WO1999035285A2 - Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes - Google Patents

Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes Download PDF

Info

Publication number
WO1999035285A2
WO1999035285A2 PCT/EP1999/000148 EP9900148W WO9935285A2 WO 1999035285 A2 WO1999035285 A2 WO 1999035285A2 EP 9900148 W EP9900148 W EP 9900148W WO 9935285 A2 WO9935285 A2 WO 9935285A2
Authority
WO
WIPO (PCT)
Prior art keywords
bacteria
probe
maduromycetes
rrna
nucleic acid
Prior art date
Application number
PCT/EP1999/000148
Other languages
French (fr)
Other versions
WO1999035285A3 (en
Inventor
Olga Genilloud
Rafael P. Mellado
Victor Parro
Vicente Rodriguez
Original Assignee
Merck Sharp & Dohme De Espana, S.A.E.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck Sharp & Dohme De Espana, S.A.E. filed Critical Merck Sharp & Dohme De Espana, S.A.E.
Priority to CA002317897A priority Critical patent/CA2317897A1/en
Priority to EP99901595A priority patent/EP1044284A2/en
Publication of WO1999035285A2 publication Critical patent/WO1999035285A2/en
Publication of WO1999035285A3 publication Critical patent/WO1999035285A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the invention relates to nucleic acid probes which specifically differentiate between the Actinomadura madurae group of bacteria and Maduromycetes. This invention also relates to assays using these probes.
  • nucleic acid probes made of genomic DNA, plasmids, riboprobes or synthetic oligonucleotides, may target the genomic DNA or certain RNA species present in biological samples.
  • the use of synthetic oligonucleotides as probes is largely preferred because oligonucleotides can be rapidly synthesized in large amounts using chemical methods, have a long shelf- life, and are easily to purify and to label.
  • Species-specific probes have been described for a large number of microorganisms.
  • the 16S and 23S rRNA genes are quite often used for probe development since sequences can easily be obtained using described methods and it is known that variable regions exist within these highly conserved genes which can be used for species-specific detection.
  • Universal probes for the detection of bacteria are known (Giovannoni, S.J. et ai, 1988, J. Bacteriol. 170: 720-726 and Barry, T. et al., 1991 , supra).
  • the Actinomycetes are aerobic, gram-positive bacteria which form branching, usually non-fragmenting hyphae and asexual spores borne on aerial mycelia. Data from 16S rRNA sequences has allowed the construction of an evolutionary tree for this order which is quite complex, containing some 37 genera in at least seven groups which include the Streptomycetes and the Maduromycetes. (Goodfellow, M., 1989, "Suprageneric classification of Actinomycetes", Bergey's Manual of Systematic Bacteriology Vol. 4, Williams and Wilkins pp. 2333-2339).
  • This invention relates to nucleic acid probes which hybridize to nucleic acids encoding a portion of the 16S rRNA of certain bacteria belonging to the genus Actinomadura under hybridization conditions, and which do not hybridize to nucleic acids encoding a portion of 16S rRNA of Maduromycetes bacteria or bacteria belonging to the genus Streptomyces under identical hybridization conditions.
  • This invention also relates to nucleic acid probes which hybridize to nucleic acids encoding a portion of the 16S rRNA of bacteria belonging to Maduromycetes under hybridization conditions, and which do not hybridize to nucleic acids encoding a portion of 16S rRNA of certain bacteria belonging to the genus Actinomadura nor to the genus Streptomyces under identical hybridization conditions.
  • Another aspect of this invention is a method for detecting the presence of bacteria related to the Actinomadura madurae group of bacteria in a sample comprising: a) contacting the sample with a nucleic acid probe; wherein said probe hybridizes to nucleic acid encoding 16S rRNA from the Actinomadura madurae group of bacteria, but not to nucleic acids encoding Streptomycetes or Maduromycetes 16S rRNA; b) imposing hybridization conditions, and c) determining if hybridization has occurred.
  • Yet another aspect of this invention is a method of differentiating the Actinomadura madurae group of bacteria from Maduromycetes and Streptomycetes in a bacteria sample comprising: a) lysing the bacteria to release bacterial DNA; b) extracting the bacterial DNA; c) contacting the extracted DNA with a probe comprising the sequence of a CNB-BIT2 probe under hybridizing conditions; and d) determining if hybridization of the probe to the extracted DNA has occurred.
  • Another aspect of this invention is a method for detecting the presence of Maduromycetes in a sample comprising: a) contacting the sample with a nucleic acid probe; wherein said probe hybridizes to nucleic acid encoding Maduromycetes 16S rRNA, but not to nucleic acids encoding streptomycetes 16S rRNA or 16S rRNA from the Actinomadura madurae group of bacteria. b) imposing hybridization conditions, and c) determining if hybridization has occurred.
  • Yet another aspect of this invention is a method of differentiating Maduromycetes from Streptomycetes and the Actinomadura madurae group of bacteria in a bacterial sample comprising: a) lysing the bacteria to release bacterial DNA; b) extracting the bacterial DNA; c) contacting the extracted DNA with a probe comprising the sequence of a CNB-BIT2M probe under hybridizing conditions; and d) determining if hybridization of the probe to the extracted DNA has occurred.
  • a further embodiment of this invention includes a kit for the differentiation of a bacteria from the Maduromycetes group from the Actinomadura madurae group of bacteria which comprises two probes: a first probe specific for the Actinomadura madurae group, approximately from 10 to 250 nucleotides in length which is complementary to or homologous with at least 90% of a nucleic acid sequence base pairs 419 to 437 of Actinomadura madurae encoding the mature 16S rRNA molecule; and a second probe, specific for the Maduromycetes bacteria, of from approximately 10-250 nucleotides in length which is complementary to or homologous with at least 90% of a nucleic acid sequence comprising base pairs 410 to 429 of Strepstosporangium vulgare encoding the mature 16S rRNA molecule (Wang, Y. et al., 1996, supra)
  • the kit may additionally comprises reagents, compositions, instructions, disposable hardware and suitable packaging.
  • Actimadura madurae group of bacteria means the group of Actinomadura modurae bacteria as used in Bergey's Manual of Bacteriology and includes six related species of Actinomadura: A. citrea A. coerula, A. cremea, A. malachitica, A. pelletieri, and A. verrucosospora.
  • probe will refer to synthetic or biologically produced nucleic acids, between approximately 10 and 250 base pairs in length which contain specific nucleotide sequences that allow specific and preferential hybridization under predetermined conditions to target nucleic acid sequences, and optionally contain a moiety for detection or for enhancing assay performance.
  • a minimum of ten nucleotides is generally necessary in order to statistically obtain specificity and to form stable hybridization products, and a maximum of 250 nucleotides generally represents an upper limit for length in which reaction parameters can be easily adjusted to determine mismatched sequences and preferential hybridization.
