WO1999034012A1 - Analyse pour la recherche de modulateurs de l'interaction entre la proteine apc2 du complexe de promotion de l'anaphase et d'autres elements d'apc - Google Patents

Analyse pour la recherche de modulateurs de l'interaction entre la proteine apc2 du complexe de promotion de l'anaphase et d'autres elements d'apc Download PDF

Info

Publication number
WO1999034012A1
WO1999034012A1 PCT/GB1998/003890 GB9803890W WO9934012A1 WO 1999034012 A1 WO1999034012 A1 WO 1999034012A1 GB 9803890 W GB9803890 W GB 9803890W WO 9934012 A1 WO9934012 A1 WO 9934012A1
Authority
WO
WIPO (PCT)
Prior art keywords
apc2
apc
polypeptide
protein
cell
Prior art date
Application number
PCT/GB1998/003890
Other languages
English (en)
Inventor
Leland Herries Johnston
Original Assignee
Medical Research Council
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical Research Council filed Critical Medical Research Council
Priority to AU17744/99A priority Critical patent/AU1774499A/en
Publication of WO1999034012A1 publication Critical patent/WO1999034012A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics

Definitions

  • the present invention is based upon UK patent application 9727277.7 filed December 23 1997, the contents of which are incorporated herein by reference.
  • the invention relates to the finding of a novel component of the yeast anaphase promoting complex (APC) and its use in assays for inhibitors or modulators of cell cycle progression, particularly in fungal cells.
  • APC yeast anaphase promoting complex
  • the progression of eukaryotic cells through the cell cycle is controlled by a number of events, including the regulated association of specific cyclins with a CDK (cyclin-dependent- kinase) .
  • CDK cyclin-dependent- kinase
  • mitotic cyclin degradation is required.
  • eukaryotic cells which have been studied including yeast, Xenopus oocytes and clam oocytes
  • APC anaphase promoting complex
  • APC anaphase promoting complex
  • Cdc28 is the major CDK and is largely responsible for controlling cell cycle progression (reviewed in Nasmyth, 1996) .
  • Gl cyclins Clns 1, 2 and 3 are active during Gl up until S phase while B-type cyclins Clbs 1-6 control DNA synthesis (Schwob et al . , 1994) and mitosis (Surana et al . , 1991).
  • the specific association of the appropriate cyclin with Cdc28 is achieved by cell cycle controlled synthesis as well as controlled degradation of the cyclin at key stages of the cycle (reviewed in King et al . , 1996; Deshaies, 1997).
  • the mitotic B-type cyclin Clb2p is active from late S phase until the end of mitosis when it is rapidly degraded by ubiquitin-mediated proteolysis (Surana et al . , 1991; Irniger et al . , 1995; Amon, 1997; Irniger and Nasmyth, 1997) . Exit from mitosis and entry into the Gl phase of the next cell cycle requires the inactivation of the Clb2 protein; over-production of Clb2p which has been stabilised by removal of its destruction box causes cells to arrest in telophase with divided chromatin and an elongated spindle (Surana et al . , 1993).
  • E3 ubiquitin-protein ligases play an important role in specifying the selection of proteins for ubiquitin-mediated degradation (Ciechanover, 1994) .
  • Studies in human, Xenopus and yeast systems have converged to reveal the E3 ubiquitin-protein ligase activity which confers specificity for cell cycle regulated degradation of mitotic cyclin by the ubiquitin pathway (Irniger et al . , 1995; King et al . , 1995; Tugendreich et al . , 1995) .
  • This E3 is a large complex of at least seven proteins, and has been called the cyclosome or anaphase promoting complex (APC) .
  • the APC is part of the essential cell cycle machinery whose components are evolutionarily conserved (Irniger et al . , 1995; King et al . , 1995; Tugendreich et al . , 1995; Peters et al . , 1996; Zachariae et al . , 1996) .
  • yeast CDC16, CDC23 , CDC26, CDC27 and APC1 have been identified as genes coding for some of these components (Lamb et al . , 1994; Irniger et al . , 1995; Zachariae et al . , 1996) .
  • yeast strains lacking the PDS1 gene are viable but in APC deficient strains show a mixed terminal arrest phenotype with a large proportion of the cells in telophase, that is, with divided chromatin (Yamamoto et al . , 1996a) .
  • APC targets include Aselp, a budding yeast protein involved in spindle elongation (Juang et al . , 1997) whose destruction is required for proper spindle disassembly after the metaphase to anaphase transition.
  • the final essential role of the APC in mitotic exit is the degradation of Clb2p (Irniger et al . , 1995; Surana et al . , 1993) .
  • Clb2p levels persist until telophase.
  • Sikorski et al (Mol . Cell. Biol . , 1993, 12; 1212-1221) disclose Cdc23 from S . cerevisiae and a number of variants thereof, including thermolabile variants.
  • Lamb et al (EMBO J. , 1994, 12;4321-4328) describe Cdcl6, Cdc23 and Cdc27 from S. cerevisiae and their interaction by two-hybrid assay and co- immunoprecipitation .
  • WO 98/21326 published on 28 May 1998, describes the APC complex and methods for analysing components thereof.
  • the total number of components, their identity and function are not known. Further, some of these components may be essential components for cell viability, making identification of them more complex. Identification of further components will allow characterisation of their function, and the development of targets for modulators of cell cycle control .
  • the present invention thus provides an assay for an inhibitor of eukaryotic cell cycle progression which comprises a) providing a polypeptide which comprises the sequence of the APC2 protein, or a fragment or variant thereof capable of associating with an Anaphase Promoting Complex (APC) ; b) providing a second polypeptide member of the APC with which said APC2 protein is capable of forming a complex in the absence of a putative inhibitor; c) providing a putative inhibitor compound; and d) measuring the degree of inhibition of binding between (a) and (b) caused by the presence of said putative inhibitor.
  • APC Anaphase Promoting Complex
  • the invention further provides an isolated polypeptide comprising the APC2 protein (GenBank Z73299; YPD YLR127C) or a variant thereof, or fragments of said protein and variants thereof which is capable of forming a complex with a second APC protein.
  • APC2 protein GenBank Z73299; YPD YLR127C
  • the polypeptide component (a) of assays of the invention may in comprise the APC2 protein sequence, particularly the S. cerevisiae APC2 protein (Genbank accession number Z73299, locus SCYLR127C) .
  • variants of this sequence may also be used, provided such variants retain the ability to associate with one or more members of the APC, particularly APC8.
  • Variants include naturally occurring variants from other eukaryotic cells, including other fungi, including those associated with superficial or systemic fungal infections of mammals particularly humans. Such infections include common infections such as Athletes foot and ringworm, as well as severe systemic infections including those found in immunocompromised patients with HIV.
  • Fungal species include for example S.pombe, Aspergillus spp, Tinea spp . , (e.g. T.pedis) , Microsporum spp., Trichophytom spp., Epidermphyton spp., Candida spp., (e.g. C.
  • eukaryotes include plants (including dicots and monocots) , invertebrates such as Drosophila , vertebrates including amphibians such as Xenopus and mammals such as mice and other rodents or primates including humans. Fungal variants are particularly preferred.
  • APC2 proteins can be found on publicly available databases.
  • the genome of C. elegans has been fully sequenced and contains an open reading frame (K06H7.5 - accession number L15314) in chromosome 3 encoding an APC2 protein of 378 amino acids.
  • the sequence may also be obtained from the Swissprot database, accession number P34513.
  • the Candida genome project has revealed a DNA sequence encoding part of the C. albicans APC2 gene (plate 265237:E03 Forward).
  • W098/21326 indicates that human APC2 is also available and that various murine ESTs have been identified which encode a protein with 96% amino acid identity to the corresponding human APC2 (the algorithm used to calculate the identity is not provided - however for very high levels of identity, e.g. from 90% upwards, there will be little or no difference between different algorithms, including those cited herein) .
  • Numerous ESTs are available on the DBEST database, including gbAA238896
  • Variants may also be synthetic, e.g. provided by random or site directed mutagenesis of the genes encoding APC2 proteins, which are then expressed to provide the synthetic variant .
  • Such variants may include temperature sensitive variants which are functional at a permissive temperature and non-functional at a higher or lower non-permissive temperature.
  • Naturally occurring variants may be obtained through recombinant DNA techniques known in the art as such.
