WO1999037333A1 - Method for removing and/or inactivating viruses - Google Patents

Abstract

The invention relates to a method for removing and/or inactivating viruses from/in a fluid containing viruses and particles. According to said method, the fluid is passed through a filter comprising a matrix and particles of cross-linked crospovidone iodine and/or crospovidone hydrogen peroxide embedded therein.

Description

Virus removal and / or inactivation methods

The present invention relates to a method for removing and / or inactivating viruses, virus-free blood components, a device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, a method for reducing the vitreiter in body fluids of an animal Organism and an agent for increasing the content of hematopoietic stem and precursor cells in peripheral blood and its use.

Viral diseases continue to pose a major threat to human health. In addition to the periodic flu waves, a number of other and often chronic viral diseases have recently been observed. Examples include AIDS, hepatitis C, Ebola, Hanta and cytomegaly infections noted.

The development of suitable therapeutic methods has undoubtedly provided encouraging results in the recent past, but it is not justified to speak of the therapeutic controllability of viral diseases. These shortcomings are due to the biological peculiarities of the various viral systems and, in particular, their high adaptability to the special conditions in their environment, including the presence of nucleotide analogs or other antiviral agents currently used. In view of these facts, it can already be a major therapeutic advance to have means available which in the end result in a reduction of the virus titer in the patient's body, on the one hand to reduce the severity of the disease, which can generally be correlated directly with the virus titer, and on the other to gain other time to allow other therapy concepts to be used.

This includes that blood components, both soluble and cellular, are supplied to the diseased organism in order to compensate for possible deficits, and also that soluble or cellular effects which are positive in the sense of a therapy are supplied to the diseased organism in the sense of therapy. These can be both allogeneic and autogenous in nature. In any case, however, it must be ensured that the corresponding preparations are virus-free.

Virus-free blood plasma or other liquids can be achieved by suitable filtration steps. It has been found that using iodine complexly bound to filter material in the form of crospovidone iodine, as described for example in DE 43 43 236 AI, viruses can be reliably inactivated.

The object of the present invention is to provide methods and devices which ensure that in a fluid comprising viruses and particles, the viruses are removed from the fluid or inactivated in the fluid.

In addition, it is an object of the invention to provide virus-free preparations of cellular components which have an increased content of hematopoietic stem cells.

Another object of the invention is to provide a method for reducing the virus titer in body fluids of an animal organism.

According to the invention, the object is achieved by a method for removing and / or inactivating viruses from / in a fluid comprising virus and particles, in which the fluid comprises a cross-linked crospovidone iodine and / or crospovidone hydrogen peroxide matrix and particles embedded therein Filter is guided.

Furthermore, the object is achieved by a method for removing and / or inactivating viruses from / in a fluid comprising viruses and particles, in which the particles are separated from the fluid and the particle-free fluid at least once via a matrix and particles of crosslinked embedded therein Crospovidone iodine and / or - 4 -

Crospovidone hydrogen peroxide comprehensive filter is performed.

The object is also achieved according to the invention by virus-free blood components, including preparations comprising them, which can be produced by one of the methods according to the invention.

Furthermore, the object is achieved by a device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, the device comprising at least one device for separating the particles from the fluid and a filter device which has at least one matrix and embedded therein particles of cross-linked crospovidone iodine and / or crospovidone hydrogen oxide filter.

In addition, the object is achieved by using the aforementioned device according to the invention for reducing the virus titer in body fluids of an animal organism and by using it in the methods according to the invention.

Finally, the object is achieved according to the invention by a means for increasing the content of hematopoietic stem and precursor in peripheral blood, which contains two components intended for sequential administration, the first component comprising an antiviral compound and the second component a combination of comprises at least one antiviral compound and a hematopoietically active compound, and by the use of the agent in the process according to the invention. - 5 -

Ultimately, the object is also achieved by a method for reducing the virus titer in body fluids of an animal organism, in which one of the aforementioned methods according to the invention is used.

In a preferred embodiment it is provided that the particles are cellular blood components.

In a particularly preferred embodiment, the cellular blood components are selected from the group comprising hematopoietic stem and progenitor cells, erythrocytes, platelets, lymphocytes, monocytes / macrophages and combinations thereof.

It is further preferred that the cellular components are differentiated cells and / or stem cells.

It is very particularly preferred if the cellular constituents comprise CD34-positive hematopoietic stem cells.

In another embodiment, the fluid is blood.

It can further be provided that the viruses are selected from the group consisting of hepatitis B, hepatitis C, cytomalaly, Epstein-Barr viruses and human herpes virus, in particular human herpes virus 6, 7 and 8 and human immunodeficiency virus includes.

The invention further proposes that before the particles are passed over the filter, they are fractionated based on their physical, chemical, phenotypic and / or genotypic characteristics. Furthermore, it can be provided that after the particles have been passed over the filter, they are fractionated based on their physical, chemical, phenotypic and / or genotypic characteristics.

In a preferred embodiment it is provided that the particles which can be obtained by one of the methods according to the invention are blood cells and that these are stimulated to multiply and / or differentiate.

An embodiment in which the blood cells are CD34-positive stem cells is very particularly preferred.

Finally, it can be provided that the fluid comprising viruses and particles is obtained from a mammalian host organism, and in particular in the mammalian host organism, before the fluid comprising the viruses and particles is withdrawn, the number of hematopoietic stem and precursor cells present in peripheral blood is increased.

In a further embodiment it can be provided that the number of hematopoietic stem cells present in peripheral blood is increased by administration to the mammalian host organism of an agent for increasing the content of hematopoietic stem and precursor cells in peripheral blood.

In a very particularly preferred embodiment, the mammalian host organism is a human organism.

In one embodiment of the method according to the invention for reducing the virus titer in body fluids of an animal organism it can be provided that the Particles and / or the fluid are passed several times over the filter.

Furthermore, it can be provided that the fluid obtained after the passage through the filter and / or the particles obtained after the passage through the filter are fed to an animal organism.

It is very particularly preferred if CD34-positive stem cells are supplied to the animal organism.

Furthermore, it can be provided that the immune system of the animal organism is destroyed before the supply of cellular blood components to an animal organism.

The method according to the invention proposes that the method for reducing the virus titer in body fluids of an animal organism is repeated at intervals.

The method according to the invention is particularly preferred if the body fluid is blood.

In another very particularly preferred embodiment, the animal organism is a mammal and in particular a human.

An embodiment in which the advantages inherent in the method according to the invention are particularly effective is that the animal organism is chronically ill with a viral disease.

In one embodiment of the agent according to the invention - 8th -

Increasing the content of hematopoietic stem and progenitor cells is selected, the antiviral compound is selected from the group Retrovir ^®, ganciclovir and other comprises.

In a further embodiment of the agent according to the invention it is provided that the hematopoietically active compound is selected from the group of cytokines, which includes granulocyte colony-stimulating factor G-CSF and others.

It can further be provided that the first component is intended for administration over a period of 10 to 28 days.

Furthermore, it can be provided that the second component is intended for administration over a period of 5 to 10 days.

In addition, in one embodiment, a total of 15 to 38 days is provided for taking the first and second components.

Finally, it can be provided in the agent according to the invention that the two components are spatially separated and assembled in a packaging unit, the administration units forming the components being able to be removed individually.

It is very particularly preferred if the administration units are daily units.

In a preferred embodiment it is provided that when Retrovir the first component and granulocyte colo- - 9 -

The never-stimulating factor G-CSF together with Retrovir is the second component, the first component is 9 daily units of Retrovir of 2 g each for oral administration and the second component is 5 daily units each consisting of 2 g of Retrovir for oral administration and 5-20 μg / kg Body weight granulocyte colony stimulating factor G-CSF is.

Finally, the invention proposes the use of the agent according to the invention in the methods according to the invention.

The method according to the invention thus provides that viruses can be removed from a fluid comprising viruses and particles or the viruses contained in a fluid comprising viruses and particles can be inactivated. It is possible for both processes to run simultaneously, one after the other, or even individually.

The invention is based on the surprising finding that it is possible to remove or inactivate the viruses by contacting crospovidone iodine and / or crospovidone hydrogen peroxide with a fluid comprising viruses and particles.

Crospovidone iodine or crospovidone hydrogen peroxide are understood herein to mean iodine complexes or hydrogen peroxide complexes based on crosslinked PVP (polyvinylpyrrolidone). Crospovidone iodine or crospovidone hydrogen peroxide is present in the filters used in a filter matrix in particulate form. Such filters, which are advantageously designed as depth filters, are in DE 43 43 226 AI and WO 95/16511 - 10 -

described, the relevant disclosure content of which is hereby incorporated in full.