  • Probes may optionally contain certain constituents that contribute to their proper or optimal functioning under certain assay conditions.
  • probes may be modified to improve their resistance to nuclease degradation (for example, by end-capping), to carry detection ligands (for example fluorescein, 32p ? biotin, etc.) or to facilitate their capture onto a solid support (for example, poly-deoxyadenosine "tails").
  • detection ligands for example fluorescein, 32p ? biotin, etc.
  • a solid support for example, poly-deoxyadenosine "tails”
  • homology and “homologous to” are meant to refer to the degree of similarity between to or more nucleic acid sequences and is not meant to imply any taxonomic relatedness between organisms.
  • the degree of similarity is expressed as a percentage, i.e., 90% homology between two sequences will mean that 90% of the bases of the first sequence are identically matched to the bases of the second sequence.
  • Specific means that a nucleotide sequence will hybridize to a predetermined target sequence and will not substantially hybridize to a non-target sequence.
  • Specifically discriminate means that a probe will substantially hybridize to a predetermined target sequence and will not substantially hybridize to a non-target sequence.
  • Hybridization is a process by which, under predetermined reaction conditions, two partially or completely complementary strands of nucleic acid are allowed to come together in an antiparallel fashion to form a double stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules pertaining to which nucleic acid bases may pair with one another.
  • Substantial hybridization means that the amount of hybridization observed will be such that one observing the results would consider the result positive in a clinical setting. Data which is considered “background noise” is not substantial hybridization.
  • Stringency hybridization conditions means approximately 35°C to 65°C in a salt solution of approximately 0.9 molar NaCl. Stringency may also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of denaturing agents present, and the temperature of hybridization. Generally as hybridization conditions become more stringent, longer probes are preferred if stable hybrids are to be formed. As a rule, the stringency of the conditions under which a hybridization is to take place will dictate certain characteristics of the preferred probes to be employed. Such relationships are well understood and can be readily manipulated by those skilled in the art.
  • the probe In designing a probe for identification purposes it is preferred that the probe should be as specific as necessary (i.e., it should not cross-react with undesired nucleic acids) and it should be highly sensitive (i.e. most if not all, strains of the organism to be detected should react with the probe).
  • the preferred target sequences should have the following characteristics: a) the sequence should be present in the genome of each strain of the microorganism concerned; and b) the evolutionary diversity of the sequence should be such that, on the one hand, there is sufficient sequence-diversity to allow differentiation of the species concerned from other closely related species and, in the other hand, sufficient sequence-conservation to allow detection of the strain of concern with the probe used.
  • the second is designated BIT-R: 5' CCGCCTACGA- GCTCTTTACGCCCA 3' (SEQ.ID.NO.:2) which is base pairs 514-537 from the Maduromycetes and Streptomycetes DNA encoding mature 16S rRNA (Wang, Y. et al., 1996, supra). Both of these can be used as primers in polymerase chain reaction technology to amplify the DNA region to obtain a preferred probe of this invention. Designated large quantities of the probe can be generated using known PCR techniques such as those in U.S. Patents 4,683,202 and 4,683, 195.
  • CNB-BIT2 was derived from a variable region of the 16S rRNA molecule. It comprises the sequence 5' GAAGCTAACGTG- ACGGTAC 3' (SEQ.ID.NO.3), which is DNA corresponding to base pairs 419- 437 from the Actinomadura madurae DNA encoding mature 16S rRNA.
  • probes similar to CNB-BIT2 may be made by increasing or decreasing the length of CNB-BIT2. For a longer probe, it is preferred that additional nucleotides (either 3' or 5') be those of the corresponding Actinomadura madurae DNA encoding mature 16S rRNA.
  • probes which are at least 80% homologous to CNB-BIT2, and preferably at least 90% homologous to CNB- BIT2.
  • CNB-BIT2M was derived from a variable region of the 16S rRNA moelcule. It comprises the sequence 5' GAAGTTGAC- GTGTACCTGCA 3' (SEQ.ID.NO:4), which is Maduromycetes DNA corresponding to base pairs 410-429 from the Maduromycetes DNA encoding mature 16S rRNA.
  • probes similar to CNB- BIT2M may be made by increasing or decreasing the length of CNB-BIT2M. For a longer probe, it is preferred that additional nucleotides (either 3 ' or 5') be those of the corresponding Maduromycetes DNA encoding mature 16S rRNA.
  • probes which are at least 80% homologous to CNB-BIT2M, and preferably at least 90% homologous to CNB- BIT2M.
  • One embodiment of this invention is a nucleic acid, designated CNB-BIT2, which provides specific binding to the chromosomal DNA encoding the mature part of the 16S rRNA molecule of bacteria from the Actinomadura madurae group and does not substantially hybridize to the equivalent chromosomal region from bacteria belonging either to the closely related Maduromycetes taxa or to the genus Streptomyces.
  • Another embodiment of this invention is a nucleic acid, designated CNB-BIT2M, which provides specific binding to the chromosomal DNA encoding the mature part of the 16S rRNA molecule of bacteria from the Maduromycetes taxa and does not substantially hybridize to the equivalent chromosomal region from bacteria belonging to the closely related Actinomadura madurae group or to the genus Streptomyces.
  • the preferred probes of this invention generally contain from at least about 23 nucleotides to about 235 nucleotides (the maximum number of nucleotides of the precursor region plus the mature region plus the regulatory region of the genes coding for the 16S rRNA).
  • the probe will contain from about 23 nucleotides to about 235 nucleotides resulting from the PCR amplification of a DNA fragment comprising a DNA sequence hybridizing with the 23 nucleotides long CNB-BIT2 and CNB-BIT2M probes.
  • the invention also relates to probes for use in hybridization assays, which use an oligonucleotide that is sufficiently complementary to hybridize to a sequence of the chromosomal DNA region encoding the mature 16S rRNA from either the Maduromycetes or the Actinomadura madurae group of bacteria but is not complementary enough to hybridize to the equivalent region from far related Gram positive bacteria as the bacterium Bacillus subtilis.
  • a particularly preferred assay in accordance with this invention is a Southern Blot.
  • One probe which can be used for a Southern blot assay is about 235 bp long, obtained by PCR amplification of the DNA fragment obtained by use of the two primers BIT-N and BIT-R.