  • a probe based on nucleic acid encoding the known APC2 sequences mentioned herein may be used to screen cDNA libraries made from dividing cells from a eukaryotic cell source of interest.
  • Sequences which hybridise to the probe under conditions of medium to high stringency for example for hybridization on a solid support (filter) overnight incubation at 42 °C in a solution containing 50% formamide , 5xSSC (750 mM NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt ' s solution, 10% dextran sulphate and 20 ⁇ g/ml salmon sperm DNA, followed by washing in 0.03M sodium chloride and 0.03M sodium citrate (i.e. 0.2x SSC) at from about 50°C to about 60°C) may be recovered and sequenced. Where a less than full length clone is obtained, RACE-PCR methods and the like may be used to obtain full length clones.
  • variants will have a degree of amino acid sequence identity of at least 50% to S . cerevisiae APC2 , more preferably at least 60%, for example at least 70%, such as at least 80%, including at least 90% or even at least 95%.
  • the percentage identity of DNA and amino acid sequences to a reference sequence can be calculated using commercially available algorithms.
  • the following programs may be used to determine homologies: BLAST, gapped BLAST, BLASTN and PSI-BLAST, which may be used with default parameters .
  • the algorithm GAP Genetics Computer Group, Madison, WI
  • Another method for determining the best overall match between a nucleic acid sequence or a portion thereof, and a query sequence is the use of the FASTDB computer program based on the algorithm of Brutlag et al (Comp. App . Biosci., 6 . ; 237-245 (1990)).
  • the program provides a global sequence alignment .
  • the result of said global sequence alignment is in percent identity.
  • Variants may also include dominant negative variants, which may be introduced into or expressed in a cell to disrupt the function of the APC and hence cell cycle progression in the cell.
  • Fragments of APC2 and its variants may also be used. Generally fragments will be generated by recombinant DNA technology, by manipulation of nucleic acid encoding APC2 and its variants. For example N-terminal fragments may be obtained by providing nucleic acid encoding an APC2 protein operably linked to a promoter, and introducing into the nucleic acid a termination codon by site directed mutagenesis. Internal or C-terminal fragments may be obtained by removal of N-terminal and/or C- terminal coding sequence of nucleic acid encoding APC2 by restriction ' digestion, or by PCR cloning of nucleic acid encoding the desired fragment using primers which define the 5 ' and 3' ends of the desired fragment. The appropriate fragment may then be introduced into an expression vector and used to provide the necessary fragment polypeptide.
  • Fragments will be those which interact with a second protein member of the APC, such as Cdc23 or Cdc 16. Fragments may be any suitable size which retains this property, for example from 50 to 800 amino acids, for example at least 100, 200, 300, 400 or 500 amino acids.
  • Suitable fragments of APC2 and its variants may be determined by routine methodology. For example, a series of overlapping fragments of around 300 amino acids in size may be made (e.g. from 1 to 300, 250 to 550, 500 to 853) and screened in a two-hybrid or pull down assay as described below against other components of the APC.
  • Fragments which bind to one or more other APC members may be used in assays, or subfragments of them may be made and investigated for interaction with APC members.
  • Various domains of the APC2 protein and its variants may be determined which interact with other members of the APC.
  • Foi the development of selective anti-fungal agents those of ski in the art may determine domains of the APC2 protein from fur, species which interact with other members of the APC or with another APC2 protein and which are least conserved between fu and humans, by comparison of the APC2 sequence shown herein w homologous sequences found in higher eukaryotes, including ms but also other mammals.
  • Such sequences may be found by for example by searching for homologous sequences to that of the yeast YRL127C sequence on databases of nucleic acid or protei sequences, including EST databases.
  • APC2 polypeptide includes the variants and fragments described herein suitable for use in assays of invention.
  • oligomerization, particularly dimerization or trimerizat ⁇ of the APC2 protein, its variants and their fragments may be used as a basis for a target for assay systems.
  • the second polypeptide component of the assay according to the invention may also be an APC2 polypeptide, variant or fragments thereof .
  • APC APC
  • Cdcl6 also referred to as APC6
  • Cdc23 also referred to as APC8
  • Cdc26 Cdc27
  • APC3 APC1
  • These polypeptides may be obtained from any suitable source, including fungi, such as S. cerevisiae or S.pombe, Aspergillus spp and Candida spps , invertebrates such as Drosophila , vertebrates including amphibians such as Xenopus and mammals such as mice and other rodents or primates including humans .
  • Fungal APC members are particularly preferred.
  • the sequences of these proteins are widely available from a number of sources, and vectors encodir these proteins are also available.
  • Sikorski et al disclose Cdc23 from S. cerevisiae and a number of variants thereof, including thermolabile variants.
  • Human cdc23 (APC8) is found on Genbank accession number 3283051 and C. albicans APC8 on plate 396132 :A03 Forward of the Candida genome project.
  • Lamb et al (EMBO J., ibid) describe Cdcl ⁇ , Cdc23 and Cdc27 from S . cerevisiae and their interaction by two-hybrid assay and co- immunoprecipitation.
  • Cdc27 and Cdcl6 activity in Xenopus eggs has been analysed by King et al (Cell, 1995, £1; 279-288) .
  • Human Cdc27 and Cdcl6 cDNAs are described by Tudendreich et al (Cell, 1995, J3JL; 261-268) .
  • the Cdcl6 cDNA was obtained by analysis of an EST database with a known Cdcl6 sequence to identify a partial human Cdcl6 cDNA sequence, which was then used to construct a full length cDNA. This technique may be used to identify other members of the APC from sources, where such sources are not presently available in the art. Human cdc27 and cdcl6 sequences are also identified in US Patent 5,726,025.
  • the second component is APC8 (cdc23) .
  • APC8 cdc23
  • APC8 is one of three APC components which comprise multiple copies of a 34 amino acid repeat motif, termed TPR (Hirano et al , 1990; Sikorski et al , 1990) , arranged as a block of tandem TPRs in the C-terminus, with one or two additional TPRs in the N-terminus. It has been proposed that TPRs mediate protein- protein interactions (Lamb et al , 1994) and thus in addition to APC8, cdcl6 and cdc27 polypeptides are also of interest as second components in the assay of the invention.
  • TPR 34 amino acid repeat motif
  • Polypeptides which are fragments, variants and fragments thereof of the APC members may also be used, provided that such polypeptides retain the ability to interact with an APC2 protein, particularly an APC2 protein of the same species as the APC member.
  • Variants and fragments may be made by routine recombinant DNA techniques, as discussed above for the production of APC2 variants and fragments.
  • reference to a polypeptide member of the APC in assays of the invention will include polypeptides which are fragments, variants and fragments thereof which retain the ability to interact with an APC2 protein.
  • variants will have a degree of amino acid sequence identity of at least 50% to a wild-type, particularly
  • APC polypeptide more preferably at least 60%, for example at least 70%, such as at least 80%, including at least 90% or even at least 95%.
  • Fragments will be those which interact with an APC2 polypeptide, particularly wild type S . cerevisiae APC2. Fragments may be any suitable size which retains this property, for example from 50 to 800 amino acids, for example at least 100, 200, 300, 400 or 500 amino acids.
  • Suitable fragments of APC2 and its variants may be determined by routine methodology. For example, a series of overlapping fragments of around 300 amino acids in size may be made (e.g. from 1 to 300, 250 to 550, 500 to 800, etc) and screened in a two-hybrid or pull down assay as described below against APC2.
  • Potential modulators of the interaction between an APC2 polypeptide and another polypeptide member of the APC may be assayed most directly by tagging one or both of the polypeptides, either in vivo or in vi tro, and using the tag as a handle to retrieve the tagged component from a mixture comprising both polypeptides and a putative modulator compound, followed by measuring the amount of other polypeptide which is associated with the retrieved polypeptide.
  • an APC2 polypeptide and an APC polypeptide may be studied by labeling one with a detectable label and bringing it into contact with the other which has been immobilized on a solid support .