Said filters can comprise fiber materials as a filter matrix and the content of the crospovidones built into the matrix can be 0.5 to 75% by weight, based on the total weight (dry).

It is noteworthy that the viruses are removed or inactivated, but not damage to the particles themselves, especially if the particles are cellular blood components and especially lymphocytes or hematopoietic stem and precursor cells.

The filter material can be provided with a sufficient pore size, which leads to an enlargement of the filter surface, which is available for contacting the fluid comprising viruses and particles.

In this context, fluid is understood in particular to be blood, but also lymph fluid. Blood is also to be understood here to mean whole blood, blood mixed with anticoagulants or otherwise treated, blood plasma, blood plasma fractions, expanded whole blood and blood plasma and the like. Furthermore, the term "blood" also includes the blood to be observed under the various pathological conditions, such pathological conditions not only the cellular component (s) of the blood but also its soluble, i.e. can include plasmatic component (s).

Furthermore, aqueous fluid should also - 11 -

gene and in particular buffer solutions are understood.

On the basis of the surprising finding, whole blood can then also be fed directly to a treatment with a filter comprising particulate crospovidone iodine and / or crospovidone hydrogen, thus enabling reliable removal and / or inactivation of viruses. In this respect, the methods according to the invention open up new possibilities in the processing of whole blood, blood plasma containing particles, cellular blood components, blood plasma fractions and the like.

It is within the scope of this invention that the fluid is conditioned via the filter in a suitable manner for the pass step. In the case of blood, this can be prevented by adding suitable anticoagulants, as are known to the person skilled in the art, for example by adding ACD or heparin.

However, it is also possible according to the invention for viruses to be removed or inactivated from / in a fluid comprising particles and viruses, the particles being separated from the fluid first and then the particles, optionally suspended in a fluid, on the one hand and the particle-free one Fluid, on the other hand, can be further processed separately in a suitable manner, wherein further treatment can also consist in non-treatment. Typically, at least one of the two fractions mentioned is treated with the crosslinked particulate crospovidone iodine and / or crospovidone hydrogen peroxide to remove and / or inactivate the viruses, preferably the particle-free fluid, for example the plasma free of cellular blood components. - 12 -

Particle and fluid are typically separated by differential centrifugation. In the event that the particles are blood cells, devices such as apheresis centrifuges and the like are typically used, particularly since they are able to remove and possibly enrich large quantities of nucleated cells from the peripheral blood. With regard to the passage of the fluid or the particles through the filter comprising particulate crospovidone iodine and / or crospovidone hydrogen peroxide, it is obvious to the person skilled in the art that the corresponding passage is repeated until the desired virus titer reduction or inactivation rate is reached, if necessary using other appropriate filters.

"Virus-free" is intended to include the physical absence of viruses as well as the absence of biologically active viruses, i.e. that, for example, the virus capsid or parts thereof are still present even after the methods according to the invention have been carried out, but the virus is no longer biologically active. Furthermore, the term also includes the fact that no virus or viral activity is no longer detectable, or at least below a defined titer or level of biological, i.e. viral, activity is reduced.

In the case of the treatment of blood, the methods according to the invention are not limited to fluid comprising particles and viruses obtained directly from an animal organism, but can of course also be applied to made-up (blood) preparations, so that the fluid generally has a liquid phase shows how, for example, buffer solutions and the particles can represent only a single cell type - 13 -

as well as a mixture of two or more cell types.

CD34-positive hematopoietic stem and progenitor cells are of great importance as cellular components because they are able to largely build up a functional immune system as a result of differentiation and multiplication. Accordingly, in the therapy of lymphotropic viruses after destruction of the differentiated cells in the patient's body carrying the viruses, the patient's immune system can be rebuilt by implantation of corresponding hematopoietic stem cells or derivatives derived therefrom. In the case of AIDS in particular, the special stem and progenitor cells are of central importance since they do not have the CD4 molecule responsible for a specific interaction of the HI virus with the cell surface.

Although the fluid is blood in many advantageous embodiments of the invention, it is not so limited. This can also involve blood which has already been processed differently or products obtained therefrom or corresponding preparations which still have a virus content. Correspondingly, the methods according to the invention can also be used for a subsequent treatment of such preparations if, for example, it has been proven after processing that the preparations are virus-positive.

In principle, the methods according to the invention can be applied to all virus forms, ie DNA as well as RNA viruses, enveloped and non-enveloped viruses, virions, prions and similar biological systems. The viruses mentioned herein also include their various vario- and seroty- - 14 -

pen a.

With regard to the methods according to the invention for removing and / or inactivating viruses, it can be provided that the particles contained in a fluid are fractionated before or after passage through a filter containing particulate crospovidone iodine or crospovidone hydrogen peroxide, a combination of both steps of course can take place within the scope of the invention. The fractionation can be based on the most diverse characteristics of the particles.

Physical features are to be understood here, inter alia, to mean the size, surface charge and shape, chemical features, inter alia, the composition of the cytoplasmic membrane or layers based thereon and also associated or connected molecules which occur both naturally, on a pathological process or on a technical one Processing or modification step can be based. Phenotypic characteristics are also to be understood in the broadest sense as the physical and chemical characteristics mentioned, as well as those that are based on the specific biological and biochemical equipment of the particles, especially when it comes to cellular blood components. These include various surface markers, enzymatic activities or detection systems coupled to the surface markers. Phenotypic features are also intended to include immunological features herein. With regard to the genotypic characteristics, those are to be understood that are based on the genetic makeup of the respective cells. In particular, this includes the detection and labeling of certain cell populations using - 15 -

directly or indirectly labeled nucleic acid probes. On the basis of the features mentioned, all known separation methods can be used in principle, including centrifugation, chromatography and fluorescence-activated cell sorting (FACS).

The lymph cells obtained using the methods described herein can be propagated or differentiated ex vivo using known culture and differentiation techniques. Certain cell populations, which are therapeutically advantageous, can thus be selectively expanded compared to the normal distribution in the blood. This is particularly advantageous when it comes to hematopoietic stem and progenitor cells, such as CD34-positive hematopoietic stem cells. CD34-positive hematopoietic stem cells are of central importance, especially in AIDS, because due to the lymphotrophic behavior of the virus, a reconstitution of the immune system is ultimately only possible on the basis of non-infected cells, as the HI virus itself as a result of the reproductive cycle would be excreted further if the viruses were removed from the plasma. The CD4 molecule, which is not expressed on the surface of CD34-positive stem cells, is essentially responsible for the uptake of HI viruses. Accordingly, these hematopoietic stem cells, increased and possibly differentiated, can form the basis for a reconstitution of a patient's immune system after the virus has been removed from the body, for example using the methods according to the invention, and the lymphatic cells carrying it have also been removed or destroyed .

It should be noted that there are special do ω Di d = tr ra N T3 3 PP ⁾ φ μ- <Ω LQ 3

H- ¹ φ tr μ- d PJ α N PJ PJ d HS <

P tr S 0 μ- Φ φ P tr P 0 Φ tr Φ ⁾ Φ φ P ddd P Φ 0

LQ £ d P Φ P 3 PJ μ- P P Φ ra Hj ra Φ? P P μ- rt Nl Ω ra P Hj

CD 0 rt Hj PJ PJ = Φ H {Φ <rt 5 P tr tr rt P d = LQ P Φ d tr N rt vo

Φ tr • Ω H {rt Hi P rt Φ Φ Φ S Φ P ⁾ LQ ra PJ Φ HJ o ra μ- Φ vo μ- Φ ⁾ μ- Φ μ- ra Hi P φ PJ CD P Φ Φ ra 1 d Hj d = μ- α 0 Φ μ- Ui

P tr CD 0 P < ⁾ r rt tr μ- 0 D. o P ^• ~ - * CD tr 3 ω 3 HS -1

UI tr & ⁾ P> Ω P Φ H {Ω Φ μ- PJ P φ rt μ- H> n Φ Hj μ- rt φ U

Φ d tr tö Hi tr PP d N ra P Φ 3 μ- Ω H {3 Φ o rt Φ P UI μ- ra rt Φ Φ tr Di CD d φ φ P rt Φ μ- P μ- ^ d rt P Φ ra μ- d $. d ≤ H {0 Hj P rt Φ 3 P <! P 0 N <

Φ Ω tr D. Hj rt P Hj μ- φ P Φ φ rt Φ φ Hj μ- N 0 P ra μ- Φ Φ

P Hi Φ PJ Ω Hj μ- LQ μ- CD tr Hj s; ra μ- φ μ- Φ HS d = 3 P tr P d tr? r P D Φ Φ n PJ-- ra Φ Ω O IQ φ rt tr

PP ⁾ Φ P CD φ d rt P o 3 d μ- Φ tr μ- Φ μ- co φ dd = D- rt co μ- rt LQ D- P ⁾ Hj 3 d tr) PJ PJ Ω Hj Φ Φ P Ω Φ <! Ω PP

