5 -transformed cells by injection into nude mice results in acquisition of the progressed phenotype following tumor formation and establishment in cell culture. These studies document that progression in this model system is a reversible process that can be stably produced by appropriate cellular manipulation. In this context, the Ad5 -transformed RE model represents an important experimental tool for identifying genes that are associated with and that mediate cancer progression.

B. Cloning and Sequencing of Rat PEG-3 cDNA

The PEG-3 gene was cloned from El l-NMT cells using subtraction hybridization as described (Jiang & Fisher, Mol. Cell. Different. 7:285-299, 1993). A full-length PEG-3 cDNA was obtained using the rapid amplification of cDNA end (RACE) procedure and direct ligation (Jiang et al., Oncogene 70:1855-1864, 1995; Jiang et al., Oncogene 77:2477-2486, 1995). Sequencing was performed by the dideoxy-chain termination (Sanger) method (Su et al., Cancer Res. 53:1929-1938, 1993). The coding region of PEG-3 was cloned into a pZeoSV vector (Invitrogen) as described (Jiang et al., Oncogene 70:1855-1864, 1995; Jiang et al., Oncogene 77:2477- 2486, 1995).

The PEG-3 gene displays sequence homology with the hamster gadd34 and mouse MyDl 16 genes. The cDNA sizes of PEG-3, gadd34 and MyDl 16 are 2210, 2088 and 2275 nt, respectively. The nt sequence of rat PEG-3 is -73% and the aa sequence is -59% homologous to the gadd34 gene (Fig. 3). PEG-3 also shares significant sequence homology, -68% nt and -72% aa, with the murine homologue of gadd34, MyDl 16 (Fig. 3). Differences are apparent in the structure of the 3' untranslated regions of PEG-3 versus gadd34/MyD116. ATTT motifs have been associated with mRNA destabilization. In this context, the presence of 3 ATTT sequences in Gadd34 and 6 tandem ATTT motifs in MyDl 16 would predict short half- lives for these messages. In contrast, PEG-3 contains only 1 ATTT motif suggesting that this mRNA may be more stable. The sequence homologies between PEG-3 and gadd34/MyD116 are highest in the amino terminal region of their encoded proteins, i.e., -69 and -76% homology with gadd34 and Mydllό, respectively, in the first 279 aa. In contrast, the sequence of the carboxyl terminus of PEG-3 significantly diverges from gadd34/Mydll6, i.e., only -28 and -40% homology in the carboxyl terminal 88 aa. In gadd34 and MyDl 16 a series of similar 39 aa are repeated in the protein, including 3.5 repeats in gadd34 and 4.5 repeats in MyDl 16. In contrast, PEG-3 contains only 1 of these 39 aa regions, with -64% and -85% homology to gadd34 and MyDl 16, respectively. On the basis of sequence analysis, the PEG-3 gene should encode a protein of 457 aa with a predicted MW of ~50kDa.

C. RNA Analysis and In vitro Transcription Assays

Total cellular RNA was isolated by the guanidinium/phenol extraction method and Northern blotting was performed as described by Jiang et al., Intl. J. Oncol. 7:227-239, 1992. Fifteen μg of RNA were denatured with glyoxal/DMSO and electrophoresed in 1% agarose gels, transferred to nylon membranes and hybridized sequentially with ³²P-labeled PEG-3, Ad5 El A and GAPDH probes (Jiang et al, Intl. J. Oncol. 7:227-239, 1992; Jiang et al, Proc. Natl. Acad. Sci. USA 93:9160-9165, 1996). Following hybridization, the filters were washed and exposed for autoradiography. The transcription rates of PEG-3, gadd34, MyDl 16, GAPDH and pBR322 was determined by nuclear run-on assays (Duigou et al., Oncogene (5:1813-1824, 1991; Su et al., Oncogene 5:309-318, 1993).