  • Suitable detectable labels include 35 S-methionine which may be incorporated into recombinantly produced polypeptides.
  • the recombinantly produced polypeptides may also be expressed as a fusion protein containing an epitope which can be labeled with an antibody, such as an antibody immobilized on a solid support.
  • the protein which is immobilized on a solid support may be immobilized using an antibody against that protein bound to a solid support or via other technologies which are known per se .
  • a preferred in vi tro interaction may utilize a fusion protein including glutathione-S-transferase (GST) . This may be immobilized on glutathione agarose beads.
  • GST glutathione-S-transferase
  • An alternative is to use a histidine tag (e.g. a His6 tag) which may be used to immobilize a polypeptide on Ni++ beads.
  • the putative modulator compound can be assayed by determining its ability to modulate the amount of labeled first polypeptide which binds to the immobilized GST- or Ni++-second polypeptide.
  • This may be determined by fractionating the glutathione-agarose or Ni++ beads by SDS-polyacrylamide gel electrophoresis .
  • the beads may be rinsed to remove unbound protein and the amount of protein which has bound can be determined by counting the amount of label present in, for example, a suitable scintillation counter.
  • an antibody attached to a solid support and directed against one of the polypeptides may be used in place of GST to attach the molecule to the solid support.
  • Antibodies against the APC2 and APC polypeptides may be obtained in a variety of ways known as such in the art, and as discussed herein.
  • these polypeptides may be in the form of fusion proteins comprising a epitope unrelated to these polypeptides, such as an HA or myc tag as described by Zachariae et al , ibid.
  • Such antibodies and nucleic acid encoding such epitopes are commercially available.
  • tags may include enzymes, such as horse radish peroxidase, or luciferase, or biotin, avidin or streptavadin.
  • a two-hybrid assay comprises the expression in a host cell of the APC2 and APC polypeptides as fusion proteins, one being a fusion protein comprising a DNA binding domain (DBD) , such as the yeast GAL4 binding domain, and the other being a fusion protein comprising an activation domain, such as that from GAL4 or VP16.
  • DBD DNA binding domain
  • the host cell which again may be bacterial, yeast, insect or mammalian, particularly yeast or mammalian
  • the reporter gene may be a reporter gene such as chloramphenicol acetyl transferase, luciferase, green fluorescent protein and ⁇ - galactosidase, with luciferase being particularly preferred.
  • Two-hybrid assays may be in accordance with those disclosed by Fields and Song, 1989, Nature 340 ; 245-246.
  • the DNA binding domain (DBD) and the transcriptional activation domain (TAD) of the yeast GAL4 transcription factor are fused to the first and second molecules respectively whose interaction is to be investigated.
  • a functional GAL4 transcription factor is restored only when two molecules of interest interact.
  • interaction of the molecules may be measured by the use of a reporter gene operably linked to a GAL4 DNA binding site which is capable of activating transcription of said reporter gene.
  • two hybrid assays may be performed in the presence of a potential modulator compound and the effect of the modulator will be reflected in the change in transcription level of the reporter gene construct compared to the transcription level in the absence of a modulator.
  • two-hybrid screens may be used to characterise and identify further members of the APC or regions within such members which interact with APC2.
  • an APC2 fusion polypeptide comprising a DNA binding domain as bait may be screened against a library of sequences or a panel of APC members (including fragments thereof) or individual APC members (including fragments thereof) fused to an activation domain, in order to determine further particular APC members or domains within these member which interact with the APC2 polypeptides .
  • These domains for example of from 50 to 300, such as from 100 to 200 amino acids in size, may be used in assays of the invention.
  • the APC2 polypeptide is provided in the form of a fusion protein with a DNA binding domain, such as the Gal4 domain
  • the APC8 polypeptide is provided in the form of a fusion protein with an activation domain, such as the Gal4 activation domain.
  • the fusions may be - or C-terminal with N-terminal binding and activation domains being preferred.
  • one of the APC2 polypeptide and APC polypeptide may be labelled with a fluorescent donor moiety and the other labelled with an acceptor which is capable of reducing the emission from the donor.
  • FRET fluorescence resonance energy transfer
  • the fluorescence signal of the donor will be altered when the polypeptides interact.
  • the presence to a candidate modulator compound which modulates the interaction will increase the amount of unaltered fluorescence signal of the donor.
  • FRET is a technique known per se in the art and thus the precise donor and acceptor molecules and the means by which they are linked to the APC2 and APC polypeptides may be accomplished by reference to the literature.
  • Suitable fluorescent donor moieties are those capable of transferring fluorogenic energy to another fluorogenic molecule or part of a compound and include, but are not limited to, coumarins and related dyes such as fluoresceins , rhodols and rhodamines, resorufins, cyanine dyes, bimanes, acridines, isoindoles, dansyl dyes, aminophthalic hydrazines such as luminol and isoluminol derivatives, aminophthalimides, aminonaphthalimides , aminobenzofurans , aminoquinolines, dicyanohydroquinones, and europium and terbium complexes and related compounds .
  • coumarins and related dyes such as fluoresceins , rhodols and rhodamines, resorufins, cyanine dyes, bimanes, acridines, isoindoles, dansy
  • Suitable acceptors include, but are not limited to, coumarins and related fluorophores, xanthenes such as fluoresceins, rhodols and rhodamines, resorufins, cyanines, difluoroboradiazaindacenes, and phthalocyanines .
  • a preferred donor is fluorescein and preferred acceptors include rhodamine and carbocyanine .
  • the isothiocyanate derivatives of these fluorescein and rhodamine available from Aldrich Chemical Company Ltd, Gillingham, Dorset, UK, may be used to label the polypeptides.
  • carbocyanine For attachment of carbocyanine, see for example Guo et al, J. Biol . Chem., 270; 27562-8, 1995.
  • assays based on modulating APC2 polypeptide homodimerization are provided. These assays may be conducted by methods analogous to those described above for pull down and two hybrid assays, by providing a second APC2 polypeptide as the component (b) of the above-described assay.
  • APC2 itself may be a target for potential modulators of the cell cycle.
  • APC2 comprises a number of potential Cdc28 phosphorylation sites. The phosphorylation status of APC2 throughout the cell cycle may be observed and putative modulators of the cell cycle may be used to determine whether such modulators alter the phosphorylation status of the polypeptide. For example, synchronously growing cultures of cells (e.g.
  • yeast insect or mammalian, but preferably yeast or other fungal cells
  • a potential modulator and a radiolabelled phosphate compound which is capable of being utilised by the cell as a substrate for phosphorylation of APC2 (e.g. ⁇ 32 P-ATP) and the degree of phosphorylation of APC2 may be determined after one or more rounds of the cell cycle.
  • a radiolabelled phosphate compound which is capable of being utilised by the cell as a substrate for phosphorylation of APC2 (e.g. ⁇ 32 P-ATP) and the degree of phosphorylation of APC2 may be determined after one or more rounds of the cell cycle.
  • Determination may be by any suitable means.
  • the APC2 may be recovered from the cell using antibodies against this protein to immunoprecipitate it, and the incorporation of radioactivity may be determined by scintillation counting. Other means of achieving this will be readily available to those of skill in the art.
  • APC2 may also be a target for ubiquitination and in a further aspect the assay of the invention may be for potential modulators of ubiquitination of the APC2.
  • an assay may comprise providing APC2 and optionally other members of the APC under conditions in which it is ubiquitinated (e.g. in a population of synchronously replicating cells) , providing a potential modulator compound and measuring the degree of ubiquitination of APC2 (e.g. using a tagged APC2 to recover APC2 followed by an immunoassay of the recovered APC2 with antibodies against ubiquitin) , and determining the effect of the modulator on the degree of ubiquitination.