Hj Φ 0 ^ D. Φ μ- 3 Φ P ⁾ J ^ rt L) tr μ- PP PJ tr Hi φ tr

POP Φ μ- 3 φ Φ JP ⁾ ≤ P Hi 1 0 d LQ Φ P Φ P s- Φ

0 φ P μ- PP Ϊ> 0 rt rr w * d CD P φ Hj μ- NPM μ- NP μ- μ- Hj Φ rt rt rt σ μ- Φ 0 0 μ- LQ PJ ^> ra d rt Φ Hj co φ • φ Φ Φ IQ LQ P • d <μ- Φ Φ o μ- Ω Φ d = rt Φ X rt HS ra

HJ rt μ- Φ Φ ^> d Φ <; d μ- 2 μ- Φ tr P • n PP μ- ⁾ μ- tö φ

^ μ- φ P N μ- H {μ- P μ- rt rt CD Φ <! P 3 LQ * μ-

0 td ra φ PJ d P μ- tr Hj D. Φ rt μ- μ- $. d Ω Hj Φ μ- 3? r P g μ- Ω P Φ μ- PJ μ- P rt <! ra μ- d μ- tr ra μ- ra <l d N Φ z

Ό P tr P Hi Hi PJ P D- φ Φ Φ Ω φ Hj rt μ- P Ό 0 P Φ μ-?

0 P φ φ rt Φ rt Φ μ- <Hj tr D. Φ Ω μ- Φ LQ rt 3 PJ 1

PP ⁾ Hj? Φ Ω M μ- d P φ Φ Φ Φ N φ ^ P tr LQ f <! OP

Φ tr rt P tr H {0 P Hi Hi Φ co PP ⁾ d = rt d rt Φ φ D. tr P μ>

P g co - P tr P LQ <N ra PJ Hi rt tr CΩ P ^ P Hj D. P Φ 0 σι rt Φ rt ^ Φ 0 = φ s; rt tr P ⁾ o φ ra PJ μ- LQ d 3 Φ N

Φ ra P> μ- 0 P tr Φ d Hj Φ Φ Hi 0 = 3 rt μ- Ω Hi Ω P Φ 3 N • <; D. 1

P μ- 3 P d μ- 3 tr μ- Φ tr 3 J rt tr rt tr <D. tr d t? rt φ

Ω 3 ra JPP μ- rt μ- Φ N 3 Φ Φ Φ μ- - 0 Hj O Hi Φ 3 tr N tr 0 l J. IQ Φ P ⁾ P Φ 0 Ω P Φ 3 Hj PPP d rt Hi d NP

Φ Φ Φ φ P φ Hj (> 3 tr 1 ra ra Φ P LQ 3 φ

CD Hj CD φ rt d Φ O d - ¹ μ- Ξ PJ Hd rt £ P ⁾ LQ d 0 = tr 0 P 0 Φ tr • P μ- 0 P p ⁾ = Φ d 3 Φ ts J Φ d P Φ IQ £

2 Φ Φ P rt Ω CD LQ PP LQ tΛ PP Φ Hj Hj Hj HS Hj μ- tr d μ- V μ- μ- P Φ tr 3 φ φ rt • * d Hi rt PJ Φ rt co Φ P Φ φ rt rt φ P Ω J d P tr - Φ μ- μ- φ 3 P IQ HS rt μ- Hi N Φ rt P ^ rt Φ <Hj M μ- rt P? d = P d Φ

Φ g φ Φ Φ tr 0 0 Φ CD d 0 μ- HS O μ- Φ HJ ra <! HS tr μ- μ- μ- J V u- rt PJ Hj H {• d rt 0 tr M 0 Φ ra Φ w g P LQ 0 Φ Φ μ- ra Ω tr μ- • P 0 P μ- tz CD P N Hj

Φ μ- Φ rt rt μ- μ- μ- μ- 3 tr PJ: Φ P tr LQ 1 d Φ

N <Hi rt P Φ Φ φ P P P 3 Φ d Hj D. 0 Φ o d ≤ z N μ- d φ μ- ra rt φ PJ Φ rt μ- D. Φ φ P D. P Ό PJ- d rt

Hi Hi> d tu <: α μ- Hj rt Φ P PJ Φ P HS Φ φ LQ tr Hj 3 ra

PJ tr o = μ- P ⁾ ra μ- P ⁾ P Φ CD Hj Φ _^ - _^ Hi 0 Φ O d = tr -> * 0

M φ μ- \ Φ P Ω tr 0 P P N ω P => J N tr tr

Hj H {H {Ω tr PJ P rt tr Φ PJ rt π d 2 •; CD N H {μ- H tr Φ φ? R μ- N 3 μ- 0 Ω μ- d tr CQ Φ ra 0 rt 0 Φ Φ Hι

0 = μ- P iQ 0 φ s; PJ ⁾ <! 3 Φ Φ rt φ 3 CD 1 LQ Φ 3 p Ö tr Ω ⁾ 3 μ- rt d μ- * d tr Hi Φ μ- Hj Φ Φ P μ- Φ M vo d tr d 1 Hj 0 ra Hj 0 PJ μ - P Φ 2 1 rt Φ 1 vo

P 1? 1 J 1 -> P - 1 0 d = P o

LQ 1 1 rt 1 1 o

iZ Di f P tn r pj Hi Ω s ^> O: ^> ra co LQ Ω φ LQ CD LQ PJ ^ tr rt ^ ra α ra Hj D.

Φ PJ Φ d μ- μ- d Φ tr μ- tr μ- 0 μ- φ Hj μ- rt J μ- d J rt PJ φ Φ Φ tr P P Φ Ω Hi Φ Hj s; φ P P d P φ PJ φ Ω φ P rt PJ Hj 3 CD

Hj LQ CD HJ tr Hj rt 0 NJP IQ μ- P μ- Φ tr Hj LQ μ- P PJ PJ φ d μ- Φ PJ CD tr CD • P Di φ Ω N Ω P 3 μ- Φ Di P d tö Ω i

P P d Ω rt o 0 μ- tö P CD ra tr Φ tr PJ P P Ω Φ -4

? t PJ P tr Hj CD Hj Hj φ • rt pj = Φ o P 3 ü P Φ rt * d LQ tr d tr UI ⁾ UI φ Ω D. rt LQ tQ μ- φ Φ rt rt £ PJ: μ- P 0 Hi Φ Hi Φ rt PJ UI

P tr <h- ¹ PP ⁾ PJ P μ-> d Di P tsi N Φ φ t Ö P CD Hi P 0 Di ⁾ p D. μ- 0 μ- ra Φ PPP ⁾ 0 rt μ- Hj μ- LQ Hi <PJ P tr rt rt Φ Hi D- Ω LQ Hi μ- μ- Hj Ω * μ- Φ CD 3 LQ Φ J Φ Φ Φ H Ω Di Φ Φ

P 3 φ Φ tr Φ CD CD Φ Di Φ tr 0 Ω P φ d = Φ P d P Hj μ- PJ tr φ <! m μ- P Hj P 3 3 3 Hi Φ P 3 tr P Hj tr PJ P LQ rt Hj o

CD Di Di φ Φ d d Hi rt CD Ό <LQ ra Di J tr tsi φ Hj J

Φ d M Φ P ra ra ö Φ μ- o μ- Φ Φ Ω CO P> Di Hj H {d 3 ra NP φ Hj 3 P Hj H CD φ H Hj PP co Hj Hi tr OP μ- rt φ P Φ Φ N d

Hj Hi PJ μ- Ω <0 LQ Φ PJ Di φ rt tr μ- rt μ- P φ φ μ- Φ tr μ- Φ iQ tr

> τ | PJ .Y Φ Φ tr φ Di φ Ω P μ- P Φ ra P Ω tr Hi P μ- rt PJ =

PJ PJ ra rt Hi Hj Hj Φ tr Φ P> rt P LQ μ- LQ tr Φ tr 3 Φ • «rt Φ 3

P Ω CD μ- Hi Φ μ- ra H {P d Φ J α Φ ra Φ Φ 3 t d φ Hj Hj Hi PJ

LQ tr φ <; μ- Ω rt d μ- d Ω P tr d P rt LQ φ PP φ i pj = $, rt rt 3 P μ- P d tr PJ rt P fV P tr Φ P Hj Ω tr LQ P ⁾ d Φ 0

PJ φ Di P Φ P μ- rt Di N μ- LQ tr d Di d = Φ Hj ra ra CJ 3 μ- • d tr P Φ Hj di φ Φ tr PJ d Φ μ- P Φ P tr Φ φ μ- φ Φ ω 0