The results of the Northern blot analysis (Figure 1) indicate that PEG-3 expression is ≥ 10-fold higher in all progressed Ad5 -transformed RE cells, including El l-NMT, specific El l-NMT X CREF somatic cell hybrid clones, Rl and R2, expressing an aggressive transformed phenotype and specific El 1 X El 1-NMT somatic cell hybrid clones, such as Ila that display the progression phenotype (Fig. 1 and Table 1). PEG-3 mRNA levels also increase following induction of progression by stable expression of the Ha-ras and HPV-18 E6/E7 oncogenes in El 1 cells (Fig. 1). A further correlation between expression of PEG-3 and the progression phenotype is provided by El 1 X El 1-NMT clones, such as Hid and A6, that initially display a suppression of the progression phenotype and low PEG-3 expression, but regain the progression phenotype and PEG-3 expression following tumor formation in nude mice, i.e., IIIdTD and A6TD (Table 1 and Fig. 1). In contrast, unprogressed Ad5 -transformed cells, including El l, El l-NMT X CREF clones FI and F2, El l X El l-NMT clones Hid, A6 and 3b and AZA-treated El 1-NMT clones Bl, Cl and C2, have low levels of PEG-3 RNA. These results provide evidence for a direct relationship between the progression phenotype and PEG-3 expression in this Ad5 -transformed RE cell culture system. They also demonstrate that the final cellular phenotype, i.e., enhanced anchorage-independence and aggressive tumorigenic properties, is a more important determinant of PEG-3 expression than is the agent (oncogene) or circumstance (selection for tumor formation in nude mice) inducing progression.

A second rodent model used to study the process of cancer progression employs CREF clones modified by transfection to express dominant acting oncogenes (such as Ha-ras, v-src, HPV-18 and the mutant adenovirus H5hrl) and tumor suppressor genes (such as Krev-1, RB and wild-type p53). In this model system, Ha-ras- transformed CREF cells are morphologically transformed, anchorage-independent and induce both tumors and lung metastases in syngeneic rats and athymic nude mice. The Krev-1 (Ha-ras) suppressor gene reverses the in vitro and in vivo properties in Ha-ras transformed cells. Although suppression is stable in vitro, Ha-ras / Krev-1 CREF cells induce both tumors and metastases after extended times in nude mice. Expression of PEG-3 is not apparent in CREF cells, whereas tumorigenic CREF cells transformed by \-src, HPV-18, H5hrl and Ha-ras contain high levels of PEG-3 RNA (Fig. 2). Suppression of Ha-ras induced transformation by Krev-1 inhibits PEG-3 expression. However, when Ha-ras / Krev-1 cells escape tumor suppression and form tumors and metastases in nude mice, PEG-3 expression reappears, with higher expression in metastatic-derived than tumor-derived clones (Fig. 2). These findings provide further documentation of a direct relationship between induction of a progressed and oncogenic phenotype in rodent cells and PEG-3 expression. As indicated above, it is the phenotype rather than the inducing agent that appears to be the primary determinant of PEG-3 expression in rodent cells.

D. In vitro Translation of PEG-3

In vitro translation was performed to confirm the predicted molecular weight of PEG-3. The plasmid pZeoSV, containing PEG-3 cDNA, was linearized by digestion with Xho I and used as a template to synthesize mRNA. In vitro translation of PEG-3 mRNA was performed with a rabbit relticulocyte lysate translation kit as described by Promega (Madison, WI).

The results are presented in Figure 4. A predominant protein after in vitro translation of PEG-3 has a molecular mass of ~50kDa. In contrast, gadd34 encodes a predicted protein of 589 aa with an M_w of ~65kDa and MyDl 16 encodes a predicted protein of 657 aa with an M_w of ~72kDa. The profound similarity in the structure of PEG-3 versus gadd34/MyD116 cDNA and their encoded proteins suggest that PEG-3 is a new member of this gene family. Moreover, the alterations in the carboxyl terminus of PEG-3 may provide a functional basis for the different properties of this gene versus gadd34/MyDl 16.

E. DNA Transfection Assays

To study the effect of PEG-3 on monolayer colony formation the Zeocin expression vector (pZeoSV) containing no insert or a pZeoSV-PEG-3 construct containing the PEG-3 coding region were transfected into the various cell types by the lipofectin method (GIBCO/BRL) and Zeocin resistant clones were isolated or efficiency of Zeocin colony formation was determined (Jiang et al., Proc. Natl. Acad. Sci. USA 93:9160-9165, 1996; Su et al., Mol. Carcinog 4:231-242, 1991).