  • APC2 assays may also be provided to target enzymatic activity of APC2 such as kinase activity.
  • Such assays will comprise providing a substrate for such activity (such as another member of the APC) under conditions where in the absence of a putative modulator, the activity may occur, and measuring the amount of modulation of said activity caused by the presence of a modulator.
  • Assays may be conducted in any convenient format conventional in the art. Where assays involve the use of fusion proteins (e.g. two hybrid assays) and/or the use of reporter constructs, such proteins and constructs may be generated by transient transfection of a host cell, or in stable transformed cell lines.
  • Cell lines may be yeast, insect, or vertebrate such as mammalian.
  • Assays will generally be conducted under physiological conditions of salt and pH, or close enough thereto to allow the outcome of the assay to be determined (e.g. transcription or enzymatic function of a reporter enzyme, etc) in a meaningful manner .
  • Assays may also be conducted where suitable in cell free systems, for example using a rabbit reticulocyte lysate .
  • assays of the invention are particularly suitable for the identification of inhibitors of cell cycle progression by disruption of the APC complex, the assay may also be used for other modulators of cell cycle progression, for example for compounds which enhances or stabilizes the various interactions described above. Stabilization of the APC complex may also prevent or antagonise cell cycle progression, since the complex itself disassembles following the exit from mitosis. Substances obtainable by assays of the invention, and their use in methods of treatment or for the manufacture of medicaments for use in methods of treatment form another aspect of the invention.
  • the assays of the invention give rise to novel cell lines useful in performing the assays. Such cell lines form a further aspect of the invention.
  • cell lines of the invention will comprise :
  • a first nucleic acid construct comprising nucleic acid encoding a fusion of an APC2 polypeptide and one of a DBD and an activation domain operably linked to a promoter
  • a second nucleic acid construct comprising nucleic acid encoding a fusion of an APC polypeptide and a DBD when (a) comprises an activation domain or an activation domain when (a) comprises a DBD, said encoding nucleic acid being operably linked to a promoter, such that and
  • nucleic acid construct comprising a reporter gene operably linked to a promoter, said promoter being less or more active in the presence of a APC2/APC-member polypeptide complex in the cell than in its absence.
  • (a) includes a DBD which is encoded 5' to the APC2 polypeptide, and (b) includes an activation domain, which is encoded 5' to an APC8 polypeptide.
  • the promoters may be homologous or heterologous to the APC2 and APC encoding sequences. Desirably, both are heterologous and preferably not regulated in a cell cycle specific manner.
  • Such promoters include CMV promoters.
  • the nucleic acid constructs may be DNA or RNA. They may be carried stably in the genome of the cell or in the form of non- integrated plasmid vectors .
  • Host cell lines include in particular fungal and mammalian, especially yeast or other fungal cell lines, including those mentioned elsewhere herein.
  • the promoter may be a constitutive promoter such as the ADH1 promoter.
  • the present invention also provides APC2 polypeptides (including the above-described variants and fragments) in isolated form, free or substantially free of material with which it is naturally associated such as other polypeptides with which it is found in the cell.
  • the polypeptides may of course be formulated with diluents or adjuvants and still for practical purposes be isolated - for example the polypeptides will normally be mixed with gelatin or other carriers if used to coat microtitre plates for use in immunoassays .
  • the polypeptides may be glycosylated, either naturally or by systems of heterologous eukaryotic cells, or they may be (for example if produced by expression in a prokaryotic cell) unglycosylated. Polypeptides may phosphorylated and/or acetylated.
  • a polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 90%, e.g. 95%, 98% or 99% of the polypeptide in the preparation is a polypeptide of the invention.
  • Polypeptides of the invention may be modified for example as described above to make them suitable for particular assay formats of the invention, including the addition of histidine residues to assist their purification or by the addition of a signal sequence to promote their secretion from a cell.
  • a polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance after production by expression from encoding nucleic acid (for which see below) .
  • Polypeptides according to the present invention may also be generated wholly or partly by chemical synthesis, for example in a step-wise manner.
  • a polypeptide according to the present invention may be used as an immunogen or otherwise in obtaining specific antibodies.
  • Antibodies are useful in purification and other manipulation of polypeptides and peptides, diagnostic screening and the like, as discussed herein.
  • a polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function. Such molecules may be useful in a therapeutic (possibly including prophylactic) context.
  • a polypeptide of the invention may be labelled with a revealing label.
  • the revealing label may be any suitable label which allows the polypeptide to be detected. Suitable labels include radioisotopes , e.g. 125 I, enzymes, antibodies, polynucleotides and linkers such as biotin. Labelled polypeptides of the invention may be used in diagnostic procedures such as immunoassays in order to determine the amount of a polypeptide of the invention in a sample.
  • a polypeptide or labelled polypeptide of the invention or fragment thereof may also be fixed to a solid phase, for example the surface of an immunoassay well or dipstick.
  • Such labelled and/or immobilized polypeptides may be packaged into kits in a suitable container along with suitable reagents, controls, instructions and the like.
  • Such polypeptides and kits may be used in methods of detection of antibodies to such polypeptides present in a sample or active portions or fragments thereof by immunoassay.
  • Immunoassay methods are well known in the art and will generally comprise : (a) providing a polypeptide comprising an epitope bindable by an antibody against said protein;
  • the provision of the novel polypeptides enables for the first time the production of antibodies able to bind it specifically.
  • Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other polypeptides, particularly other APC members of the same species for which it has no or substantially no binding affinity (e.g. a binding affinity of at least about lOOOx worse) .
  • Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules.
  • Antibodies according to the present invention may be specific for the wild- type polypeptide.
  • Antibodies according to the invention may be specific for a particular mutant, variant, allele or derivative polypeptide as between that molecule and the wild-type polypeptide, so as to be useful in diagnostic and prognostic methods as discussed below. Antibodies are also useful in purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid.
  • Preferred antibodies according to the invention are isolated, in the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components. Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.
  • Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit) with a polypeptide of the invention. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al , Nature, 357:80- 82, 1992) .
  • an antibody specific for a protein may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047.
  • Example antibody fragments capable of binding an antigen or other binding partner are the Fab fragment consisting of the VL, VH, CI and CHI domains; the Fd fragment consisting of the VH and CHI domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab')2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region. Single chain Fv fragments are also included.
  • Humanized antibodies in which CDRs from a non-human source are grafted onto human framework regions, typically with the alteration of some of the framework amino acid residues, to provide antibodies which are less immunogenic than the parent non-human antibodies, are also included within the present invention.
  • Antibodies according to the present invention may be used in screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used in purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding a
  • Nucleic acid may be single or double stranded polynucleotides .
  • Single stranded nucleic acids include anti-sense nucleic acids.