PJ PP d P o Φ Hi Hj Φ rt P Hi tr P 0 α H {μ- μ- PH {μ- φ μ- rt P IQ tr Hi P μ-? Hi D- Φ φ φ μ- P Di JPP ⁾ φ φ <-ύ LQ ra Φ LQ ra Di ⁾ P ⁾ Φ 0 CD LQ 0 LQ O rt rt 3 tr tr tr H rt μ- LQ <! PJ ≤ Ω Φ PP Hj Hi 0 Φ LQ tr • Φ d Hj Φ D. P ⁾ μ-

Di P d <! φ 0 P μ- tr 3 P ra Φ JP Hi μ- φ PJ ra tö μ- P Φ μ- Φ LQ CD ¹ μ- 3 μ- 0 3 HS μ- Hj Φ rt Di Φ ra μ- Hj Φ iZ PJ rt D. μ- P Ω φ Ω -o φ P> Di PP> = N ra Di P tr φ> Φ φ Ω Ω Ω 3 μ- φ tr Φ Ω Φ fV ra tr d 3 μ- CD Hi • d P Hj tr tr tr PJ P rt 3 P φ tr 3 Φ φ φ

Ω f <! φ LQ d o φ μ- 3 T5 ra P Φ N - N φ μ- d P μ- P

Φ <! P ⁾ μ- P rt CD tv Hi Hj P PJ Φ P Φ 0 rt P μ- PP tr P

CD 0 P Hj Φ Pi LQ μ- Di μ- • d <! rt μ- H- ¹ Ξ Φ co Φ LQ Φ tr o rt PP φ Hj CD P PJ P • Φ Ό 0 m rt 0 Φ Hj D. rt ra D ω φ rt

PJ P 0 2 ^> Φ PP PJ I- ¹ Hi ≤ ⁾ μ- LQ P Φ Φ Φ Φ rt Φ μ- PJ i Hl Hj φ μ- μ- PJ> rt μ- rt Φ LQ μ- P Hj PJ P μ - μ- μ- rt 3 rt Φ Φ PJ Hj μ- P D. CD P * d μ- Φ HJ tr ra 2 d rt P 3 ra Φ 3 d Hi O d μ- ω μ- 3 LQ • d O PJ μ- Di ≤ 3 Ω φ PJ ^ CD tr 3 • d PN p rt ra Ω Φ φ d Φ P rt φ Φ μ- t μ- P): O Φ rt μ- Φ

LQ Φ LQ ^• ^ tr d CD ra Hl μ- ra μ- tr P Hj rt PP tr D. Hj μ- Φ φ CD

Hj Φ μ- rt rt P d = - Hi 0 PJ rt:> PJ μ- Φ Φ rt P μ- - ¹

D. Hl tr P d Hi PJ φ tr PJ o P rt 3 ra Φ μ- 3 tr LQ Hj Ω Φ ra P Φ

Φ μ- PJ PP ⁾ d μ- Hi rt Hj - d N μ- H {0 = 3 tr PN € Di P

Hj P φ LQ P μ- Ω P rt μ- 3 <! φ P Ϊ LQ Φ Φ Ω Φ φ φ • »rt μ- ra P tr φ O Φ 0 • μ- Φ ra μ- Hj P D- μ- μ- μ-

<d Φ P N LQ ra 3 P P P Hj φ rt Hj PJ μ- rt d Di d rt ra? P

0 P P Φ d φ tr Φ Φ CD LQ P 3 Ω PJ Φ P φ Hj Φ 0 =

Hj LQ 3 Hj P Φ μ- P co Hl Di Φ P D. <! Φ tr P P D. Ω μ- P • d

Hj CD s ^> Φ ra P ra PJ = 0 Φ CD Φ Φ P ra P Ω tr Ω Ϊ P φ n μ- LQ Φ Ό to Ω d Hj P Φ Hj Hj rr PJ Φ tr P ⁾ Φ Hj

Ω Φ Hj P ⁾ POPJ tr IQ 3; v tr μ- co <! Φ LQ ra i Φ PP μ- t 3 Hj rt P): D. P Φ Φ tr Φ φ d 0 ra Φ rt Φ PP 'd W rt p = φ rt Hi d Φ Di μ- Hi P PJ P tr Hj PJ P Di tr d P μ- Φ Q Hj Φ ^• »HJ Di μ- Φ - -

P Φ Hj Φ Φ Φ & φ oo

LQ P Hi

<rt <2 tr tr t N Φ tr P P LQ Ω φ Nl D CO ≤ 0 <^ rt rt tQ Hi Hj CD LQ μ-

0 μ- Φ μ- pj μ- Φ d μ- N Φ Φ Φ tr μ- d Φ Ω μ- tr μ- PJ Φ d μ- μ- Φ Φ Φ 3

H {Φ Hj rt P Φ μ- LQ P s: P P ar Φ P Hj P tr φ P Hi P P Ω PJ μ- Φ

CD Hj HJ Di Hj φ Φ φ P Φ Di φ Φ LQ rt tr P μ- ta

Φ μ- μ- PJ Φ tr α Hl 3 <tr CD <! M μ- Φ P Φ rt μ- LQ PJ tr ra P P Φ Φ d = tö ^ μ- φ i

Φ p μ- P tr rt H {o φ Hi Φ H {TJ Hl d μ- N PJ d ra P tr

P Hj rt Hi Hi ~ 4

Ω LQ Di) ⁾ Hj 3 P dd P μ- d Φ 3 UI

P tr Φ Φ H {μ- d d D LQ μ- Hj μ- 1 Hi Φ Hi Φ H Ω LQ φ 3 rt φ UI

Φ Hj Hj co D. rt Φ rt μ- CD ra P> Φ μ- P μ- rt μ- PJ ra tr φ Hi Φ P U

P d Φ 0 Φ HS O Di Hl Φ P Hj P Di Ω N μ- φ () <P φ Di

Di P P ϊ- g ≤ μ- - H μ- μ- μ- LQ d tr d rt rt φ Hi P μ- td ra

PJ LQ 0 Φ ra ⁾ Φ P ra ra Φ PN Φ ^ μ- Hi d = Φ μ- φ

& Ö d s: tr x H! Ω ra ^ μ- ~ 3 Ω Hj LQ t d D, Φ Hi HS co P μ-

P Di 0 0 = Di tr 3 Φ d tr d 0 = Hi - d μ- HS μ- Ω tr <! Hj P μ- φ Hj Hi Φ φ PJ d P Di CD Φ P D- P d = μ- φ μ- P Di tr Φ O μ- Φ

P rart d Η PP μ- PJ ^• * P LQ μ- P tr Di CD LQ Φ μ- Hj Ω Hj ra Φ g Φ CD Di <τ) CΛ Φ φ Hi μ- «• <Ω Φ PP ⁾ co IQ tr

Φ * d <P Hj O 0 Hi Hj Di o Di P Φ Φ 0 tr Hi d O Φ rt ^ μ- Φ μ- P ⁾ Hj s. Hj PJ = D. PJ Hj Φ <! P CD <! Hi φ d ^ Ω μ- P d PJ =

PN Hi d N LQ μ- P ⁾ O μ- Hi LQ ra 0 μ- • φ 0 HS PP PJ tr Φ PJ P tr

Φ μ- d rt d PJ Φ t PJ Φ CD J H! P 3 μ- LQ ra P LQ μ-

3 φ CD PJ 0 IQ P rt H {rt P LQ Ω o 4 ra P φ LQ rt ra Φ μ- tö μ- PJ PJ Φ μ- μ- φ φ 0 CD tr Hj Di ^• > ra ≤ rt P φ μ - 0 Hl ra 0 rt d - ^y ra Hj P μ- Di rt rt LQ φ rt φ Φ Φ

H {rt φ LQ d = 3 d P Φ CD 3 d P ⁾ P Φ p = d PJ ra Di Φ μ- P Di μ- O 3 φ HS Φ tr d rt φ - Φ d ra P φ Hi PPPP ⁾ 3 o Φ rt rt Φ HJ Hi Hj ra> d P Di P rart P 3 Di LQ μ- <! W Φ φ Φ Hj Φ 1

Φ P CD μ- PJ rt D. φ • _^ μ- rt Φ μ- o μ- Hj P

P ra P φ d J 3 rt Φ ≤ μ- IQ PJ 3 Hj Di d Ό Hl <>

Ω μ- ra P P ra 1S1 tr α d Φ P φ P d d d μ- P d μ- 0 μ- ω co tr P d Di 3 Φ • LQ PJ P Hi μ- Φ 0 Ω co ra φ Di 3 P Hi ω

Ω P PJ TJ P ⁾ Φ tr Di CD <rt 3 Di tr rt • d Di Hi rt 1 tr μ- K LQ d Hi m Hi> τ) P Φ Φ Φ Φ φ μ- φ α Φ d μ- •