  • the Southern blot, or dot blot assay can be conducted using well known procedures. Generally, it involves the steps of immobilizing a target nucleic acid or population of nucleic acids on a filter such as nitrocellulose, nylon or other derivatized membranes which are readily commercially available. The immobilized nucleic acids are then tested for hybridization under predetermined stingency conditions with the probe of interest.
  • Hybridization can be detected in a number of ways.
  • the probe can be isotopically labeled with the addition of a 32p_p n osphorous moiety to the 5 '-end of the oligonucleotide by the conventional polynucleotide kinase reaction. After hybridization has occurred, unhybridized probe is removed by washing. The filters are exposed to x-ray film and the intensity of the hybridization signals is evaluated.
  • the probes of this invention may be chemically synthesized using commercially available methods and equipment.
  • the solid phase phosphoramidite methods can be used to produce short oligonucleotides between 15 and 30 nucleotides long.
  • this invention is preferred to chemically synthesize short DNA oligonucleotides using any of the Applied Biosystems DNA Synthesizers, using reagents supplied by the same company.
  • the chemically synthesized oligonucleotides were obtained from Boehringer Mannheim.
  • streptomyces ambofaciens Streptomyces ambofaciens, S. antibioticus, S. cinnamonensis, S. coelicolor A3 (2), S. fradiae, S. lividans TK21 , S. nataliensis, S. peucetius, S. violascens and Streptomyces sp. Procedures used for the growth and manipulation of the bacteria related this invention and general DNA manipulation were as described (Hopwood et al, 1985, Genetic Manipulation of Streptomyces. A Laboratory Manual. John Innes Foundation. Norwich; and Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press.
  • Genomic DNA was prepared as follows: Approximately 0.5-1.0 g mycelia were resuspended in 2 ml lysis buffer (NaCl 0.1 M, EDTA 50 mM, pH 8.0) containing glass beads (3 mm diameter) and the suspension was vortexed for 2 minutes before adding 2 ml of lysis buffer plus 10- 15 mg lysozyme and 50 mg ml " l RNase DNase-free. The suspension was incubated for 30-80 min. at 37°C. After the addition of 500 ml 10% SDS (w/v), the solution was incubated at 37°C for 15 min.
  • the glass beads were removed and the DNA extracted four times with 1 volume of phenol/chloroform/isoamyl alcohol (25:24: 1 ) and once more with 1 volume of chloroform.
  • the extracted DNA was ethanol precipitated, dried and resuspended in 500 ml distilled water.
  • 20 mg of the chromosomal DNA extracted from each strain was restricted with 50 units of the endonucleases BamHI or PstI by incubation in the respective buffers as recommended by the supplier (Boehringer Mannheim) at 37°C for 16 h and the samples fractionated by electrophoresis in 0.8% agarose gels.
  • the fractionated DNA fragments were transferred to Hybond N+ membranes (Amersham, pic.) by capillary transfer for 16 h.
  • the DNA immobilized in the solid support was then washed with a hybridization buffer containing 5 x SSC, 5 x Denhardt's solution and 0.5% SDS and allowed to hybridize with 10 pmol of the radioactively labeled CNB-BIT2 or CNB-BIT2M probe in the same buffer for 16 h at 45°C.
  • the solid supports were then washed three times with lx SSC (0.15 M NaCl plus 0.015 M sodium citrate, pH 7.2) and 0.5% SDS at the hybridization temperature.
  • the solid supports were then set to exposure in X-ray films at -70°C prior to be developed.
  • the CNB-BIT2M probe hybridized with all the Maduromycetes strains listed in the table above but not with the Actinomadura madurae group of strains nor with the Streptomyces strains mentioned above.
  • the CNB-BIT2 probe hybridized with all the Actinomadura madurae group of strains listed in the table above but not with the Maduromycetes strains nor with the Streptomyces strains mentioned above.
  • both probes also gave a negative result with low G+C content genomic DNA from the far related bacterium Bacillus subtilis carried as a negative control.
  • CNB-BIT2 can differentiate between the Actinomadura madurae group of bacteria and Maduromycetes in hybridization with genomic DNA and that CNB-BIT2M can differentiate between Maduromycetes and the Actinomadura madurae group of bacteria in hybridization with genomic DNA.
  • Chromosomal DNA from all the strains used in Example 1 was extracted as described and the extracted DNA was used for PCR amplification using primers BIT-N: 5' CCAAGACTCCTACGGGAGGCAGCAG 3' (SEQ.ID.NO.T) and BIT-R: 5' CCGCCTACGAGCTCTTTACGCCCA 3' (SEQ.ID.NO.:2).
  • genomic DNA template Approximately 0.5- 1.0 mg genomic DNA template was used with 280 ng of each primer in a final reaction volume of 100 ml of a incubation buffer containing 16.6 mM (NH4)2S04, 67 mM Tris-HCl (pH 8.8), 0.1 % Tween- 20 and 1 mM MgCl2- Amplifications were performed in automated thermocyclers by incubation at 95°C (5 min) followed by 30 cycles of incubation at 95°C (1 min), 55°C (1 min) and 72°C (1 min) in the presence of one unit of EcoTaq polymerase (Ecogen).
  • EcoTaq polymerase EcoTaq polymerase
  • the resulting about 235 bp long amplified DNA fragments were fractionated by electrophoresis in 1.5% agarose gels.
  • the fractionated DNA fragments were transferred to Hybond N+ membranes (Amersham, pic.) by capillary transfer for 16 h.
  • the DNA immobilized in the solid support was then washed with a hybridization buffer containing 5 x SSC, 5 x Denhardt's solution and 0.5% SDS and set to hybridize with 10 pmol of the radioactively labeled CNB-BIT2 or CNB-BIT2M probes in the same buffer for 16 h at 45°C.
  • the solid supports were then washed three times with l x SSC (0.15 M NaCl plus 0.015 M sodium citrate, pH 7.2) and 0.5% SDS at the hybridization temperature. The solid supports were then set to exposure in X-ray films at -70°C prior to be developed.
  • the CNB-BIT2M probe hybridized with all the approximately 235 bp long PCR amplified fragments from all the Maduromycetes strains listed in the Table above but not with the Actinomadura madurae group of strains nor with the Streptomyces strains mentioned above.
  • the CNB-BIT2 probe hybridized with all the approximately 235 bp long PCR amplified fragments from the Actinomadura madurae group of strains listed in the Table above but not with the Maduromycetes strains nor with the Streptomyces strains mentioned above.
  • CNB-BIT2 can differentiate between the Actinomadura madurae group and Maduromycetes in hybridization with genomic DNA and that CNB-BIT2M can differentiate between Maduromycetes and the Actinomadura madurae group of bacteria in hybridization with genomic DNA; both of them gave negative hybridization with DNA from the Streptomyces strains listed above.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Saccharide Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a method to differentiate between bacteria from the Actinomadura madurae group of bacteria and the Maduromycetes taxa using two nucleic acid probes that are complementary to a conserved region of the Maduromycetes 16S rRNA genes and to a conserved region of the Actinomadura madurae group of bacteria 16S rRNA genes, respectively. The probes permit the rapid detection of DNA coding for the 16S rRNA in a sample differentiating the Actinomadura madurae group of bacteria from Maduromycetes within the Actinomycetales order as well as the A. madurae group of bacteria and Maduromycetes from streptomycetes. The method is accurate and reproducible.