  • Nucleic acid may be provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the murine genome, except possibly one or more regulatory sequence (s) for expression. Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA.
  • Nucleic acids include nucleic acids which comprise a sequence having at least 60% homology, more preferably at least 70%, such as at least 80%, 90%, 95%, 98% or 99% sequence homology nucleic acid of S. cerevisiae APC2.
  • the present invention thus provides an isolated nucleic acid which consists essentially of the nucleic acids described above encoding an APC2 polypeptide.
  • the term “consist essentially of” refers to nucleic acids which do not include any substantial additional 5' or 3 ' nucleic acid sequences.
  • the invention further provides a vector comprising an isolated nucleic acid wherein said nucleic acid is linked to 5 ' or 3 ' vector sequences with which it is not naturally associated in the genome of a cell .
  • Suitable 5 ' sequences include a promoter operably linked to the APC2 encoding sequences.
  • Vectors may be plasmids, viral e.g. 'phage phagemid or baculoviral, cosmids , YACs, BACs , or PACs as appropriate.
  • the vectors may be provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
  • the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector.
  • Vectors may be used in vi tro, for example for the production of RNA or used to transfect or transform a host cell.
  • the vector may also be adapted to be used in vivo, for example in methods of gene therapy.
  • Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. Suitable host cells include bacteria, eukaryotic cells such as mammalian and yeast, and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells, COS cells and many others.
  • Promoters and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed.
  • yeast promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmtl and adh promoter.
  • Mammalian promoters include the metallothionein promoter which is can be included in response to heavy metals such as cadmium.
  • Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. All these promoters are readily available in the art .
  • the vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the polypeptide is produced as a fusion and/or nucleic acid encoding secretion signals so that the polypeptide produced in the host cell is secreted from the cell.
  • nucleic acids which are fragments of the nucleic acids described above.
  • nucleic acids which are preferred include nucleic acids which consist essentially of from 15 to 50, for example from 15 to 35, 18 to 35, 15 to 24, 18 to 30, 18 to 21 or 21 to 24 nucleotides of a sequence having at least 60% homology to the nucleic acid sequence of S . cerevisiae APC2 or their complements.
  • nucleic acids include anti-sense nucleic acids.
  • Antisense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of polypeptide encoded by a given DNA sequence so that its expression is reduce or prevented altogether.
  • anti-sense sequences may be used to modulate the expression of APC2 , for example in the treatment of fungal infections.
  • the construction of antisense sequences and their use is described in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990), Crooke , Ann. Rev. Pharmacol. Toxicol . , 32:329-376, (1992), and Zamecnik and Stephenson, P.N.A.S, 75:280-284, (1974) .
  • nucleic acids of the invention which consist essentially of from 15 to 50 nucleotides as defined above may however be linked at the 3 ' but preferably 5' end to short (e.g from 4 to 15, such as from 4 to 10 nucleotides) additional sequences to which they are not naturally linked.
  • additional sequences are preferably linkers which comprise a restriction enzyme recognition site to facilitate cloning when the nucleic acid of the invention is used for example as a PCR primer.
  • Nucleic acids useful as probes and primers may carry a revealing label.
  • Suitable labels include radioisotopes such as 32 P or 35 S, fluorescent labels, enzyme labels, or other protein labels such as biotin. Such labels may be added to polynucleotides or primers of the invention and may be detected using by techniques known per se .
  • Nucleic acid sequences encoding all or part of the APC2 gene and/or its regulatory elements can be readily prepared by the skilled person using the information and references contained herein and techniques known in the art (for example, see Sambrook, Fritsch and Maniatis, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1989, and Ausubel et al, Short Protocols in Molecular Biology, John Wiley and Sons, 1992) . These techniques include (I) the use of the polymerase chain reaction (PCR) to amplify samples of such nucleic acid, e.g. from genomic sources, (ii) chemical synthesis, or (iii) preparing cDNA sequences. Modifications to the wild type sequences described herein can be made, e.g. using site directed mutagenesis, to lead to the expression of modified polypeptides or to take account of codon preference in the host cells used to express the nucleic acid.
  • PCR polymerase chain reaction
  • short sequences for use as primers will be produced by synthetic means, involving a step wise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art .
  • Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15-50 nucleotides) based on the sequence information provided herein to a region of the mRNA or genomic sequence encoding the mRNA which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from a murine or human cell (e.g.
  • an actively dividing cell such as a fetal cell
  • performing a polymerase chain reaction under conditions which bring about amplification of the desired region isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA.
  • the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
  • Genomic clones containing the APC2 gene and its introns and promoter regions may also be obtained in an analogous manner, starting with genomic DNA from a murine or human cell, e.g. a primary cell such as a liver cell, a tissue culture cell or a library such as a phage, cosmid, YAC (yeast artificial chromosome) , BAC (bacterial artificial chromosome) or PAC (P1/P2 phage artificial chromosome) library.
  • a primary cell such as a liver cell, a tissue culture cell or a library such as a phage, cosmid, YAC (yeast artificial chromosome) , BAC (bacterial artificial chromosome) or PAC (P1/P2 phage artificial chromosome) library.
  • APC2 encodes a 853 amino acid protein of 99 kD (GenBank Z73299; YPD YLR127C) containing several potential Cdc28 phosphorylation sites. Database searches reveal a domain of weak homology (23%- 28% identity, 49%-55% similarity) to Drosophila and human genes belonging to the cullin family (Kipreos et al . , 1996; Jackson, 1996) as well as to a S. pombe hypothetical protein. Cullin family members appear to have a role in cell cycle regulation and include S. cerevisiae CDC53 , which controls Gl cyclin degradation (Jackson, 1996; Willems et al . , 1996).
  • APC2p interacts wi th the APC component Cdc23p in vivo
  • a triple Myc epitope tagged version of APC2 was integrated in wild type haploid CG378 (MATa ura3 leu2 trpl ade5) at the APC2 locus.
  • wild type haploid CG378 MATa ura3 leu2 trpl ade5
  • APC2Myc3p was detected as a 100 kD protein by Western blotting of crude extracts from log phase cells.
  • the APC2Myc3 strain and the corresponding isogenic parental strain were transformed with a low copy plasmid containing a double HA epitope tagged CDC23 , CDC23HA2.
  • Extracts prepared from cells expressing various combinations of these tagged proteins were subjected to imunoprecipitation with anti- Myc antibodies and probed with an anti-HA antibody to look for co-precipitation of Cdc23p with APC2p.
  • Cdc23HA2p was specifically co-precipitated with APC2Myc3p. This in vivo interaction between Cdc23p and APC2p strongly supports our evidence that APC2p is indeed a newly identified component of APC.
  • Yeast transformations were as described (Schiestl and Gietz, 1989). Yeast was grown in rich broth supplemented with 2% glucose, YPD, (Sherman et al . , 1986) or with the appropriate carbon source at 2%. Minimal medium was yeast nitrogen base (Difco) , with appropriate supplements and a carbon source at 2%.
  • a DNA fragment containing the APC2 ORF and flanking promoter sequences was generated by PCR using the following oligonucleotides: ATTGAATTGTTTGCCTGACTAGTG (SEQ ID NO-l) and CGGGATCCTCTGATATACGTACGACC (SEQ ID NO: 2) .
  • the resulting PCR product was digested with BamHI and Spel and cloned into a URA3 bearing integrative plasmid vector.
  • the plasmid was cut at a unique Nrul site and integrated upstream of APC2 .
  • Genomic DNA from the transformant was digested with Malawi I and self ligated and transformed into E. coli .
  • the resulting URA3 plasmid also carries 4.5 kb of APC2 sequences including the complete open reading frame and 1.4 kb of upstream sequences. This construct was able to rescue a lethal open reading frame deletion.