H {Ω 0 = ra Ω PJ => d Hj d ⁾ PJ μ- CD μ- Hj Hj PJ Hi td μ- rt HS Φ PP Ω μ- tr Hj LQ tr Ό φ PJ Hi P • d P Hl Φ P μ - P Φ Hi Hi LQ tr M rt Φ * d φ PJ NP ^y1 PJ = rt P? R Φ PJ P rt P LQ Hi μ- LQ ra o rt P rt P φ 3 PJ Hj μ- rt Hi μ- rt PJ N tr Φ Φ HS φ ra P i- ^y 0 LQ d rt

Hi PJ_ PJ φ μ- Φ py ¹ Φ P μ- 0 = Hj Hj μ- μ- ra Di φ ≤ Φ P αi

Di o Hl (Λ> rt 0 Φ P P Φ Hj Φ ra Φ Ω φ μ- d μ- μ- 3 LQ • d

PJ Hj φ o Φ P tö Ό P O P ≤ tr rt P P Ω φ): Hi

CD LQ d = LQ P Φ - <μ- Φ Φ Φ rt N LQ tr r) tr Φ

PJ O <Φ Φ P d Φ P Hj P ⁾ ? Ro μ- d rt X ra Φ D- Φ μ- Ω tö P CD φ P rV μ- rt ^► 0 Hj ra Φ Hi d rt Hj o P 0 = LQ P Φ PP tr μ- μ- HS φ PJ P ra tr J Hl tr μ- Ω LQ φ LQ s- Hi φ Hj N Φ d ra LQ Hi P Φ μ- Φ Hi P ⁾ φ P d = tr D- PJ - φ μ- O 3 3 Φ <d P rt 3 PJ 3 P 3 P rrt tr CD Φ ra Φ PP Hj Φ PJ = Φ P Φ N α d φ tr Hj Di rt μ- Hi 0 ra m <Hj μ - 3 - D. Hj LΛ> tr Hj d μ- ra μ- Hj PJ = φ 2 *> PJ Φ P μ- Φ ra μ- Hi Φ Hj co Hi Hi ≤

P ~ rt φ • d ra φ P Φ P Di 3 LQ Hj <i 3 rt d • rt PJ d = Φ

Φ PP ⁾ P D. Di φ Φ K Hi 0 d 3 H d = <Φ tr LQ Hj 13

CD r P Hi ra ra μ- rt Hl Φ Hj P Φ PJ Hj ra 0 P ra 0 ö d Hj Φ Di

Φ PJ N PJ μ- Ω φ Φ Hj H {φ ra μ- tr Di D- CD Hj μ- Φ φ P φ o μ- P Φ d rt Ω tr μ- PJ tr Ω rt Hj μ- 1 Φ PJ Di μ- Hi Φ Hi PP

PP μ- Hj Φ tr Φ D. rV P ⁾ <tr Φ Φ φ H {CD μ- Q μ- ra φ N

P W

Φ P PJ Φ rt 0 M P P LQ LQ φ Ω μ- N d i

P Φ P μ- rt Hj μ- φ LQ m φ tr P d J vo

CD P 0 Φ 1 1 P Hi φ μ- 1 1 P β

1 1 1 3 1 P o

- 19 -

The plasma portion and the particulate portion are separated, the blood plasma being subjected to filtration using a filter comprising crospovidone iodine or hydrogen and the viruses contained therein being removed or inactivated, and the particulate fraction optionally being further treated separately.

The further treatment of the particulate fraction can be designed in such a way that individual cell populations are selectively removed on the basis of their phenotypic, chemical, physical and biological properties and then expanded or differentiated. Subsequently, parts of these cells or cell populations and / or parts of the plasma, possibly also both components completely, can be returned to the animal, i.e. attributed in particular to the human organism.

It is furthermore possible that the proportion of stem cells can be increased using the agent described here and thus the yield of stem cells and / or differentiated can be specifically increased in the first steps of the method according to the invention outlined above.

According to the method according to the invention it can further be provided that a certain amount of blood is withdrawn from the patient suffering from a viral disease and treated as described above before this, or parts thereof, are returned to him.

Alternatively, it is possible for the method outlined above to be carried out continuously, ie for the organism to be treated to be removed from the inventive device. - 20 -

Connection and / or inactivation of viruses from / in a fluid comprising particles and viruses is or will be connected, in which the process described above is carried out and the blood treated in this way, optionally in the form of components or parts, is immediately returned to the body.

In particular with regard to the chronic course of various viral diseases, it may be necessary that the method according to the invention for reducing the virus titer has to be repeated at intervals, the frequency and extent being essentially influenced by the course of the disease and by the type of viral disease.

If the method according to the invention is carried out repeatedly, suction can be exerted from the plasmatic compartment onto the non-plasmatic compartments of the patient suffering from a viral disease, with the result that there is a therapeutically positive, increased flushing out of the viruses from the non-plasmatic compartment and A new equilibrium between the virus titer in the plasmatic and in the non-plasmatic compartment comes at a lower level.

Among other things, this seems particularly advantageous. in the case of the treatment of hepatitis, a corresponding suction being exerted on the liver as a result of the repeated application of the method according to the invention.

Similar to the advantageous effects of preparations that have a high content of CD34-po- - 21 -

If the patient has hematopoietic stem cells, this also applies very particularly to the method according to the invention for reducing the virus titer, it being possible in a further sub-step in this regard that the immune system of the animal organism is destroyed or conditioned before the virus-free blood components are administered in such a way that it starts from the supplied hematopoietic stem and progenitor cells, it is possible to rebuild the immune system, or parts thereof, without this being impaired by viral activities.

In the following, the invention will be further explained with the aid of exemplary embodiments and the attached FIG. 1, which represents a schematic representation of the device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, from which further advantages and features of the underlying invention result.

EXAMPLE 1

Although the methods described here for removing and / or inactivating viruses can in principle be applied to all viruses and virus-like biological systems, and also to those which cause chronic viral diseases, the methods according to the invention and the device according to the invention are illustrated below using the example of the human immunodeficiency virus (HIV) are represented as representatives of lymphotrophic viruses.

Separation of blood plasma and cellular blood components

In a first step, the plasma and the cellular - 22 -

ren components of the blood separated. In the present case, an apheresis centrifuge was used, in which the blood cell separation is based on differential centrifugation and which allows large amounts of nucleated cells from the peripheral blood to be enriched. Suitable devices are, for example, Fenwal CS 3000 (company Baxter) or Haemonetics model V50 (company Haemonetics) or COBE Spectra (company COBE). Such devices allow the processing of 10 to 25 1 blood volume in 1 to 3 hours. The blood introduced into the apheresis device was treated with anticoagulants to prevent the blood from coagulating during apheresis. After the apheresis is complete, the plasmatic components and the cellular components can be processed further separately.

The exact boundary conditions of the centrifugation apparatus used for cell extraction must be individually adapted to the respective blood batch and depend not only on the cell population to be obtained but also on the respective rheological properties of the blood batch to be specifically treated. However, the setting of the said boundary conditions is daily practice for the person skilled in the art.

Inactivating virions in plasma

The blood plasma obtained from the apheresis is then fed to a treatment with a depth filter, which is shown schematically in FIG. 1.

In biocidal filtration, plasma is passed through a biocidal filter layer or alternatively through a biocidal filter - 23 -

layer and a directly downstream, excess iodine adsorbing layer is filtered. The filter layers typically consist of suitable carrier materials such as cellulose or polyolefins or other suitable substances or a mixture thereof as well as auxiliaries and additives. The PVPP iodine, which acts as an active agent, is inertly incorporated into the carrier matrix.

The viruses are inactivated when they pass through the filter system, while the blood plasma passes through the filter without damage. The functional diagram of a typical biocidal filtration is shown in FIG. 1 using the example of a filtration with two layers.

As can be seen from FIG. 1, virus-containing plasma enters the filter configured with layers 2 and 3 at the entry point 1 before it emerges again at the exit point 4 as virus-inactivated plasma.