Description

HYBRIDIZATION PROBES WHICH DIFFERENTIATE BETWEEN THE ACTINOMADURA MADURAE GROUP OF BACTERIA AND MADUROMYCETES
CROSS-REFERENCE TO RELATED APPLICATIONS
Not Applicable.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D Not Applicable.
REFERENCE TO MICROFICHE APPENDIX
Not Applicable.
FIELD OF THE INVENTION
The invention relates to nucleic acid probes which specifically differentiate between the Actinomadura madurae group of bacteria and Maduromycetes. This invention also relates to assays using these probes.
BACKGROUND OF THE INVENTION
Although much progress have been made in the last decade for the identification of microorganisms, the procedures in use are often still laborious, non-sensitive and not specific. Many of these pitfalls can be overcome by using nucleic acid probes. These nucleic acid probes, made of genomic DNA, plasmids, riboprobes or synthetic oligonucleotides, may target the genomic DNA or certain RNA species present in biological samples. The use of synthetic oligonucleotides as probes is largely preferred because oligonucleotides can be rapidly synthesized in large amounts using chemical methods, have a long shelf- life, and are easily to purify and to label.
Traditional methods for describing the make up of natural microbial communities, while expensive and laborious, only permit the identification of those microorganisms that can be cultivated in the laboratory. It is generally considered that less than 20% of the microorganisms in nature have been discovered, and that the development of new culture-independent methods for studying the composition of microbial communities are needed. (Ward, D.M. et al., 1990 Nature, 345: 63-64). The sequence of 16S rRNA, a common but distinctive cellular element, has already been used for this purpose, and has revealed the presence of numerous uncultured microorganisms in natural communities (Ward, D.M. et al., supra; Giovannoni, S.J. et ai. 1990, Nature, 345: 60-63; Barry T. et al, 1991 , In PCR Methods and Applications, Cold Spring Harbour, pp 51 -56; Mehling, A. et al., 1995, Microbiology, 141 : 2139-2147; and Rheims, H. et al., 1996, Microbiology, 142: 2863-2870).
Species-specific probes have been described for a large number of microorganisms. The 16S and 23S rRNA genes are quite often used for probe development since sequences can easily be obtained using described methods and it is known that variable regions exist within these highly conserved genes which can be used for species-specific detection. Universal probes for the detection of bacteria are known (Giovannoni, S.J. et ai, 1988, J. Bacteriol. 170: 720-726 and Barry, T. et al., 1991 , supra).
The Actinomycetes are aerobic, gram-positive bacteria which form branching, usually non-fragmenting hyphae and asexual spores borne on aerial mycelia. Data from 16S rRNA sequences has allowed the construction of an evolutionary tree for this order which is quite complex, containing some 37 genera in at least seven groups which include the Streptomycetes and the Maduromycetes. (Goodfellow, M., 1989, "Suprageneric classification of Actinomycetes", Bergey's Manual of Systematic Bacteriology Vol. 4, Williams and Wilkins pp. 2333-2339).
Currently the art is silent as to a simple yet robust method to discriminate between close groups of actinomycetes which occur in natural isolates, particularly for those bacteria which develop aerial mycelia prior to release of their spores. It would be desirable to have nucleic acid probes which could be used in fast, accurate assays which could differentiate between actinomycetes grouped around Actinomadura madurae and Maduromycetes within the Maduromycetes taxa.
DETAILED DESCRIPTION OF THE INVENTION
This invention relates to nucleic acid probes which hybridize to nucleic acids encoding a portion of the 16S rRNA of certain bacteria belonging to the genus Actinomadura under hybridization conditions, and which do not hybridize to nucleic acids encoding a portion of 16S rRNA of Maduromycetes bacteria or bacteria belonging to the genus Streptomyces under identical hybridization conditions. This invention also relates to nucleic acid probes which hybridize to nucleic acids encoding a portion of the 16S rRNA of bacteria belonging to Maduromycetes under hybridization conditions, and which do not hybridize to nucleic acids encoding a portion of 16S rRNA of certain bacteria belonging to the genus Actinomadura nor to the genus Streptomyces under identical hybridization conditions.
Another aspect of this invention is a method for detecting the presence of bacteria related to the Actinomadura madurae group of bacteria in a sample comprising: a) contacting the sample with a nucleic acid probe; wherein said probe hybridizes to nucleic acid encoding 16S rRNA from the Actinomadura madurae group of bacteria, but not to nucleic acids encoding Streptomycetes or Maduromycetes 16S rRNA; b) imposing hybridization conditions, and c) determining if hybridization has occurred.
Yet another aspect of this invention is a method of differentiating the Actinomadura madurae group of bacteria from Maduromycetes and Streptomycetes in a bacteria sample comprising: a) lysing the bacteria to release bacterial DNA; b) extracting the bacterial DNA; c) contacting the extracted DNA with a probe comprising the sequence of a CNB-BIT2 probe under hybridizing conditions; and d) determining if hybridization of the probe to the extracted DNA has occurred.
Another aspect of this invention is a method for detecting the presence of Maduromycetes in a sample comprising: a) contacting the sample with a nucleic acid probe; wherein said probe hybridizes to nucleic acid encoding Maduromycetes 16S rRNA, but not to nucleic acids encoding streptomycetes 16S rRNA or 16S rRNA from the Actinomadura madurae group of bacteria. b) imposing hybridization conditions, and c) determining if hybridization has occurred.
Yet another aspect of this invention is a method of differentiating Maduromycetes from Streptomycetes and the Actinomadura madurae group of bacteria in a bacterial sample comprising: a) lysing the bacteria to release bacterial DNA; b) extracting the bacterial DNA; c) contacting the extracted DNA with a probe comprising the sequence of a CNB-BIT2M probe under hybridizing conditions; and d) determining if hybridization of the probe to the extracted DNA has occurred.
A further embodiment of this invention includes a kit for the differentiation of a bacteria from the Maduromycetes group from the Actinomadura madurae group of bacteria which comprises two probes: a first probe specific for the Actinomadura madurae group, approximately from 10 to 250 nucleotides in length which is complementary to or homologous with at least 90% of a nucleic acid sequence base pairs 419 to 437 of Actinomadura madurae encoding the mature 16S rRNA molecule; and a second probe, specific for the Maduromycetes bacteria, of from approximately 10-250 nucleotides in length which is complementary to or homologous with at least 90% of a nucleic acid sequence comprising base pairs 410 to 429 of Strepstosporangium vulgare encoding the mature 16S rRNA molecule (Wang, Y. et al., 1996, supra)
The kit may additionally comprises reagents, compositions, instructions, disposable hardware and suitable packaging.
As used throughout this application and claims, the following definitions apply.
"Actimadura madurae group of bacteria" means the group of Actinomadura modurae bacteria as used in Bergey's Manual of Bacteriology and includes six related species of Actinomadura: A. citrea A. coerula, A. cremea, A. malachitica, A. pelletieri, and A. verrucosospora.
The term "probe" will refer to synthetic or biologically produced nucleic acids, between approximately 10 and 250 base pairs in length which contain specific nucleotide sequences that allow specific and preferential hybridization under predetermined conditions to target nucleic acid sequences, and optionally contain a moiety for detection or for enhancing assay performance. A minimum of ten nucleotides is generally necessary in order to statistically obtain specificity and to form stable hybridization products, and a maximum of 250 nucleotides generally represents an upper limit for length in which reaction parameters can be easily adjusted to determine mismatched sequences and preferential hybridization. Probes may optionally contain certain constituents that contribute to their proper or optimal functioning under certain assay conditions. For examples, probes may be modified to improve their resistance to nuclease degradation (for example, by end-capping), to carry detection ligands (for example fluorescein, 32p? biotin, etc.) or to facilitate their capture onto a solid support (for example, poly-deoxyadenosine "tails"). "Preferential hybridization" or "hybridizing preferentially" means that hybridization with the intended target nucleic acid results in a hybridization reaction product which is more stable than any hybridization reaction product resulting from hybridization with a non-target nucleic acid under identical conditions. It is well within the skill of the ordinary artisan to compare stability of hybridization reaction products and evaluate which one is more stable, i.e. determine which one has bound "preferentially".