  • the triple Myc epitope tagged APC2Myc3 was constructed as follows: the APC2 ORF was amplified using PCR with the oligonucleotides APC2-5 5' GGCTCTAGATTTGGTATTGTTCAAAATTTTC 3 1 (SEQ ID NO: 3) and APC2-3 5' GGCTCTAGAATGTCATTTCAGATTACCCCA 3' (SEQ ID NO: 4) and Pfu Taq polymerase (Stratagene) . The PCR product was digested with Xbal and cloned into Xbal digested pRS306-3Myc vector. In frame insertion was confirmed by sequencing the resulting pRS306-APC2-3Myc construct. For integration at the APC2 locus, this construct was cut at a unique Spel site 240bp downstream from the initiating ATG.
  • HI kinase assay protein A/G beads- Immune complex were collected by centrifugation and washed 3 times with breaking buffer, 2 times with kinase buffer (25 mM MOPS pH 7.2, 10 mM MgCl 2 , ImM EGTA) and incubated for 20 minutes at room temperature with 15 ml kinase buffer containing lmg/ml Histone HI and 0.1 ml ATP ⁇ 32 P (lOmCi/ml) . The reaction was stopped by adding one volume of cracking buffer. Phosphorylated Histone HI were analysed by PAGE-SDS and autoradiography.
  • Protein A/G beads-immune complex were collected, washed 3 times with breaking buffer and co-precipitating proteins were released by boiling in cracking buffer. The supernatant was processed for western blotting analysis as detailed above.
  • This example demonstrates in vivo interaction of APC2 and APC8 in a yeast two hybrid assay system.
  • Plasmid pAS2-APC2 contains the DNA sequence encoding amino acids 9-853 of Apc2 sub-cloned into pAS2. It was constructed by cloning a 3.5kb Xhol/Sall DNA fragment containing APC2 into the Sail site of the two-hybrid vector pAS2 (Clontech) .
  • pAS2-APC2 bears the DNA sequence encoding amino acids 9-853 of Apc2 fused in frame to the sequence encoding the DNA-binding domain of Gal4. This fusion is downstream of an ADH1 promoter and so is expressed constitutively in vivo.
  • Plasmid pACT2-CDC23 which contains the DNA sequence encoding amino acids 1-626 of Cdc23/Apc8 sub-cloned into pACT2.
  • the full length CDC23 gene was obtained using by PCR using the primers APC8FOR (BAMHI) ACT (Sequence: 5 'AAAAAAGGATCCCGATGAATGACGACAGCCAGGATAAAATAATACATG 3' (SEQ ID NO:5), containing Ba ⁇ jHI site, underlined) and CDC23REV (SALI)
  • the ligation mixes were used to transform calcium-competent E. coli JM109 (Promega) and plasmid DNA was purified from several of the resulting colonies. This was digested with Hindlll to confirm insert orientation and one of the plasmids containing CDC23 in the correct orientation was used for two-hybrid analysis.
  • This plasmid designated pACT2-CDC23, bears the DNA sequence encoding amino acids 1-626 of Cdc23 fused in frame to the sequence encoding the transcription activating domain of Gal4. This fusion is downstream of an ADH1 promoter and so is expressed constitutively in vivo .
  • the yeast reporter strain for the two-hybrid system Y187 contains the LacZ reporter gene with upstream Gal4 binding sites and the strain YRG-2 (Stratagene) contains the HIS3 reporter gene with upstream Gal4 binding sites. These strains were cotransformed with:
  • pGBT9 two-hybrid vector encoding the Gal4 DNA binding domain, Clontech
  • pCLl wild type full length GAL4 in a YCp50 derivative
  • pVA3-l encodes murine p53 (72-390) fused in-frame to Gal4 DBD; Clontech) and pTDl-1 (SV40 large T-antigen (84-708) fused in- frame to Gal4 transcription activating domain; Clontech) ;
  • Transformants were selected by plating on SC (Glucose) -Leu-Trp agar and incubating at 30°C for 3 days. Five individual colonies from each transformation were streaked onto SC (Glucose) -Leu-Trp agar plates and incubated at 30°C overnight These plates were used as stocks and were stored at 4°C for up to 1 month. The expression of the HIS3 and LacZ reporter genes in each of the above strains was then analysed as described below.
  • the ⁇ -galactosidase activity of each of the Y187-derived test strains was analysed using the qualitative SSX and colony lift assays.
  • SSX Plate Assay Five colonies of each strain were streaked from the stock plates (see above) onto SSX (Glucose) -Leu-Trp agar and then incubated at 30°C. The colour of the cells in each streak was monitored for several days. Y187 containing both pGBT9 and pCLl should turn blue overnight whilst yeast carrying interacting fusion proteins should turn blue after one to six days. Yeast carrying non- interacting fusion proteins will remain white after six or more days, as will yeast harbouring both pGBT9 and pACT2.
  • the reporter strain which had been cotransformed with (i) pGBT9 and pCLl and (ii) pVA3-l and pTDl-1 (the positive interaction control between p53 and large T-antigen) had turned blue on SSX agar. After a total of four days incubation at 30°C, one additional strain had turned blue on SSX media. This strain had been cotransformed with pAS2-APC2 and pACT2-CDC23 (which express Gal4DBD-Apc2 (9 _ 853) and Gal4AD-Cdc23 (1 _ 626) respectively). The Y187 strain harbouring the plasmids pGBT9 and pACT2 remained white after six days incubation at 30°C, as did the other strains tested.
  • the reporter strain Y187 was cotransformed with:
  • pGBT9 two-hybrid vector encoding the Gal4 DNA binding domain
  • pCLl wild type full length GAL4 in a YCp50 derivative
  • pVA3-l encodes murine p53 (72-390) fused in-frame to Gal4 DBD; Clontech) and pTDl-1 (SV40 large T-antigen (84-708) fused in- frame to Gal4 transcription activating domain; Clontech) ;
  • Plasmid pACT-APC2 encoding amino acids 9-853 of Apc2 is sub- cloned into pACTl (Clontech) .
  • pACT-APC2 was constructed by cloning a 3.5kb Xhol/Sall DNA fragment containing APC2 into the Sail site of the two-hybrid vector pACTl (Clontech) .
  • Yeast reporter strains are constructed in a similar fashion to Example 2 above, with the strains being cotransformed with:
  • Transformants are selected and plated as described in Example 2 above, together with the appropriate Example 2 controls. After three days incubation the positive control (pVA3-l and PTD1-1) have grown, as well as the strain transformed with pAS2-APC2 and pACT-APC2 (which express Gal4DBD-Apc2 (9 _ 853) and Gal4AD-Apc2 (9 -. 853) respectively) . This indicates that Apc2 forms homodimers .
  • Beta-galactosidase expression is also tested as described above, using the SSX and colony lift assays, together with the appropriate controls.
  • the reporter strain which had been cotransformed with (i) pGBT9 and pCLl and (ii) pVA3-l and pTDl-1 turns blue on SSX agar.
  • the strain which is been cotransformed with pAS2-APC2 and pACT-APC2 which express Gal4DBD-Apc2 (9 _ 853) and Gal4AD-Apc2 (9 -. 853) respectively
  • Gal4DBD-Apc2 (9 _ 853) and Gal4AD-Apc2 (9 -. 853) respectively also turns blue, indicating that APC2 forms homodimers.
  • the Y187 strain harbouring the plasmids pGBT9 and pACT2 remain white after six days incubation at 30 °C.
  • the reporter strain Y187 is incubated for 3 days at 30°C as above. After 30 minutes the colonies of reporter strain which are cotransformed with pGBT9 and pCLl turn blue. After an additional hour the colonies of reporter strain which are cotransformed with pVA3-l and pTDl-1 (the positive interaction control between p53 and large T-antigen) also turn blue and, after a total of eight hours incubation at 30°C, the colonies of the strains are cotransformed with pAS2- APC2 and pACT-APC2 (which express Gal4DBD-Apc2 (9 -. 853) and Gal4AD- Apc2 (9 _ 853) respectively) also turn blue.
  • the Y187 strain harbouring the plasmids pGBT9 and pACT2 remains white after an overnight incubation at 30°C, as do the other strains tested, indicating that Apc2 forms homodimers.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne la découverte d'un nouveau composé du complexe de promotion de l'anaphase de la levure (APC) et son utilisation dans des analyses pour la recherche d'inhibiteurs ou de modulateurs de la progression du cycle cellulaire, notamment dans les cellules fongiques. L'invention se rapporte particulièrement à une analyse pour la recherche d'un inhibiteur de la progression du cycle des cellules eucaryotes, qui consiste à: (a) prévoir un polypeptide comprenant la séquence de la protéine d'APC2, un fragment ou un variant de celle-ci, capable de s'associer à un complexe promoteur de l'anaphase (APC); (b) prévoir un deuxième élément polypeptidique de l'APC avec lequel la protéine d'APC2 est capable de former un complexe en l'absence d'un inhibiteur putatif; (c) prévoir un composé inhibiteur putatif; et (d) mesurer le degré d'inhibition de la liaison entre (a) et (b) induite par la présence dudit inhibiteur putatif. Le deuxième composant est de préférence APC8 (Cdc23).
PCT/GB1998/003890 1997-12-23 1998-12-23 Analyse pour la recherche de modulateurs de l'interaction entre la proteine apc2 du complexe de promotion de l'anaphase et d'autres elements d'apc WO1999034012A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU17744/99A AU1774499A (en) 1997-12-23 1998-12-23 Assays for modulators of the interaction between anaphase promoting complex protein apc2 and other apc members