The thickness and diameter of the layers can be adapted to the particular application, so that the capacity required for the plasma volume to be filtered is available. The layers are suitably arranged in a holder and can be fixed in order to enable an optimal filtration process. This functional part can then be poured into a sheathing made of a suitable plastic that is usually used for the storage or conveyance of blood plasma, such as, for example, used in bags for storing blood plasma or in dialysis tubes. The sheathing is additionally provided with connecting hoses and at the end with a suitable coupling for connection to cannulas, collecting containers etc. Through this sheathing g T) ö d NDHX 2 d yQ> τ_ α DO ra Hj 3 2 <d = N tr 3 H Φ <CD

Φ tr μ- P Φ d P H μ- P d J Φ H 0 P μ- Φ PJ μ- 0 tr d φ μ- 3 P 0 0

P 0 Φ LQ P <rt rt PJ CD H s- Hj Ω LQ ^• ^ _^ P Φ UQ μ- rt Di Hi 3

CD CD ra LQ Φ 1 Φ s: H μ- rt tr Φ 2 • d Hi Φ rt rV Φ LQ μ-

Ω ü Di ra d CD μ- <i Hi μ- φ Φ φ μ- rt μ- 3 CD Φ> 0 Φ rt tr tr d Ω tr P μ- Φ CD rt μ- d Φ 3 P td Φ Di Φ P n P> LQ U3 tr P -J

PJ Hj PJ = φ Φ Hj 3 d PJ X rt P - ^y μ- P): • ra P μ- rt ü f Φ ISI UI μ- rt Ω Hj Hi μ- 3 μ- Ω rt Φ D. Φ Ω ιΛ CD φ N ffi Hj CD tr d UI

1 tr μ- Φ CD 0 <! tr μ- HS HS Φ tr μ- UI

Ω tQ ra rt rt Φ PJ Φ Ω φ 3 tr LQ rt P • d s- P 0 rt <! Φ PJ P LQ Φ μ- H {ra 3 P rt tr P

Μ Φ rt μ- φ Φ Hj • PP? yQ Di Φ Φ P 0 rt s; PJ rt Φ φ g> d • d ^f ϋ φ μ- P LQ 3 <rt d] φ P μ- D. 3 φ d Hi μ- P d μ- d tr d - rt Φ μ- 0 s: μ- J tr Hj LQ H {Hj μ- p ^y1 (> d P

CΩ Hl Φ PP ⁾ ra φ PJ P rt HS d <P Hj NP ι_ι. tr μ- Di P 0 ^ 3 P Φ

Φ Hl Hj rt ra H {d PJ HS μ- rt 0 Φ Φ Φ Φ - ^y Φ PJ PJ 0 = α P

Hi Φ Φ Φ 3 Z Φ CD P D- d Di Φ μ- d μ- rt rt μ- P »d LQ LQ d HS ra Hj PJ d PP Φ P Φ Hi rt P ⁾ rt • 0 Hi ra HJ d t - N D. g rt Φ N p? Hj Di rt P Di rt PJ 0 Ω d μ- 0 μ- d μ-

PJ Φ 0 0 D <o Φ Φ D- Φ rt »d μ- μ- <tr LQ φ 3 μ- ≤ Ω 3 φ

HS Φ LQ 3 φ Ω 3 P d P μ- HS μ- rt Ω 0 Hi μ- in Φ d tr tr HS φ Ki P tr P PJ φ <p ⁾ P): tr Hi J μ- rt rt o Hj Hi V PJ ^r τj d K tr P 0 Hj tö <rt Ω ^ Φ CD rt φ d 3 Φ rt o rt Di φ P go P ⁾ P D- μ- Φ Φ tr <μ- P rt P d Ω Φ Φ φ μ- Di d μ- Ω φ μ- rt PJ Hj P μ- tr μ- P tr <^ 3 3 rt φ fi p tr rt P φ rt CD Hi Hj HS P Φ o μ- O D. Φ Hj Hi

CD φ rt 3 PJ tr φ d μ- 0 N Hj & ^ Hi j PJ P φ μ- d PJ P Φ μ- Di PJ tr Φ HS ra PP Φ ra P μ ^j rt φ> CD P Ω 1 p φ P 3 Φ HS ra pr 0 N μ- Ω rt PJ d μ- Hj μ- n PJ tr

NP ar Φ Φ Ω ^ 0 LQ φ rt Φ PJ = Ω C ⁾ φ PJ P ö ra μ- Φ Di rt t

Φ Φ PPP 'μ- P Φ P Hj P tr Hj LQ rt Φ 1 3 P ra μ- d (^ in o = tsi μ- HS tr rt CD Hj NP rt _* - ~ μ- PJ Φ μ- Hi> PJ Φ P ra φ P ra μ- Hl CD μ- rt φ ω Hj <v P Φ D- rt P 0 1 • »Φ Ω LQ 1

3 d 1— 'Φ rt φ Φ Ω φ HJ P Ό P ⁾ yi PP Φ φ D- P φ PJ μ- φ CΩ

§J P 3 Φ Hj Hj tr tr PJ rt PJ rt H d Hi P Φ CD P Di P Hi rt iQ Φ P μ- P Hi Φ rt Hi l- ¹ μ- '' P Φ P PJ φ rt Φ φ pj = Φ Φ td PP rt μ- P μ- PJ rt 0 iQ μ- ^ <! * d X μ- 3 3 rt Hj CD rt, .. φ co rt Φ o rt «P d ra P μ- o • fl • d rt P? Φ μ- tr Kl $, μ- Ω tr s: rt PP μ- HS P Hi Φ P PJ PJ Hi 0 <ra ^

^ t d rt tr φ Φ O O PJ PJ rt Hj μ- PJ φ φ μ- μ- co Hj Φ Hj ra Hj? CΩ yQ P P P? l Hj σι PJ ra LQ μ- Hi LQ rt

Φ • - - Di Hj μ- Ω 0 rt d d Di rt J o rt Ω d rt tr Φ pj = rt

P φ Φ rt tr φ P PJ PJ p Ω Φ 0 PJ rt μ »d tr Φ PJ: $, rt Hj

Di 3 PP rt Hj PPPP μ- et Φ m Hi CD μ- tr o Hj Φ μ- Hj pj = ⁾ μ- μ- μ- • rt D rt 3 Φ Hj φ 3 0 μ- o P Φ tr rt tr d rt

PJ rt φ H PJ φ Φ J μ- μ- O P PJ P ra IQ Hi μ- P n P μ-

3 μ- P tr tr P Hj rt <d P d Ό 3 φ Kl rt P μ- Di 0 μ- o P p ⁾ LQ Φ Di ⁾ 0 PP μ- 3 Hi ≤ t - ^y d Φ tD φ P

P>. 3 Ϊ Φ P φ <rt d Ω μ- 0 d t φ 3 3 ι μ- Φ ra

0 in PJ rt rt Φ Hi Φ μ- Φ P rt tr H {ol μ- J o <ra P <! rt - ^y μ- H {P Hi HS <! μ- HS LQ rt Φ t- ^y r φ td o 0 rt rt 0

Φ o \ ° <i Φ 0 Hi Φ CD CD Φ Φ φ 3 PJ Φ - ^y o P Φ CD Hj rt o

3 μ- P PJ d iQ d Hi Hj tr ra rt D. PJ rt • d LQ H

Hj μ- Φ PP LQ tr P Φ Ω PJ rt CD μ- μ- 3 • μ- CD td t • Hj P ⁾

0 ⁾ rt H {rt s H {HS P tr P ^y - Φ PP ^► 0 PJ HJ 3 μ- φ. φ P

1 Φ φ Φ Φ M

Φ Di rt rt CD Di 1 \. ü Φ PJ P • • Ω LQ ra P P μ- P Φ O Φ PJ 1 Φ P? 1 μ> tr φ

1 Ω P Hj Hj Hj rt 1 co o

tr 1 o

- 25 -

Acetic acid (EDTA) washed before cell aggregates were removed through a sterile 30 μm nylon filter. The cells were then resuspended in 300 μl of this buffer solution per 10 ⁸ white blood cells and subjected to treatment with the filter apparatus, the layer thickness and the filter base area depending on the cell type to be filtered (lymphocytes: approximate diameter 9 to 12 μm and monocytes / macrophages: approximate diameter 12 to 16 μm) was selected.

The following tests were carried out to detect HI viruses or their replication:

HIV detection through cocultures

7 days after removal of the medicaments from the culture medium, 10 ⁷ expanded cells were cocultivated with an identical number of PHA-stimulated mononuclear cells of an HIV-negative donor. Twice a week, the culture supernatant was examined for the presence of HIV using the p24 antigen test and the branched DNA test. Fresh PHA stimulated donor cells were added to the cultures once a week. A culture was recognized as positive if the p24 antigen> 30 pg / ml or more than 500 virus equivalents / ml was detectable in two consecutive supernatants.

Detection of HIV-DNA using PCR

An aliquot of 10 ⁶ cells from the cell culture was centrifuged in a microcentrifuge and their total cellular DNA was isolated. Non-infected H9 cells served as negative controls as well as - 26 -

provided stem cells from a healthy donor. The samples were used undiluted (60,000 cells per reaction batch) and in dilutions of 1:10 and 1: 100. HIV-DNA was detected using conserved gag primers using a nested PCR reaction (nested PCR). The HCH2 cell line, which contains one HIV genome per cell, served as a positive control. The following primers were used:

5 'gag687: AGAACCAAGGGGAAGTGACATAGCA and 3' gag992: TTACAATCTGGGTTCGCATTTTGG and 3 'gagl047: TGCTGTCATCATTTCTTCTAGTGT and 5' LTR768: GCGGAGGCTAGAAGGAGAGAG.