The terms "homology" and "homologous to" are meant to refer to the degree of similarity between to or more nucleic acid sequences and is not meant to imply any taxonomic relatedness between organisms. The degree of similarity is expressed as a percentage, i.e., 90% homology between two sequences will mean that 90% of the bases of the first sequence are identically matched to the bases of the second sequence.
"Specific" means that a nucleotide sequence will hybridize to a predetermined target sequence and will not substantially hybridize to a non- target sequence.
"Specifically discriminate" means that a probe will substantially hybridize to a predetermined target sequence and will not substantially hybridize to a non-target sequence.
"Hybridization" is a process by which, under predetermined reaction conditions, two partially or completely complementary strands of nucleic acid are allowed to come together in an antiparallel fashion to form a double stranded nucleic acid with specific and stable hydrogen bonds, following explicit rules pertaining to which nucleic acid bases may pair with one another.
"Substantial hybridization" means that the amount of hybridization observed will be such that one observing the results would consider the result positive in a clinical setting. Data which is considered "background noise" is not substantial hybridization.
"Stringent hybridization conditions" means approximately 35°C to 65°C in a salt solution of approximately 0.9 molar NaCl. Stringency may also be governed by such reaction parameters as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of denaturing agents present, and the temperature of hybridization. Generally as hybridization conditions become more stringent, longer probes are preferred if stable hybrids are to be formed. As a rule, the stringency of the conditions under which a hybridization is to take place will dictate certain characteristics of the preferred probes to be employed. Such relationships are well understood and can be readily manipulated by those skilled in the art.
In designing a probe for identification purposes it is preferred that the probe should be as specific as necessary (i.e., it should not cross-react with undesired nucleic acids) and it should be highly sensitive (i.e. most if not all, strains of the organism to be detected should react with the probe). Hence, the preferred target sequences should have the following characteristics: a) the sequence should be present in the genome of each strain of the microorganism concerned; and b) the evolutionary diversity of the sequence should be such that, on the one hand, there is sufficient sequence-diversity to allow differentiation of the species concerned from other closely related species and, in the other hand, sufficient sequence-conservation to allow detection of the strain of concern with the probe used.
Comparison and alignment of the Maduromycetes and the Actinomadura madurae group of bacteria 16S rDNA sequences present in data bases confirmed the existence of the so-called variable regions that appears in all 16S rDNA of actinomycetes, but also allowed the identification of a particular region within the Actinomadura madurae 16S rDNA, in which the homology with the Maduromycetes equivalent sequences seemed to be low, as well as the identification of the equivalent region within the Maduromycetes 16S rDNA in which the homology with the Actinomadura madurae group of bacteria equivalent sequences seemed to be low. Sequence comparison and analysis were carried out using programs from the UWGCG package (Version 9.0, December, 1996) and the Edit- View 1.0 DNA sequencer viewer (Applied Biosystems). 16S rDNA sequences were obtained from the NCBI Genbank database.
As a result of the sequence comparison, two primers were designed. This first is designated BIT-N: 5" CCAAGACTCCTACGGGAGGC- AGCAG 3' (SEQ.ID.NOT ) which is base pairs 302-326 from the Actinomadura madurae DNA encoding mature 16S rRNA. (Wang, Y. et al., 1996, Int. J. Syst. Bacterioi, 46: 958-663). The second is designated BIT-R: 5' CCGCCTACGA- GCTCTTTACGCCCA 3' (SEQ.ID.NO.:2) which is base pairs 514-537 from the Maduromycetes and Streptomycetes DNA encoding mature 16S rRNA (Wang, Y. et al., 1996, supra). Both of these can be used as primers in polymerase chain reaction technology to amplify the DNA region to obtain a preferred probe of this invention. Designated large quantities of the probe can be generated using known PCR techniques such as those in U.S. Patents 4,683,202 and 4,683, 195.
A preferred probe, CNB-BIT2, was derived from a variable region of the 16S rRNA molecule. It comprises the sequence 5' GAAGCTAACGTG- ACGGTAC 3' (SEQ.ID.NO.3), which is DNA corresponding to base pairs 419- 437 from the Actinomadura madurae DNA encoding mature 16S rRNA. In accordance with this invention, probes similar to CNB-BIT2 may be made by increasing or decreasing the length of CNB-BIT2. For a longer probe, it is preferred that additional nucleotides (either 3' or 5') be those of the corresponding Actinomadura madurae DNA encoding mature 16S rRNA.
Also included in this invention are probes which are at least 80% homologous to CNB-BIT2, and preferably at least 90% homologous to CNB- BIT2.
Another preferred probe, CNB-BIT2M, was derived from a variable region of the 16S rRNA moelcule. It comprises the sequence 5' GAAGTTGAC- GTGTACCTGCA 3' (SEQ.ID.NO:4), which is Maduromycetes DNA corresponding to base pairs 410-429 from the Maduromycetes DNA encoding mature 16S rRNA. In accordance with this invention, probes similar to CNB- BIT2M may be made by increasing or decreasing the length of CNB-BIT2M. For a longer probe, it is preferred that additional nucleotides (either 3 ' or 5') be those of the corresponding Maduromycetes DNA encoding mature 16S rRNA.
Another aspect of this invention are probes which are at least 80% homologous to CNB-BIT2M, and preferably at least 90% homologous to CNB- BIT2M.
One embodiment of this invention is a nucleic acid, designated CNB-BIT2, which provides specific binding to the chromosomal DNA encoding the mature part of the 16S rRNA molecule of bacteria from the Actinomadura madurae group and does not substantially hybridize to the equivalent chromosomal region from bacteria belonging either to the closely related Maduromycetes taxa or to the genus Streptomyces.
Another embodiment of this invention is a nucleic acid, designated CNB-BIT2M, which provides specific binding to the chromosomal DNA encoding the mature part of the 16S rRNA molecule of bacteria from the Maduromycetes taxa and does not substantially hybridize to the equivalent chromosomal region from bacteria belonging to the closely related Actinomadura madurae group or to the genus Streptomyces. The preferred probes of this invention generally contain from at least about 23 nucleotides to about 235 nucleotides (the maximum number of nucleotides of the precursor region plus the mature region plus the regulatory region of the genes coding for the 16S rRNA). More preferably, the probe will contain from about 23 nucleotides to about 235 nucleotides resulting from the PCR amplification of a DNA fragment comprising a DNA sequence hybridizing with the 23 nucleotides long CNB-BIT2 and CNB-BIT2M probes.
The invention also relates to probes for use in hybridization assays, which use an oligonucleotide that is sufficiently complementary to hybridize to a sequence of the chromosomal DNA region encoding the mature 16S rRNA from either the Maduromycetes or the Actinomadura madurae group of bacteria but is not complementary enough to hybridize to the equivalent region from far related Gram positive bacteria as the bacterium Bacillus subtilis.
A particularly preferred assay in accordance with this invention is a Southern Blot. One probe which can be used for a Southern blot assay is about 235 bp long, obtained by PCR amplification of the DNA fragment obtained by use of the two primers BIT-N and BIT-R. The Southern blot, or dot blot assay can be conducted using well known procedures. Generally, it involves the steps of immobilizing a target nucleic acid or population of nucleic acids on a filter such as nitrocellulose, nylon or other derivatized membranes which are readily commercially available. The immobilized nucleic acids are then tested for hybridization under predetermined stingency conditions with the probe of interest. Under stringent conditions probes with nucleotide sequences with greater complementary to the target will exhibit a higher level of hybridization than probes whose sequences have less homology. Hybridization can be detected in a number of ways. For example, the probe can be isotopically labeled with the addition of a 32p_pnosphorous moiety to the 5 '-end of the oligonucleotide by the conventional polynucleotide kinase reaction. After hybridization has occurred, unhybridized probe is removed by washing. The filters are exposed to x-ray film and the intensity of the hybridization signals is evaluated.
The probes of this invention may be chemically synthesized using commercially available methods and equipment. For example, the solid phase phosphoramidite methods can be used to produce short oligonucleotides between 15 and 30 nucleotides long. For this invention is preferred to chemically synthesize short DNA oligonucleotides using any of the Applied Biosystems DNA Synthesizers, using reagents supplied by the same company. The chemically synthesized oligonucleotides were obtained from Boehringer Mannheim.
Maduromycetes strains which are detectable by the probes of this invention may be obtained from the ATCC collection and are listed in the following table:
STRAIN NAME ATCC NUMBER
Actinomadura citrea ATCC 27887
Actinomadura coerulea ATCC 33576
Actinomadura cremea ATCC 33577
Actinomadura spadix ATCC 27298
Actinomadura spiralis ATCC 351 14
Actinomadura fastidiosa ATCC 33516
Actinomadura ferruginea ATCC 35575
Actinomadura helvata ATCC 27295
Actinomadura livida ATCC 33578
Actinomadura madurae ATCC 19425
Actinomadura malachitica ATCC 27888
Actinomadura pusilla ATCC 27296
Actinomadura roseola ATCC 33579
Actinomadura rubra ATCC 27031
Actinomadura salmonea ATCC 33580
Actinomadura viridis ATCC 27103
Microbispora aerata ATCC 15448
Microbispora amethystogenes ATCC 15740
Microbispora diastatica ATCC 33325
Microbispora echinospora ATCC 27300
Microbispora parva ATCC 33326
Microbispora rosea ATCC 12950
Microtetraspora flexuosa ATCC 35864
Microtetraspora fusca ATCC 23058
Microtetraspora glauca ATCC 23057
Microtetraspora niveoalba ATCC 27301
Planobispora rosea ATCC 23866 Streptosporangium roseum ATCC 12428 Strepto porangium vulgare ATCC 33329
The following streptomycetes strains may be used in this invention: Streptomyces ambofaciens, S. antibioticus, S. cinnamonensis, S. coelicolor A3 (2), S. fradiae, S. lividans TK21 , S. nataliensis, S. peucetius, S. violascens and Streptomyces sp. Procedures used for the growth and manipulation of the bacteria related this invention and general DNA manipulation were as described (Hopwood et al, 1985, Genetic Manipulation of Streptomyces. A Laboratory Manual. John Innes Foundation. Norwich; and Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York). For DNA extraction, bacteria were grown in LB or YEME media at the ATCC recommended temperatures. Chromosomal DNA was purified from cultures growing in late exponential phase as described for maize (Dellaporta et al., 1985, "Maize DNA Miniprep". Molecular Biology of Plants- a Laboratory Course Manual. Cold Spring Harbor, N.Y. Cold Spring Harbor Laboratory, N.Y. USA. pp. 36-37) as adapted for Streptomyces (Mehling et al. 1995, Microbiology, 141 :2139-2147).
The following non-limiting Examples are presented to better illustrate the invention.
EXAMPLE 1
Differentiation between streptomycetes and Maduromycetes by Southern analysis of genomic DNA
Strains of bacteria were obtained and grown until mid logarithmic phase to validate the usefulness of the CNB-BIT2 probe to differentiate between the Actinomadura madurae group of bacteria and other Maduromycetes, and the usefulness of the CNB-BIT2M probe to differentiate between Maduromycetes and the Actinomadura madurae group, as well as the usefulness of both probes to differentiate either Maduromycetes or the Actinomadura madurae group of bacteria from bacteria belonging to the Streptomyces genus. Genomic DNA was prepared as follows: Approximately 0.5-1.0 g mycelia were resuspended in 2 ml lysis buffer (NaCl 0.1 M, EDTA 50 mM, pH 8.0) containing glass beads (3 mm diameter) and the suspension was vortexed for 2 minutes before adding 2 ml of lysis buffer plus 10- 15 mg lysozyme and 50 mg ml"l RNase DNase-free. The suspension was incubated for 30-80 min. at 37°C. After the addition of 500 ml 10% SDS (w/v), the solution was incubated at 37°C for 15 min. The glass beads were removed and the DNA extracted four times with 1 volume of phenol/chloroform/isoamyl alcohol (25:24: 1 ) and once more with 1 volume of chloroform. The extracted DNA was ethanol precipitated, dried and resuspended in 500 ml distilled water. 20 mg of the chromosomal DNA extracted from each strain was restricted with 50 units of the endonucleases BamHI or PstI by incubation in the respective buffers as recommended by the supplier (Boehringer Mannheim) at 37°C for 16 h and the samples fractionated by electrophoresis in 0.8% agarose gels. The fractionated DNA fragments were transferred to Hybond N+ membranes (Amersham, pic.) by capillary transfer for 16 h. The DNA immobilized in the solid support was then washed with a hybridization buffer containing 5 x SSC, 5 x Denhardt's solution and 0.5% SDS and allowed to hybridize with 10 pmol of the radioactively labeled CNB-BIT2 or CNB-BIT2M probe in the same buffer for 16 h at 45°C. The solid supports were then washed three times with lx SSC (0.15 M NaCl plus 0.015 M sodium citrate, pH 7.2) and 0.5% SDS at the hybridization temperature. The solid supports were then set to exposure in X-ray films at -70°C prior to be developed.
The CNB-BIT2M probe hybridized with all the Maduromycetes strains listed in the table above but not with the Actinomadura madurae group of strains nor with the Streptomyces strains mentioned above. The CNB-BIT2 probe hybridized with all the Actinomadura madurae group of strains listed in the table above but not with the Maduromycetes strains nor with the Streptomyces strains mentioned above. As expected both probes also gave a negative result with low G+C content genomic DNA from the far related bacterium Bacillus subtilis carried as a negative control. The results obtained indicate that CNB-BIT2 can differentiate between the Actinomadura madurae group of bacteria and Maduromycetes in hybridization with genomic DNA and that CNB-BIT2M can differentiate between Maduromycetes and the Actinomadura madurae group of bacteria in hybridization with genomic DNA.
EXAMPLE 2 Differentiation between streptomycetes and Maduromycetes by Southern analysis of PCR amplified DNA
Chromosomal DNA from all the strains used in Example 1 was extracted as described and the extracted DNA was used for PCR amplification using primers BIT-N: 5' CCAAGACTCCTACGGGAGGCAGCAG 3' (SEQ.ID.NO.T) and BIT-R: 5' CCGCCTACGAGCTCTTTACGCCCA 3' (SEQ.ID.NO.:2). Approximately 0.5- 1.0 mg genomic DNA template was used with 280 ng of each primer in a final reaction volume of 100 ml of a incubation buffer containing 16.6 mM (NH4)2S04, 67 mM Tris-HCl (pH 8.8), 0.1 % Tween- 20 and 1 mM MgCl2- Amplifications were performed in automated thermocyclers by incubation at 95°C (5 min) followed by 30 cycles of incubation at 95°C (1 min), 55°C (1 min) and 72°C (1 min) in the presence of one unit of EcoTaq polymerase (Ecogen).
The resulting about 235 bp long amplified DNA fragments were fractionated by electrophoresis in 1.5% agarose gels. The fractionated DNA fragments were transferred to Hybond N+ membranes (Amersham, pic.) by capillary transfer for 16 h. The DNA immobilized in the solid support was then washed with a hybridization buffer containing 5 x SSC, 5 x Denhardt's solution and 0.5% SDS and set to hybridize with 10 pmol of the radioactively labeled CNB-BIT2 or CNB-BIT2M probes in the same buffer for 16 h at 45°C. The solid supports were then washed three times with l x SSC (0.15 M NaCl plus 0.015 M sodium citrate, pH 7.2) and 0.5% SDS at the hybridization temperature. The solid supports were then set to exposure in X-ray films at -70°C prior to be developed.
The CNB-BIT2M probe hybridized with all the approximately 235 bp long PCR amplified fragments from all the Maduromycetes strains listed in the Table above but not with the Actinomadura madurae group of strains nor with the Streptomyces strains mentioned above. The CNB-BIT2 probe hybridized with all the approximately 235 bp long PCR amplified fragments from the Actinomadura madurae group of strains listed in the Table above but not with the Maduromycetes strains nor with the Streptomyces strains mentioned above. The results obtained indicate that CNB-BIT2 can differentiate between the Actinomadura madurae group and Maduromycetes in hybridization with genomic DNA and that CNB-BIT2M can differentiate between Maduromycetes and the Actinomadura madurae group of bacteria in hybridization with genomic DNA; both of them gave negative hybridization with DNA from the Streptomyces strains listed above.

Claims

WHAT IS CLAIMED:
1. A nucleic acid probe which hybridizes to a nucleic acid encoding a portion of 16S rRNA of bacteria from the Actinomadura madurae group under hybridization conditions, and which does not hybridize to a nucleic acid encoding a portion of 16S rRNA of Maduromycetes bacteria under identical hybridization conditions.
2. A probe according to Claim 1 which is DNA.
3. A probe according to Claim 2 which is between 10-250 base pairs.
4. A probe according to Claim 3 which is complementary to or homologous with at least 90% of a nucleic acid sequence comprising an Actinomadura madurae nucleic acid corresponding to base pairs 419-437 of Actinomadura madurae DNA encoding mature 16S rRNA.
5. A probe according to Claim 3 comprising 5' GAAGCTAACGTGACGGTAC 3' (SEQ.ID. NO.:3).
6. A method for detecting the presence of the Actinomadura madurae group of bacteria in a sample comprising: a) contacting the sample with a nucleic acid probe, wherein said probe hybridizes to nucleic acid encoding Actinomadura madurae group of bacteria 16S rRNA, but not to nucleic acid encoding Maduromycetes 16S rRNA; b) imposing hybridization conditions; and c) determining if hybridization has occurred.
7. A method according to Claim 6 further comprising the step of lysing bacteria in the sample prior to step a).
8. A method according to Claim 7 wherein the probe is a radioactively labeled probe.
9. A method according to Claim 8 wherein hybridization conditions are stringent hybridization conditions.
10. A method for differentiating between Actinomadura madurae group of bacteria from Maduromycetes bacteria and bacteria belonging to the Streptomyces genus in a sample comprising: a) immobilizing nucleic acids from putative Maduromycetes and/or Actinomadura madurae group of bacteria; b) contacting the immobilized nucleic acids with a labeled probe, wherein said probe hybridizes to nucleic acid encoding Actinomadura madurae group of bacteria 16S rRNA but not to nucleic acids encoding Maduromycetes or streptomycetes 16S rRNA; c) imposing hybridization conditions; and d) determining if hybridization of the probe to Actinomadura madurae group nucleic acids has occurred.
11. A method according to Claim 10 wherein said probe comprises nucleic acids selected from the group consisting of: a) nucleic acids comprising SEQ.ID.NO.:3; and b) nucleic acids comprising a 235 bp amplification product made by PCR amplification using primers SEQ.ID.NO.:l and SEQ.ID.NO.:2.
12. A nucleic acid probe which hybridizes to a nucleic acid encoding a portion of 16S rRNA of Maduromycetes bacteria under hybridization conditions, and which does not hybridize to nucleic acids encoding a portion of 16S rRNA of Actinomadura madurae group of bacteria or bacteria belonging to the Streptomyces genus under identical hybridization conditions.
13. A probe according to Claim 12 which is DNA.
14. A probe according to Claim 13 which is between 10-250 base pairs.
15. A probe according to Claim 14 which is complementary to or homologous with at least 90% of a nucleic acid sequence comprising a Maduromycetes nucleic acid corresponding to base pairs 410-429 of Maduromycetes DNA, other than Actinomadura madurae, encoding mature 16S rRNA.
16. A probe according to Claim 14 comprising 5' GAAGTTGACGTGTACCTGCA 3' (SEQ.ID. NO.:4).
17. A method for detecting the presence of Maduromycetes bacteria in a sample comprising: a) contacting the sample with a nucleic acid probe, wherein said probe hybridizes to nucleic acid encoding Maduromycetes 16S rRNA, but not to nucleic acids encoding Actinomadura madurae group of bacteria or to streptomycetes 16S rRNA; b) imposing hybridization conditions; and c) determining if hybridization has occurred.
18. A method according to Claim 17 further comprising the step of lysing bacteria in the sample prior to step a).
19. A method according to Claim 18 wherein the probe is a radioactively labeled probe.
20. A method according to Claim 19 wherein hybridization conditions are stringent hybridization conditions.
21. A method for differentiating between maduromyces bacteria and Actinomadura madurae group of bacteria in a sample comprising: a) immobilizing nucleic acids from putative Maduromycetes and/or Actinomadura madurae group of bacteria. b) contacting the immobilized nucleic acids with a labeled probe, wherein said probe hybridizes to nucleic acids encoding Maduromycetes 16S rRNA but not to nucleic acids encoding Actinomadura madurae group of bacteria or streptomycetes 16S rRNA; c) imposing hybridization conditions; and d) detecting hybridization of the probe to Maduromycetes nucleic acid.
22. A method according to Claim 21 wherein said probe comprises nucleic acids selected from the group consisting of: a) nucleic acids comprising SEQ.ID.NO.:4; and b) nucleic acids comprising a 235 bp amplification product made by PCR amplification using primers SEQ.ID.NO..T and SEQ.ID.NO.:2.
PCT/EP1999/000148 1998-01-08 1999-01-05 Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes WO1999035285A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA002317897A CA2317897A1 (en) 1998-01-08 1999-01-05 Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes
EP99901595A EP1044284A2 (en) 1998-01-08 1999-01-05 Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7079998P 1998-01-08 1998-01-08
US60/070,799 1998-01-08

Publications (2)

Publication Number Publication Date
WO1999035285A2 true WO1999035285A2 (en) 1999-07-15
WO1999035285A3 WO1999035285A3 (en) 1999-10-14

Family

ID=22097462

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1999/000148 WO1999035285A2 (en) 1998-01-08 1999-01-05 Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes

Country Status (3)

Country Link
EP (1) EP1044284A2 (en)
CA (1) CA2317897A1 (en)
WO (1) WO1999035285A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001023609A2 (en) * 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which detect bacteria of the genus thermobifida
WO2001023608A2 (en) * 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
US6235484B1 (en) 1999-05-03 2001-05-22 Gen-Probe Incorporated Polynucleotide probes for detection and quantitation of actinomycetes
US6821770B1 (en) 1999-05-03 2004-11-23 Gen-Probe Incorporated Polynucleotide matrix-based method of identifying microorganisms

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988003957A1 (en) * 1986-11-24 1988-06-02 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
WO1995013396A2 (en) * 1993-11-11 1995-05-18 U-Gene Research B.V. A method for identifying microorganisms, and aids useful thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988003957A1 (en) * 1986-11-24 1988-06-02 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
WO1995013396A2 (en) * 1993-11-11 1995-05-18 U-Gene Research B.V. A method for identifying microorganisms, and aids useful thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AMANN R I ET AL: "PHYLOGENETIC IDENTIFICATION AND IN SITU DETECTION OF INDIVIDUAL MICROBIAL CELLS WITHOUT CULTIVATION" MICROBIOLOGICAL REVIEWS, vol. 59, no. 1, 1 March 1995 (1995-03-01), pages 143-169, XP002026194 *
STACKEBRANDT ET AL: "Designation of Streptomycete 16S and 23S rRNA-based target regions for oligonucleotide probes" APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 57, no. 5, 1 May 1991 (1991-05-01), pages 1468-1477, XP002090717 ISSN: 0099-2240 *
WANG ET AL: "Phylogenetic analysis reveals new relationships among members of the genera Microtetraspora and Microbispora" INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, vol. 46, no. 3, 1 July 1996 (1996-07-01), pages 658-663, XP002090716 cited in the application *
WARD-RAINEY ET AL: "The phylogenetic structure of the genus Streptosporangium" SYSTEMATIC AND APPLIED MICROBIOLOGY, vol. 19, 1 March 1996 (1996-03-01), pages 50-55, XP002090719 ISSN: 0723-2020 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6235484B1 (en) 1999-05-03 2001-05-22 Gen-Probe Incorporated Polynucleotide probes for detection and quantitation of actinomycetes
US6821770B1 (en) 1999-05-03 2004-11-23 Gen-Probe Incorporated Polynucleotide matrix-based method of identifying microorganisms
US7449328B2 (en) 1999-05-03 2008-11-11 Gen-Probe Incorporated Probe matrix-based device for identifying microorganisms
WO2001023609A2 (en) * 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which detect bacteria of the genus thermobifida
WO2001023608A2 (en) * 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
WO2001023609A3 (en) * 1999-09-27 2001-11-08 Merck Sharp & Dohme De Espana Hybridization probes which detect bacteria of the genus thermobifida
WO2001023608A3 (en) * 1999-09-27 2003-04-17 Merck Sharp & Dohme De Espana Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora

Also Published As

Publication number Publication date
EP1044284A2 (en) 2000-10-18
WO1999035285A3 (en) 1999-10-14
CA2317897A1 (en) 1999-07-15

Similar Documents

Publication Publication Date Title
WO2001023608A2 (en) Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
Schwieger et al. A new approach to utilize PCR–single-strand-conformation polymorphism for 16S rRNA gene-based microbial community analysis
US6025132A (en) Probes targeted to rRNA spacer regions, methods and kits for using said probes, for the detection of respiratory tract pathogens
JP5196854B2 (en) Probe set, probe carrier and inspection method
US5705339A (en) Methods for the detection of the bacterial agents causing spoilage of beer
JPH11503921A (en) Universal target for species identification
EP0556504B1 (en) Oligonucleotides for detecting Vibrio parahaemolyticus
EP0438587B1 (en) Nucleic acid probes for the detection of pneumocystis carinii
EP1012328A2 (en) Dna-sequence-based diagnosis of mastitis from a milk sample
Sikora et al. Genetic diversity of Bradyrhizobium japonicum field population revealed by RAPD fingerprinting
JPH09107998A (en) Identification of genus specific and species specific legionella
EP2014775A2 (en) Method for the detection of bacterial species of the genera Anaplasma/Ehrlichia and Bartonella
JP2695127B2 (en) Nucleic acid sequence specific to Mycobacterium kansasi
EP0948643A1 (en) GENETIC MARKERS AND METHODS FOR THE DETECTION OF $i(LISTERIA MONOCYTOGENES) AND $i(LISTERIA SPP)
EP0426843B1 (en) Nucleic acid probes for the detection of neisseria gonorrhoeae
EP1044284A2 (en) Hybridization probes which differentiate between the actinomadura madurae group of bacteria and maduromycetes
KR100436741B1 (en) Genes for detecting bacteria and detection method by using the same
CA2075186A1 (en) Hybridization probes for the detection of branhamella catarrhalis strains
EP1012346A1 (en) Hybridization probes which differentiate between streptomycetes and maduromycetes
Bentley et al. A Staphylococcus aureus‐specific oligonucleotide probe derived from 16S rRNA gene sequences
JPH10210980A (en) Oligonucleotide for detecting lactic acid bacterium and detection of the same bacterium
WO2001023609A2 (en) Hybridization probes which detect bacteria of the genus thermobifida
WO2001088186A2 (en) Methods for detecting and identifying a gram positive bacteria in a sample
US5721097A (en) Hybridization probes for the detection of branhamella catarrhalis strains
Wang et al. Rapid differentiation of bacterial species with multiple probes of different lengths in a single slot blot hybridization

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2317897

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2317897

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1999901595

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09600146

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999901595

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999901595

Country of ref document: EP