El 1 and El 1-NMT cells were transfected with the protein coding region of the PEG-3 gene cloned into pZeoSV (Fig. 6). This construct permits an evaluation of growth in Zeocin in the presence and absence of PEG-3 expression. El 1 and El 1-NMT cells were also transfected with the p21 (mda-6) and mda-1 genes, previously shown to display growth inhibitory properties. Colony formation in both El l and El l-NMT cells is suppressed 10 to 20%, whereas the relative colony formation following p21 (mda-6) and mda-1 transfection is decreased by 40 to 58% (Fig. 6). Colony formation is also reduced by 10 to 20%) when PEG-3 is transfected into CREF, normal human breast (HBL-100) and human breast carcinoma (MCF-7 and T47D) cell lines. Although the gadd and MyD genes were not tested for growth inhibition in El l or El l-NMT cells, previous studies indicate colony formation reductions of >50 to 75% in several cell types transfected with gadd34, gadd45, gaddl53, MyDl 16 or MyDl 18. The lack of dramatic growth suppressing effects of PEG-3 and its direct association with the progression state suggest that this gene may represent a unique member of this acidic protein gene family that directly functions in regulating progression. This may occur by constitutively inducing signals that would normally only be generated during genomic stress. In this context, PEG-3 might function to alter genomic stability and facilitate tumor progression.

F. PEG-3 is Inducible by DNA Damage

Like hamster gadd34 and its murine homologue MyDl 16, PEG-3 steady-state mRNA and RNA transcriptional levels are increased following DNA damage by methyl methanesulfonate (MMS) and gamma irradiation (λlR) (Figs. 2 and 5). In contrast, nuclear run-on assays indicate that only the PEG-3 gene is transcriptionally active (transcribed) as a function of transformation progression (Fig. 5). This is apparent in CREF cells transformed by Ha-ras and in El l-NMT and various El l-NMT subclones either expressing or not expressing the progression phenotype (Fig. 5). The gadd34/MyD116 gene, as well as the gadd45, MyDl 18 and gadd 153 genes, encode acidic proteins with very similar and unusual charge characteristics. PEG-3 also encodes a putative protein with acidic properties similar to the gadd and MyD genes (Fig. 3). The carboxyl-terminal domain of the murine MyDl 16 protein is homologous to the corresponding domain of the herpes simplex virus 1 γ, 134.5 protein, that prevents the premature shutoff of total protein synthesis in infected human cells. Replacement of the carboxyl-terminal domain of γ,34.5 with the homologous region from MyDl 16 results in a restoration of function to the herpes viral genome, i.e., prevention of early host shutoff of protein synthesis. The carboxyl terminus of PEG-3 is significantly different than that of MyDl 16 (Fig. 3). Moreover, the carboxyl-terminal domain region of homology between MyDl 16 and the γ,34-5 protein is not present in PEG-3. In this context, the localization, protein interactions and properties of PEG-3 may be distinct from gadd and MyD genes.

G. PEG-3 Induces a Progression Phonotype in Ad5 -transformed RE Cells

An important question is whether PEG-3 expression simply correlates with transformation progression or whether it can directly contribute to this process. To distinguish between these two possibilities we have determined the effect of stable elevated expression of PEG-3 on expression of the progression phenotype in El l cells. Ell cells were transfected with a Zeocin expression vector either containing or lacking the PEG-3 gene and random colonies were isolated and evaluated for anchorage independent growth (Fig. 7). A number of clones were identified that display a 5- to 9- fold increase in agar cloning efficiency in comparison with El 1 and El 1 -Zeocin vector transformed clones. To confirm that this effect was indeed the result of elevated PEG-3 expression, independent Zeocin resistant Ell clones either expressing or not expressing the progression phenotype were analyzed for PEG-3 mRNA expression (Fig. 8). This analysis indicates that elevated anchorage-independence in the El l clones correlates directly with increased PEG-3 expression. In contrast, no change in Ad5 El A or GAPDH mRNA expression is detected in the different clones. These findings demonstrate that PEG-3 can directly induce a progression phenotype without altering expression of the Ad5 El A transforming gene. Example 2 Identification of Human PEG-3 This Example illustrates the identification of a human PEG-3 cDNA molecule. Initially, PEG-3 gene expression was examined in various human tumor cell lines using a rat PEG-3 cDNA 3 '-end fragment as a probe under low stringency conditions. Hybridization was performed at 65°C overnight in the following solution: 800 μl of 5M NaCl, 80 μl of 0.5M EDTA, 2 ml of 1M Na(PO₄) (pH 6.4), 10 ml 10% SDS, 23.12 ml H2O, for a total of 40 ml. Following hybridization, washing was performed in lx SSC, 0.1%SDS at room temperature for 15 minutes, and then twice at 65°C for 30 minutes. Overnight exposures indicated that the MCF-7 cell line highly expresses a human PEG-3 homolog and MCF-7 was used to provide mRNA resources for the establishment of a cDNA library.

To establish an MCF-7 cDNA library, poly (A") RNA was extracted and purified of from MCF-7 cells, and cDNA was generated using oligo (dT) as a primer through reverse transcription. λBk-MCV was used as a vector to generate cDNA library. The original MCF-7 cDNA library was generated with 1 x 10⁶ pfu and insert size was about 0.4 Kb - 4 Kb.

The MCF-7 cDNA library was screened using a 600 bp rat PEG-3 cDNA 3'-end fragment as a probe at low stringency. Prehybridization and hybridization were performed in the following solution:

100%> Formamide 50 ml

20X SSC 25 ml

50X Denhardt's 10 ml l m Na(PO₄) (pH 6.8) 5 ml

100 mg/ml SSDNA 1ml

10% SDS 1ml

H₂0 8 ml

100 ml Hybridization was performed at 42°C overnight. Washing was performed in IX SSC, 0.1% SDS at room temperature for 15 minutes, and then twice at 65°C for 30 minutes. Exposures were performed overnight.

Twenty-five positive clones were isolated from the MCF-7 cDNA library using the above condition through primary screening, secondary screening, and third screening. After restriction mapping and sequencing, all 25 positive clones were confirmed to have an insert of human PEG-3 cDNA 3'-end. The size for all these inserts was about 400 - 500 bp.

Northern blots were performed to evaluate the human PEG-3 gene expression pattern in normal human tissues and human tumor cell lines, using a 400 bp human PEG-3 cDNA 3'-end fragment as a probe.

Hybridization was performed at 65 °C overnight in the following solution: 800 μl of 5M NaCl, 80 μl of 0.5M EDTA, 2 ml of 1M Na(PO₄) (pH 6.4), 10 ml 10% SDS, 23.12 ml H2O, for a total of 40 ml. Following hybridization, washing was performed in lx SSC, 0.1%SDS at room temperature for 15 minutes, and then twice at 65°C for 30 minutes. Overnight exposures indicated 2 mRNA species of human PEG-3 gene that express in a high level in most human tumor cell lines. These two mRNA species are about 1.5 and 2.8 Kb in size. No expression of PEG-3 gene was detected in all normal tissues except skeletal muscle which expresses 1.5 Kb species of human PEG-3 mRNAs in a low level.

5' RACE was used to generate the full length human PEG-3 cDNA, using poly (A") RNA extracted from MCF-7 cells as a template. PEG gene specific primers were designed from the human PEG-3 cDNA 400 bp fragment, including primer A (CTAAGGCGTGTCCATGCTCTGGCC; SEQ ID NO:3), primer B (CTCCT CTGCCTGGGCAATG; SEQ ID NO:4) and primer C (CGAGCAAAGCGGCTTCGA TC; SEQ ID NO:5). First strand cDNA synthesis was carried out using human PEG-3 gene specific primer A or B through reverse transcription. cDNA was purified by GlassMax DNA isolation spin cartridge purification and TdT tailed. PCR of dc -tailed cDNA was carried out using nested primer B or primer C. After PCR, the PCR products were separated using 1% agarose at 100 voltages for 1 hour. Two dominant fragments (1.7 Kb and 0.9 Kb) were observed after electrophoresis and cut for subcloning using AT cloning vector. After sequencing some subclones, the 1.7 Kb fragment was confirmed to cover all coding regions of the human PEG-3 cDNA, and 0.9 Kb fragment was a truncated product of the human PEG-3 cDNA with a start at the first internal repeat of PEG-3 cDNA and also had a 25 bp unique sequence at the 5'-end. The 5' and 3' sequences of the 1.7 kb fragment are shown in Figure 13.

The human PEG-3 gene also was found to express in human primary tumor samples using the RT-PCR method. Total RNAs extracted from primary human tumor sample were used as template, with an oligo (dT) primer. Reverse transcription was carried out in 42°C for one hour. For PCR, First strand cDNA generated from reverse transcription was used as the template, and the primers were the human PEG-3 gene specific primers designed from the human PEG-3 gene cDNA 3'-end. PCR conditions were as follows:

Denaturation 94°C - 5' 1 cycle

Denaturation 94°C - 30"

Annealing of primers 60°C - 30' 35 cycles

Primer extension 72°C - 2'

Followed by

Final extension 72°C - 7'

Indefinite hold 4°C, until samples are removed

Electrophoresis was used to separate PCR products of all tested samples, in a 1.5%) agarose gel, for 1 hour at 100 V.

Example 3

PEG-3 Induces Angiogenesis This Example illustrates the relationship between PEG-3 and angiogenesis. A. Expression of PEG-3 Correlates with Tumor Phenotype

El l cells, which display a low tumorigenicity phenotype, were transfected with an expression vector resulting in overexpression of rat PEG-3. The transfected cells induced tumors in 100% of animals within 12 days, whereas the untransfected cells required 35-45 days for tumor formation. In addition, the transfected cells induced very large and bloody tumors. Thus, overexpression of PEG-3 leads to a very aggressive tumor phenotype. In contrast, similar experiments employing E11:NMT cells transfected with PEG-3 antisense resulted in a less aggressive phenotype.

B. PEG-3 Expression Correlates with VEGF Expression

VEGF is an angiogenic factor that appears to have the greatest impact on tumor angiogenesis. El l cells transfected with PEG-3, as described above, contain high levels of VEGF mRNA. In addition, transcription of VEGF message (as assessed by nuclear run on assays) is high in El l cells transfected with PEG-3. Furthermore, secretion of VEGF into medium is not observed for El l cells, but is observed in El l cells transfected with PEG-3. Such secretion decreases in El l cells:NMT cells transfected with PEG-3 antisense. No change was seen in the expression of other angiogenic growth factors including basis FGF, midkine and pleiotropin.

C. PEG-3 Expression Correlates with the Number of Microvessels

Immunohistological studies show an increase in the numbers of microvessels in the interior of El 1 /PEG-3 tumors. This results was confirmed by CD31 and Factor VII immunostaining.

From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

1. A method for modulating angiogenesis in an organism, comprising administering to an organism an agent that alters expression and/or activity of a progression- associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, or a variant of one of the foregoing sequences, and thereby modulating angiogenesis in the organism.

2. A method according to claim 1, wherein the agent inhibits expression of the progression-associated protein.

3. A method according to claim 1, wherein the agent comprises an antisense polynucleotide.

4. A method according to claim 1, wherein the agent comprises an antibody or antigen-binding fragment thereof.

5. A method according to claim 1, wherein the agent is administered systemically.

6. A method according to claim 1, wherein the agent is administered to a tumor.

7. A method according to claim 1, wherein the agent is present within a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

8. A method for modulating angiogenesis, comprising contacting a cell capable of undergoing angiogenesis with an agent that alters expression and/or activity of a progression-associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, or a variant of one of the foregoing sequences, and thereby modulating angiogenesis.

9. A method according to claim 8, wherein the agent inhibits expression of the progression-associated protein.

10. A method according to claim 8, wherein the agent comprises an antisense polynucleotide.

11. A method according to claim 8, wherein the agent comprises an antibody or antigen-binding fragment thereof.

12. A method for determining whether an agent modulates angiogenesis, comprising the steps of:

(a) contacting a candidate agent with a polypeptide comprising a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, or a portion or variant of one of the foregoing sequences, under conditions and for a time sufficient to allow the candidate agent and polypeptide to interact; and

(b) determining the effect of the candidate agent on the ability of the polypeptide to induce angiogenesis, and therefrom determining whether the agent modulates angiogenesis.

13. A method for determining whether an agent modulates angiogenesis, comprising the steps of:

(a) contacting a candidate agent with a cell transformed or transfected with a reporter gene under the control of an endogenous promoter or regulatory element of a progression-associated protein, wherein the progression-associated protein comprises a sequence encoded by a nucleotide sequence recited in SEQ ID NO:l or SEQ ID NO:2, under conditions and for a time sufficient to allow the candidate agent to interact with the promoter or regulatory element; and (b) determining the effect of the candidate agent on the level of reporter protein produced by the cell, and therefrom identifying determining whether the agent modulates angiogenesis.

14. A method according to claim 13, wherein the candidate agent is present within a combinatorial small molecule library.