The 5'LTR768 and 3'gagl047 were used for the primary amplification under the following reaction conditions: 2 minutes at 94 ° C. (1 cycle), 50 ° C. for 2 minutes and 72 ° C. for 2 minutes (per cycle). Then 39 cycles of 1 minute at 94 ° C, 1 minute at 50 ° C and 1 minute at 72 ° C were connected. An amplificate of 1068 base pairs was found. The secondary reaction was carried out with 10 μl of the DNA (template) of the first reaction formed using the primers 5'gag687 and 3'gag992. The individual cycles were identical to those described above, the total number of cycles was 30. The analysis of the DNA fragments was carried out in a 1% agarose gel by means of ethyl bromide staining.

Detection of HIV replication using RT-PCR

Sections of the HIV-1 reverse transcriptase gene were amplified by mononuclear cells prior to treatment in cell culture and at different times during the culture. - 27 -

adorned to track the sensitivity of the reverse transcriptase under the selection pressure of the antiretroviral drugs used. For this, the RT-PCR was used using the following primers: 5'2536: CACTT-TAAATTTTCCCAT and 3'3388: ACATAATTGCCTTACTTTAATC. In reverse transcriptase PCR, however, a magnesium concentration of 1.25 mM and 50 cycles under the above reaction conditions was used. An 825 base pair DNA piece was amplified and sequenced using the T7 polymerase method in order to detect possible mutations in the reverse transcriptase.

EXAMPLE 2

A method for obtaining a preparation of CD34-positive stem cells from HIV-positive whole blood is described below.

In order to achieve the highest possible starting titer of CD34-positive hematopoietic stem cells, HIV patients were exposed to a conditioning regimen consisting of 2 g of Retrovir per os for 14 days before the apheresis treatment and 10 μg / kg body weight of granulocyte colony-stimulating factor G -CSF exists for the last 5 days before the apheresis treatment. As a result of the surprising effect of the combination for the sequential administration of the compounds mentioned, the number of hematopoietic stem cells in the peripheral blood increased drastically.

The HIV-positive blood obtained in this way was separated into blood plasma and cellular blood components, as described in Example 1, and the viruses were removed or inactivated. - 28 -

The CD34-positive stem cells were then selectively isolated from the mixture of white blood cells of the peripheral blood obtained by specific antigen-antibody-mediated immune reactions on the surface of the cells. A commercially available monoclonal antibody (eg clone UBEND / 10 or HP10A-2) was used for this purpose, which recognizes an epitope of the 115 kDa transmembrane glycoprotein (CD34). This is expressed on 2-4% of the cells present in the bone marrow and has been identified as the earliest marker of the hematopoietic stem cells. This procedure is also known as positive selection. For this purpose, the population of white blood cells (shown below for <2 × 10 ⁹ mononuclear cells) was mixed with 100 μl of a block reagent (eg F _c fragment of the immunoglobulin G; concentration 1 mg / ml). This blocks the non-specific binding of the monoclonal antibody to be used below against the CD34 antigen to the F _c receptor, which is also expressed on stem cells other than hematopoietic. In a second step, the cells were mixed by adding 100 μl of the CD34 antibody, which was coupled to paramagnetic microbeads, and incubated at 4-6 ° C. for 30 minutes. The cell suspension was then placed on the prepared MiniMacs column in a magnetic cell separator. The cells were placed on the column in a concentration of 5 × 10 ⁸ white blood cells and separated from the run by means of pregnancy. The column was then washed four times with 500 μl PBS with 0.5% human serum albumin and 5 mM EDTA. The column was then removed from the magnetic separator and placed in a small sterile tube under a sterile workbench and eluted with 1 ml of the above buffer. This process was repeated again with another column prepared - 29 -

to achieve a further enrichment of the CD34 positive cells. The cell filtrate of the first run, which contained all leukocytes except the CD3-positive stem cells, can in principle be (re) infused into the patient.

The eluate obtained after the treatment with the CD34 antibody column was then incubated in the sense of a negative selection with a monoclonal antibody (GK1.5) against the CD4 antigen, which was coupled with paramagnetic microbeads and via the magnetic column of CD4 positive cells separated. This was necessary to remove all of the early progenitor cells bearing the CD4 antigen from the cell mixture, since CD4 acts as the main receptor molecule for HIV.

The purified CD34-positive stem cells thus obtained were then centrifuged for 5 minutes at 1500 rpm and in RPMI 1640 / IMDM 10% (250 ml ISCOVE's modified Dulbecco's medium; 250 ml RPMI 1640; 50 ml 10% human AB serum ; 5 ml of an IM sodium pyruvate solution, 5 ml of a 2 mM L-glutamic acid solution; 5 ml of a 100 U / ml penicillin solution and 0.1 mg / ml streptomycin; 500 μl of a 5 x 10 ⁵ molar solution of 2-mercaptoethanol) resuspended. These cells were propagated in the cell culture medium mentioned above with the addition of stem cell factor, IL-1, IL-3 and IL-6 in plastic culture bottles with 0.3% agar.

The preparation comprising CD34-positive hematopoietic stem cells obtained in this way was examined for the effectiveness of the removal or inactivation of the HI viruses by means of the HIV detection tests listed in Example 1 and no HIV viruses could be detected anymore. - 30 -

will be.

EXAMPLE 3

Starting from the preparation comprising CD34-positive stem cells described in Example 2, these were expanded and then differentiated in order to check whether, as a result of the treatment, the ability to differentiate and thus to build up a functional immune system after introduction into a suitable host organism was still present .

Expansion of CD34 positive stem cells

To expand the stem cells into the various cell lines, 1 μmol zidovudine (AZT Glaxo Welcome), 10 μmol didanosine (DDI, Bristol-Myers Squibb) and 0.6 μmol indinavir (Crixivan, Merck, Sharp & Dohme) were added to the media. These concentrations were above IC95 for HIV in phytohaemagglutinin (PHA) (0.1 μg / ml) stimulated peripheral blood mononuclear cells. The antiretroviral drugs were not toxic in this concentration.

After about 2 weeks of cell culture, the number of CD34-positive cells used could be increased by a factor of 30 to 50 (typically to 5 x 10 - 5 x 10 ¹⁰ ). After this period, an aliquot of the cells was subjected to a comprehensive FACS analysis (fluorescence-activated cell sorting). For this purpose, 2 × 10 ⁵ CD34-positive cells with the corresponding antibody, which was conjugated with fluorescein isothiocyanate (FITC) or phyco-erythrin (PE), were used. Antibodies against were used - 31 -

the following cellular antigens of hematopoietic differentiation: CD5, CD7, CD10, CD19, CD20, CD13, CD14, CD15, CD16, CD33, CD38, CD45RA, CD45R0, CD71 and HLADR. Either clone 12.8 (IgM isotype) or clone ICH3 (isotype IgG2a) was used on CD34 antibodies. The corresponding isotypic controls were carried out as a negative control. After 20 minutes incubation at 4 ° C, the cells were washed with PBS 1% bovine serum albumin and 50,000 cell events were evaluated.

Progenitor cell examinations

In order to be able to estimate the development of hematopoietic cell lines from the enriched CD34-positive cells, hematopoietic progenitor studies were carried out. For this purpose, 3000 or 10,000 CD34-positive cells / ml were incubated in ISCOVE's methyl cellulose medium with 2 IU erythropoietin / ml and 50 μl PHA-stimulated human conditioned medium with 1% fetal calf serum. 250 μl each of this solution were incubated in 24 perforated plates for 14 days at 37 ° C. and 5% CO ₂ . The colony forming units of the erythroid line (CFU-E) and the granulocyte / macrophages (CFU-GM) were microscopically reported as the number of colonies / 3000 cells. An individual examination of some methyl cellulose colonies was carried out and these were removed with a micropipette and subjected to the PCR analysis for HIV contamination. Colonies with more than 50 cells were counted as CFU-GM, and more than 3 clones of hemoglobin-containing red blood cells were counted as CFU-E. - 32 -

Lymphocyte function and proliferation

The lymphocyte function was tested in vitro using functional tests of the hematopoietic CD34-positive stem cells obtained from HIV-containing blood. For this purpose, 10 cells / ml in 2 ml of RIO medium in 24 perforated plates were stimulated with either anti-CD3 (clone 12F6) in the concentration of 0.1 μg / ml or PHA (5.0 μg / ml). After 6-48 hours of incubation, the supernatant for cytokines was examined in the interferon-γ and interleukin 4 ELISA according to the manufacturer's instructions.

Lymphocyte proliferation was performed at least 10 days after the last stimulation. In the mixed lymphocyte reaction, allogeneic mononuclear cells of the peripheral blood of HIV-negative donors irradiated with 30 Gγ were used in RPMI-1640 medium with 10% human AB serum in a cell density of 10 ⁶ cells / ml.

In each case 0.1 ml was added to the wells of a 96-well plate with a round bottom and 0.1 ml of cultured lymphocytes to be tested (10 ⁶ cells / ml) or with medium alone. For mitogen-induced proliferation, PHA (10 μg / ml) was added to the cultured lymphocytes in the medium described above (RPMI-1640/10% human AB serum). The cells were incubated for 5 days and incubated with radiolabelled thymidine (1 μCi / well) overnight. The stimulation indices represented the ratio of counts in stimulated cultures divided by counts in unstimulated cultures. - 33 -

Zvtotoxicity tests

The HIV-specific cytotoxic T cell response was examined as follows: B-lymphocyte cell lines were established from patient blood by immortalization with the Epstein-Barr virus. These were infected with recombinant vaccinia viruses that express either the E. coli Lac Z gene or the HIV genes (gag, pol and env) of HIV-1 IIIB. To activate the natural killer function or the lymphokine To investigate killer function, K562 and Daudi cells were used as target cells. The target cells were labeled with sodium chromate, which contained radioactive chromium-51. The effector cells were either autologous mononuclear cells of the peripheral blood or the cultured and propagated lymphocytes (especially CD8 lymphocytes) and were added to the microtiter plates in a ratio of 50: 1, 25: 1, 12.5: 1 and 6.25 : 1 added. The controls included medium and target cells alone to determine the spontaneous release of the radioactive chromium without specific lysis. The maximum lysis was determined by treating the target cells with detergents. After 4-5 hours of incubation at 37 ° C., the cell supernatants were harvested and the number of counts was determined in a γ counter. The relative lysis of the target cells was calculated as follows: Percent lysis = ([experimental counts / min. - spontaneous counts / min.]: [Maximum release of detergent treatment counts / min. Spontaneous release counts / min.]) X 100.

In summary, it can be stated that the CD34-positive stem cells obtained in this way have not been damaged in terms of their differentiability as a result of the method according to the invention - 34 -

have and can also be used according to the invention, as outlined above.

The features of the invention disclosed in the above description and in the claims can be essential both individually and in any combination for realizing the invention in its various embodiments.

Claims

- 35 -Procedures for removing and / or inactivating virus claims

1. A method for removing and / or inactivating viruses from / in a fluid comprising viruses and particles, characterized in that the fluid comprises a filter comprising a matrix and particles of crosslinked crospovidone iodine and / or crospovidone hydrogen peroxide embedded therein to be led.

2. A method for removing and / or inactivating viruses from / in a fluid comprising viruses and particles, characterized in that the particles are separated from the fluid and the particle-free fluid at least once via a matrix and particles of cross-linked crospovidone iodine and embedded therein / or crospovidone water - 36 -

peroxide filter is performed.

3. The method according to claim 1 or 2, characterized in that the particles are cellular blood components.

4. The method according to any one of claims 1 to 3, characterized in that the cellular blood components are selected from the group comprising hematopoietic stem and precursor cells, erythrocytes, platelets, lymphocytes, monocytes / macrophages and combinations thereof.

5. The method according to claim 4, characterized in that the cellular components are differentiated cells and / or stem cells.

6. The method according to claim 5, characterized in that the cellular components comprise CD34-positive hematopoietic stem cells.

7. The method according to any one of claims 1 to 6, characterized in that the fluid is blood.

8. The method according to any one of claims 1 to 7, characterized in that the viruses are selected from the group consisting of hepatitis B, hepatitis C, cytomegalovirus, Epstein-Barr viruses and human herpes virus, in particular human herpes virus 6 , 7 and 8, and human immunodeficiency virus.

9. The method according to any one of claims 1 to 8, characterized in that before the particles are passed over the filter, these based on their physical, - 37 -

chemical, phenotypic and / or genotypic characteristics are fractionated.

10. The method according to any one of claims 1 to 9, characterized in that after the particles have been passed over the filter, they are further fractionated based on their physical, chemical, phenotypic and / or genotypic characteristics.

11. The method according to any one of claims 1 to 10, characterized in that the particles obtainable by one of the methods according to one of the preceding claims are blood cells and these are stimulated to multiply and / or differentiate.

12. The method according to claim 11, characterized in that the blood cells are CD34 -positive stem cells.

13. The method according to any one of claims 1 to 12, characterized in that the fluid comprising viruses and particles is obtained from a mammalian host organism, and in particular in the mammalian host organism before the fluid comprising the viruses and particles is removed, the number of hematopoietic tables present in peripheral blood Precursor and stem cells are increased.

14. The method according to claim 13, characterized in that the number of haematopoietic progenitor and stem cells present in peripheral blood is increased by administration to the mammalian host organism of an agent for increasing the content of haematopoietic stem and progenitor cells in peripheral blood. - 38 -

15. The method according to any one of claims 1 to 14, characterized in that the mammalian host organism is a human organism.

16. The method according to any one of the preceding claims for the production of virus-free blood components from virus-containing blood.

17. Virus-free blood components, including these comprehensive preparations, can be prepared by one of the above methods.

18. Device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, characterized in that the device comprises at least one device for separating the particles from the fluid and a filter device which has at least one matrix and embedded therein Filters comprising cross-linked crospovidone iodine and / or crospovidone hydrogen peroxide filter.

19. The apparatus of claim 18 for use in a method according to any one of the preceding claims.

20. A method for reducing the virus titer in body fluids of an animal organism, characterized in that a method according to one of the preceding claims is used.

21. The method according to claim 20, characterized in that the particles and / or the fluid are passed several times over the filter. - 39 -

22. The method according to claim 20 or 21, characterized in that the fluid obtained after the passage through the filter and / or the particles obtained after the passage through the filter are supplied to an animal organism.

23. The method according to claim 22, characterized in that CD34-positive stem cells are supplied to the animal organism.

24. The method according to any one of claims 20 to 23, characterized in that the immune system of the animal organism is destroyed before the supply of cellular blood components in an animal organism.

25. The method according to any one of claims 20 to 24, characterized in that the method for reducing the virus titer in body fluids of an animal organism is repeated at intervals.

26. The method according to any one of claims 20 to 25, characterized in that the body fluid is blood.

27. The method according to any one of claims 20 to 26, characterized in that the animal organism is a mammal, and in particular a human.

28. The method according to any one of claims 20 to 27, characterized in that the animal organism is chronically ill with a viral disease.

29. Means for increasing the content of hematopoietic - 40 -

Stem and progenitor cells in peripheral blood, characterized in that they contain two components intended for sequential administration, the first component comprising an antiviral compound and the second component comprising a combination of at least one antiviral compound and a hematopoietically active compound.

30. Composition according to claim 29, characterized in that the antiviral compound is selected from the group comprising Retrovir ^® , ganciclovir and others.

31. Composition according to claim 29 or 30, characterized in that the hematopoietically active compound is selected from the group comprising the granulocyte colony-stimulating factor G-CSF and others.

32. Agent according to one of claims 29 to 31, characterized in that the first component is intended for administration over a period of 10 to 28 days.

33. Agent according to one of claims 29 to 32, characterized in that the second component is intended for administration over a period of 5 to 10 days.

34. Agent according to one of claims 29 to 33, characterized in that a total time of 15 to

38 days for taking the first and second components.

35. Agent according to one of claims 29 to 34, characterized - 41 -

characterized in that the two components are spatially separated and made up in a packaging unit, the administration units forming the components being individually removable.

36. Composition according to claim 35, characterized in that the administration units are daily units.

37. Agent according to one of claims 29 to 36, characterized in that when Retrovir ^{® is} the first component and granulocyte colony-stimulating factor G-CSF together with Retrovir ^{® is} the second component, the first component 9 daily units of Retrovir, each 2 g for oral administration and the second component 5 daily units each consisting of 2 g retrovir for oral administration and 5-20 μg / kg body weight granulocyte colony-stimulating factor G-CSF.

38. Use of an agent according to one of the preceding claims in a method for removing and / or inactivating viruses from / in a fluid comprising viruses and particles and in particular in a method according to one of the preceding claims.

39. Use of a device for removing and / or inactivating viruses from / in a fluid comprising particles and viruses, in particular according to one of the preceding claims, in a method for reducing the virus titer in body fluids of an animal organism, in particular in a method according to one of the preceding claims.