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9727277.7 1997-12-23
GBGB9727277.7A GB9727277D0 (en) 1997-12-23 1997-12-23 Assay

Publications (1)

Publication Number Publication Date
WO1999034012A1 true WO1999034012A1 (fr) 1999-07-08

Family

ID=10824190

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1998/003890 WO1999034012A1 (fr) 1997-12-23 1998-12-23 Analyse pour la recherche de modulateurs de l'interaction entre la proteine apc2 du complexe de promotion de l'anaphase et d'autres elements d'apc

Country Status (3)

Country Link
AU (1) AU1774499A (fr)
GB (1) GB9727277D0 (fr)
WO (1) WO1999034012A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001064913A2 (fr) * 2000-03-02 2001-09-07 Rigel Pharmaceuticals, Inc. Proteines de cycle cellulaire associees au rad9, compositions et procedes d'utilisation
WO2002012273A2 (fr) * 2000-08-03 2002-02-14 Syngenta Participations Ag Gènes cibles d'herbicides et procédés
US6737244B2 (en) 2000-04-03 2004-05-18 Rigel Pharmaceuticals, Inc. Ubiquitin ligase assay
US7524642B2 (en) 2000-04-03 2009-04-28 Rigel Pharmaceuticals, Inc. Assays for identifying ubiquitin agents and for identifying agents that modify the activity of ubiquitin agents

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995028483A1 (fr) * 1994-04-14 1995-10-26 Cold Spring Harbor Laboratory Proteines regulatrices du cycle cellulaire et leurs utilisations
WO1995033819A2 (fr) * 1994-06-02 1995-12-14 Mitotix, Inc. Proteines se fixant a la cdk4 (kinase cyclino-dependante de type 4)
WO1997042222A1 (fr) * 1996-05-08 1997-11-13 Cyclacel Limited Procedes et moyens destines a inhiber l'activite de cdk4
EP0812594A1 (fr) * 1996-06-13 1997-12-17 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Composés interférant avec la réplication de l'ADN dans les cellules proliférant rapidement pour l'utilisation dans la thérapie des cancers, et méthodes pour identifier ces composés
EP0843008A1 (fr) * 1996-11-14 1998-05-20 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Méthodes pour la production du complexe promoteur de l'anaphase

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995028483A1 (fr) * 1994-04-14 1995-10-26 Cold Spring Harbor Laboratory Proteines regulatrices du cycle cellulaire et leurs utilisations
WO1995033819A2 (fr) * 1994-06-02 1995-12-14 Mitotix, Inc. Proteines se fixant a la cdk4 (kinase cyclino-dependante de type 4)
WO1997042222A1 (fr) * 1996-05-08 1997-11-13 Cyclacel Limited Procedes et moyens destines a inhiber l'activite de cdk4
EP0812594A1 (fr) * 1996-06-13 1997-12-17 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Composés interférant avec la réplication de l'ADN dans les cellules proliférant rapidement pour l'utilisation dans la thérapie des cancers, et méthodes pour identifier ces composés
EP0843008A1 (fr) * 1996-11-14 1998-05-20 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Méthodes pour la production du complexe promoteur de l'anaphase
WO1998021326A2 (fr) * 1996-11-14 1998-05-22 Boehringer Ingelheim International Gmbh Procedes de production d'un complexe stimulant l'anaphase

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
H YU, J-M PETERS, R W KING, A M PAGE, P HIETER, M W KIRSCHNER: "Identification of a Cullin Homology Region in a Subunit of the Anaphase-Promoting Complex", SCIENCE, vol. 279, 20 February 1998 (1998-02-20), pages 1219 - 1222, XP002100878 *
K M KRAMER, D FESQUET, A L JOHNSON, L H JOHNSTON: "Budding yeast RSI1/APC2, a novel gene necessary for initiation of anaphase, encodes an APC subunit", EMBO JOURNAL, vol. 17, no. 2, 1998, pages 498 - 506, XP002100880 *
V OLLENDORFF, D J DONOGHUE: "The Serine/Threonine Phosphatase PP5 Interacts with CDC16 and CDC27, Two Tetratricopeptide Repeat-containing Subunits of the Anaphase-promoting Complex", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 51, 19 December 1997 (1997-12-19), pages 32011 - 32018, XP002100881 *
W ZACHARIAE, A SHEVCHENKO, P D ANDREWS, R CIOSK, M GALOVA, M J R STERK, M MANN, K NASMYTH: "Mass Spectrometric Ananlysis of the Anaphase-Promoting Complex from Yeast: Identification of a Subunit Related to Cullins", SCIENCE, vol. 279, 20 February 1998 (1998-02-20), pages 1216 - 1219, XP002100879 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001064913A2 (fr) * 2000-03-02 2001-09-07 Rigel Pharmaceuticals, Inc. Proteines de cycle cellulaire associees au rad9, compositions et procedes d'utilisation
WO2001064913A3 (fr) * 2000-03-03 2002-04-18 Rigel Pharmaceuticals Inc Proteines de cycle cellulaire associees au rad9, compositions et procedes d'utilisation
US6737244B2 (en) 2000-04-03 2004-05-18 Rigel Pharmaceuticals, Inc. Ubiquitin ligase assay
US6740495B1 (en) 2000-04-03 2004-05-25 Rigel Pharmaceuticals, Inc. Ubiquitin ligase assay
US7022493B2 (en) 2000-04-03 2006-04-04 Rigel Pharmaceuticals, Inc. Ubiquitin conjugation assays
US7524642B2 (en) 2000-04-03 2009-04-28 Rigel Pharmaceuticals, Inc. Assays for identifying ubiquitin agents and for identifying agents that modify the activity of ubiquitin agents
US7781182B2 (en) 2000-04-03 2010-08-24 Rigel Pharmaceuticals, Inc. Ubiquitin ligase assay
WO2002012273A2 (fr) * 2000-08-03 2002-02-14 Syngenta Participations Ag Gènes cibles d'herbicides et procédés
WO2002012273A3 (fr) * 2000-08-03 2003-05-30 Syngenta Participations Ag Gènes cibles d'herbicides et procédés

Also Published As

Publication number Publication date
GB9727277D0 (en) 1998-02-25
AU1774499A (en) 1999-07-19

Similar Documents

Publication Publication Date Title
Warbrick et al. Homologous regions of Fen1 and p21Cip1 compete for binding to the same site on PCNA: a potential mechanism to co-ordinate DNA replication and repair
Hwang et al. A novel yeast screen for mitotic arrest mutants identifies DOC1, a new gene involved in cyclin proteolysis
Burtis et al. The doublesex proteins of Drosophila melanogaster bind directly to a sex‐specific yolk protein gene enhancer.
Bertolaet et al. UBA domains mediate protein-protein interactions between two DNA damage-inducible proteins
Chen et al. Purification and characterization of the 1.0 MDa CCR4-NOT complex identifies two novel components of the complex
Farrás et al. SKP1–SnRK protein kinase interactions mediate proteasomal binding of a plant SCF ubiquitin ligase
Schlenstedt et al. Mutants in a yeast Ran binding protein are defective in nuclear transport.
US6464974B1 (en) Immunosuppressant target proteins
Grueneberg et al. Human and Drosophila homeodomain proteins that enhance the DNA-binding activity of serum response factor
Mundt et al. On the regulation and function of human polo-like kinase 1 (PLK1): effects of overexpression on cell cycle progression
Fleckner et al. U2AF65 recruits a novel human DEAD box protein required for the U2 snRNP-branchpoint interaction.
Erdman et al. Functional and genetic characterization of the oligomerization and DNA binding properties of the Drosophila doublesex proteins
Lu et al. Evidence for a NIMA-like mitotic pathway in vertebrate cells
US6410245B1 (en) Compositions and methods for detecting ligand-dependent nuclear receptor and coactivator interactions
Umeda et al. A novel nuclear protein, Twa1, and Muskelin comprise a complex with RanBPM
Morrell et al. Sid4p-Cdc11p assembles the septation initiation network and its regulators at the S. pombe SPB
Zheng et al. Hec1p, an evolutionarily conserved coiled-coil protein, modulates chromosome segregation through interaction with SMC proteins
WO1995033052A9 (fr) Proteines cibles immunodepressives
US6432692B1 (en) Sensitive bioassay for detecting agonists of the aryl hydrocarbon receptor
Siaut et al. An Rpb4/Rpb7-like complex in yeast RNA polymerase III contains the orthologue of mammalian CGRP-RCP
WO1999034012A1 (fr) Analyse pour la recherche de modulateurs de l'interaction entre la proteine apc2 du complexe de promotion de l'anaphase et d'autres elements d'apc
US5679566A (en) Yeast NMD2 gene
Feng et al. Identification and characterization of Saccharomyces cerevisiae Cdc6 DNA-binding properties
US7410774B1 (en) Compounds modulating sister chromatid separation and method for identifying same
US7790843B2 (en) Cypin polypeptide and fragments thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: KR

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA