WO1999025721A1

WO1999025721A1 - Detection and treatment of retinal degenerative disease

Info

Publication number: WO1999025721A1
Application number: PCT/US1998/024322
Authority: WO
Inventors: Carol L. Freund; Roderick R. Mcinnes; Jens Looser; Constance L. Cepko; Takahisa Furukawa; Eric M. Morrow
Original assignee: The Hospital For Sick Children; President And Fellows Or Harvard College
Priority date: 1997-11-13
Filing date: 1998-11-13
Publication date: 1999-05-27
Also published as: WO1999025721B1; AU1408999A

Abstract

The invention features a novel gene, CRX, which encodes a retinal-specific transcriptional activator protein. Mutations within the CRX gene are responsible for cone-rod dystrophy, a retinal degenerative disease. The invention features methods for the detection of CRX mutations, and for the prevention and treatment of retinal degenerative diseases influenced by the CRX gene.

Description

DETECTION AND TREATMENT OF RETINAL DEGENERATIVE DISEASE

Statement as to Federally-Sponsored Research This research has been sponsored in part by NIH grant number R01 EYO 8064.

The U.S. government has certain rights to the invention.

Background of the Invention The neural retina is an exquisitely sensitive light detector comprised of photoreceptor cells. These cells are responsible for phototransduction, a process which encompasses a series of signal amplification steps, and enhances the sensitivity of the visual system such that a single photon of light may be detected. The cascade is initiated by the capture of light by 11-cis retinal, a chromophore bound by the opsin proteins (rhodopsin in rod photoreceptors and cone opsins in cone photoreceptors)

The proteins necessary for phototransduction are found within an elaborate and highly specialized membranous structure, the photoreceptor outer segment. This structure appears to be relatively fragile, degenerating in response to many environmental and or genetic perturbations (e.g., see M.M. LaVail et al., Invest. Opthalmol Visual Sci. 28: 1043-1048, 1987; T.P. Dryja and T. Li, Hum. Mol. Genet. 4:1739-1743, 1995). Forty-five genetic loci for isolated (i.e., non-syndromic) inherited retinal degenerations have been mapped in humans, but the molecular genetic basis of only twelve of these disorders has been determined. Mutations in seven of these twelve genes lead to the clinical phenotype termed retinitis pigmentosa (RP). RP affects both rod and cone photoreceptor function throughout the retina and leads to gradual loss of peripheral vision followed by a loss of central vision. All but one of the seven known

RP genes encode a protein involved in phototransduction or photoreceptor outer segment structure. The five known genes associated with other forms of retinal degeneration include those for choroideremia, gyrate atrophy, Sorsby fundus dystrophy, Leber's congenital amaurosis, and Stargardt's disease.

Cone-rod dystrophy (CRD) is a clinical category of inherited retinal degeneration and occurs in autosomal dominant, autosomal recessive, and X-linked forms (A.C. Bird, Am. J. Opthalmol. 119:543-562, 1995). CRD also affects both cone and rod photoreceptor function across the retina, but differs from RP in that central visual loss is usually the earlier manifestation and, as the disease progresses, peripheral function is also lost (K. Evans et al., Arch. Opthalmol. 113: 195-201, 1995; JP. Szylyk et al., Arch. Opthalmol. 111 :781-788, 1993; K. Yagasaki and S.G. Jacobson, Arch. Opthalmol. 107:701-708, 1989). The autosomal dominant form of

CRD manifests substantial locus heterogeneity, with four loci assigned to date, on chromosomes 18q21.1-21.3 (M. Warburg et al., Am. J. Med. Genet. 39:288-293, 1991), 17pl2-13 (J. Balciuniene et al., Genomics 30:281-286, 1995; R.E. Kelsell et al., Hum. Mol. Genet. 6:597-600, 1997), 17q (J.A. Klystra and A.S. Aylsworth, Can. J. Opthalmol. 28:79-80, 1993), and 19ql3 (K. Evans et al., Nat. Genet. 6:210-213,

1994; CN. Gregory et al., m. J. Hum. Genet. 55: 1061-1063, 1994).

None of the genes associated with any form of CRD have yet been identified. Identification of such genes would make it possible to both diagnose the disease and identify effective therapies.

Summary of the Invention

We have discovered a novel gene, CRX, which is necessary for photoreceptor differentiation. Furthermore, we have found that CRN is mutated in patients with cone-rod dystrophy and Leber's congenital amaurosis (LCA). Our discovery makes possible the development of diagnostic, prognostic, and therapeutic compounds and methods for the detection and treatment of diseases involving retinal degeneration or malformation.

In a first aspect, the invention features a substantially pure CRX polypeptide. In preferred embodiments, the CRX polypeptide is a mammalian polypeptide, more preferably, a human polypeptide, a murine polypeptide, or a canine polypeptide. Most preferably, the human polypeptide is the polypeptide set forth in SEQ ID NO: 1 , the canine polypeptide is set forth in SEQ ID NO: 2, and the murine polypeptide is the polypeptide set forth in SEQ ID NO: 3. In another embodiment of this aspect, the polypeptide has the biological activity of a CRX polypeptide. In yet another embodiment, the CRX polypeptide is a CRX polypeptide which confers a CRX- associated disease when expressed in the appropriate cellular context.

In a second aspect, the invention features substantially pure nucleic acid encoding a CRX polypeptide. In one embodiment of this aspect, the nucleic acid is DNA, preferably genomic DNA or cDNA. In a preferred embodiment, the DNA has the sequence of SEQ ID NO: 4 (human CRX), or degenerate variants thereof, and encodes the amino acid sequence of SEQ ID NO: 1. In another preferred embodiment, the DNA has the sequence of SEQ ID NO: 5 (canine CRX), or degenerate variants thereof, and encodes the amino acid sequence of SEQ ID NO: 2. In another preferred embodiment, the DNA has the sequence of SEQ ID NO: 6 (murine CRX), or degenerate variants thereof, and encodes the amino acid sequence of

SEQ ID NO: 3. In still another preferred embodiment, the DNA encodes a CRX polypeptide having conservative amino acid substitutions and having CRX biological activity. In another preferred embodiment, the DNA encodes a mutant polypeptide. In a third aspect, the invention features a nucleic acid which hybridizes to sequences found within the nucleic acid of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID

NO: 6 under high stringency conditions. In another preferred embodiment, the invention features a probe for analyzing the CRN nucleic acid of an animal, the probe having a sequence complementary to at least 50% of at least 60 nucleotides of the nucleic acid encoding the CRX polypeptide or complementary to the nucleic acid encoding the CRX polypeptide, the probe being sufficient probe sufficient to allow nucleic acid hybridization to at least a portion of CRN nucleic acid under high stringency conditions. In a preferred embodiment, the sequence of the probe is complementary to at least 90% of at least 18 nucleotides of the nucleic acid encoding the CRX polypeptide. In yet another preferred embodiment, the invention features a nucleic acid comprising the antisense sequence of a CRX coding strand, a fragment of a CRX coding strand, or the antisense sequence specific for a mutant CRX coding strand, the sequence being sufficient to decrease CRX biological activity when present in a cell having CRX biological activity. In preferred embodiments, the antisense sequence comprises the A to C transversion at base pair 239, this nucleotide being within the codon for glutamic acid at CRX amino acid position 80, or comprises the deletion of a G nucleotide usually present at base pair 502, this nucleotide being within the codon for glutamic acid at CRX amino acid position 168, or comprises the

C to T transversion at base pair 551, this nucleotide being within the codon for leucine at CRX amino acid position 184.

In a fourth aspect, the invention features CRN DΝA that is operably linked to regulatory sequences for expression of CRX polypeptide. In a preferred embodiment, the regulatory sequences comprise a promoter. In another preferred embodiment, the promoter is inducible. In yet another preferred embodiment, the promoter is the CRX promoter.

In a fifth aspect, the invention features substantially pure DΝA containing regulatory sequences sufficient for the transcriptional regulation of the CRX gene in vivo. In various embodiments of the third aspect, the DΝA comprises the region from the CRN transcriptional start site to 1, 4, 6, 10, 25, 40, or 50 kilobase(s) upstream from said start site. In one embodiment, the CRX regulatory sequences are operably linked to a reporter gene sequence.

In a sixth, related aspect, the invention features a vector for gene therapy, the vector comprising the CRX regulatory DNA sequences of the fifth aspect. In a preferred embodiment, the CRX regulatory DNA within the gene therapy vector is operably linked to DNA encoding a polypeptide, wherein the polypeptide is a therapeutic polypeptide, preferably CRX.

In a seventh, related aspect, the invention features non-human transgenic animals comprising the nucleic acids of the second, third, fourth, or fifth aspects, preferably rodents, most preferably in mice.

In an eighth aspect, the invention features a method of generating an antibody that specifically binds a CRX polypeptide, the method comprising administering a CRX polypeptide, or a fragment of a CRX polypeptide, to an animal capable of generating an immune response, and isolating the antibody from the animal. In one embodiment, the invention features a method of generating an antibody that specifically binds a mutant CRX polypeptide, this method comprising administering a mutant CRX polypeptide or fragment of a mutant CRX polypeptide, to an animal capable of generating an immune response, and isolating the antibody from the animal. In preferred embodiments, the mutant CRX polypeptide or fragment thereof has an alanine residue at CRX amino acid position 80, or has a leucine residue at CRX amino acid position 184, or has at its carboxy terminus the amino acid sequence of SEQ ID NO: 7 (ser pro leu cys leu arg arg ser gly leu gly tyr tyr pro gin gly arg leu). In a ninth, related aspect, the invention features an antibody that specifically binds a CRX polypeptide. In preferred embodiments, the antibody specifically binds a) the first 38 amino acids N-terminal to the CRX homeodomain, or b) at least ten amino acids between amino acids 99 through 299 (C-terminal to the CRX homeodomain), or c) at least ten amino acids between amino acids 99 through 157, or d) at least ten amino acids between amino acids 171 through 299. In yet another preferred embodiment, the antibody binds a CRX polypeptide having an alanine residue at CRX amino acid position 80,. In another preferred embodiment, the antibody binds a CRX polypeptide having a leucine at position 184. In still another preferred embodiment, the antibody specifically binds the polypeptide sequence of

SEQ ID NO: 7.

In a tenth, related aspect, the invention features a method of detecting the presence of a CRX polypeptide, the method comprising contacting a sample with the antibody that specifically binds a CRX polypeptide, and assaying for binding of antibody to the polypeptide. In one preferred embodiment, the polypeptide is a mutant polypeptide. In another preferred embodiment, the polypeptide is a wild-type polypeptide.

In an eleventh aspect, the invention features a method of diagnosing an increased likelihood of developing a retinal disease, this method comprising analyzing the nucleic acids of an animal to determine whether the nucleic acids contain a mutation in a CRN gene, wherein the presence of said mutation is an indication that the animal has an increased likelihood of developing a retinal disease.

In a preferred embodiment of the eleventh aspect, primers are used for detecting the mutation, and are selected from: J3 (SEQ ID NO: 8); J6 (SEQ ID NO: 9); J7 (SEQ ID NO: 10); J10 (SEQ ID NO: 11); Jl 1 (SEQ ID NO: 12); J13 (SEQ ID

NO: 13); J15 (SEQ ID NO: 14); J31 (SEQ ID NO: 15); J32 (SEQ ID NO: 16); J33 (SEQ ID NO: 17); J34 (SEQ ID NO: 18); J35 (SEQ ID NO: 19); J36 (SEQ ID NO: 20); J37 (SEQ ID NO: 21); JH1 (SEQ ID NO: 22); and JH2 (SEQ ID NO: 23).

In other preferred embodiments of the eleventh aspect, the method further comprises the step of sequencing nucleic acid encoding CRX from the test subject, or further comprises the step of using nucleic acid primers specific for the CRN gene and wherein the primers are used for DΝA amplification by the polymerase chain reaction. In other preferred embodiments, the analyzing includes single strand conformational polymorphism (SSCP) analysis, or restriction length polymorphism (RFLP) analysis.

In yet other preferred embodiments of the eleventh aspect, the nucleic acid may be genomic DNA, cDNA, or RNA. In still other preferred embodiments of the eleventh aspect, the nucleic acid is amplified by the polymerase chain reaction. The primers used in the polymerase chain reaction are selected from: J3 (SEQ ID NO: 8); J6 (SEQ ID NO: 9); J7 (SEQ ID NO: 10); JIO (SEQ ID NO: 11); Jl 1 (SEQ ID NO: 12); J13 (SEQ ID NO: 13); J15 (SEQ ID NO: 14); J31 (SEQ ID NO: 15); J32 (SEQ ID NO: 16); J33 (SEQ ID NO: 17); J34 (SEQ ID NO: 18); J35 (SEQ ID NO: 19); J36 (SEQ ID NO: 20); J37 (SEQ ID NO:

21); JH1 (SEQ ID NO: 22); and JH2 (SEQ ID NO: 23).

In still other embodiments of the eleventh aspect, the test subject may be prenatal, or postnatal, is a mammal, and may, for example, be human or canine.

In yet other embodiments of the eleventh aspect, CRN nucleic acid analysis detects a missense mutation, preferably a mutation converting the glutamic acid residue at position 80 of CRX into alanine, or a mutation converting the proline residue at position 184 of CRX into leucine, or a frameshift mutation, preferably comprising a deletion of a G nucleotide within codon eleven of the thirteen codons specifying the WSP amino acid motif of CRX. In a further preferred embodiment, the analysis detects a mutation resulting in a truncated protein.

In a twelfth, related aspect, the invention features a method is for the diagnosis of a genetic predisposition for adCRD, LCA, retinitis pigmentosa, or age-related macular degeneration (AMD).

In a thirteenth aspect, the invention features a kit for the analysis of CRX nucleic acid. In one preferred embodiment, the kit contains nucleic acid probes for analyzing the nucleic acid of an animal, sufficient to determine whether said animal contains a mutation in said CRN nucleic acid. In another preferred embodiment, the kit contains antibodies for analyzing the CRX protein of an animal, sufficient to determine whether the animal contains a mutation in a CRN gene. In yet another preferred aspect, the animal is a human or a dog.

In a fourteenth aspect, the invention features a method of detecting a compound useful for the treatment of retinal disease, the method comprising assaying transcription levels of a reporter gene operably linked to a promoter, said promoter selected from: the rhodopsin promoter, the inter photoreceptor resinoid binding protein (IRBP) promoter, the cone opsin promoter, the arresting promoter, and the CRX promoter, said method comprising the steps of: (a) exposing said reporter gene to said compound, and

(b) assaying said reporter gene for an alteration in reporter gene activity relative to a reporter gene not exposed to said compound.

In a preferred embodiment of the above aspect, the method comprises assaying transcription levels of at least two of the said reporter genes. In related preferred embodiments, either an increase or a decrease in transcription may indicate a compound useful for the treatment of retinal disease.

In other preferred embodiments of the above aspect, the reporter gene is in a cell, the cell is in an animal. In still other preferred embodiments, the cell is a retinal cell, a pineal cell, or a photoreceptor cell, and the promoter is the rhodopsin promoter, the inter photoreceptor retinoid binding protein (IRBP) promoter, a cone opsin promoter, the arrestin promoter, or the CRX promoter. In other preferred embodiments, the promoter is the serotonin Ν-acetyl-transferase promoter, the hydroxyindole-O-methyltransferase promoter, or the pineal gland night-specific ATPase promoter. In a fifteenth, related aspect, the invention features a method of detecting a compound useful for the treatment of retinal disease, said method comprising the steps of: (a) exposing a cell to a test compound, and

(b) assaying said cell for an alteration in the level of rhodopsin, inter photoreceptor retinoid binding protein (IRBP), cone opsin, arrestin, or CRX polypeptides, relative to a cell not exposed to said compound. In a preferred embodiment of the above aspect, the method comprises assaying levels of at least two of the polypeptides. In other preferred embodiments, either an increase or a decrease in the level of said polypeptide indicates a compound useful for the treatment of retinal disease. In yet another preferred embodiment, the cell of the method of the eleventh aspect is in an animal. In a sixteenth aspect, the invention features a method of preventing a retinal disease, the method comprising introducing into a retina an expression vector comprising a CRN gene operably linked to a promoter, the CRN gene encoding a CRX polypeptide having CRX biological activity. In one preferred embodiment, the CRN gene is a mutant CRN gene. In another preferred embodiment, the CRN gene is a wild- type CRN gene.

In a seventeenth aspect, the invention features a method of preventing or ameliorating the effects of a disease-causing mutation in a CRN gene, the method comprising introducing into a retina an expression vector comprising a CRN gene operably linked to a promoter, the CRN gene encoding a functional CRX polypeptide. In one preferred embodiment, the CRN gene is a mutant CRN gene. In another preferred embodiment, the CRN gene is a wild-type CRN gene.

In a eighteenth aspect, the invention features a method of treating or preventing a retinal disease, the method comprising administering to an animal a compound that mimes the activity of wild- type CRX. In a nineteenth aspect, the invention features a method of treating or preventing a retinal disease, the method comprising administering to an animal a compound that modulates the levels of endogenous CRX. In preferred embodiments, the modulation may result in an increase or in a decrease of endogenous CRX. In another preferred embodiment, the modulation results from changes in transcriptional activity of the CRN gene. In still other preferred embodiments, the disease may be cone-rod dystrophy, Leber's Congenital Amaurosis, age-related macular degeneration, or retinitis pigmentosa.

In an twentieth aspect, the invention features a nonhuman transgenic animal expressing a transgenic polypeptide having CRX biological activity. In a preferred embodiment, the CRX transgene comprises the CRX sequence of SEQ ID NO: 1.

In a twenty-first, related aspect, the invention features a nonhuman transgenic animal expressing a retinal disease-causing CRX polypeptide. In preferred embodiments, the DNA encoding the CRX transgene comprises the CRX missense mutation shown in Fig. IC and ID, the CRX frameshift mutation shown in Fig. 2B and 2C, a CRX mutation such that the first nucleotide of codon 56 is altered, resulting in an amino acid change at position 56, a CRX mutation such that the first or second nucleotide of codon 217 is deleted, or a CRX mutation such that the third nucleotide of codon 167 and the first nucleotide of codon 168 are deleted. Preferably, the CRX transgene is operably linked to regulatory sequences for expression of CRX polypeptide, and more preferably, the regulatory sequences comprise a promoter.

A preferred embodiment of the twentieth and twenty- first aspects is that the transgenic animal is a mouse.

A twenty-second aspect of the invention features cells from the transgenic animal of the sixteenth and seventeenth aspects.

A twenty-third aspect of the invention features a non-human animal wherein one or both genetic alleles encoding a CRX polypeptide are mutated, and cells from the mutant animal. In a preferred embodiment, the mutant animal is a mouse.

In a twenty- fourth, related aspect, the invention features a non-human animal wherein one or both genetic alleles encoding a CRX polypeptide are disrupted, deleted, or otherwise rendered nonfunctional. Cells from the mutant animal also are featured. In a preferred embodiment, the mutant animal is a mouse.

In a twenty-fifth, related aspect, the invention features a method of detecting a compound useful for the treatment of retinal disease, the method comprising assaying binding of a CRX polypeptide to a promoter selected from: the rhodopsin promoter, the interphotoreceptor retinoid binding protein (IRBP) promoter, the cone-opsin promoter, the arrestin promoter, the serotonin N-acetyl-transferase promoter, the hydroxyindole-O-methyltransferase promoter, the pineal gland-specific ATPase promoter and the CRX promoter. The method further comprises the steps of (a) exposing the promoter to the compound and a CRX polypeptide, and (b) assaying binding of the CRX polypeptide to the promoter for an alteration in binding activity relative to a reporter gene not exposed to the compound.

In a preferred embodiment of the twenty-fifth aspect is that the CRX polypeptide is a wild-type polypeptide. In another preferred embodiment, the CRX polypeptide is a mutant polypeptide. In a related preferred embodiment, the binding activity increases in the presence of the compound. In yet another preferred embodiment, the binding activity decreases in the presence of the compound. In another preferred embodiment, the assay is performed in a cell-free assay. In a related preferred embodiment, the assay is performed in a cell. By "CRX", "CRX protein", or "CRX polypeptide" is meant a polypeptide, or fragment thereof, which has at least 30%, more preferably at least 35%, and most preferably 40% amino acid identity to either the amino-terminal 38 amino acids or the carboxy- terminal 200 amino acids of the human, dog, or mouse CRX polypeptides (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively) . It is understood that polypeptide products from splice variants of CRN gene sequences are also included in this definition. Preferably, the CRX protein is encoded by nucleic acid having a sequence which hybridizes to a nucleic acid sequence present in either SEQ ID NO: 4 (human CRNcDNA), SEQ ID NO: 5 (canine CRNcDNA), or SEQ ID NO: 6 (murine CRNcDNA) under stringent conditions. Even more preferably the encoded polypeptide also has wild-type CRX biological activity, or in the alternative, mutant CRX biological activity. Preferably, the CRX polypeptide has at least three other conserved regions, these being in the homeodomain, the OTX tail, and the WSP motif.

It is understood that, unless otherwise indicated, a CRX polypeptide includes wild- type CRX and mutant CRX.

By "CRN nucleic acid" or "CRN gene" is meant a nucleic acid, such as genomic DΝA, cDΝA, or mRΝA, that encodes CRX, a CRX protein, CRX polypeptide, or portion thereof, as defined above. A CRN nucleic acid also may be a CRN primer or probe, or antisense nucleic acid that is complementary to a CRN nucleic acid. It is understood that, unless otherwise indicated, a CRN nucleic acid includes wild- type CRN and mutant CRN. It is also understood that the accepted nomenclature for murine genes and human genes specifies the use of "Crx" and "CR ' respectively. For convention, "CRN' represents the genera.

By "wild- type CRX" is meant a CRN nucleic acid or CRX polypeptide having the nucleic acid and/or amino acid sequence most often observed among members of a given animal species and not associated with a disease phenotype. Wild-type CRX is biologically active CRX. A wild-type CRX is, for example, a human, canine, or murine CRX polypeptide having the sequence of SEQ ID NO: 1 , SEQ ID NO: 2, or

SEQ ID NO: 3, respectively, or a human, canine, or murine CRN nucleic acid having the sequence of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6, respectively.

By "mutant CRX", "CRX mutation(s)" or "mutations in CRX" is meant a CRX polypeptide or nucleic acid having a sequence that deviates from the wild-type sequence in a manner sufficient to confer a retinal disease phenotype in at least some genetic and/or environmental backgrounds. Such mutations may be naturally occurring, or artificially induced. They may be, without limitation, insertion, deletion, frameshift, or missense mutations. A mutant CRX protein may have one or more mutations, and such mutations may affect different aspects of CRX biological activity (protein function), to various degrees. Alternatively, a CRX mutation may indirectly affect CRX biological activity by influencing, for example, the transcriptional activity of a gene encoding CRX, or the stability of CRN mRNA. For example, a mutant CRX gene may be a gene which expresses a mutant CRX protein or may be a gene which alters the level of CRX protein in a manner sufficient to confer a retinal disease phenotype in at least some genetic and/or environmental backgrounds.

By "biologically active" CRX is meant a CRX protein or CRN gene that provides at least one biological function equivalent to that of a CRX polypeptide or

CRN gene.

Biological activities of a wild-type CRX polypeptide include, but are not limited to, the ability to bind DΝA sequences comprising OTX- or OTX-related DΝA- binding consensus sequences, the ability to transcriptionally activate certain photoreceptor-specific promoters, one example being the IRBP promoter (see Fig. 3), and the ability to stimulate photoreceptor cell precursors to terminally differentiate into rod-type photoreceptors. Inhibition of wild- type CRX biological activity, by expression of a dominant- inactive CRX protein or a CRX antibody in photoreceptor precursor cells results, for example, in the inhibition of rod cell differentiation. Preferably, the standard for the biological activity of the wild-type CRX is determined using the CRN nucleic acid or CRX polypeptides of SEQ ID ΝOs: 1-6. The degree of CRX biological activity may be intrinsic to the CRX polypeptide itself, or may be modulated by increasing or decreasing the number of CRX polypeptide molecules present intracellularly. Mutant CRX biological activity may be a dominant-interfering, dominant active biological activity, or the absence of at least one wild-type CRX biological activity. Dominant-interfering CRX biological activities include, but are not limited to, the ability to disrupt expression or activity of wild- type CRX, and the ability to decrease the differentiation or survival of rod or cone photoreceptors. Dominant- active CRX biological activities include, but are not limited to, the increased ability to bind DNA sequences comprising OTX- or OTX-related DNA-binding consensus sequences and to transcriptionally activate certain photoreceptor-specific promoters, one example being the IRBP promoter (see Fig. 3), in a manner greater than that of wild-type CRX. In this regard, a mutant CRX will display at least 120%> of at least one wild-type activity, more preferably, a mutant CRX will display at least 130-150% of a wild-type activity, and most preferably, a mutant CRX will display at least 150- 200%. of a wild-type activity. Mutant CRX biological activity may also be a similar, but reduced activity relative to the biological activity of wild-type CRX. Mutant CRX will display less than 50% of at least one wild-type activity, more preferably, a mutant CRX will display less than 20-30% of at least one wild-type activity, and most preferably, a mutant CRX will display less than 5% of at least one wild-type activity. By "CRX regulatory region" is meant a nucleic acid sequence normally present in the CRX flanking regions or in the wild-type CRN gene or CRNmRΝA which is capable of conferring or enhancing wild-type expression of CRX polypeptide. A preferred CRX regulatory region is the approximately four kilobase nucleic acid sequence found 5' to the wild-type CRN gene transcription start site. By "retinal degenerative disease" is meant any disease having symptoms which includes degeneration of the intracellular structures, cells, and/or tissues of the retina. For example, cone-rod dystrophy, Leber's congenital amaurosis, Stargardt's disease, retinitis pigmentosa, choroideremia, gyrate atrophy, Sorsby fundus dystrophy, and age-related macular degeneration are retinal degenerative diseases. By "OTX- or OTX-related DΝA-binding consensus sequences"is meant the consensus sequence TAATCC/T or a variant sequence TAATCA, these sequences being DΝA binding sites for members of the OTX gene family. OTX and OTX-related DNA-binding consensus sequences are found in transcriptional control regions, particularly in those of photoreceptor-specific genes such as Irbp.

By "homeobox" is meant a highly conserved, approximately 180-base polynucleotide sequence that encodes a protein which controls body part-, organ- or tissue-specific gene expression in a wide variety of eukaryotes. A homeobox encodes a homeodomain, a helix-turn-helix DNA-binding domain belonging to a discrete class of transcription factors. An example of a homeobox-containing gene is the CRN gene.

By "WSP motif is meant the thirteen residues between amino acid positions 158 and 170 of CRX (ATNSIWSPASESP) (SEQ ID NO: 24). Seven of these amino acids, SIWSPAS (SEQ ID NO: 25), are 100% conserved among CRX, OTX1, and

OTX2 (Fig. 4B).

By "OTX tail" is meant a peptide with the sequence DPLDYKDQSAWK (SEQ ID NO: 26) in the carboxyl terminus of CRX. A variation of this sequence is found in the carboxyl termini of OTX1 and OTX2, wherein the first portion of the sequence is DCLDYK (SEQ ID NO: 27) (Fig. 4B).

By "photoreceptor-specific gene" or "photoreceptor-specific promoter" is meant genes or promoters that are specifically active in retinal photoreceptors. Such genes include, but are not limited to, that encoding the inter photoreceptor retinoid-binding protein (IRBP) (G.I. Liou et al., Biochem. Biophy. Res. Commun. 181 :159-165, 1991), rhodopsin (R. Kumar et al., J. Biol. Chem. 271 :29612-29618,

1996; D.J. Zack et al., Neuron 6: 187-199, 1991), cone-opsin (M.S. Saha et al., Curr. Opin. Genet. Dev. 2:582-588, 1992), and arrestin (T. Kikuchi et al., Mol. Cell. Biol. 13:4400-4408, 1993) (see Fig. 5 A for examples).

By "high stringency conditions" is meant hybridization in 2X SSC at 40 °C with a DNA probe length of at least 40 nucleotides. For other definitions of high stringency conditions, see F. Ausubel et al., Current Protocols in Molecular Biology, pp. 6.3.1-6.3.6, John Wiley & Sons, New York, NY, 1994, hereby incoφorated by reference.

By "analyzing" or "analysis" is meant subjecting a CRN nucleic acid or CRX polypeptide to a test procedure that allows the determination of whether a CRN gene is wild- type or mutant. For example, one could analyze the CRN genes of an animal by amplifying genomic DΝA using the polymerase chain reaction (PCR), and then determining the DΝA sequence of the amplified DΝA.

By "probe" or "primer" is meant a single-stranded DΝA or RΝA molecule of defined sequence that can base pair to a second DΝA or RΝA molecule that contains a complementary sequence (the "target"). The stability of the resulting hybrid depends upon the extent of the base pairing that occurs. The extent of base-pairing is affected by parameters such as the degree of complementarity between the probe and target molecules, and the degree of stringency of the hybridization conditions. The degree of hybridization stringency is affected by parameters such as temperature, salt concentration, and the concentration of organic molecules such as formamide, and is determined by methods known to one skilled in the art (see, for example, F. Ausubel et al., supra.) Probes or primers specific for CRN nucleic acid preferably will have at least 35% sequence identity, more preferably at least 45-55% sequence identity, still more preferably at least 60-75% sequence identity, still more preferably at least 80- 90% sequence identity, and most preferably 100% sequence identity. Probes may be detectably-labelled, either radioactively, or non-radioactively, by methods well-known to those skilled in the art. Probes are used for methods involving nucleic acid hybridization, such as: nucleic acid sequencing, nucleic acid amplification by the polymerase chain reaction, SSCP analysis, RFLP analysis, Southern hybridization, Northern hybridization, in situ hybridization, electrophoretic mobility shift assay

(EMSA). By "pharmaceutically acceptable carrier" means a carrier which is physiologically acceptable to the treated mammal while retaining the therapeutic properties of the compound with which it is administered. One exemplary pharmaceutically acceptable carrier is physiological saline. Other physiologically acceptable carriers and their formulations are known to one skilled in the art and described, for example, in Remington 's Pharmaceutical Sciences, (18^th edition), ed. A. Gennaro, 1990, Mack Publishing Company, Easton, PA.

By "substantially identical" is meant a polypeptide or nucleic acid exhibiting at least 50%, preferably 85%, more preferably 90%, and most preferably 95% identity to a reference amino acid or nucleic acid sequence. For polypeptides, the length of comparison sequences will generally be at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids. For nucleic acids, the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides.

Sequence identity is typically measured using sequence analysis software with the default parameters specified therein (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). This software program matches similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. By "substantially pure polypeptide" is meant a polypeptide that has been separated from the components that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the polypeptide is a CRX polypeptide that is at least 75%, more preferably at least 90%, and most preferably at least 99%>, by weight, pure. A substantially pure CRX polypeptide may be obtained, for example, by extraction from a natural source (e.g., a fibroblast, or retinal photoreceptor cell) by expression of a recombinant nucleic acid encoding a CRX polypeptide, or by chemically synthesizing the protein. Purity can be measured by any appropriate method, e.g., by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

A protein is substantially free of naturally associated components when it is separated from those contaminants which accompany it in its natural state. Thus, a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be substantially free from its naturally associated components. Accordingly, substantially pure polypeptides not only includes those derived from eukaryotic organisms but also those synthesized in E. coli or other prokaryotes.

By "substantially pure DNA" is meant DNA that is free of the genes which, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence. By "transene" is meant any piece of DNA which is inserted by artifice into a cell, and becomes part of the genome of the organism which develops from that cell. Such a transgene may include a gene which is partly or entirely heterologous (i.e., foreign) to the transgenic organism, or may represent a gene homologous to an endogenous gene of the organism.

By "transgenic" is meant any cell which includes a DNA sequence which is inserted by artifice into a cell and becomes part of the genome of the organism which develops from that cell. As used herein, the transgenic organisms are generally transgenic mammals (e.g., rodents such as rats or mice) and the DNA (transgene) is inserted by artifice into the nuclear genome.

By "knockout mutation" is meant an alteration in the nucleic acid sequence that reduces the biological activity of the polypeptide normally encoded therefrom by at least 80% relative to the unmutated gene. The mutation may, without limitation, be an insertion, deletion, frameshift mutation, or a missense mutation. Preferably, the mutation is an insertion or deletion, or is a frameshift mutation that creates a stop codon.

By "transformation" is meant any method for introducing foreign molecules into a cell. Lipofection, DEAE-dextran-mediated transfection, microinjection, protoplast fusion, calcium phosphate precipitation, retroviral delivery, electroporation, and biolistic transformation are just a few of the methods known to those skilled in the art which may be used. For example, biolistic transformation is a method for introducing foreign molecules into a cell using velocity driven microprojectiles such as tungsten or gold particles. Such velocity-driven methods originate from pressure bursts which include, but are not limited to, helium-driven, air-driven, and gunpowder-driven techniques. Biolistic transformation may be applied to the transformation or transfection of a wide variety of cell types and intact tissues including, without limitation, intracellular organelles (e.g., and mitochondria and chloroplasts), bacteria, yeast, fungi, algae, animal tissue, and cultured cells. By "transformed cell" is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding (as used herein) a CRX polypeptide.

By "positioned for expression" is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the sequence (i.e., facilitates the production of, e.g., a CRX polypeptide, a recombinant protein or a RNA molecule).

By "promoter" is meant a minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell type-specific, tissue- specific, temporal-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' or intron sequence regions of the native gene.

By "operably linked" is meant that a gene and one or more regulatory sequences are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequences.

By "cone opsin" is meant an opsin present in a cone photoreceptor. Cone opsin types vary among species. For example, rodents (e.g., mice) have red/green opsin and blue opsin, while primates (e.g., humans) have red opsin, green opsin, and blue opsin. By "conserved region" is meant any stretch of six or more contiguous amino acids exhibiting at least 30%, preferably 50%, and most preferably 70% amino acid sequence identity between two or more of the OTX family members, (e.g., between human or murine CRX, and murine OTXl or OTX2). Examples of conserved regions within the OTX family are the OTX-tail, the WSP motif, and the homeodomain; whereas these sequences are present in the protein, it will be understood that non- coding regions also may be conserved. By "detectably-labeled" is meant any means for marking and identifying the presence of a molecule, e.g., an oligonucleotide probe or primer, a gene or fragment thereof, or a cDNA molecule. Methods for detectably-labeling a molecule are well known in the art and include, without limitation, radioactive labeling (e.g,, with an isotope such as ³²P or ³⁵S) and nonradioactive labeling (e.g., chemiluminescent labeling, e.g., fluorescein labeling).

By "antisense" as used herein in reference to nucleic acids, is meant a nucleic acid sequence that is complementary to the coding strand of a gene, preferably, a CRN gene. An antisense nucleic acid is capable of preferentially lowering the activity of a mutant CRX polypeptide encoded by a mutant CRX gene.

By "purified antibody" is meant antibody which is at least 60%, by weight, free from proteins and naturally occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably 90%>, and most preferably at least 99%, by weight, antibody, e.g., a CRX amino-terminus-specific antibody. A purified antibody may be obtained, for example, by affinity chromatography using recombinantly-produced protein or conserved motif peptides and standard techniques.

By "specifically binds" is meant an antibody that recognizes and binds a human and/or murine CRX polypeptide but that does not substantially recognize and bind other non-CRX molecules in a sample, e.g., a biological sample, that naturally includes protein. A preferred antibody binds to the CRX polypeptide sequence of Fig. 4, 7, or 6 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, human, canine, and murine, respectively). Another preferred antibody binds to the CRX amino-terminal polypeptide comprising amino acids 1-38 (SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30, human, canine, and murine, respectively). Yet another preferred antibody binds to the CRX carboxy-terminal polypeptide comprising amino acids 99-299 (SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33, human, canine, and murine, respectively). Still another preferred antibody binds to the CRX internal polypeptide comprising amino acids 99-157 (SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36, human, canine, and murine, respectively).

By "neutralizing antibodies" is meant antibodies that interfere with any of the biological activities of a wild-type or mutant CRX polypeptide, for example, the ability of CRX to transcriptionally activate photoreceptor-specific genes. The neutralizing antibody may reduce the ability of a CRX polypeptide to transcriptionally activate a target gene by, preferably 50%, more preferably by 70%, and most preferably by 90% or more. Any standard assay for the biological activity of a transcriptional activator protein, including those described herein, may be used to assess potentially neutralizing antibodies that are specific for CRX.

By "expose" is meant to allow contact between an animal, cell, lysate or extract derived from a cell, or molecule derived from a cell, and a test compound.

By "treat" is meant to submit or subject an animal (e.g. a human), cell, lysate or extract derived from a cell, or molecule derived from a cell to a test compound.

By "test compound" is meant a chemical, be it naturally-occurring or artificially-derived, that is surveyed for its ability to modulate an alteration in reporter gene activity or protein levels, by employing one of the assay methods described herein. Test compounds may include, for example, peptides, polypeptides, synthesized organic molecules, naturally occurring organic molecules, nucleic acid molecules, and components thereof.

By "assaying" is meant analyzing the effect of a treatment, be it chemical or physical, administered to whole animals or cells derived therefrom. The material being analyzed may be an animal, a cell, a lysate or extract derived from a cell, or a molecule derived from a cell. The analysis may be, for example, for the purpose of detecting altered gene expression, altered RNA stability, altered protein stability, altered protein levels, or altered protein biological activity. The means for analyzing may include, for example, antibody labeling, immunoprecipitation, phosphorylation assays, and methods known to those skilled in the art for detecting nucleic acids.

By "modulating" is meant changing, either by decrease or increase, in biological activity. By "a decrease" is meant a lowering in the level of biological activity, as measured by a lowering/increasing of: a) protein, as measured by ELISA; b) reporter gene activity, of at least 30%, as measured by reporter gene assay, for example, /αcZ/β-galactosidase, green fluorescent protein, luciferase, etc.; c) mRNA, levels of at least 30%, as measured by PCR relative to an internal control, for example, a "housekeeping" gene product such as β-actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). In all cases, the lowering is preferably by 30%, more preferably by 40%, and even more preferably by 70%.

By "an increase" is meant a rise in the level of biological activity, as measured by a lowering/increasing of: a) protein, measured by ELISA; b) reporter gene activity, as measured by reporter gene assay, for example, /αcZ/β-galactosidase, green fluorescent protein, luciferase, etc.; c) mRNA, as measured by PCR relative to an internal control, for example, a "housekeeping" gene product such as β-actin or glyceraldehyde 3 -phosphate dehydrogenase (GAPDH). Preferably, the increase is by 5% or more, more preferably by 15% or more, even more preferably by 2-fold, and most preferably by at least 3 -fold.

By "alteration in the level of gene expression" is meant a change in gene activity such that the amount of a product of the gene, i.e., mRNA or polypeptide, is increased or decreased, or that the stability of the mRNA or the polypeptide is increased or decreased. By "reporter gene" is meant any gene which encodes a product whose expression is detectable and/or quantitatable by immunological, chemical, biochemical or biological assays. A reporter gene product may, for example, have one of the following attributes, without restriction: fluorescence (e.g., green fluorescent protein), enzymatic activity (e.g., /αcZ/β-galactosidase, luciferase, chloramphenicol acetyltransferase), toxicity (e.g., ricin), or an ability to be specifically bound by a second molecule (e.g., biotin or a detectably labelled antibody). It is understood that any engineered variants of reporter genes, which are readily available to one skilled in the art, are also included, without restriction, in the foregoing definition.

By "protein" or "polypeptide" or "polypeptide fragment" is meant any chain of more than two amino acids, regardless of post- translational modification (e.g., glycosylation or phosphorylation), constituting all or part of a naturally-occurring polypeptide or peptide, or constituting a non-naturally occurring polypeptide or peptide.

By "missense mutation" is meant the substitution of one purine or pyrimidine base (i.e. A, T, G, or C) by another within a nucleic acid sequence, such that the resulting new codon encodes an amino acid distinct from the amino acid originally encoded by the reference (e.g. wild-type) codon.

By "frameshift mutation" is meant the insertion or deletion of at least one nucleotide within a polynucleotide coding sequence. A frameshift mutation alters the codon reading frame at and/or downstream from the mutation site. Such a mutation results either in the substitution of the encoded wild-type amino acid sequence by a novel amino acid sequence, or a premature termination of the encoded polypeptide due to the creation of a stop codon, or both.

Brief Description of the Drawings Fig. 1A, IB, IC, and ID show the pedigree of a family (Family 1) with cone- rod dystrophy, and the homeodomain mutation in the CRN gene of affected family members. Fig. 2 A, 2B, and 2C show the pedigree of a family with cone-rod dystrophy, and the frameshift mutation in the CRN gene of affected family members.

Fig. 3 A and 3B show reporter gene constructs for a CRX transactivation assay, and transactivation of reporter gene constructs by murine CRX. Fig. 4A and 4B show the sequence of the human CRNcDNA, the deduced amino acid sequence, and a sequence comparison with the homeodomains of other homeodomain-containing proteins.

Fig. 5A, 5B, 5C, and 5D show the OTX binding consensus sequence, nucleotide sequences of probes and competitors for EMS As, and EMS As of murine CRX.

Fig. 6A, 6B, 6C, and 6D show the deduced murine CRX amino acid sequence, a sequence comparison with the homeodomains of other homeodomain-containing proteins, and the murine Crx cDNA sequence.

Fig. 7A, 7B, and 7C show the canine CRNcDNA sequence, the deduced canine CRX amino acid sequence, and a sequence comparison with human and murine CRX polypeptides.

Fig. 8A, 8B, 8C, and 8D show the location of oligonucleotide primers used for PCR amplification of human CRX, the genomic organization of human CRN, the human CRNcDNA, and the human CRN probe fragments used for Northern and in situ hybridization.

Fig. 9A, 9B, and 9C show that CRN is specifically and abundantly expressed in adult human retina.

Fig. 10A, 10B, IOC, 10D, 10E, 10F, 10G, 10H, 101, 10J, 10K, and 10L show CRN expression in the developing and mature murine retina. Fig. 11 A, 1 IB, 1 IC, 1 ID, 1 IE, 1 IF, and 1 IG show a retroviral construct used to express murine CRX in retinal cells, and the retinal cell subtypes of the resulting CRX retro virus-infected clones. Fig. 12A, 12B, 12C, 12D, 12E, 12F, 12G, and 12H show control (pLIA/EnR) and dominant negative murine CRX (pLIA/CRX-EnR) retroviral expression vectors, repression of transcriptional activation by the dominant negative CRX, and the morphology of cells expressing the dominant negative CRX. Fig. 13 shows that the human CRX gene maps to 19ql 3.3 , with the CORD2 critical region.

Fig. 14A and 14B show the pedigree of two individuals diagnosed with LCA. Note that the affected individual in each family is the only one with a mutation in the CRN gene.

Detailed Description of the Invention

We have discovered a new gene, CRN, which encodes a protein controlling photoreceptor formation and survival. Mutations in this gene cause retinal degeneration and are responsible for one of the inherited cone-rod dystrophies (CRDs). Our discovery allows for novel diagnostics, therapeutics, and drug screening methods.

A critical step in understanding the molecular basis of inherited eye abnormalities, is to identify the transcription factors required for eye morphogenesis and differentiation. We previously cloned the retinal homeobox gene ChxlO (I.S.C. Liu et al., Neuron 13:377-393, 1994) and established that this gene is required for the normal development of the mammalian eye (a mutation in ChxlO causes the mouse developmental eye defect, ocular retardation; M. Burmeister et al., Nat. Genet. 12:376-384, 1996). To identify additional novel homeobox genes required for retinal formation or maintenance, we performed low stringency screens for novel homeobox genes expressed in the retina. These screens led us to a novel OTX-like homeodomain-containing protein, CRX, and the mouse and human cDΝAs encoding

CRX. We find that CRN is expressed specifically in the developing and adult retina in photoreceptor cells and is thus the first photoreceptor-specific transcription factor to be identified. CRX binds to a conserved site in the upstream region of many photoreceptor-specific genes, including the OTX site that is deleted in human blue cone monochromats, and is capable of transactivating constructs that carry this site. In addition, CRX transactivation activity is necessary for the formation of outer segments and terminals of rat photoreceptor cells in vivo. CRX is also required for the survival of photoreceptors .

Hence, CRN was a strong candidate gene for the autosomal dominant form of CRD at 19ql3 not only because it mapped within the genetic interval containing the

CORD2 locus, but also because of its photoreceptor-specific pattern of expression and its ability to activate transcription from genes involved in phototransduction. There was sufficient shared disease features among patients with retinal degeneration diseases, such as LCA, Stargardt's disease, retinitis pigmentosa, choroideremia, gyrate atrophy, Sorsby fundus dystrophy, and age-related macular degeneration (AMD), that

CRN was a strong candidate gene for these diseases as well.

We therefore searched for mutations in the CRN gene in patients with CRD, LCA, and AMD. CRN mutations were identified in a family with autosomal dominant CRD linked to the CORD2 locus, and in a second small autosomal dominant CRD family. De novo CRN mutations were also found in two individuals diagnosed with

LCA, but with no family history of the disease. These findings have important implications for the understanding of photoreceptor development, maintenance and survival, and for the diagnosis and treatment of retinal degeneration.

Structural and Functional Significance of CRX Mutations

The identification and characterization of transcription factor genes expressed in the developing eye has contributed remarkably to the understanding of mammalian eye morphogenesis and differentiation. CRX is the first transcription factor reported to have a photoreceptor-specific expression pattern. Furthermore, CRX is important for both the development and survival of photoreceptor cells.

Expression of CRN begins at approximately the El 2.5 timepoint in the developing mouse retina. As very few rods have been generated by this point, CRN most likely is expressed by cone photoreceptors. We find that CRN is most highly expressed between postnatal day 4 (P4) and P9, when rod photoreceptor differentiation is maximal. CRX exhibits specific binding to conserved DΝA sequences found upstream of several photoreceptor-specific genes, and CRX activates transcription from the IRBP minimum promoter in a CRX-binding site dependent manner. Moreover, a dominant-negative form of CRX inhibits rod outer segment and rod terminal formation in vivo, and mice homozygous for a disrupted allele of CRN have neither rod- nor cone-mediated responses to light, as determined by electroretinogram (ERG) recording. Ectopic expression of CRX in vivo increases the frequency of rod-only clones and blocks the development of some types of non-photoreceptor cells. Hence, CRN plays a key role in photoreceptor development, and can affect the development of other retinal types.

CRN, like many other transcription factor genes active in development, continues to be expressed in mature non-dividing cells; in some of these instances, cell survival or maintenance of the differentiated phenotype depends upon the continued activity of the transcription factor gene (H.M. Blau, Ann. Rev. Bioch. 61 :1213-1230, 1992). Our demonstration that mutations in the CRN gene lead to the degeneration of rod and cone photoreceptors in autosomal dominant CRD (adCRD) indicates that CRX is necessary for the survival of these differentiated non-mitotic neurons in the adult retina. The two mutations in the CRN gene (E80A and El 68 [Δl bp]) that we have identified in adCRD patients are most likely to be loss-of-function alleles, although as discussed below, the possibility that either may act as a dominant negative allele cannot be excluded. The glutamic acid to alanine missense mutation occurs at the first residue of the recognition helix of the homeodomain (position 42 of the homeodomain sequence, Glu42). A glutamic acid is present at this position in 226/346 homeodomains examined (D. Duboule, Guidebook to the Homeobox Genes, Oxford University Press, Toronto, 1994). Protein-DΝA co-crystal structures of both a paired- like homeodomain (D.S. Wilson et al., Cell 82:709-719, 1995) and of an engrailed homeodomain (C.R. Kissinger et al., Cell 63:579-590, 1990) have shown that Glu42 forms an electrostatic interaction with an arginine at position 31 of the homeodomain, and this Arg31 directly contacts the sugar phosphate backbone. The pairing of an arginine and a glutamic acid residue at the 31st and 42nd positions of the homeodomain is highly conserved. Not only are the consensus residues of all homeodomain classes at positions 31 and 42 arginine and glutamic acid, respectively, but the coincident occurrence of these residues is invariant in paired and paired-like homeodomains, every Arg31 being coupled with a Glu42. In a collection of 346 homeodomains examined, Arg31 is found with either Glu42 (79.5%) or Asp42 (13%), and occasionally Pro42 (2.5%>) or Gln42 (2%). Alanine is present at position 42 in conjunction with Arg31 in two homeodomains, one found in fungi (Cc Aa2-1) and one in Drosophila (d-msh-2/NK- 4). Conversely, in this large set of homeodomains, those which have Glu42 also have Arg31 in almost every case, except in the caudal (cad) class which have Glu42 and Lys31, or in a few of the so-called atypical homeodomains. These relationships suggest that Glu42 has been highly conserved in order to maintain the interaction with

Arg31, which is itself conserved because of its phosphate contact. This hypothesis is more likely than the alternative - that Glu42 is conserved to facilitate protein-protein interactions - since the glutamic acid residue is much more conserved among homeodomains than would be any interacting protein.

Given this structural data, therefore, we believe that the E80A mutation in the CRN gene is a loss of function allele. The loss of function results from the inability of CRX Ala42 to form a salt bridge with Arg31 , an inability that may prevent proper folding of the homeodomain or which may disrupt the Arg31-DΝA phosphate interaction, thus compromising the DNA binding affinity. The structural analysis of the paired-like homeodomain (D.S. Wilson et al., Cell 82:709-719, 1995) also showed that the Glu42 in the homeodomain contacts the sugar-phosphate backbone through a water-mediated hydrogen bond, and that during dimer binding, Glu42 was involved in two contacts with residues of the second homeodomain, both a direct contact with Arg3 and a water mediated hydrogen bond with Arg44. Consequently, alteration of this charged Glu42 to Ala42 may affect dimerization or binding. Finally, we cannot exclude the possibility that the E80A mutation creates a dominant negative allele: the E80A protein may be capable of a normal fold, and may interact with some or all of its usual protein partners to sequester them in an ineffective transcription complex.

The El 68 [Δl bp] mutation leads to a frameshift within the conserved WSP domain and predicts the synthesis of a prematurely truncated CRX protein missing the C-terminal two-fifths of the polypeptide, including the conserved OTX-tail. Only 18 new amino acids are encoded as a result of the frameshift, and these contain no recognized or common protein sequence motif present in the databases. The mutant protein made from this allele is also likely to have reduced function. Even if this mutant polypeptide is stable, the loss of 44% of the protein from the carboxy- terminus is likely to abrogate protein-protein interactions that are critical to transactivation of CRX target regulatory elements. On the other hand, El 68 [Δl bp] could be a dominant negative allele because it encodes an intact homeodomain which could bind to target sequences and obstruct the binding of the normal CRX protein and other components of the transcription complex. It seems improbable that either of these mutations will acquire novel properties and thus act as a neomorph. In summary, CRD patients carrying either a E80A or El 68 [Δl bp] CRN allele are most likely to have an overall reduction of CRN gene function, but the loss of function will be greater than 50% if these alleles are dominant negatives.

The molecular and cellular mechanisms by which the CRN mutations reported here cause the premature death of rods and cone photoreceptors in adCRD patients are unknown. Nevertheless, several lines of evidence indicate that the failure to generate or to maintain normal outer segments may be the fundamental cellular abnormality. The observation that outer segments do not develop in cultured photoreceptors expressing a dominant negative CRN allele suggests that CRN is necessary for the biogenesis of photoreceptor outer segments in vivo. Moreover, the expression of CRN in the differentiated photoreceptor indicates that the gene is also required for the continuous morphogenesis of new disks in the outer segment, a process referred to as disk renewal (the disks turn over at an average rate of -10% per day in primates; R.

Young, Invest. Opthalmol. Vis. Sci. 15:700-725, 1976). Since CRX binds to a sequence (TAATCC/A) found upstream of at least six major outer segment proteins (rhodopsin, inter photoreceptor resinoid-binding protein (Irbp), cone opsin, rod alpha- transducin, and arresting), and transactivates the expression of reporter genes carrying this sequence, the principle mechanism by which CRX controls outer segment biogenesis and disk renewal may be as a major regulator of the expression of many - if not all - outer segment proteins. This crucial position in the disk morphogenesis pathway makes CRX an ideal diagnostic and therapeutic target.

The loss of CRN function imposed by the E80A and El 68 [Δl bp] alleles may therefore critically reduce the synthesis of key outer segment proteins (the actual reductions cannot be predicted without knowledge of the abundance of the CRX protein in the cell in vivo, of its affinity for native promoters, and of the effects of cooperativity and synergy on its occupancy of binding sites). The effects of CRN mutations on the formation of rhodopsin alone, for example, may account fully for a failure to develop or maintain outer segments. Rhodopsin comprises 90% of the protein in the disks of the outer segment (D.H. Anderson et al., Invest. Opthalmol. Vis. Sci. 17:117-133, 1978). A 50% decrease in rhodopsin synthesis could contribute to photoreceptor pathology in adCRD, since mice with only a single functional rhodopsin allele exhibit disorganization of the outer segments and progressive outer segment shortening (M.M. Humphries et al., Nat. Genet. 15:216-219, 1997). This process, in combination with the effects of reduction in other outer segment proteins, may lead over time to complete loss of outer segments and cell death.

Of the other apparent CRN-regulated genes expressed in rod photoreceptors, decreased expression of alpha- transducin, arrestin, or IRBP may not, on their own, make a major contribution to the photoreceptor degeneration of CRD. There is no known association of mutations in any of these genes with inherited retinal degenerative disorders, and mice heterozygous for an IRBP null allele have normal photoreceptors (up to 4 months of age). Hence, it is likely that CRX regulates the expression of other disk rim proteins, particularly those known to be associated with dominant forms of human retinal degeneration, such as the disk rim protein rds/peripherin (A.C. Bird, Am. J. Opthalmol. 119:543-562, 1995; T.P. Dryja and T. Li, Hum. Mol. Genet. 4: 1739- 1743 , 1995), and the ABCR protein associated with

Stargardt disease (R. Allikmets et al., Nat. Genet. 15:236-246, 1997).

Finally, although these hypotheses for the pathogenesis of adCRD due to CRX mutations are focused on abnormal development or maintenance of the photoreceptor outer segment, an additional site of cellular pathology is suggested by the observation that rod terminals failed to form in cultured photoreceptors expressing a dominant negative CRN allele. There are several important genetic implications arising from our discovery that mutations in the CRN gene affect both rod and cone photoreceptors and result in retinal degeneration in adCRD and LCA. First, this finding suggests that other clinically-distinct inherited retinal degenerations affecting either cone or rod photoreceptors may also result from alterations in the function of this gene. Support for this hypothesis comes from a parallel drawn with another photoreceptor-specific gene, RDS. Inherited retinal degenerations with different clinical diagnoses ranging from maculopathies to retinitis pigmentosa have been found to be associated with RDS mutations. Thus, mutations in the CRN gene may be associated with clinical phenotypes that manifest predominantly as abnormalities of rod photoreceptor function, such as retinitis pigmentosa, or of cone function, such as cone dystrophies or disease entities apparently localized to the macula, i.e., macular degenerations (A.C. Bird, Am. J. Opthalmol. 119:543-562, 1995; R.S. Molday, In: Progress in Retinal and Eye Research, pp. 271-299, G. Chader and Ν. Osborne, eds., Pergamon Press Ltd., Oxford, 1994; G.H. Travis and J. E. Hepler, Nat. Genet. 3: 191-192, 1993).

Second, CRN may also be implicated in inherited retinal degenerations with onset late in life. This possibility is illustrated by the example of mutations in the ABCR gene (R. Allikmets et al., Nat. Genet. 15:236-246, 1997) which cause both Stargardt's disease, a macular degeneration, and 16% of cases of AMD (R. Allikmets et al., Nαt. Genet. 15:236-246, 1997). Thus, any gene associated with monogenic diseases causing inherited maculopathy, such as occurs in adCRD due to mutations in the CRN gene, is also a candidate gene that may predispose to the risk of developing AMD.

Finally, we believe that CRN may be a modifier gene that determines the severity of disease in patients with inherited retinal degenerations due to mutations in genes that are CRX-regulated, such as rhodopsin. Different wild type CRN alleles may produce different amounts of gene product. A patient with a rhodopsin missense substitution who carries a CRN allele that produces a relatively large amount of CRX protein may consequently synthesize more of the mutant rhodopsin, leading to more rapid retinal degeneration. Considerable variation in the severity of disease expression have been noted in heterozygotes with the same rhodopsin mutation, both within and between families (A. Gal et al., In: Progress in Retinal and Eye Research, pp. 51-79,

G. Chader and Ν. Osborne, eds., Elsevier Science Ltd., Great Britain, 1997). The wide spectrum of disease expression within families having inherited retinal degenerations makes the search for a modifier locus of strong interest both clinically and scientifically.

The CRX gene

Mouse eye and human retinal cDΝA libraries were screened at low stringency for homeobox genes, and murine and human CRN (cone-rod homeobox containing gene) cDΝAs were isolated. A canine cDΝA library was then screened with a human CRX probe, and a canine CRX cDΝA was isolated. CRX shares regions of sequence similarity with mouse OTXl and OTX2, and Drosophila orthodenticle (otd), and hence belongs to the otx family of homeobox genes.

Synthesis of CRX proteins

The characteristics of the cloned CRX gene sequences (e.g., SEQ ID NO: 4) may be analyzed by introducing the sequence into various cell types or using in vitro extracellular systems. The function of CRX proteins may then be examined under different physiological conditions. For example, the CRX-encoding DNA sequence may be manipulated in studies to understand the expression of the CRN gene and gene product. Alternatively, cell lines may be produced which over-express the CRN gene product allowing purification of CRX for biochemical characterization, large-scale production, antibody production, and patient therapy. For protein expression, eukaryotic and prokaryotic expression systems may be generated in which CRN gene sequences are introduced into a plasmid or other vector which is then used to transform living cells. Constructs in which the CRX cDΝAs containing the entire open reading frames inserted in the correct orientation into an expression plasmid may be used for protein expression. Alternatively, portions of the

CRN gene sequences, including wild-type or mutant CRN sequences, may be inserted. Prokaryotic and eukaryotic expression systems allow various important functional domains of the CRX proteins to be recovered as fusion proteins and then used for binding, structural and functional studies and also for the generation of appropriate antibodies. Since CRX protein expression may induce terminal differentiation in some cell types, it may be desirable to express the protein under the control of an inducible promoter.

Typical expression vectors contain promoters that direct the synthesis of large amounts of mRΝA corresponding to the inserted CRN nucleic acid in the plasmid bearing cells. They may also include eukaryotic or prokaryotic origin of replication sequences allowing for their autonomous replication within the host organism, sequences that encode genetic traits that allow vector-containing cells to be selected for in the presence of otherwise toxic drugs, and sequences that increase the efficiency with which the synthesized mRΝA is translated. Stable long-term vectors may be maintained as freely replicating entities by using regulatory elements of, for example, viruses (e.g., the OriP sequences from the Epstein Barr Virus genome). Cell lines may also be produced which have integrated the vector into the genomic DΝA, and in this manner the gene product is produced on a continuous basis.

Expression of foreign sequences in bacteria such as Escherichia coli requires the insertion of the CRN nucleic acid sequence into a bacterial expression vector. This plasmid vector contains several elements required for the propagation of the plasmid in bacteria, and expression of inserted DΝA of the plasmid by the plasmid-carrying bacteria. Propagation of only plasmid-bearing bacteria is achieved by introducing in the plasmid selectable marker- encoding sequences that allow plasmid-bearing bacteria to grow in the presence of otherwise toxic drugs. The plasmid also bears a transcriptional promoter capable of producing large amounts of mRNA from the cloned gene. Such promoters may or may not be inducible promoters which initiate transcription upon induction. The plasmid also preferably contains a polylinker to simplify insertion of the gene in the correct orientation within the vector. In a simple E. coli expression vector utilizing the lac promoter, the expression vector plasmid contains a fragment of the E. coli chromosome containing the lac promoter and the neighboring lacZ gene. In the presence of the lactose analog IPTG, RNA polymerase normally transcribes the lacZ gene producing lacZ mRNA which is translated into the encoded protein, β-galactosidase. The lacZ gene can be cut out of the expression vector with restriction endonucleases and replaced by a CRN gene sequence, or fragment, fusion, or mutant thereof. When this resulting plasmid is transfected into E. coli, addition of IPTG and subsequent transcription from the lac promoter produces

CRN mRΝA, which is translated into a CRX polypeptide.

Once the appropriate expression vectors containing a CRN gene, or fragment, fusion, or mutant thereof, are constructed they are introduced into an appropriate host cell by transformation techniques including calcium phosphate transfection, DEAE- dextran transfection, electroporation, microinjection, protoplast fusion and liposome- mediated transfection, etc., as noted elsewhere herein. The host cells which are transfected with the vectors of this invention may include (but are not limited to) E. coli, pseudomonas, Bacillus subtilus, or other bacilli, other bacteria, yeast, fungi, insect (using, for example, baculoviral vectors for expression), mouse or other animal or human tissue cells. Mammalian cells can also be used to express the CRX protein using a vaccinia virus expression system described in Ausubel et al., supra. In vitro expression of CRX proteins, fusions, polypeptide fragments, or mutants encoded by cloned DNA is also possible using the T7 late-promoter expression system. This system depends on the regulated expression of T7 RNA polymerase which is an enzyme encoded in the DNA of bacteriophage T7. The T7 RNA polymerase transcribes DNA beginning within a specific 23-bp promoter sequence called the T7 late promoter. Copies of the T7 late promoter are located at several sites on the T7 genome, but none is present in E. coli chromosomal DNA. As a result, in T7 infected cells, T7 RNA polymerase catalyzes transcription of viral genes but not of E. coli genes. In this expression system recombinant E. coli cells are first engineered to carry the gene encoding T7 RNA polymerase next to the lac promoter. In the presence of IPTG, these cells transcribe the T7 polymerase gene at a high rate and synthesize abundant amounts of T7 RNA polymerase. These cells are then transformed with plasmid vectors that carry a copy of the T7 late promoter protein. When IPTG is added to the culture medium containing these transformed E. coli cells, large amounts of T7 RNA polymerase are produced. The polymerase then binds to the T7 late promoter on the plasmid expression vectors, catalyzing transcription of the inserted cDNA at a high rate. Since each E. coli cell contains many copies of the expression vector, large amounts of mRNA corcesponding to the cloned cDNA can be produced in this system and the resulting protein can be radioactively labeled. Plasmid vectors containing late promoters and the corresponding RNA polymerases from related bacteriophages such as T3, T5, and SP6 may also be used for in vitro production of proteins from cloned DNA. E. coli can also be used for expression using an Ml 3 phage such as mGPI-2. Furthermore, vectors that contain phage lambda regulatory sequences, or vectors that direct the expression of fusion proteins, for example, a maltose-binding protein fusion protein or a glutathione-S-transferase fusion protein, also may be used for expression in E. coli. Eukaryotic expression systems permit appropriate post-translational modifications to expressed proteins. Transient transfection of a eukaryotic expression plasmid allows the transient production of a CRX polypeptide by a transfected host cell. CRX proteins may also be produced by a stably-transfected mammalian cell line. A number of vectors suitable for stable transfection of mammalian cells are available to the public (e.g., see Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, Supp. 1987), as are methods for constructing such cell lines (see e.g., Ausubel et al., supra). In one example, cDNA encoding a CRX protein, fusion, mutant, or polypeptide fragment is cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene. Integration of the plasmid and, therefore, integration of the CRX-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 μM methotrexate in the cell culture medium (as described, F. Ausubel et al., supra). This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR-mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in F. Ausubel et al., supra. These methods generally involve extended culture in medium containing gradually increasing levels of methotrexate. The most commonly used DHFR- containing expression vectors are pCVSEII-DHFR and pAdD26SV(A) (described in F. Ausubel et al., supra). The host cells described above or, preferably, a DHFR-deficient CHO cell line (e.g., CHO

DHFR^" cells, ATCC Accession No. CRL 9096) are among those most preferred for DHFR selection of a stably-transfected cell line or DHFR-mediated gene amplification.

Eukaryotic cell expression of CRX proteins allows for studies of the CRN gene and gene products including determination of proper expression and post-translational modifications for biological activity, identifying regulatory elements located in the 5' region of CRN genes and their roles in tissue regulation of CRX protein expression. It also permits the production of large amounts of normal and mutant proteins for isolation and purification, and the use of cells expressing CRX proteins as a functional assay system for antibodies generated against the protein. Eukaryotic cells expressing CRX proteins may also be used to test the effectiveness of pharmacological agents on CRX associated retinal degeneration, or as means by which to study CRX proteins as components of a transcriptional activation system. Expression of CRX proteins, fusions, mutants, and polypeptide fragments in eukaryotic cells also enables the study of the function of the normal complete protein, specific portions of the protein, or of naturally occurring polymorphisms and artificially produced mutated proteins. The CRN DNA sequences can be altered using procedures known in the art, such as restriction endonuclease digestion, DNA polymerase fill-in, exonuclease deletion, terminal deoxynucleotide transferase extension, ligation of synthetic or cloned DNA sequences and site-directed sequence alteration using specific oligonucleotides together with PCR. Another preferred eukaryotic expression system is the baculovirus system using, for example, the vector pBacPAK9, which is available from Clontech (Palo Alto, CA). If desired, this system may be used in conjunction with other protein expression techniques, for example, the myc tag approach described by Evan et al. {Mol. Cell Biol. 5:3610-3616, 1985). Once the recombinant protein is expressed, it can be isolated from the expressing cells by cell lysis followed by protein purification techniques, such as affinity chromatography. In this example, an anti-CRX antibody, which may be produced by the methods described herein, can be attached to a column and used to isolate the recombinant CRX proteins. Lysis and fractionation of CRX protein- harboring cells prior to affinity chromatography may be performed by standard methods (see e.g., Ausubel et al., supra). Once isolated, the recombinant protein can, if desired, be purified further by e.g., by high performance liquid chromatography (HPLC; e.g., see Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, Work and Burdon, Eds., Elsevier, 1980).

Polypeptides of the invention, particularly short CRX fragments and longer fragments of the N-terminus and C-terminus of the CRX protein, can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide

Synthesis, 2nd ed., 1984, The Pierce Chemical Co., Rockford, IL). These general techniques of polypeptide expression and purification can also be used to produce and isolate useful CRX polypeptide fragments or analogs, as described herein.

Those skilled in the art of molecular biology will understand that a wide variety of expression systems may be used to produce the recombinant CRX proteins. The precise host cell used is not critical to the invention. The CRX proteins may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., S. cerevisiae, insect cells such as Sf9 cells, or mammalian cells such as COS-1, NIH 3T3, or HeLa cells). These cells are commercially available from, for example, the American Type Culture Collection, Rockville, MD (see also F. Ausubel et al., supra). The method of transformation and the choice of expression vehicle (e.g., expression vector) will depend on the host system selected. Transformation and transfection methods are described, e.g., in F. Ausubel et al., supra, and expression vehicles may be chosen from those provided, e.g. in Pouwels et al., supra.

Testing for the presence of CRX biological activity

Identification of both biologically active and mutant forms of CRX allows the study of CRX biological activity in retinal photoreceptor-specific gene activation, photoreceptor differentiation, maintenance and degeneration. For example, administration of a CRX protein, or polypeptide fragment thereof, may have an ability to activate photoreceptor-specific gene expression, as measured by cell-based and cell- free assays known in the art and described herein. An inhibitory amount of a CRX reagent (e.g., a compound that reduces the biological function of CRX, such as a CRX neutralizing antibody or antisense CRN nucleic acid, a CRN nucleic acid encoding a dominant-negative form of the CRX protein, or a compound which decreases CRX- mediated gene expression) may be similarly assessed. Such assays may be carried out in a cell which either expresses endogenous CRX or a cell to which is introduced a heterologous amount of a CRX polypeptide or in a cell-free assay. Preferably, the cell is capable of undergoing CRX-specific gene expression, and/or CRX-induced terminal differentiation. CRX biological activity or inhibition thereof may be assessed in these CRX expressing cells, whereby such CRX-inducing or -inhibiting activity is evaluated based upon the level of expression of the CRX target genes, i.e., photoreceptor- specific genes such as those encoding interphotoreceptor retinoid-binding protein (IRBP), rhodopsin, cone opsin, rod alpha-transducin, and arrestin, and pineal gland- specific genes, such as serotonin Ν-acetyltransferase, hydroxyindole-O- methyltransferase, and pineal night-specific ATPase.

Cellular Distribution of CRX

We have looked at the distribution of CRN mRΝA expression by Northern hybridization and by in situ hybridization, and have found that CRN mRNA expression is limited to retinal photoreceptor cells in the developing mouse, adult mouse, and adult human (developing human was not examined). The only other region which expressed CRN is the pineal gland. The expression and function of CRX in the pineal gland is discussed herein (infra).

CRX Fragments

Polypeptide fragments which incorporate various portions of CRX proteins are useful in identifying the domains important for the biological activities of CRX proteins. Methods for generating such fragments are well known in the art (see, for example, Ausubel et al., supra) using the nucleotide sequences provided herein. For example, a CRX protein fragment may be generated by PCR amplifying the desired fragment using oligonucleotide primers designed based upon the CRN (SEQ ID NO: 4) nucleic acid sequences. Preferably the oligonucleotide primers include unique restriction enzyme site which facilitate insertion of the fragment into the cloning site of a mammalian expression vector. This vector may then be introduced into a mammalian cell by artifice by the various techniques known in the art and described herein, resulting in the production of a CRN gene fragment. CRX polypeptide fragments will be useful in evaluating the portions of the protein involved in transcriptional activation, DΝA binding, protein-protein interactions, or other important biological activities. These fragments may be used alone, or as chimeric fusion proteins. CRX polypeptide fragments may also be used to raise antibodies specific for various regions of CRX.

CRX Antibodies

In order to prepare polyclonal antibodies, CRX proteins, fragments of CRX proteins, or fusion proteins containing defined portions of CRX proteins can be synthesized in bacteria by expression of corresponding DΝA sequences in a suitable cloning vehicle. Fusion proteins are commonly used as a source of antigen for producing antibodies. Two widely used expression systems for E. coli are lacZ fusions using the pUR series of vectors and trpE fusions using the pATH vectors. The proteins can be purified, and then coupled to a carrier protein and mixed with Freund's adjuvant (to help stimulate the antigenic response by the animal of choice) and injected into rabbits or other laboratory animals. Alternatively, protein can be isolated from CRX expressing cultured cells. Following booster injections at bi-weekly intervals, the rabbits or other laboratory animals are then bled and the sera isolated. The sera can be used directly or can be purified prior to use, by various methods including affinity chromatography employing reagents such as Protein A-Sepharose, Antigen Sepharose, and Anti-mouse-Ig-Sepharose. The sera can then be used to probe protein extracts from CRX expressing tissue run on a polyacrylamide gel to identify CRX proteins. Alternatively, synthetic peptides can be made that correspond to the antigenic portions of the protein and used to innoculate the animals.

In order to generate peptide or full-length protein for use in making, for example, CRX-specific antibodies, a CRX coding sequence can be expressed as a C- terminal fusion with glutathione S-transferase (GST; Smith et al., Gene 67:31-40, 1988). The fusion protein can be purified on glutathione-Sepharose beads, eluted with glutathione, and cleaved with thrombin (at the engineered cleavage site), and purified to the degree required to successfully immunize rabbits. Primary immunizations can be carried out with Freund's complete adjuvant and subsequent immunizations performed with Freund's incomplete adjuvant. Antibody titers are monitored by Western blot and immunoprecipitation analyzes using the thrombin-cleaved CRX fragment of the GST-CRX fusion protein. Immune sera are affinity purified using CNBr-Sepharose-coupled CRX protein. Antiserum specificity is determined using a panel of unrelated GST proteins (including GSTp53, Rb, HPV-16 E6, and E6-AP).

It is also understood by those skilled in the art that monoclonal CRX antibodies may be produced by using as antigen CRX protein isolated from CRX expressing cultured cells or CRX protein isolated from tissues. The cell extracts, or recombinant protein extracts containing CRX protein, may for example, be injected with Freund's adjuvant into mice. After being injected, the mice spleens may be removed and resuspended in phosphate buffered saline (PBS). The spleen cells serve as a source of lymphocytes, some of which are producing antibody of the appropriate specificity.

These are then fused with permanently growing myeloma partner cells, and the products of the fusion are plated into a number of tissue culture wells in the presence of a selective agent such as hypoxanthine, aminopterine, and thymidine (HAT). The wells are then screened by ELISA to identify those containing cells making antibody capable of binding a CRX protein or polypeptide fragment or mutant thereof. These are then re-plated and after a period of growth, these wells are again screened to identify antibody-producing cells. Several cloning procedures are carried out until over 90% of the wells contain single clones which are positive for antibody production. From this procedure a stable line of clones which produce the antibody is established. The monoclonal antibody can then be purified by affinity chromatography using Protein A Sepharose, ion-exchange chromatography, as well as variations and combinations of these techniques. Truncated versions of monoclonal antibodies may also be produced by recombinant methods in which plasmids are generated which express the desired monoclonal antibody fragment(s) in a suitable host.

As an alternate or adjunct immunogen to GST fusion proteins, peptides corresponding to relatively unique hydrophilic regions of, for example, CRX may be generated and coupled to keyhole limpet hemocyanin (KLH) through an introduced C- terminal lysine. Antiserum to each of these peptides is similarly affinity purified on peptides conjugated to BSA, and specificity is tested by ELISA and Western blotting using peptide conjugates, and by Western blotting and immunoprecipitation using CRX expressed as a GST fusion protein.

Alternatively, monoclonal antibodies may be prepared using the CRX proteins described above and standard hybridoma technology (see, e.g., Kohler et al., Nature 256:495, 1975; Kohler et al., Eur. J. Immunol. 6:511, 1976; Kohler et al., Eur. J. Immunol. 6:292, 1976; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, New York, NY, 1981; F. Ausubel et al., supra). Once produced, monoclonal antibodies are also tested for specific CRX protein recognition by Western blot or immunoprecipitation analysis (by the methods described in F. Ausubel et al., supra).

Monoclonal and polyclonal antibodies that specifically recognize a CRX protein (or fragments thereof), such as those described herein, are considered useful in the invention. Antibodies that inhibit a CRX described herein may be especially useful in preventing or slowing retinal degeneration. For example, one form of retinal degeneration may be due to the expression of mutant rhodopsin, whose gene may be under the transcriptional regulation of CRX. A decrease in the level of mutant rhodopsin, effected by inhibiting CRX, might slow the degenerative disease. Antibodies of the invention may be produced using CRX amino acid sequences that do not reside within highly conserved regions, and that appear likely to be antigenic, as analyzed by criteria such as those provided by the Peptide Structure Program (Genetics Computer Group Sequence Analysis Package, Program Manual for the GCG Package, Version 7, 1991) using the algorithm of Jameson and Wolf (CABIOS 4:181, 1988). These fragments can be generated by standard techniques, e.g., by the PCR, and cloned into the pGEX expression vector (F. Ausubel et al., supra). GST fusion proteins are expressed in E. coli and purified using a glutathione agarose affinity matrix as described in F. Ausubel et al., supra). To generate rabbit polyclonal antibodies, and to minimize the potential for obtaining antisera that is non- specific, or exhibits low-affinity binding to a CRX, two or three fusions are generated for each protein, and each fusion is injected into at least two rabbits. Antisera are raised by injections in series, preferably including at least three booster injections. In addition, antibodies of the invention may be produced using CRX amino acid sequences that do reside within highly conserved regions. For example, amino acid sequences from the OTX tail, WSP motif, and homeobox of CRX may be used as antigens to generate antibodies specific toward both CRX and the OTXs, and possibly specific toward other members of a CRX family of proteins. These antibodies may be screened as described above.

In addition to intact monoclonal and polyclonal anti-CRX antibodies, the invention features various genetically engineered antibodies, humanized antibodies, and antibody fragments, including F(ab')2, Fab', Fab, Fv and sFv fragments.

Antibodies can be humanized by methods known in the art, e.g., monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; Oxford Molecular, Palo Alto, CA). Fully human antibodies, such as those expressed in transgenic animals, are also features of the invention (Green et al., Nature Genetics 7:13-21, 1994).

Ladner (U.S. Patent 4,946,778 and 4,704,692) describes methods for preparing single polypeptide chain antibodies. Ward et al. Nature 341:544-546, 1989) describe the preparation of heavy chain variable domains, which they term "single domain antibodies," which have high antigen-binding affinities. McCafferty et al. (Nature 348:552-554, 1990) show that complete antibody V domains can be displayed on the surface of fd bacteriophage, that the phage bind specifically to antigen, and that rare phage (one in a million) can be isolated after affinity chromatography. Boss et al. (U.S. Patent 4,816,397) describe various methods for producing immunoglobulins, and immunologically functional fragments thereof, which include at least the variable domains of the heavy and light chain in a single host cell. Cabilly et al. (U.S. Patent

4,816,567) describe methods for preparing chimeric antibodies.

Use of CRX Antibodies

Antibodies to CRX proteins may be used, as noted above, to detect CRX proteins or to inhibit the biological activities of CRX proteins. For example, nucleic acid encoding an antibody or portion of an antibody may be expressed within a cell to inhibit CRX function. In addition, the antibodies may be coupled to compounds for diagnostic and/or therapeutic uses such as radionucleotides for imaging and therapy and liposomes for the targeting of compounds to a specific tissue location.

Detection of CRX gene expression

As noted, the antibodies described above may be used to monitor CRX protein expression. In addition, in situ hybridization is a method which may be used to detect the expression of CRN genes. In situ hybridization techniques, such as fluorescent in situ hybridization (FISH), rely upon the hybridization of a specifically labeled nucleic acid probe to the cellular RΝA in individual cells or tissues. Therefore, it allows the identification of mRΝA within intact tissues, such as the retina. In this method, oligonucleotides or cloned nucleotide (RΝA or DΝA) fragments corresponding to unique portions of CRN genes are used to detect specific mRΝA species, e.g., in the retina. Numerous other gene expression detection techniques are known to those of skill in the art and may be employed here.

Identification of CRX Transcriptional Regulatory Elements The human CRN gene and associated transcriptional regulatory regions are cloned into a bacterial artificial chromosome (BAC) vector described in Shizuya, H., et al. (1992) Proc. Nat. Acad. Sci. U.S.A. 89: 8794-8797. The cloned CRX transcriptional regulatory region may be used in the methods of the invention to specifically regulate transcription of an operably linked gene or coding region.

Identification of Additional CRX Genes

Standard techniques, such as the polymerase chain reaction (PCR) and DΝA hybridization, may be used to clone additional CRX homologues in other species. For example, the human CRN cDΝA was cloned by low stringency hybridization using a fragment from a CHX10 cDNA as a probe. Thus, additional CRN sequences may be readily identified using low stringency hybridization. Furthermore, murine, canine, and human CRN-specific primers may be used to clone additional CRN related genes by RT-PCR.

Detection of CRX mutations and altered expression levels

CRX polypeptides and nucleic acid sequences find diagnostic use in the detection or monitoring of conditions involving retinal photoreceptor degeneration. For example, mutations in CRN that decrease CRX biological activity may be correlated with cone-rod dystrophy in humans. Accordingly, a decrease or increase in the level of CRX production may provide an indication of a deleterious condition.

Levels of CRX expression may be assayed by any standard technique. For example, the regulatory sequences may be assayed as a means of determining whether altered expression is likely, or CRN transcription may be quantified in normal EBV- transformed lymphoblasts and these levels may be compared to levels in the lymphocytes of the test subject. CRX expression in a biological sample (e.g., a biopsy) may be monitored by standard Northern blot analysis or may be aided by PCR (see, e.g., F. Ausubel et al., supra; PCR Technology: Principles and Applications for DNA Amplification, H.A. Ehrlich, Ed., Stockton Press, NY; Yap et al. Nucl. Acids. Res. 19:4294, 1991). A biological sample obtained from a patient may be analyzed for one or more mutations in CRN nucleic acid sequences using a mismatch detection approach. Generally, these techniques involve PCR amplification of nucleic acid from the patient sample, followed by identification of the mutation (i.e., mismatch) by either altered hybridization, aberrant electrophoretic gel migration, binding or cleavage mediated by mismatch binding proteins, or direct nucleic acid sequencing. Any of these techniques may be used to facilitate mutant CRX detection, and each is well known in the art; examples of particular techniques are described, without limitation, in Orita et al. (Proc. Natl. Acad. Sci. USA 86:2766-2770, 1989) and Sheffield et al. (Proc. Natl. Acad. Sci. USA 86:232-236, 1989).

Mismatch detection assays also provide an opportunity to diagnose a CRX- mediated predisposition to retinal degenerative disease before the onset of symptoms.

For example, a patient heterozygous for a CRX mutation that suppresses CRX biological activity or expression may show no clinical symptoms and yet possess a higher than normal probability of developing retinal degenerative disease. Moreover, certain wild-type alleles of CRN present in the population may enhance the risk of developing other retinal degenerations, or multigenic diseases such as age-related macular degeneration. Alternatively, certain alleles of CRN present in the population may enhance the risk of more rapid retinal degeneration in patients with monogenic diseases, such as mutations in the rhodopsin gene. Given this diagnosis, a patient may take precautions to minimize their exposure to adverse environmental factors (for example, UV exposure) and to carefully monitor their medical condition (for example, through frequent physical examinations). This type of CRX diagnostic approach may also be used to detect CRX mutations in prenatal screens. The CRX diagnostic assays described above may be carried out using any biological sample (for example, any biopsy sample, blood sample, or other tissue sample) in which CRX is normally expressed. Identification of a mutant CRN gene may also be assayed using these sources for test samples.

Alternatively, a CRX mutation, particularly as part of a diagnosis for predisposition to CRX-associated retinal degenerative disease, may be tested using a DΝA sample from any cell, for example, by mismatch detection techniques. Preferably, the DΝA sample is subjected to PCR amplification prior to analysis.

In yet another approach, immunoassays are used to detect or monitor CRX protein expression in a biological sample. CRX-specific polyclonal or monoclonal antibodies (produced as described above) may be used in any standard immunoassay format (e.g., ELISA, Western blot, or RIA) to measure CRX polypeptide levels. These levels would be compared to wild- type CRX levels. For example, a decrease in CRX production may indicate a condition involving insufficient apoptosis. Examples of immunoassays are described, e.g., in F. Ausubel et al., supra.

Immunohistochemical techniques may also be utilized for CRX detection. For example, a tissue sample may be obtained from a patient, sectioned, and stained for the presence of CRX using an anti-CRX antibody and any standard detection system (e.g., one which includes a secondary antibody conjugated to horseradish peroxidase). General guidance regarding such techniques can be found in, e.g., Bancroft and

Stevens (Theory and Practice of Histological Techniques, Churchill Livingstone, 1982) and F. Ausubel et al., supra.

In one preferred example, a combined diagnostic method may be employed that includes an evaluation of CRX protein production (for example, by immunological techniques or the protein truncation test (Hogerrorst et al., Nature Genetics 10:208-

212, 1995) and also includes a nucleic acid-based detection technique designed to identify more subtle CRX mutations (for example, point mutations). As described above, a number of mismatch detection assays are available to those skilled in the art, and any preferred technique may be used. Mutations in CRX may be detected that either result in loss of CRX expression or loss of normal CRX biological activity. In a variation of this combined diagnostic method, CRX biological activity is measured as apoptotic-inducing activity using any appropriate apoptosis assay system (for example, those described herein).

Therapies Therapies may be designed to circumvent or overcome a CRN gene defect or inadequate or excessive CRN gene expression, and thus modulate and possibly alleviate conditions involving retinal degeneration. CRN is expressed in retinal photoreceptor cells. Hence, in considering various therapies, it is understood that such therapies will be targeted to the retina, and preferably to photoreceptor cells. Reagents that modulate CRX biological activity may include, without limitation, full length CRX polypeptides, or fragments thereof, CRN mRΝA or antisense RΝA, or any compound which modulates CRX biological activity, expression, or stability.

a) Protein Therapy

Treatment or prevention of retinal degeneration can be accomplished by replacing mutant or surplus CRX protein with normal protein, by modulating the function of mutant protein, or delivering normal CRX protein to the appropriate cells, or by altering the levels of normal or mutant protein. It is also be possible to modify the pathophysiologic pathway (e.g., a signal transduction pathway) in which the protein participates in order to correct the physiological defect.

To replace a mutant protein with normal protein, or to add protein to cells which no longer express sufficient CRX, it is necessary to obtain large amounts of pure CRX protein from cultured cell systems which can express the protein. Delivery of the protein to the affected retinal tissue can then be accomplished using appropriate packaging or administrating systems. Alternatively, small molecule analogs may be used and administered to act as CRX agonists or antagonists and in this manner produce a desired physiological effect. Methods for finding such molecules are provided herein.

b) Gene Therapy

Gene therapy is another potential therapeutic approach in which normal copies of the CRN gene or nucleic acid encoding CRN antisense RΝA are introduced into retinae to successfully encode for normal and abundant protein or CRN antisense RΝA in cells which express excessive normal or mutant CRX, respectively. The gene must be delivered to those cells in a form in which it can be taken up and encode for sufficient protein to provide effective function. Alternatively, for some CRX mutations it may be possible slow retinal degeneration and/or modulate CRX activity by introducing another copy of the homologous gene bearing a second mutation in that gene or to alter the mutation, or use another gene to block any negative effect.

Transducing retroviral, adenoviral, and human immunodeficiency viral (HIV) vectors can be used for somatic cell gene therapy especially because of their high efficiency of infection and stable integration and expression; see, e.g., Cayouette, M., and Gravel, C, 1997; Hum. Gene Therapy, 8:423-430; Kido, M., et al.

1996; Curr. Eye Res., 15:833-844; Bloomer, U., et al., 1997; J. Virol., 71 :6641-6649; Naldini, L., et al. (1996) Science 272:263-267; Miyoshi, H., et al. (1997), Proc. Nat. Acad. Sci., U.S.A., 94:10319-1032. For example, the full length CRN gene, or portions thereof, can be cloned into a retroviral vector and driven from its endogenous promoter or from the retroviral long terminal repeat or from a promoter specific for the target cell type of interest (such as neurons). Other viral vectors which can be used include adenovirus, adeno-associated virus, vaccinia virus, bovine papilloma virus, or a herpes virus such as Epstein-Barr Virus.

Gene transfer could also be achieved using non- viral means requiring infection in vitro. This would include calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be potentially beneficial for delivery of DΝA into a cell. Although these methods are available, many of these are of lower efficiency.

Transplantation of normal genes into the affected cells of a patient can also be useful therapy. In this procedure, a normal CRN gene is transferred into a cultivatable cell type, either exogenously or endogenously to the patient. These cells are then injected into the targeted tissue(s). Retroviral vectors, adenoviral vectors, adenovirus-associated viral vectors, or other viral vectors with the appropriate tropism for cells likely to be involved in CRX- related diseases(for example, retinal cells) may be used as a gene transfer delivery system for a therapeutic CRN gene construct. Numerous vectors useful for this puφose are generally known (Miller, Human Gene Therapy 15-14, 1990; Friedman,

Science 244:1275-1281, 1989; Eglitis and Anderson, BioTechniques 6:608-614, 1988; Tolstoshev and Anderson, Curr. Opin. Biotech. 1 :55-61, 1990; Shaφ, The Lancet 331 : 1277-1278, 1991; Cornetta et al., Nucl. Acid Res. and Mol. Biol. 36: 311-322, 1987; Anderson, Science 226: 401-409, 1984; Moen, Blood Cells 17: 407-416, 1991; Miller et al., Biotech. 7: 980-990, 1989; Le Gal La Salle et al., Science 259: 988-990, 1993; and Johnson, Chest 107: 77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323: 370, 1990; Anderson et al., U.S. Patent No. 5,399,346). Non-viral approaches may also be employed for the introduction of therapeutic DNA into retinal photoreceptor cells otherwise predicted to undergo degeneration. For example, CRX may be introduced into a photoreceptor cell by lipofection (Feigner et al., Proc. Natl. Acad. Sci. USA 84: 7413, 1987; Ono et al., Neurosci. Lett. 117: 259, 1990; Brigham et ah, Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Meth. Enz. 101 :512, 1983), asialorosonucoid-polylysine conjugation (Wu et al., J. Biol. Chem. 263: 14621, 1988; Wu et al., J. Biol. Chem. 264: 16985, 1989); or, less preferably, micro-injection under surgical conditions (Wolff et al., Science 247: 1465, 1990).

In the constructs described, CRNcDNA expression can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionem promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in retinal or photoreceptor cells may be used to direct CRX expression. The enhancers used could include, without limitation, those that are characterized as tissue- or cell-specific in their expression. Alternatively, if a CRN genomic clone is used as a therapeutic construct (for example, following isolation by hybridization with the CRNcDNA described above), regulation may be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.

Antisense based strategies may be employed to explore CRN gene function and as a basis for therapeutic drug design. The principle is based on the hypothesis that sequence-specific suppression of gene expression can be achieved by intracellular hybridization between mRΝA and a complementary antisense species. The formation of a hybrid RΝA duplex may then interfere with the processing/transport/translation and/or stability of the target CRN mRΝA. Antisense strategies may use a variety of approaches including the use of antisense oligonucleotides and injection of antisense RΝA. Antisense effects can be induced by control (sense) sequences, however, the extent of phenotypic changes are highly variable. Phenotypic effects induced by antisense effects are based on changes in criteria such as protein levels, protein activity measurement, and target mRΝA levels.

For example, CRX gene therapy may also be accomplished by direct administration of antisense CRN mRΝA to a photoreceptor cell that is expected to undergo undesired degeneration. The antisense CRN mRΝA may be produced and isolated by any standard technique, but is most readily produced by in vitro transcription using an antisense CRNcDNA under the control of a high efficiency promoter (e.g., the T7 promoter). Administration of antisense CRN mRNA to cells can be carried out by any of the methods for direct nucleic acid administration described above.

An alternative strategy for inhibiting CRX function using gene therapy involves intracellular expression of an anti-CRX antibody or a portion of an anti-CRX antibody. For example, the gene (or gene fragment) encoding a monoclonal antibody that specifically binds to CRX and inhibits its biological activity may be placed under the transcriptional control of a retinal-specific gene regulatory sequence.

Another therapeutic approach within the invention involves administration of recombinant CRX polypeptide, either directly to the site of a potential or actual retinal degeneration event (for example, by injection) or systemically (for example, by any conventional recombinant protein administration technique). The dosage of CRX depends on a number of factors, including the size and health of the individual patient, but, generally, between 0.1 mg and 100 mg inclusive are administered per day to an adult in any pharmaceutically acceptable formulation.

c) Preventative Anti-Degenerative Therapy

In a patient diagnosed to be heterozygous for a CRX mutation or to be susceptible to CRX mutations or aberrant CRX expression (even if those mutations or expression patterns do not yet result in alterations in CRX expression or biological activity), any of the above therapies may be administered before the occunence of the disease phenotype. For example, the therapies may be provided to a patient who has a mutation in the homeobox domain of CRN, but does not yet show symptoms of retinal degeneration. In particular, compounds shown to modulate CRX expression or CRX biological activity may be administered to patients diagnosed with potential or actual degenerative diseases by any standard dosage and route of administration (see above).

Alternatively, gene therapy using an antisense CRN mRΝA expression construct may be undertaken to reverse or prevent the cell defect prior to the development of the degenerative disease.

The methods of the instant invention may be used to reduce or diagnose the disorders described herein in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated or diagnosed, the CRX polypeptide, nucleic acid, or antibody employed is preferably specific for that species.

Administration of CRX Polypeptides. CRN Genes, or Modulators of CRX Synthesis or Function A CRX protein, gene, or modulator of CRX may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer neutralizing CRX antibodies or CRX- inhibiting compounds (e.g., antisense CRN or a CRX dominant negative mutant) to patients suffering from a retinal degenerative disease. Administration may begin before the patient is symptomatic. Any appropriate route of administration may be employed, for example, administration may be parenteral, intravenous, intra-arterial, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, by suppositories, or oral administration. Therapeutic formulations may be in the forni of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.

Methods well known in the art for making formulations are found, for example, in Remington 's Pharmaceutical Sciences, (18^th edition), ed. A. Gennaro, 1990, Mack

Publishing Company, Easton, PA. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for CRX modulatory compounds include ethylene- vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

Assays for the identification of compounds that modulate or mime CRX biological activity

Methods of observing changes in CRX biological activity are exploited in high- throughput assays for the puφose of identifying compounds that modulate mutant or wild-type CRX transcriptional activity. Compounds that mime CRX activity also may be identified by such assays. Furthermore, compounds that modulate transcription of the CRN gene itself may be identified; in some cases, it may be desirable to increase or decrease CRX protein levels by such an approach. Such identified compounds may have utility as therapeutic agents in the treatment of retinal degenerative disease.

Test Compounds

In general, novel drugs for prevention or treatment of retinal degeneration by modulating or miming CRX biological activity are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PharmaMar, U.S.A. (Cambridge, MA). In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.

In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their therapeutic activities for retinal degenerative disorders should be employed whenever possible. When a crude extract is found to modulate CRX biological activity, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having retinal degeneration-preventative or -palliative activities, via the modulation or miming of CRX biological activity or expression. The same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value may be subsequently analyzed using a standard animal model for retinal degenerative disease known in the art, or animals carrying mutated CRN genes.

Screens for compounds affecting CRX protein expression

CRNcDΝAs may be used to facilitate the identification of compounds that increase or decrease CRX protein expression. In one approach, candidate compounds are added, in varying concentrations, to the culture medium of cells expressing CRN mRΝA. The CRN mRΝA expression is then measured, for example, by Northern blot analysis (F. Ausubel et al., supra) using a CRNDNA, or cDNA or RNA fragment, as a hybridization probe. The level of CRN mRNA expression in the presence of the candidate compound is compared to the level of CRN mRNA expression in the absence of the candidate compound, all other factors (e.g., cell type and culture conditions) being equal. The effect of candidate compounds on CRX-mediated gene expression may, instead, be measured at the level of translation by using the general approach described above with standard protein detection techniques, such as Western blotting or immunoprecipitation with a CRX-specific antibody (for example, the CRX specific antibody described herein). In an alternative approach to detecting compounds which regulate CRX at the level of transcription, candidate compounds may be tested for an ability to regulate a reporter gene whose expression is directed by a CRN gene promoter. For example, a cell that normally expresses CRN, such as a retinal photoreceptor cell, or alternatively, a cell that normally does not express CRN, such as a fibroblast, may be transfected with a expression plasmid that includes a luciferase reporter gene operably linked to the CRX promoter. Candidate compounds may then be added, in varying _ At appropriate timepoints, cells treated with test compounds are lysed and subjected to the appropriate reporter assays, for example, a colorimetric or chemiluminescent enzymatic assay for /αcZ/β-galactosidase activity, or fluorescent detection of GFP. Changes in reporter gene activity of samples treated with test compounds, relative to reporter gene activity of appropriate control samples, indicate the presence of a compound that modulates the transcriptional activity of CRX.

In one embodiment, one transgene could comprise a reporter gene such as lacZ or GFP, operatively linked to a promoter from a photoreceptor-specific gene (such as those encoding rhodopsin, IRBP, cone opsin, rod alpha-transducin, and arrestin), or a pineal gland-specific gene (such as those encoding serotonin N-acetyltransferase, hydroxyindole-O-methyltransferase, and pineal night-specific ATPase). Transgenes may be present within the genomic DNA of a cell to be tested, or may be transiently introduced, and cells may be photoreceptors, or other types of cells. A second transgene, comprising a second reporter gene operatively linked to a second promoter (such as an SV40 promoter), is included as an internal control. Hence, the amount of activity resulting from a reporter gene that is operatively linked to a retinal-specific promoter that is a transcriptional target of CRX reflects the ability of a test compound to modulate the transcriptional activity of CRX. CRX may be naturally expressed within the test cell, such as a retinal cell or a pineal cell, or may be artificially expressed in a another type of cell, from a permanent or transiently-introduced transgene. Either wild-type or mutant forms of CRX may be tested. As well, reporter gene assays can be performed in cells lacking CRX, in order to isolate molecules that mime CRX activity. In order to identify compounds that increase or decrease transcription of the CRN gene, reporter gene constructs employing the CRN promoter region may be used. Enzyme-linked immunosorbant assays for compounds that mime or modulate CRX transcriptional activity

Enzyme-linked immunosorbant assays (ELISAs) are easily incoφorated into high-throughput screens designed to test large numbers of compounds for their ability to modulate biological activity of a given protein. When used in the methods of the invention, changes in a given indicator protein level (e.g., rhodopsin, IRBP, cone opsin, rod-alpha transducin, arrestin, or serotonin N-acetyltransferase, the genes of which are transcriptional targets of CRX), relative to a control, reflect changes in CRX biological activity, or the presence of a compound that mimes CRX activity, depending upon the assay. The presence of CRX polypeptide also may be monitored in order to test for compounds that influence CRX transcription, translation, or mRNA or polypeptide stability. The test samples may be cells, cell lysates, or purified or partially-purified molecules. Cells may be photoreceptors or other types of cells, transgenic or transiently transfected, using methods that are well-known to skilled artisans.

Protocols for ELISA may be found, for example, in Ausubel et al., supra. In one embodiment, the so-called "sandwich" ELISA, treated samples comprising cell lysates or purified molecules are loaded onto the wells of microtiter plates coated with "capture" antibodies. Unbound antigen is washed out, and a second antibody, coupled to an agent to allow for detection, is added. Agents allowing detection include alkaline phosphatase (which can be detected following addition of colorimetric substrates such as -nitrophenolphosphate), horseradish peroxidase (which can be detected by chemiluminescent substrates such as ECL, commercially available from Amersham) or fluorescent compounds, such as FITC (which can be detected by fluorescence polarization or time-resolved fluorescence).

The amount of antibody binding, and hence the level of protein expressed by a CRX-transcriptional target gene, is easily quantitated on a microtiter plate reader. For example, an increased level of a target protein in a treated sample, relative to the level of a target protein in an untreated sample, indicates a test compound that increases the transcriptional activity of CRX. It is understood that appropriate controls for each assay are always included as a baseline reference. High-throughput assays for the puφose of identifying compounds that modulate or mime CRX biological activity can be performed using treated samples of cells, cell lysates, baculovirus lysates, and purified or partially-purified molecules.

Interaction trap assays Two-hybrid methods, and modifications thereof, are used to screen for compounds that modulate the physical interactions of CRX with other molecules (e.g., proteins or nucleic acids). Such assays also are used to identify novel proteins that interact with CRX, and hence may be naturally occurring regulators of CRX. Such assays are well-known to skilled artisans, and may be found, for example, in F. Ausubel et al., supra.

Secondary screens of test compounds that appear to modulate or mime CRX transcriptional activity

After test compounds that appear to have CRX transcription-modulating activity are identified, it may be necessary or desirable to subject these compounds to further testing. The invention provides such secondary confirmatory assays. For example, a compound that appears to modulate the biological activity of mutant CRX (i.e., induces mutant CRX to have activity approaching wild-type CRX) in early testing will be subject to additional assays to confirm that transcriptional levels of other CRX target genes are reproducibly influenced by the compound. At late stages testing will be performed in vivo to confirm that the compounds initially identified as affecting CRX activity will have the predicted effect on CRX in 60 concentrations, to the culture medium of the cells. Luciferase expression levels may then be measured by subjecting the compound-treated transfected cells to standard luciferase assays known in the art, such as the luciferase assay system kit used herein that is commercially available from Promega, and rapidly assessing the level of luciferase activity on a luminometer. The level of luciferase expression in the presence of the candidate compound is compared to the level of luciferase expression in the absence of the candidate compound, all other factors (e.g., cell type and culture conditions) being equal.

Compounds that modulate the level of CRX protein expression may be purified, or substantially purified, or may be one component of a mixture of compounds such as an extract or supernatant obtained from cells, from mammalian serum, or from growth medium in which mammalian cells have been cultured (F. Ausubel et al., supra). In an assay of a mixture of compounds, CRX protein expression is tested against progressively smaller subsets of the compound pool (e.g., produced by standard purification techniques such as HPLC or FPLC) until a single compound or minimal number of effective compounds is demonstrated to modulate CRX protein expression.

Screens for compounds affecting CRX biological activity Compounds may also be screened for their ability to modulate CRX biological activity, for example, transcriptional activation by CRX. In this approach, the degree of CRX-mediated transcription in the presence of a candidate compound is compared to the degree of transcription in its absence, under equivalent conditions. Again, the screen may begin with a pool of candidate compounds, from which one or more useful modulator compounds are isolated in a step-wise fashion. Transcriptional activation may be measured by any standard assay, for example, those described herein. 61

Another method for detecting compounds that modulate the biological activity of CRX is to screen for compounds that interact physically with a given CRX polypeptide. These compounds are detected by adapting yeast two-hybrid expression systems known in the art. These systems detected protein interactions using a transcriptional activation assay and are generally described by Gyuris et al. (Cell

75:791-803, 1993) and Field et al. (Nature 340:245-246, 1989), and are commercially available from Clontech (Palo Alto, CA).

Below are examples of high- throughput systems useful for evaluating the efficacy of a molecule or compound in treating or preventing a retinal degenerative condition caused by a mutant CRX protein, or whose course is affected by a wild-type

CRX protein.

Reporter gene assays for compounds that mime or modulate CRX transcriptional activity

Assays employing the detection of reporter gene products are extremely sensitive and readily amenable to automation, hence making them ideal for the design of high- throughput screens. Assays for reporter genes may employ, for example, colorimetric, chemiluminescent, or fluorometric detection of reporter gene products. Many varieties of plasmid and viral vectors containing reporter gene cassettes are easily obtained. Such vectors contain cassettes encoding reporter genes such as /αcZ/β-galactosidase, green fluorescent protein (GFP), and luciferase, among others.

Cloned DNA fragments encoding transcriptional control regions of interest are easily inserted, by DNA subcloning, into such reporter vectors, thereby placing a vector- encoded reporter gene under the transcriptional control of any gene promoter of interest. The transcriptional activity of a promoter operatively linked to a reporter gene can then be directly observed and quantitated as a function of reporter gene activity in a reporter gene assay. vivo. In the first round of in vivo testing, the compound is administered to animals with either wild-type or mutant CRX genes by one of the means described in the Therapy section above. Retinal tissue is isolated within hours to days following treatment, and are subjected to assays as described above.

Construction of transgenic animals and knockout animals

Characterization of CRN genes provides information that is necessary for CRX knockout animal models to be developed by homologous recombination. Preferably, the model is a mammalian animal, most preferably a mouse. Similarly, an animal model of CRX oveφroduction may be generated by integrating one or more CRN sequences into the genome, according to standard transgenic techniques.

As an example of one such transgenic animal, we have made a mouse with a knockout mutation that deletes the CRX homeodomain coding region. The knockout mice are viable and may be used to identify compounds which ameliorate or exacerbate a CRX-associated condition.

Therapeutic use of compounds identified by high throughput systems

A compound that promotes an alteration in the expression or biological activity of the CRX protein is considered particularly useful in the invention; such a molecule may be used, for example, as a therapeutic to increase cellular levels of biologically active CRX and thereby exploit the ability of CRX polypeptides to induce photoreceptor-specific gene expression. This would be advantageous in the treatment of certain retinal degenerative diseases.

A compound that decreases CRX activity (e.g., by decreasing CRN gene expression or biological activity) may also be used to treat retinal degenerative diseases. For example, a patient with a rhodopsin missense mutation who carries a CRN allele that produces a relatively large amount of CRX protein may consequently synthesize more of the mutant rhodopsin, leading to more rapid retinal degeneration. In this example, inhibiting CRX biological activity and/or expression may be therapeutically beneficial.

A compound that regulates CRX activity may also be useful for treatment of disruption of the circadian cycle, as occurs during jet travel across time zones, or types of circadian rhythm dysfunction.

Molecules that are found, by the methods described above, to effectively modulate CRN gene expression or polypeptide activity may be tested further in animal models. If they continue to function successfully in an in vivo setting, they may be used as therapeutics to either inhibit or enhance CRX biological activity and/or expression, as appropriate.

Compounds identified using any of the methods disclosed herein, may be administered to patients or experimental animals with a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form, as described in the Therapy section above.

The following examples are to illustrate the invention. They are not meant to limit the invention in any way.

EXAMPLE I: MOLECULAR CLONING AND SEQUENCE ANALYSIS OF MURINE AND HUMAN CRX Molecular cloning of a murine CRX cDNA

A degenerate RT-PCR-based screen was used to identify members of several gene families expressed in the developing retina (T. Furukawa et al., Proc. Natl. Acad. Sci. USA 94:3088-3093, 1997). A murine CRNcDNA fragment obtained in the screening was used as a probe for a mouse P0-P3 eye cDNA library (X. Yang et al., J. Neurosci. 13:3006-3017, 1993). The longest clone isolated from this library

(approximately 1.6 Kb) was subcloned into pBluescript (Stratagene), and analyzed. Sequence analysis revealed a complete open reading frame for a novel gene belonging to the otx family of homeobox genes. Using the first ATG, the deduced open reading frame encodes a 299 amino acid polypeptide with a predicted mass of 32 kDa. Fig. 6A shows the deduced amino acid sequence of the mouse CRNcDNA. The boxed amino acid sequence corresponds to the homeodomain. A double underline indicates the "otx tail" which is observed in the C-terminus of OTX family members. The GenBank accession number of this sequence is U77615.

The predicted amino acid sequence of murine CRX (mCRX) shows a high degree of homology to mouse OTXl and OTX2 (A. Simeone et al., EMBO J. 12:2735-2747, 1993). Fig. 6B shows the amino acid sequence alignment of the mCRX homeodomain and other OTX-related homeodomains. Residues identical to mCRX protein are indicated by dashes. The lysine residue at the ninth position of the recognition helix (helix 3/4) is underlined. The homeodomain of the predicted mCRX protein has 88%, 86% and 85% identities with the mouse OTXl, OTX2 and Drosophila orthodenticle (otd) (R. Finkelstein et al, Genes Dev. 4: 1516-1527, 1990) homeodomains, respectively (Fig. 6B). Further, the mCRX homeodomain has a lysine at the ninth position of the recognition helix, a feature shared by other OTX and OTX-related homeodomain proteins (Fig. 6B). As well, the mCRX homeodomain is 55%-60% identical to the homeodomains of a series of other OTX-related proteins, such as Ptxl/Potx (T. Lamonerie et al., Genes Dev. 10: 1284-1295, 1996; D.P. Szeto et al., Proc. Natl. Acad. Sci. USA 93:7706-7710, 1996), Solurshin (E.V. Semina et al., Nat. Genet. 14:392-399, 1996), and UNC30 (Y. Jin et al., Nature 372:780-783, 1994)(Fig. 6B).

Fig. 6C shows the amino acid homologies between the mouse OTXl, OTX2 proteins and the mouse CRX. The homeodomain is shown in a shaded box, and the

OTX tail is shown by a black bar. Interestingly, the CRX deduced protein contains a peptide with the sequence DPLDYKDQSAWK in the carboxyl terminus (Fig. 6A, 6C). This motif with a slight variation is also observed in the carboxyl termini of OTXl and OTX2, each of which contain two tandem copies of this repeat. We have therefore named this motif the "OTX tail". The zebrafish, Xenopus, and chick OTX proteins also contain OTX tails at their C-termini (L. Bally-Cuif et al., Mech. Dev. 49:49-63, 1995; LL. Blitz and K.W. Cho, Development 121:993-1004, 1995; Y. Li et al., Mech. Dev. 48:229-244, 1994; H. Mori et al., Brain Res. Mol. Brain Res. 27:221- 231, 1994; M. Pannese et al., Development 121 :707-720, 1995), but the Drosophila otd protein does not contain this motif. Elucidation of the function of the OTX tail awaits future analyzes. Finally, amino acid sequence conservation between mCRX, OTXl, and OTX2 is observed in regions outside of the homeodomain and OTX tail (Fig. 6C). This includes the conservation of 38 amino acids in the amino termini of the proteins. As well, amino acid sequences on the carboxyl side of the homeodomains of these proteins show a low degree of homology among CRX, OTXl and OTX2 (Fig. 6C). The homology between CRX and the OTX proteins in several regions indicates that

CRX is a new member of the OTX family of proteins.

Molecular cloning of a human CRX cDNA

To identify homeobox genes essential to the retina, a λgtlO human retinal cDNA library (3x10^ pfu) was plated and Hybond-N+ (Amersham) membranes were used for plaque blotting according to standard methods using a 680 bp fragment of the human CHX10 cDNA which included the homeobox and the CVC domain (E.M.

Levine and N. Schechter, Proc. Natl. Acad. Sci. USA 90:2729-2733, 1993; P.

Svendsen and J. McGhee, Development 121 : 1253-1262, 1995). The 680 bp Apal restriction fragment from the CHX10 cDNA was radioactively labeled (A.P. Feinberg and B. Vogelstein, Anal. Biochem. 132:6-13, 1983) and used at a concentration of 1-2 xlO" cpm/ml hybridization buffer. To complete the full length sequence, 6 additional clones were obtained from the λgtlO human retinal cDNA phage library and 6 clones from a human retinal plasmid library. The open reading frame (Fig. 4A) has two adjacent in-frame ATG codons at the 5' end of the ORF (ATCATGATG, and ATGATGGCG). An in-frame stop codon is present in the genomic sequence 66 bp 5' of the first ATG. Since both conform well to the Kozak consensus sequence for translation initiation (M. Kozak, Nucl. Acids Res. 15:8125-8148, 1987), the first in- frame ATG is considered here to be the initiation codon.

Using the first in-frame ATG, the CRX open reading frame encodes a 299 amino acid protein, with a predicted mass of 32 kDa. The predicted human CRX protein is 97% identical to the mouse orthologue; there are only 10 residues that differ between the human and mouse proteins. None of these differences are in the homeodomain or other conserved motifs described below, and all changes (shown below the human CRX sequence in Fig. 4A) are conservative. The 1.4 kb size of the human CRNcDNA shown is smaller than expected based on the size of the human retinal CRN mRNA (-4.5 kb and -3.0 kb) on Northern blots (Fig. 9A), indicating that additional untranslated sequence is yet to be isolated. In Fig. 4A, exon boundaries of human CRX(hCRX) are indicated with arrow heads, and mutations identified in patients with cone-rod dystrophy are indicated in bold above the nucleotide sequence. To examine the relationship of hCRX to other proteins, we compared its sequence to those in the databases (S.F. Altschul et al, J. Mol. Biol. 215:403-410,

1990). Fig. 4B shows a comparison of the homeodomains of close relatives of CRX, OTXl, OTX2 (A. Simeone et al., EMBO J. 12:2735-2747, 1993), otd (R. Finkelstein et al, Genes Dev. 4:1516-1527, 1990), NBPhox (M. Yokoyama et al., DNA Res. 3:311-320, 1996), Rax (T. Furukawa et al, Proc. Natl. Acad. Sci. USA 94:3088-3093, 1997), CHX10 (I.S.C. Liu et al., Neuron 13:377-393, 1994), and bed (G. Frigerio et al., Cell 47:735-7 '46, 1986). Amino acids identical to hCRX are indicated by a dot and the three helices of the homeodomain are shaded. The percent identities between the hCRX homeodomain and proteins of interest is shown at the right in Fig. 4B. Two neuronal homeodomains are shown, NBPhox and Rax, which are very closely related to hCRX although they, like CHX10 have a glutamine at position nine of the recognition helix. The homeodomain of CHX10, which was included in the probe which identified hCRX, is 62% identical.

CRX, OTXl, OTX2 and otd are members of the bicoid family by virtue of the presence of a lysine residue at position 9 of helix 3, a position known to be responsible for determining target specificity. The Drosophila bicoid homeodomain is 40% identical to CRX, and is shown for comparison in Fig. 4B. The alignments of two other conserved domains found only in OTXl , OTX2 and CRX, the WSP motif and the OTX-tail are presented in Fig. 4B and percent identities indicated. Gaps introduced for complete alignment of the OTX-tails are shown as dashes. Human CRX is most similar to the human OTXl and OTX2 homeodomain proteins (A. Simeone et al., EMBO J. 12:2135-21 Al , 1993), with 40% and 44% overall identity, respectively. The overall identity between CRX and the Drosophila orthodenticle homeodomain protein (R. Finkelstein et al., Genes Dev. 4: 1516-1527, 1990), is 19%.

The CRX homeodomain is located in residues 39-99 (Fig. 4A; underlined), placing it close to the amino-terminus of the polypeptide, an arrangement similar to that of its OTXl and OTX2 relatives. The CRX homeodomain is 88% and 86% identical to those of human OTXl and OTX2, respectively (Fig. 4B), and 85% identical to the orthodenticle homeodomain. The hCRX homeodomain belongs to the prd- i e class of homeodomains, being 55-75% identical to other homeodomains of this class (D. Duboule, supra). Because hCRX contains a lysine residue at position nine of the recognition helix, it can be placed into the bicoid (D. Duboule, supra) family of homeodomains along with OTXl , OTX2, Ptxl/POTX (P.J. Gage and S.A.

Camper, Hum. Mol. Genet. 6:457-464, 1997), and solurshin (E.V. Semina et al., Nat. Genet. 14:392-399, 1996). Interestingly, the two homeodomains most similar to that of CRX (apart from the OTX group) are: NBPhox (M. Yokoyama et al., DNA Res. 3:311-320, 1996), which is expressed in neuroblastoma cells, and Rax/Rx (T. Furukawa et al., Proc. Natl. Acad. Sci. USA 94:3088-3093, 1997; P.H. Mathers et al., Nature 387:603-607, 1997), which is also retinal specific, like CRX (Fig. 6B). Although the overall identity between hCRX and OTXl or OTX2 outside the homeodomain is low (29% and 33%, respectively), two additional short amino acid sequences are highly conserved among them; interestingly, neither of these motifs is found in Drosophila. The first sequence, which we designate the WSP motif, is defined by the 13 residues between positions 158 and 170 (ATVSIWSPASESP; double underlined in Fig. 4A); seven of these amino acids, SIWSPAS, are 100% conserved among the CRX, OTXl, and OTX2 (Fig. 4B). The second motif has been termed the OTX-tail, and is located at the C-terminus of CRX (triple underlined residues 284-295, Fig. 4A), and in two copies in each of OTXl and OTX2 (Fig. 4B). Notably, hCRX does not contain two domains found in CHX10 and several other prd- like class homeodomain proteins, the octapeptide (M. Noll, Curr. Opin. Genet. Dev.

3:595-605, 1993) commonly seen in many proteins with a paired-type homeodomain, or the OAR domain (T. Furukawa et al., supra), a fifteen amino acid motif near the carboxy terminus. Additional characteristics of the hCRX protein that are also found in other transcription factors include a high percentage of serine and threonine residues (27%, 44/166) in the carboxy terminal half, and an overall high frequency of proline (13%, 40/299). CRX, like OTXl and OTX2, has a poly-glutamine stretch (9/11 amino acids in CRX) immediately following the homeodomain. Poly-amino acid stretches have been found in many transcription factors and in general enhance transcription efficiency (P. Kunzler et al., Biol. Chem. Hoppe Seyler 376:201-211, 1995). Immediately preceding the homeodomain are two residues, arginine and lysine, conserved in OTXl, OTX2, and Drosophila, which are reminiscent of a nuclear targeting sequence (C Dingwall and R.A. Laskey, Trends Biochem. Sci. 16:478-481, 1991).

Molecular Cloning of a Canine CRX cDNA

A Zap Express EcoRI/XhoI normal dog retina library was plated (5.1 x IO⁷ pfii) and Hybond N+ membranes were used for plaque blotting according to standard methods (Ausubel et al., supra; Sambrook et al., supra). The Smal/Bglll fragment from a full length human CRX cDNA was radiolabeled and used at a concentration of 1-2 x IO⁶ cpm ml in hybridization buffer at 50% formamide stringency. Purified plaques were amplified with oligonucleotide primers (T7 and T3) specific for the phage arm sequence. Five plaques amplified with human CRX specific primers J15 or

J37 (Table l)and either T7 or T3. PCR amplification products were directly sequenced. Sequences were aligned and a composite full length sequence (SEQ ID NO: 4) was assembled from the five purified phage. The identity between the canine protein sequence with that from either human or mouse is greater than 97%.. Both the WSP motif and the OTX- tail are 100% identical among the three proteins.

EXAMPLE II: GENERAL METHODS Human Sequence Comparisons

The human CRNcDNA sequence was compared to sequences in the available public databases. The computation was performed at the National Center for Biotechnology Information (NCBI) using the BLAST network service (S.F. Altschul et al., J. Mol. Biol. 215:403-410, 1990).

Human CRN Expression Analysis by Northern Hybridization

Total RNA from cultured human skin fibroblasts was prepared with Trizol (Gibco/BRL), according to manufacturer's instructions. Poly A⁺ RNA from adult human retina was obtained from Clontech, and RNA blots were made as described previously (R.A. Bascom et al., Hum. Mol. Genet. 4:1895-1902, 1995). The multiple human tissue RNA blot was purchased from Clontech. The human CRX 3 'probe (Fig. 4D) and the β-actin probe (Clontech) were labeled with [³ P]dCTP (A.P. Feinberg and B. Vogelstein, Anal. Biochem. 132:6-13, 1983) Hybridization for both blots was carried out according to Clontech instructions.

Human CRN Expression Analysis by In Situ Hybridization

Seven μm sections of adult human retina were processed and hybridized with an antisense human CRNriboprobe (Fig. 8D) essentially as described (L. Tessarollo et al., Development 115: 11-20, 1992), except substitution of 35s by 33p Sections were photographed with bright field using a Zeiss Axiophot microscope, and silver grains were visualized by red filtered side illumination.

Murine Crx Expression Analysis by Northern and In Situ Hybridization

RNA was extracted from adult Swiss-Webster mouse tissues. Ten μg of total RNA from each tissue was used for Northern blots, using nucleotides 928-1594 of the murine CRNcDNA as a probe. The full length cDNA of CRN was used as a probe for in situ hybridization (T. Furukawa et al., Proc. Natl. Acad. Sci. USA 94:3088-3093, 1997).

Electrophoretic Mobility Shift Assays (EMSA^) For EMS A, a homeodomain peptide of murine CRX was produced by cloning a

302 bp Smal fragment containing the homeobox sequence into the Smal site of pGEX4Tl (Pharmacia), and overexpressing it in E. coli. The resulting glutathione-S- transferase (GST)-CRX homeobox fusion protein was purified using Glutathione Sepharose 4B (Pharmacia). EMSA was performed as described (D. Wilson et al., Genes Dev. 7:2120-2134, 1993).

Mouse CRX Transactivation Assays

For expression in NIH3T3 cells, the entire Crx cDNA was subcloned into pME18S (Dr. K. Maruyama, Tokyo Medical and Dental Univ.), an expression vector under the transcriptional regulation of the SRα promoter. For the CRX-EnR fusion construct, a 302 bp Xmal fragment (encoding amino acids 7-108) containing the CRX homeobox was fused to the EnR domain. To make the CRX-EnR fusion, the Nraαl CRN fragment, an EcoRI-Xmal linker encoding amino acids #2-6 with a Ncol site at the methionine of position #2, an Xmal-Clal linker, and a Clal-Notl (partial digestion)

930 bp fragment of the EnR (F.L. Conlon, et al., Development 122:2427-2435, 1996) were ligated into a shuttle vector, pSLAX21 (B.A. Morgan and D. M. Fekete, Methods Cell Biol. 51:185-218, 1996). The Clal site inside this construct was designed so that the entire CRX-EnR fusion could be excised as a 1.3 kb Clal fragment from pSLAX21 /CRX-EnR. The oligonucleotide sequences for the Xmal-Clal linker was,

(top strand) 5' CCGGGCATCGACGGTAC (SEQ ID NO: 37); (bottom strand) 5' CGGTACCCTCGATGC (SEQ ID NO: 38). The 1.3 kb CRX-EnR Clal fragment was blunt-ended and cloned into pME18S. Chloramphenicol acetyl transferase (CAT) reporter constructs were made by inserting a Hindlll-BamRl fragment containing the OTX-binding consensus site or its derivatives into the Hindϊlϊ-BamHl site either of ρBL-CAT2 (B. Luckow and G. Schϋtz, Nucl. Acids Res. 15:5490, 1987) for pOTX-CAT, pOTX(A)-CAT and pRETl-CAT, or of pBL-CAT3 (B. Luckow and G. Schϋtz, Nucl. Acids Res. 15:5490, 1987) for pIRBP123-CAT and pIRBP(mut)123-CAT. The Hindlϊl-Bamlrll fragments used for these constructs were created by annealing the following complementary oligonucleotides. For pOTX-CAT: (top strand) 5' AGC

TTCAGGATTAAAGGGCAGGATTAAAGGCAGGATTAAAGGCAGGATTAAAG GCAGGATTAAAGGG (SEQ ID NO: 39); (bottom strand) 5' GATCCCCTTT AATCCTGCCTTTAATCCTGCCTTTAATCCTGCCTTTAATCCTGCCTTTAATC

CTGA (SEQ ID NO: 40); for pRETl-CAT: (top strand) 5' AGCTTGCCAATT AGGCCCCGCCAATTAGGCCCCGCCAATTAGGCCCCGCCAATTAGGCCCCG CCAATTAGGCCCCG (SEQ ID NO: 41); (bottom strand) 5'-GATCCGGGGC CTAATTGGCGGGGCCTAATTGGCGGGGCCTAATTGGCGGGGCCTAATTGG CGGGGCCTAATTGGCG (SEQ ID NO: 42). The GGATTA sequence in the top strand of pOTX-CAT was replaced with TGATTA in pOTX(A)-CAT. For pIRBP123-CAT, two oligonucleotides corresponding to -123 to - 58 bp and to -57 to +18 bp within the promoter sequence of human IRBP were annealed with the two complementary oligonucleotides which were designed to make Hindlll and BamHI ends. The pIRBP 123(mut)-CAT is identical to pIRBP 123-CAT except for the mutations in the promoter sequence between -48 and -52 indicated in Fig. 9A. NIH3T3 cells on 10 cm dishes were transfected with 10 μg of the expression vector with or without the CRNcDNA insert, plus 7.5 μg CAT reporter vector, and 2.5 μg of the β-gal expression vector (pSVβ, Clontech). After 2 days, cells were harvested and CAT activity was measured according to J. Sambrook et al., supra. Loading was normalized by reference to levels of β-galactosidase activity derived from the co-transfected pSVβ-gal plasmid. Each experiment performed three times; CAT activities were measured using a Phosphorimager and the values were averaged.

Murine CRN-encoding Retrovirus Construction An EcoRV -Hindi Crx cDΝA fragment containing the entire CRX coding region was subcloned into the SnaBl site of the pLIA virus vector (pLIA/CRX). In addition, the 1.3 kb Clal fragment of CRX-EnR described above was cloned into pLIA to make pLIA/CRX-EnR. A Clal-BamUl 930 bp EnR fragment was cloned into the EcoRl-BamRl site of the pSLAX21 with a Ncoϊ-Clal linker. A 1.0 kb Clal fragment containing EnR was cloned into the SnaBI site of pLIA. To produce virus, the plasmids were transfected along with a helper plasmid into a subline of the 293T cell line (Dr. Martine Roussel, St. Jude Children's Research Hospital/Memphis); supernatant was collected every 6-8 hrs starting at 24 hr post- transfection and was concentrated as described in F. Ausubel et al., supra.

Murine CRX-encoding Retrovirus Injection and Clonal Analysis of Infected Retinae In vivo infection of retinae was carried out by injection of virus into P0 rat eyes

(C/D, Charles River Laboratories) (D.L. Turner and C.L. Cepko, Nature 328: 131-136, 1987). Infected retinae were dissected after 3 weeks, fixed, and stained for alkaline phosphatase (AP) (S.C. Fields-Berry et al., Proc. Natl. Acad. Sci. USA 89:693-697, 1992). Retinae were mounted and serially cryosectioned at 20 μm to visualize infected clones. The cellular composition of each clone was determined through reconstruction from camera lucida drawings and/or photographs (D.L. Turner and C.L. Cepko, Nature 328: 131-136, 1987). All clones were scored in LIA CRX infected retinae. Due to a higher titer leading to a greater number of clones in LIA- infected retinae, approximately only 250 clones in continuous sections were scored. As shown in Table 2, injected animals from the same litter were compared.

Chromosomal Mapping by In Situ Hybridization

The CRX 5' probe (Fig. 8D) was labeled to a specific activity of 8.3 x 10^ cpm/μg DNA with [³H]-dTTP and [³H]-dATP (NEN) using a multiprime DNA labeling system (Amersham, #RPN 1600Y). In situ hybridization to BrdU- synchronized peripheral blood lymphocytes was performed using published methods (A.M.V. Duncan et al., Genomics 19:400-401, 1994; M.E. Haφer and G.F. Saunders, Chromosoma 83:431-439, 1981). Chromosomes were stained with a modified fluorescence, 0.25% Wright's stain procedure (CC. Lin et al., Cytogenet. Cell Genet. 39:269-274, 1985).

Radiation Hybrid (RH) and Yeast Artificial Chromosome (YAC) contig mapping

PCR primers specific for the 3'-UTR of CRN (JH1 and JH2, Table 2 and Fig. 3) were designed using the Primer program (Version 3.0, Whitehead Institute/MIT Center for Genome Research) The conditions of PCR for all mapping experiments were: initial denaturation for 2 min. at 94°C, annealing for 40 sec. at 55°C, extension for 40 sec. at 72°C, 35 cycles. Radiation hybrid mapping experiments were carried out in duplicate using the Genebridge 4 panel (M. Walter et al., Nat. Genet. 7:22-28, 1994) (purchased from Research Genetics). A human specific amplification product of the predicted size (160 bp) was observed in positive assays. The Whitehead Institute/MIT Center for Genome Research RH server was used to order the new STSs relative to framework markers. All the protocols used for the YACs have been described previously (S.W. Scherer and L.-C. Tsui, In: Advanced Techniques in Chromosome Research, pp. 33-72, K. Adolph, ed., Marcel Dekkar Inc., New York, 1991).

CRN gene cloning and determination of the genomic structure Four genomic clones were obtained by hybridization of the CRN 3 'probe (Fig.

4D) to a PAC (PI artificial chromosome) library (P.A. Ioannou et al., Nat. Genet. 6:84-89, 1994). The coordinates of the PAC clones identified are: dJ310F22, dJ447D21, dJ747K14 and dJ816C6. Four genomic phage were obtained by screening a λDASH (Sau3A I) partial human genomic library with the CRN 3 'probe using standard methods. The genomic structure was obtained by PCR amplification across the introns using primers known from the exon sequence (intron 1 : J13 and J3; intron 2: J6 and J7; denaturation for 1 min. at 98°C, annealing for 1 min at 62°C, extension for 2 min. at 72°C, 30 cycles). The resulting fragments were subcloned using the TA cloning kit (Invitrogen). Sequence analysis revealed the exon/intron junctions. The region containing the imperfect CAG repeat was PCR-amplified with primers J33 and

JIO (Table 1) under the following conditions: denaturation for 1 min. at 98°C, annealing for 30 sec at 64°C, extension for 30 sec. at 72°C, 30 cycles. PCR products were either directly sequenced or separated on a 6% denaturing polyacrylamide gel.

Phenotype of CRD Families 1 and 2 The two autosomal dominant CRD families comprised a four generation pedigree of Greek origin (6 affected subjects, three unaffected, and three spouses) and a two generation family with northern European origins (3 affected members and 2 others). In affected patients in both families, the diagnosis of CRD was based on clinical examination and tests of retinal function (K. Evans et al., Arch. Opthalmol. 113:195-201, 1995; JP. Szylyk et al., Arch. Opthalmol. 111 :781-788, 1993; K.

Yagasaki and S.G. Jacobson, Arch. Opthalmol. 107:701-708, 1989). Loss of visual acuity and disturbances of color vision began in the first or second decade of life and in later life marked central visual field defects and pigmentary retinopathy developed . Informed consent was obtained from all subjects after the nature of the procedures was explained fully. The research procedures were in accordance with institutional guidelines and the Declaration of Helsinki.

Linkage analysis

Pedigree information, allele frequencies and genotype data for Family 1 were processed by means of the LINKS YS data management package as described previously. The lod score calculations for the cosegregation of the mutations with the disease phenotype were determined using the FASTLINK version (3. OP) of the LINKAGE programs (R.W. Cottingham et a\., Am. J. Hum. Genet. 53:252-263, 1993; G.M. Lathrop et al., Proc. Natl. Acad. Sci. USA 81 :3443-3446, 1984; A.A Schaffer et al., Hum. Hered. 44:225-237, 1994) for linkage analysis. The CRD phenotype was analyzed as an autosomal dominant trait with complete penetrance, onset during childhood, and a disease allele frequency of 0.0001 (K. Evans et al., Nat. Genet. 6:210-213, 1994). The CRN gene was considered to be comprised of one normal and one mutant allele with frequencies of 0.9999 and 0.0001, respectively. The mutant allele was defined as the presence of either the E80A (Family 1) or 1 bp deletion

(Family 2) mutation.

Mutation Screening

The CRN gene was amplified in four fragments for SSCP analysis. The location and identity of the primers are shown (Fig. 8 A) and the primer sequences are reported in Table 1. To obtain fragments less than 250 bp for optimal mutation detection, the exon 2 amplification product (314 bp) was digested with Rsal before SSCP analysis, generating fragments of 178 bp and 136 bp. Similarly, exon 3 was amplified in two independent, overlapping fragments of 501 bp (exon 3a) and 474 bp (exon 3b), which, prior to SSCP analysis, were digested with Styl yielding: 191bp, 174 bp, and 136bp for the exon 3a fragment, and 287bp and 187bp for the exon 3b fragment. SSCP conditions were essentially as reported (R.A. Bascom et al., Hum. Mol. Genet. 4: 1895-1902, 1995).

Mutation Detection

The E80A mutation was detected in Family 1 by PCR-amplification of exon 2 with primers J35 and J34 and the products were cleaned through a Centricon 100 (Amicon) prior to digestion with Hinfl for 1 hour. Digestion products were separated on a non-denaturing polyacrylamide gel (Protogel, National Diagnostics). Ethidium bromide staining was used to visualize the fractionated products. The E80A mutation was assessed in the normal population by amplification of a portion of exon 2 with Jl 1 and J34 primers, followed by purification through Qiaquick PCR spin columns

(QIAGEN) and subsequent digestion with Ddel. Digested products were separated on an 8% nondenaturing polyacrylamide gel and visualized by ethidium bromide staining. Normal alleles produce fragments of 102 bp, 61 bp, and 26 bp and mutant alleles generate fragments of 163 bp and 26 bp. The single nucleotide deletion was evaluated by amplification of exon 3 with primers J33 and J32, followed by digestion with Hinfl. The expected fragment sizes for normal alleles are: 450bp, 298bp, 84bp, and 20bp and for deletion alleles: 533bp, 298bp and 20bp.

Plasmid sequencing was carried out with the T7 Sequencing Kit (Pharmacia Biotech) according to manufacturer's instructions. PCR products were purified using Qiaquick PCR spin columns (QIAGEN), then directly sequenced using the T7

Sequencing Kit (Pharmacia Biotech) with the following modifications: 10 μl PCR product and 1 μl (200ng/μl) oligonucleotide primer were combined and heated at 95°C for 5 min., then placed on ice. A mix of 2μl annealing buffer, 3μl labeling buffer, 2 μl diluted enzyme, and 2μl 35sdATP was added to the template:primer, then 4.5μl of the reaction mix was transferred to the termination mixes, and allowed to incubate at 37°C for 10 min. before STOP buffer was added.

Table 1 : Oligonucleotide Primers used for PCR-amplification and Sequencing of the Human

CRX Gene J3: 5'- CACCTCCTCACGGGCATAG -3' (SEQ ID NO: 8)

J6: 5'- CGCGGATCCTGCTGCCTGCATTTAGCCC -3' (SEQ ID NO: 9) J7: 5'- ATAAGAATGCGGCCGCTATGCCCGTGAGGAGGTG -3' (SEQ ID NO: 10)

JIO: 5'- GTAGGAATCTGAGATGCCCA -3' (SEQ ID NO: 11) Jl l : 5'- CTTCACCCGGAGCCAACTG -3' (SEQ ID NO: 12) J13: 5'- GTGGATCTGATGCACCCAGGC -3' (SEQ ID NO: 13)

J15: 5'- CCTCAGGCTCCCCAACCAC -3' (SEQ ID NO: 14) J31 : 5'- CAGAGGTCCTCCAAGAGATGAGGCC -3' (SEQ ID NO: 15) J32: 5'- GATCTAAACTGCAGGGAAGCAGATTC -3' (SEQ ID NO: 16) J33: 5'- CCAGCACCTCTCACCAATAAGTGTC -3' (SEQ ID NO: 17) J34: 5'- CTCTTTGTTCCGGGCAGGCCTC -3' (SEQ ID NO: 18)

J35: 5'- GGATGGAATTCTTGGTCATCCCAC -3' (SEQ ID NO: 19) J36: 5'- CTGCACGTCACCCCATGGTGAGTAAC -3' (SEQ ID NO: 20) J37: 5'- GGCGTAGGTCATGGCATAGG -3' (SEQ ID NO: 21) JH1 : 5'-GATTCTCTCAACCCTAACACCG-3' (SEQ ID NO: 22) JH2: 5'-GGGCACGGTGATTCTGAC-3' (SEQ ID NO: 23)

EXAMPLE ITT: CRX EXPRESSION IS CONFINED TO THE RETINA. AND CORRELATES WITH PHOTORECEPTOR CELL DEVELOPMENT

Expression of human CRX To examine the tissue-specificity of CRN expression, we performed Northern blot analyzes on ten adult human tissues using the human CRX 3 'probe (Fig. 8D). In Fig. 9 A the left blot contains: right lane, 5μg total RNA from cultured human fibroblasts and left lane, 2 μg polyA+ human retina RNA; the right blot is a human multiple tissue northern blot (Clontech), each lane containing 2 μg polyA+ RNA from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Human β- actin probe was used to control for RNA quality and relative abundance. A specific 2.0 kb band is observed in each lane. Heart and skeletal muscle possess two forms of β-actin, 1.8 kb and 2.0 kb (Fig. 9B). A specific and abundant transcript of -4.5 kb was detected in retina, but not in any other tissue examined, including skin fibroblast, heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas (Fig. 9A), even after long autoradiographic exposure (not shown). An additional faint band of —3.0 kb was detected specifically in the retina lane, and could represent cross hybridization with a closely related sequence, although the probe was predominantly made up of 3' UTR sequence, and therefore may more likely represent another mRNA species expressed from the CRN gene (Fig. 9B). To identify the specific cells of the adult retina that express CRN, paraffin- embedded adult human retinal sections were examined by in situ hybridization with a ³³P-labeled antisense riboprobe prepared from the human CRX in situ cDΝA fragment (bp 255 to 780, Fig. 8D), which encompasses the region encoding the homeodomain and most of the carboxy-terminal portion of the protein. A specific strong signal is obtained only in the photoreceptor layer (Fig. 9C) indicating that the CRN gene is expressed exclusively in photoreceptors, and certainly in rod cells. Cone cell expression could not be determined by this method. (Retinal cell layers are indicated at the left of Fig. 9C: GCL, ganglion cell layer; IΝL, inner nuclear layer; OΝL, outer nuclear layer, RPE, retinal pigmented epithelium.)

Expression of mouse Crx

To examine the tissue specificity of CRN expression, RΝA from the adult mouse retina and nine other adult mouse tissues was analyzed on a Northern blot using the mouse CRNcDNA as a probe. The upper panel of Fig. 10A shows the hybridization signal obtained with a mouse CRNcDNA probe. The lower panel shows EtBr staining of RNA. Each lane contains 10 μg of total RNA. A single abundant transcript of 3.0 kb is detected in the mouse retina and no signal is observed in the other tissues examined. Subsequent analysis also detected a signal in the pineal gland, a brain structure believed to be involved in the regulation of circadian rhythms. The expression levels of CRX were shown to display a diurnal variation with peak levels at 0:200 being 3-fold greater than levels at 16:00 (X. Li et al., Proc. Natl. Acad. Sci. U.S.A. 95:1876-1881, 1998) in situ hybridization was performed on developing and adult mouse eye sections (Fig. 10; gel; ganglion cell layer, ipl; inner plexiform layer, inl; inner nuclear layer, opl; outer plexiform layer, onl; onl, os; outer segment). CRN transcripts are first detected in the retinae of El 2.5 embryos, localized to the outer aspect of the neural retina, corresponding to the prospective photoreceptor layer (Fig. 10B). At this stage of retinal development, genesis of cone photoreceptors is increasing while rod genesis has not yet occurred at a significant level (L.D. Carter-Dawson and M.M. LaVail, J. Comp. Neurol. 188:263-272, 1979). At El 5.5, after the completion of cone genesis, and the initiation of rod genesis (L.D. Carter-Dawson and M.M. LaVail, J. Comp. Neurol. 188:263-272, 1979), a moderate level of expression is observed which was also restricted to the prospective photoreceptor layer (Fig. 10C).

The peak period for rod photoreceptor birthdays is around the time of birth of the animal (L.D. Carter-Dawson and M.M. LaVail, J. Comp. Neurol. 188:263-272, 1979; I. Νir, et al., J. Cell Biol. 98:1788-1795, 1984). The neonatal period is also the time when photoreceptor-specific gene expression can be observed in the developing photoreceptor layer for a number of genes. During postnatal retinal development, CRN also is expressed in the photoreceptor layer (Fig. 10), with expression throughout the prospective photoreceptor layer at postnatal day 4 (P4) (Fig. 10E, 10F) and peak expression at P6 (Fig. 10G, 10H). This pattern correlates with the rapid increase in cells expressing rhodopsin and other phototransduction genes between P6-P8 (I.

Ahmad et al., Biochem. and Biophys. Res. Comm. 173:463-470, 1990; D. Hicks and C. Barnstable, J. Histochem. Cytochem. 35:1317-1328, 1987; M. Νi et al., Curr. Eye Res. 11 :219-229, 1992; P.L. Stepanik et al., Exp. Eye Res. 57: 189-197, 1993). Around P6, the outer plexiform layer (OPL) is visible and leads to the separation of developing rods into two groups, those in the ONL (ONL) and those in the inner nuclear layer (INL). Similarly, CRN expression is observed throughout the newly established OΝL, as well as in a subset of cells in the IΝL, presumably conesponding to developing rods trapped on the vitreal side of the OPL (R. Young, J. Comp. Neurol. 229:362-73, 1985) (Fig. 10H). At P9, the intensity of the CRN signal is slightly decreased but is discretely localized to the OΝL (Fig. 101, 10J). Expression of CRN mRΝA persists in mature photoreceptors in the adult retina (Fig. 10K, 10L).

EXAMPLE IV: DΝA BINDING ACTIVITY OF CRX PROTEIN

The otx gene family has a lysine at position 51 of the homeodomain that confers DNA binding specificity for the sequence motif TAATCC/T (S.D. Hanes and R. Brent, Science 251:426-430, 1991; J. Treisman et al., Cell 59:553-562, 1989). We searched for this motif in available upstream regions of photoreceptor-specific genes, focusing on sequences in regions that are conserved among species. The consensus sequence (TAATCC/T) and a variant sequence (TAATCA)are found in several species in photoreceptor-specific upstream regions, including those for genes encoding the inteφhotoreceptor retinoid-binding protein (IRBP) (G.I. Liou et al., Biochem. Biophys. Res. Commun. 181: 159-165, 1991), rhodopsin (R. Kumar et al., J. Biol. Chem. 271 :29612-29618, 1996; D.J. Zack et al., Neuron 6: 187-199, 1991), cone opsin

(M.S. Saha et al., Curr. Opin. Genet. Dev. 2:582-588, 1992), and arrestin (T. Kikuchi et al., o/. Cell. Biol. 13:4400-4408, 1993).

Fig. 5 A shows OTX binding consensus sequences in bold type and boxed in the 5' flanking sequences for IRBP, opsin; red and green opsins, blue opsin, Drosophila opsin, and arrestin. "Orientation" indicates that the sequence is shown in F, forward orientation or R, reverse orientation, with respect to the direction of transcription. Although the fifth base (C) of the OTX recognition sequence,

5'-TAATCC/T-3' is known to be important for DNA binding specificity, the sixth base (C/T) has less importance (S.D. Hanes and R. Brent, Science 251 :426-430, 1991). CRX was tested for binding to these sequences using the electrophoretic mobility shift assay (EMSA). The Otx-oligos (TAATCC/T), the Otx(A)-oligo (TAATCA), and the Retl-oligo, were used as DNA probes (Fig. 8B). Retl (PCE 1) is one of the putative ct^'s-acting DNA regulatory elements of the rhodopsin promoter (M.A. Morabito et al., J. Biol. Chem. 266:9667-9672, 1991), and its core consensus sequence (5'-TAATTG- 3') is found in many opsin promoter sequences (T. Kikuchi et al., Mol. Cell. Biol.

13:4400-4408, 1993).

A fusion protein between glutathione- S transferase (GST) and the homeodomain of CRX was incubated with radio-labeled DNA probes. Radio-labeled oligonucleotide probes were incubated without additional protein (lanes 1 , 4, 7), with GST protein (lanes 2, 5, 8) or with GST-CRX fusion protein (lanes 3,6,9). Arrow indicates a specifically shifted band (Fig. 5C). The CRX homeodomain shows strong binding both to the Otx-oligo and to the Otx(A)-oligo (Fig. 5C; lane 1-6). The Retl probe, however, yields a shifted band of lower intensity (Fig. 5C; lane 7-9), indicating that CRX binds less strongly to the Retl oligo than it does to the Otx- and Otx(A)-oligos.

The specificity of CRX binding to the OTX consensus sequence was assessed by a competition experiment. The same unlabeled OTX-oligo was co-incubated as a competitor at increasing molar excess with respect to the labeled probe (25-, 50-, and 100-fold molar excess in lanes 2-4, respectively). A mutated OTX-consensus oligo was included as a competitor at increasing molar excess with respect to the labeled probe (25-, 50-, and 100-fold molar excess in lanes 5-7, respectively). The addition of cold competitor of the identical oligo results in a dose-dependent inhibition of the DNA-binding activity of CRX (Fig. 5D, lanes 2, 3, and 4). Binding is not, however, inhibited by competition with an oligo that was mutated in the OTX consensus sequence (Fig. 5D, lanes 5, 6, and 7).

EXAMPLE V: CRX TRANSACTIVATES THE IRBP PROMOTER In order to assess the efficiency of CRX as a transcriptional activator, a mouse

CRX expression construct was co-transfected into NIH3T3 cells with various CAT reporter constructs, and CAT assays were conducted during the period of transient expression (Fig. 3). CAT reporter plasmids were transfected into NIH3T3 cells with either control vector pME18S (SRα promoter) alone (lane 1, 3, 5, 7), or pME18S-CRX expression plasmid (lane 2, 4, 6, 8, 9).

First, CRX was tested for its ability to transactivate expression of reporter plasmids containing the chloramphenicol acetyltransferase (CAT) gene under the control of the thymidine kinase (tk) minimal promoter, linked to either five repeats of the Otx, Otx(A), or Retl core sequences (Fig. 3A). As seen in Fig. 3B, CRX transactivates expression of reporter genes fused to the OTX (lanes 1, 2) and OTX(A)

(lanes 3, 4) consensus binding sites. Transactivation activity is also observed using constructs containing the Retl sequence. However, Retl transactivation is weaker compared with that of the OTX consensus sites (lanes 5, 6).

To determine whether CRX could specifically activate a photoreceptor-specific transcriptional promoter, a reporter construct containing the -123 to +18 bp region of the IRBP promoter was co-transfected with the CRX expression construct. The results of this experiment (Fig. 3B, lane 7, 8) demonstrate that CRX is capable of significant transcriptional activation from reporter constructs carrying the IRBP promoter fragment. Furthermore, when the CRX binding site is mutated at positions previously found to decrease IRBP promoter activity (N. Bobola et al., J. Biol. Chem. 270: 1289-

1294, 1995) (Fig. 3 A), a significant reduction in the transcription activity is observed (Fig. 3B, lane 9). The remaining transcription activity is likely due to the presence of a Retl -like site in this promoter (Fig. 3 A).

Three additional pieces of evidence provide support that CRX is important for transcriptional activation of the IRBP gene in vivo. First, expression of IRBP temporally mimics that of CRX (G. I. Liou et al., Dev. Biol. 161 :345-356, 1994).

Second, analysis of transgenic mice carrying IRBP promoter constructs has revealed that 123 bp of the 5' flanking region of the human IRBP gene is sufficient for photoreceptor specific-expression in vivo (N. Bobola et al., J. Biol. Chem. 270: 1289- 1294, 1995). Third, the OTX binding site is protected specifically by nuclear extracts from retinoblastoma cell lines (which express IRBP), as seen by DNasel footprint analysis.

EXAMPLE VI: FORCED EXPRESSION OF CRX AFFECTS RETINAL CELL

DIFFERENTIATION IN VIVO

To test the effects of CRX overexpression on the development of retinal cells in vivo, refroviruses encoding CRX were injected into the developing retina. Infection of the rat retina at P0 with viruses carrying reporter genes alone results in clusters of clonally related cells ranging in size from 1 to 22 cells, and containing rod photoreceptors, amacrine and bipolar interneurons, and Mϋller glial cells in various combinations (D.L. Turner and C.L. Cepko, Nature 328: 131-136, 1987). Approximately 75% of these clones contain only rods, whereas the remaining clones contain exclusively non-rods, or combinations of rods and non-rods. If CRX expression were sufficient to instruct the rod cell fate, the percentage of rod-only clones should increase in retinae infected with a retrovirus encoding CRX.

Alternatively, CRX alone may not be sufficient for rod determination, but CRX expression may be sufficient to block non-rod cell fates. This possibility would be supported by an absence or a decrease of non-rod cells in clones infected by the

CRX-expressing virus. Retinal progenitor cells at PO were infected in vivo with LIA or LIA CRX virus (Fig. 11 A). (pLIA is derived from MMLV and is designed to express a marker gene, alkaline phosphatase (AP), under the control of an IRES sequence and a second gene under the control of the LTR promoter.) After retinal development was complete, infected retinae were subsequently stained for alkaline phosphatase activity, and clonal analysis was performed by reconstructing serially sectioned retinae. Identification of cell types was determined by the characteristic moφhologies and locations of terminally differentiated cells.

Fig. 1 IB, 1 IC, 1 ID, and 1 IE show examples of retinal cell types from 20 μm frozen sections of pLIA-infected retinae (arrow heads indicates cell body, and gel; ganglion cell layer, ipl; inner plexiform layer, inl; inner nuclear layer, opl; outer plexiform layer, onl; ONL, os; outer segment). Four cell types were observed: Fig. 1 IB shows an example of a rod photoreceptor, Fig. 1 IC shows an example of a bipolar cell, Fig. 1 ID shows an example of an amacrine cell, and Fig. 1 IE shows an example of a Mϋller glial cell. Cells infected with LIA/CRX showed moφhologies indistinguishable from cells infected with LIA.

No abnormal cell types were observed in the LIA/CRX-infected retinae; however, the cellular composition of clones infected with LIA/CRX was clearly altered relative to clones infected with LIA (Table 2). First, the LIA/CRX clones exhibited a statistically significant increase in the percentage of clones containing rod photoreceptors only (from 75.5% to 84.6%) (Table 2, Fig. 1 IF; standard error is represented by the error bar). Second, the LIA/CRX virus infected retinae were remarkable for an almost complete absence of amacrine interneurons in virally-infected clones (Table 2, Fig. 1 IG). The percentage of clones containing amacrines was reduced from 4.0% to 0.55%. As well, the percentages of clones containing Mϋller glia was markedly reduced (from 5.07% to 1.53%) (Table 2, Fig. 1 IG). Finally, the percentages of clones containing bipolar interneurons appeared to be unaltered in LIA/CRX infected clones (Table 2, Fig. 1 IG).

EXAMPLE VII: TRANSACTIVATION ACTIVITY OF CRX IS NECESSARY FOR

ROD OUTER SEGMENT FORMATION To determine whether CRX is required for rod differentiation, a LIA vector carrying a variant of CRX, CRX-EnR, was made (Fig. 12A). The homeodomain of

CRX was fused to the repressor domain of the Drosophila engrailed protein (indicated by a hatched box in Fig. 12A), producing a fusion protein which, due to the presence of the engrailed repressor domain, should block transcription activation by CRX (P. Badiani et al., Genes Dev. 8:770-782, 1994; F. L. Conlon et al., Development

122:2427-2435, 1996).

To examine the ability of CRX-EnR to impair transcription activation by CRX, transcription assays were performed following co-transfection of CRX and CRX-EnR expression plasmid into NIH3T3 cell lines (Fig. 12B). A plasmid encoding the wild-type CRX induces activation of transcription of the IRBP promoter

(pIRBP123-CAT) (lane 2). In contrast, the CRX-EnR is unable to activate transcription (Fig. 12B, lane 3) and furthermore, it blocks with transcription activation by wild-type CRX in a dose-dependent fashion (Fig. 12B, lanes 4, 5, 6, and 7).

The LIA/CRX-EnR virus was used to infect PO rat retinae, and 20μM frozen sections from infected eyes were examined at P21. A LIA virus which expressed the engrailed repressor domain alone (LIA/EnR) was used as a control. The retinae infected with LIA EnR developed rods (Fig. 12C, 12E), amacrine cells and Mϋller cells that appeared normal in terms of moφhology and location. However, the number of bipolar cells was reduced almost to zero. This effect on bipolar cells confounded our ability to draw conclusions from a quantitative analysis of the clonal composition of the LIA CRX-EnR infected retinae. The LIA CRX-EnR virus-infected retinae exhibited a dramatic phenotype of photoreceptor differentiation relative to either LIA-infected or LIA/EnR-infected retinae (Fig. 12D, 12F). Whereas the LIA/EnR-infected retinae show normal rod photoreceptors (Fig. 12C, 12E), the LIA/CRX-EnR-infected cells fail to form terminally differentiated rods. LIA CRX-EnR infected cells were located in the outer nuclear layer (ONL), yet only rarely formed outer segments or terminals (i.e. the axonal endings of rod cells located in the outer plexiform layer; opl) (Fig. 12D, 12F). Over 1,000 ONL cells, resulting from multiple retinae from several litters of infected animals, were observed to have this phenotype. The few cells that form any outer-segment-like structures exhibited abnormal outer segments and/or terminals.

The LIA CRX-EnR virus infected retinae exhibit normal amacrine and Mϋller cells. As in the LIA/EnR retinae, bipolar cells are again reduced to near zero.

To distinguish whether the photoreceptor phenotype of LIA/CRX-EnR-infected retinae was due to a failure of moφhogenesis or due to degeneration of outer segments and terminals that may have formed normally, retinae infected by the same viruses were harvested at PI 4, the earliest age when significant outer segment formation would have occuned in the majority of rod photoreceptors. Although LIA/EnR virus-infected retinae show normal moφhology of rod photoreceptor cells with outer segments, the LIA CRX-EnR virus-infected retinae harvested at P14 show a very similar phenotype to those harvested at P21 (Fig.l2G, 12H).

These data show that formation of outer segments does not occur in presumptive rods infected by the LIA/CRX-EnR virus, indicating that transactivation by CRX is necessary for rod differentiation.

EXAMPLE VTIT: CRN MAPS TO 19ql3.3. A REGION CONTAINING THE CORD2 LOCUS The CRN gene was localized to chromosome 19ql3.3 using a combination of in situ hybridization, somatic cell hybrid, radiation hybrid (RH) mapping, and yeast artificial chromosome (YAC) contig analysis.

In our initial experiments, the CRX 5' cDΝA probe (Fig. 8D) was hybridized to BrdU-synchronized peripheral blood lymphocytes. The analysis of the distribution of

400 silver grains following in situ hybridization revealed a significant clustering of grains on the long arm of chromosome 19. In particular, 63 grains were observed on 19ql3.2-13.4 with a peak distribution at 19ql3.3 (p<0.0001)(data not shown).

To confirm and refine the localization experiments, PCR primers designed from the 3'-UTR of CRN (JH 1 and JH2, Fig. 8 A) were used to screen the ΝIGMS somatic cell hybrids (panel #2) and the GeneBridge 4 RH panel (M. Walter et al., Nat. Genet. 7:22-28, 1994). The results confirmed that the CRX gene resides on chromosome 19q approximately 29.98 cR from marker RP_L28_1 which, at the time of this study, was the most distal marker on the Whitehead Institute Genome Center framework radiation hybrid map.

Finally, the same primer set was also used to screen the CEPH mega YAC library (I.M. Chumakov et al., Nature 377 SUPP: 175-297, 1995; T.J. Hudson et al., Science 270: 1945-1954, 1995). Although only a single clone could be identified (829f9) it was possible to position this YAC to the genomic interval flanked by D 19S219 and D 19S246 which were the markers known to flank the CORD2 locus

(CN. Gregory et al, Am. J. Hum. Genet. 55:1061-1063, 1994).

Fig. 13 shows the position of CRX within the context of the Lawrence Livermore National Laboratory chromosome 19 map (L.K. Ashworth et al., Nat. Genet. 11 :422-427, 1995). DNA markers are shown on the left and YAC clones are represented by black vertical lines. The CRX gene could be located on YAC clone

829f9 only and not clone 790a5 as would have been predicted based on marker content. This observation is not suφrising since this region of the genome is underrepresented by YACs and some of the clones are known to be inherently unstable (L.K. Ashworth et al., Nat. Genet. 11 :422-427, 1995). For the same reason, although YAC clones 786g4 and 75 le6 did not amplify with the CRX primers, they are not eliminated from the CRN region, since they could contain small deletions. The results, however, positioned CRX between markers D 19S219 and D 19S246 which were shown by genetic recombination studies to delineate the CORD2 locus. This finding is consistent with the RH data. Our results indicated CRN could be considered a positional candidate for the CORD2 disease gene (Fig. 13).

EXAMPLE IX: LINKAGE ANALYSIS OF FAMILIES 1 AND 2 Prior to the identification of a CRN gene mutation, linkage of CRD in Family 1

(Fig. 1 A) to the CORD2 locus was demonstrated by genotyping 6 markers in the region. The highest lod score (2.71 at θ=0.0) was obtained with marker locus D19S412 which is within the critical interval for CORD2 (CN. Gregory et al., Am. J. Hum. Genet. 55: 1061-1063, 1994). A lod score of 2 is generally accepted as sufficient (although not significant) evidence for linkage of a disease to a previously known locus with a similar phenotype (M. Al-Maghtheh et al., Am. J. Hum. Genet. 59:864- 871, 1996). Additionally, linkage to the other known CRD loci on autosomes 6p, 17q, 17q and 18q was excluded in this family (data not shown).

To determine the odds that the two mutations in the CRN gene found in Families 1 and 2 (see below) are linked to the CORD2 locus, compared to the hypothesis that the disease and the two CRN mutations cosegregate with CRD in these families by chance, we added the lod scores obtained with the two families by considering that the CRN gene was comprised of one normal and one mutant allele (i.e., that both mutations are disease-causing alleles and not rare variants). The highest lod score obtained for Family 1 was 2.71 (at θ=0.0) and for Family 2 was 0.60

(at θ=0.0), giving a combined lod score of 3.31. Given the linkage of Family 1 to the CORD2 locus and the cosegregation of the mutations in both families with the disease phenotype (with the combined lod score of 3.31), there is a strong suggestion that the CRN gene is responsible for CRD at the CORD2 locus. The biological data that the mutations in Families 1 and 2 are disease- causing (see below) provide strong additional evidence that mutations in the CRN gene cause CRD.

EXAMPLE X: IDENTIFICATION OF CRX MUTATIONS IN PATIENTS WITH CONE-ROD DYSTROPHY AND OTHER RETINAL DEGENERATIVE DISEASES The genomic structure of CRX To ascertain whether mutations in the CRN gene are responsible for CRD at the

CORD2 locus, we first determined the exon-intron structure of the gene (Fig. 8B). Four PAC clones and four phage clones containing the CRN gene were obtained using the CRN 3 ' probe. Analysis of the genomic organization showed that three coding exons are separated by two introns of 1.2 kb and -3 kb, respectively (Fig. 8B). The two introns interrupt the coding sequence at precisely the same location as in the human OTXl and OTX2 genes. The first intron is situated 4 1/3 codons 5' to the homeobox and the second within the homeobox, between the codons 84 and 85, the fifth and sixth residues of the third helix (Fig. 4A, 8B). The exon/intron junction sequences are shown in Table 3.

Table 3:

Exon: Length Acceptor Exon Sequence Donor

1 >100 bp (start) ...CCCAA GTGAGTACAG

2 152 bp (Py)i6/2θCCAG GCGCC...TTCAG GTGGGGTGGT

3 1149+ (Py)i7/2θCCAG GTTTG... (end) Because expansion of polymoφhic CAG repeat sequences is associated with premature neuronal cell death in other regions of the central nervous system (P. Kunzler et al., Biol. Chem. Hoppe Seyler 376:210-211, 1995), we determined whether the number of CAG codons in the imperfect CAG repeat in exon 3 immediately following the homeobox (Fig. 4A) is polymoφhic. Examination of this repeat in a total of 224 chromosomes was carried out by one of two methods, either direct sequence analysis (5 controls and 20 CRD patients, see below), or PCR amplified with primers J33 and JIO (87 controls). Our results indicate that this 11 codon interrupted CAG repeat is not variable in the collection of CRD patients reported here nor in the normal population. Consequently, expansion of this repeat is unlikely to cause cone- rod dystrophy.

Identification of CRX mutations in patients with cone-rod dystrophy

To determine whether mutations in the CRN gene cause cone-rod dystrophy, we examined the gene in the two autosomal dominant inheritance families whose pedigrees are shown in Fig. 1 and 2, as well as in a panel of four autosomal dominant, three autosomal recessive and 21 simplex or multiplex probands. To identify gross deletions or rearrangements in the gene, the CRX full probe (Fig. 4D) was hybridized to a Southern blot of genomic DΝA restriction digested with EcoRI or Smal. No gross rearrangements or deletions were detected in our collection of patients. To detect substitutions and other small alterations in the three CRN exons or in the immediate flanking intron sequences (-90 bp), we first used single stranded gel electrophoresis to detect SSCPs, as described previously (R.A. Bascom et al., Hum. Mol. Genet. 4: 1895-1902, 1995). All aberrantly migrating samples were subjected to direct sequencing. We detected one missense mutation and one deletion resulting in a frameshift. A missense mutation in the homeobox of the CRX gene of Family 1. Fig. 1A shows the four generation pedigree of Family 1 (squares indicate males, circles indicate females, filled shapes indicate affected, and open shapes indicate unaffected individuals). All living members were evaluated by an ophthalmologist, and individuals included in the mutation analysis are indicated with an asterick.

A variant band was observed in the SSCP analysis of exon 2 of two affected members of the four generation Family 1 (Fig. 1A). Direct sequencing of exon 2 revealed an A -> C transversion base pair 229, which changes a glutamic acid residue to alanine (E80A)(Fig. IC). The left panel of Fig. IC shows the normal sequence through the area (control), and the right panel shows the heterozygous presence of both an A and a C at base pair 239 within codon 80 (mutant).

The mutation abolishes recognition of both a, Ddel restriction site (C/TNAG) and a Hinfl restriction site (G/ANTC). To determine whether this allele cosegregated with CRD in this family, the J35/J34 exon 2 PCR product of eleven family members was restriction digested with Hinfl (Fig. IB). Normal alleles yielded the expected two bands of 229 bp and 85 bp in all unaffected individuals of Family 1, indicating complete digestion of both alleles. The DNA of affected individuals from this family produced the expected normal bands, as well as the predicted additional band of 314 bp, indicating the loss of the Hinfl restriction site in the mutant allele (Fig. IB).

To assure that the E80A allele is not polymoφhic in the population, 120 control DNAs were assessed by Jl 1/J34 amplification of exon 2, followed by digestion with Ddel, producing fragments of 102 bp, 61 bp, and 26 bp from a normal allele, but 163 bp and 26 bp from a mutant allele. The E80A mutation was not found in the 240 control chromosomes examined from a predominantly Caucasian population.

Furthermore, since the ethnic background of Family 1 is Greek, 27 DNA samples from individuals of Greek descent were analyzed. The E80A allele is not a polymoφhism in the Greek population, since it was absent from 54 control chromosomes.

Fig. ID shows an alignment of the recognition helices of the wild type CRX (upper) and mutant CRX. A # indicates an amino acid known from crystal structure analysis of related homeodomains to contact the sugar phosphate backbone, and "B" indicates a residue that is involved in specifying sequence recognition (D. Duboule, supra; CR. Kissinger et al., Cell 63:579-590, 1990; D. Wilson et al., Cell 82:709-719, 1995). The glutamine which is converted to alanine by the mutation in Family 1 is the first amino acid of the recognition helix, a residue likely to be important for proper function of the homeodomain .

A deletion causes a frameshift in the CRX gene of Family 2.

The CRN gene of four members of a small cone-rod dystrophy family (Family 2, Fig. 2) was examined. Fig. 2A shows the pedigree of Family 2 (squares indicate males, circles indicate females, filled shapes indicate affected, and open shapes indicate unaffected individuals). The members who were examined in this study by

SSCP and direct sequencing are indicated with an asterick.

Amplified fragments exon 3a and 3b from affected members displayed altered mobility in SSCP analysis. Direct sequencing of exon 3 revealed the deletion of a G nucleotide usually present at bp 502, within the glutamic acid codon at residue 168 (E168 [Δl bp]), the 11th amino acid of the WSP motif (Fig. 2B). The frameshift resulting from this deletion leads to truncation of 132 amino acids C-terminal to El 68, and the addition of 18 other amino acids.

In Fig. 2C, the consequence of the frameshift on the polypeptide product is shown aligned with the predicted wild type sequence (only the carboxy-terminal portion of the protein is shown). The mutation occurs at the end of the conserved

WSP motif, indicated by the arrow. The deleted amino acids encompass the conserved OTX-tail, creating a mutant CRX polypeptide of 185 amino acids. The mutation was not present in the unaffected member of Family 2. The deletion removes a Hinfl restriction site, allowing control chromosomes to be screened to evaluate the frequency of this allele in the general Caucasian population. PCR amplification of exon 3 followed by digestion with Hinfl produced fragments of 450 bp, 298 bp, 84 bp, and 20 bp from the normal allele, while the mutant allele yielded fragments of 533 bp, 298 bp and 20 bp fragments. The El 68 [Δl bp] mutation was not detected in 240 control chromosomes examined, indicating that it is not a polymoφhic variant.

Identification of CRX mutations in patients with Leber's congenital amaurosis

Leber's congenital amaurosis (LCA) is a disease in which patients are born lacking functional photoreceptors. Examination of the CRN genes of three such patients revealed that each patient possessed unique CRN mutations.

Direct sequencing of the CRN gene of LCA Patient 1 revealed a G to A transition at the first position of codon 56. This transition changes the codon from

GCA (the wild-type sequence) to ACA, and results in the substitution of a threonine for the alanine normally found at this position. Alanine 56, which is located within helix one of the CRX homeodomain, is highly conserved at analogous positions within related proteins (see Fig. 6B). Moreover, the mutation found in LCA Patient 1 is similar to the mutation found in CRD Family 1 , which also disrupts the CRX homeodomain.

The CRN gene of LCA Patient 2 contained a two base pair deletion which eliminates the third position in the codon for serine 167, and the first position in the codon for glutamate 168, resulting in a frameshift; this mutation is similar to the single base deletion found at the first position in the codon for glutamate 168 in CRD Family

2. A mutation found within the CRN gene of LCA Patient 3 also results in a frameshift, due to a single base pair deletion at the first or second position of the codon for glycine 217 .

None of the nucleotide sequence variations described above was observed within the CRX genes of more than 500 control subjects, including 100 normal subjects, and more than 100 patients with other eye diseases. Hence, these and other nucleotide alterations within the CRX gene are likely to be valuable predictors for various retinal diseases.

Identification of CRX mutations in patients with Adult Macular Degeneration (AMD) AMD is a multifactorial disease which is thought to have a genetic component (J.M. Seddon et al., Am. J. Ophthalmol. 123: 199-206, 1997). The genetic component of multifactorial diseases such as AMD may be a single mutant gene (as in the small but important subset of coronary artery disease patients with mutations in the LDL receptor), or multiple genes, due to the effect of one or more predisposing genes.

We have discovered a mutation in CRX associated with AMD. Our rationale for attempting to identify CRX mutations in AMD patients is based upon our finding that CRX is expressed in both rods and cones and is associated with a variety of single gene diseases affecting both types of photoreceptors. To date, we have identified one putative AMD disease-causing mutation in CRX, P184L. The P184L mutation is not a polymoφhism or common variant because it was not present in 1018 chromosomes (62 normal individuals, 447 retinal disease patients) examined by SSCP analysis. The patient, an 80 year old male with 'dry' AMD, has no living family, precluding the use of additional genetic analysis on the association of this allele with AMD. Proline 184 is located in the sequence ...glyl 83-prol84-serl85... which is predicted by protein structure algorithms to causes a full 180 degree haiφin turn to form in the peptide chain. The P184L substitution is predicted to remove the haiφin and also create a local hydrophobic patch which may predispose to abnormal subunit aggregation. We predict this alteration results in at least partial loss of CRX protein function.

The relationship between CRX and AMD may be readily further confirmed by examining the effects of substitutions found in AMD patients on i) the structure, abundance, and intracellular localization of the CRX protein; ii) the ability of the CRX protein to interact with other polypeptides and to activate transcription; and iii) the ability of the mutant allele to replace wild-type Crx in the mouse retina in vivo using the methods provided herein. All of the required methods for confirmation are standard to those skilled in the art (see e.g., F. Ausubel et al., supra). Several standard techniques are available to assess protein folding.

First, circular dichroism analysis of the C-terminal section of the normal and mutant CRX polypeptide may be used to compare the effect of the P148L or any other mutation on the fold of the protein. In this type of experiment, the C-terminal residues, gly 151 to leu 267, of CRX are fused to GST using standard methods, and the fold of the proteins examined. This method is simple and readily reveals the substantial structural change that P184L is predicted to cause (CM. Deber et al., Proc. Natl. Acad. Sci. U.S.A. 90: 11648-11652, 1993).

Second, the ability of the P184L protein, or any other mutation of CRX, to activate transcription from the IRBP promoter, described herein, or another promoter (e.g., the rhodopsin promoter) may be examined in vitro. Using methods described herein, we have previously shown that other CRX alleles we identified are associated with a loss of transcriptional activity (C.L. Freund et al., Cell 91 :543-553, 1997; C.L. Freund et al., Nat. Genet. 18:311-312, 1998).

Third, the yeast two-hybrid system may be used identify several proteins that interact with the C-terminal section of CRX. We have performed such a screen and have isolated numerous positive clones. One may readily determine whether the PI 84L or other mutant CRX proteins can associate with these interacting polypeptides as effectively as the wild type C-terminal fragment using this method.

Fourth, to examine the stability of the P184L protein, one may express the wild-type and mutant proteins (e.g., the P184L CRX protein) in COS cells using standard techniques (R.G. Taylor and R.R. Mclnnes, J. Biol. Chem. 269:27473-27477,

1994), and compare the abundance of the mutant CRX mRNA and protein to the normal CRX mRNA and protein using RNA and western blots, respectively. Since the P184L and other similar mutations are predicted to create a hydrophobic patch that could lead to aggregation of mutant CRX monomers in the nucleus (akin to the protein aggregates that occur in the polyglutamine tract expansion neurodegenerations like Huntington's disease; B.T. Koshy and HN. Zoghbi, Brain Pathol. 7:927-942, 1997), one may also determine whether such mutant proteins form intranuclear aggregates. Using antibodies against CRX protein, produced using methods described herein, the intracellular location of normal CRX, as well as CRX containing the a mutation, is examined. Intranuclear or cytoplasmic aggregates may also be identified by electron microscopy of the COS cells. This step may be necessary since aggregated CRX may not be detectable by antibodies that detect the normally folded and unaggregated CRX protein, because the antigenic sites may be masked within the abnormal aggregate. Finally, to demonstrate that a mutation (e.g., the P184L mutation) lacks normal function in photoreceptors in vivo, one may show that, in contrast to the wild-type CRN allele, the mutant allele cannot complement the loss of CRX function present in mice, described herein, carrying a disruption of the Crx gene. To introduce wild type and mutant CRX into the photoreceptors of Crx-/- mice, one may utilize a transgene with a promoter that will function in these photoreceptors in the absence of the endogenous CRX protein. Unexpectedly, the expression of IRBP is not downregulated in the Crx-I- mice (infra), indicating that the IRBP promoter can be used for this experiment. Moreover, expression of the mouse Irbp gene (G.I. Liou et al., Dev. Biol. 161 :345-356, 1994) begins about the same time as Crx. Thus, production of mice carrying a transgene construct comprising the Irbp promoter and eith the normal or mutant human CRNcDNA, including the endogenous CRNpolyadenylation site, is likely to lead to expression of the transgene in photoreceptors. It is preferred to generate at least three founders each with the wild-type CRX or mutant transgene. It is expected that at least one mouse line will have a level of retinal expression of the transgene that is comparable to that of the endogenous mouse Crx gene, a fact that can be established by doing densitometry on RΝA blots made from wild-type, strain-matched controls and transgenic FI animals. FI mice with the desired level of human CRX transgene expression are then bred to the targeted Crx-I- mice. The retinas of F2 offspring carrying a single functional copy of the wild-type transgene in a Crx-I- background are be compared to matched mice with a single similarly expressed mutant transgene. We predict that the Crx-I- mice carrying the wild-type transgene will have normal rod photoreceptor outer segments at 1 month of age, as do heterozygous (i.e. Crx+I- ) mice. In contrast, comparable Crx-I- mice carrying the mutant transgene are likely to have no outer segments, or a severe reduction in their length, due to loss of CRX function. Other promoters can also be used for this study, including the T-αl-alpha-tubulin gene promoter, as well as the CRN promoter. Additional putative AMD-causing mutations in the CRN gene in patients with

AMD can be assayed using the same approaches as described above for the P 184L mutation. To date, we have finished screening 90 samples by SSCP analysis (including 32 samples from probands with familial AMD, and 58 random AMD patients). In addition to the P184L mutation, we found two synonymous mutations (S34S and S199S) in this set of 90 samples. We have partly screened -100 more samples and have identified two reproducible novel SSCP band shifts not seen previously in SSCPs of more than 1000 other chromosomes. The frequency of CRX mutations in AMD patients may be as high as about 1 in 80. Once a putative mutation has been identified, confirmation of its pathogenicity will be established as described herein.

Summary of CRX Mutations in Patients with Retinal Degenerative Diseases Using methods described herein, including SSCP analysis, RFLP analysis,

Southern and Northern blot hybridization, and direct sequencing, we have discovered a large number of mutations in the CRN gene in patients with retinal degenerative diseases, including CRD, LCA, and AMD (Table A). These mutations include deletions and missense mutations of the coding sequence, as well as mutations presumably leading to RΝA splicing errors.

EXAMPLE XI: ANALYSIS OF MICE CARRYING A TARGETED DISRUPTION

OF THE CRX GENE We have generated mice carrying a targeted disruption of the Crx gene. The Crx gene-targeting vector was designed to replace all of exon 3 and the first part of exon 4, corresponding to amino acids 36-268 in the mouse Crx protein (Fig. 6; SEQ

ID NO: 3) with PGKneo sequences. The deleted sequences contain the entire homeodomain coding region. Thus, the disruption would be predicted to abolish the DNA binding activity, resulting in a null allele. The targeting vector was electroporated into TCI embryonic stem (ES) cells (129/SvEv-derived line). Two of the correctly-targeted ES cell lines were microinjected into C57BL/6 blastocysts and each of several chimeric male mice transmitted the targeted allele. One half of the TCI -derived offspring were identified as heterozygous for the targeted allele both by analysis of the EcoRI fragments on a Southern blot and by a PCR-based screen utilizing a mutant-specific primer within the neo construct. Heterozygotes were crossed to produce litters that included all three Crx genotypes (heterozygotes, __ homozygotes, and wild-type). The homozygous mutant animals are viable, and we could examine them for retinal phenotypes throughout the period of maturation of the retina, as well as for their ability to process light.

We processed retinas from 2- week-old and 3 -week-old sibling mice (Crx +/+, Crx +/-, and Crx -/-) for Epon plastic sectioning and examined them microscopically.

The outer segments (OS) of photoreceptor cells, which function to detect light, were absent in Crx-/- mice. The OS were shorter in the Crx +/- mouse relative to their +/+ siblings. These results indicate that Crx is essential for the formation of the OS.

In the Crx -/- mice, a decline with age in photoreceptor numbers was evident. The number of photoreceptor nuclei in 10-day-old Crx -/- was similar to the number observed in Crx +/+ and Crx +/- mice. By six months, however, the numbers of rows of photoreceptor nuclei was reduced to 0-4 rows compared to 10-12 rows in Crx +/+ siblings. Thus, at six months, photoreceptor degeneration was nearly complete. In order to examine the ability of the animals to process light, we recorded electroretinograms (ERGs) for Crx +/+, Crx +/-, and Crx -/- mice under light-adapted and dark- adapted conditions. In the dark- adapted state, the ERG is generated primarily by cells in the rod pathway. Under bright light adaptation, the rod pathway is suppressed and only the cells in the cone pathway contribute to the ERG. The ERG in the dark-adapted state showed that Crx -/- mice had no ability to process light using the rod pathway pathway, while light-adapted responses showed 1 -month-old Crx -/- siblings had no ability to process light using the the cone pathway. Therefore, the lack of ERG activity recorded in Crx -/- mice under both dark- and light-adapted conditions indicated that Crx -/- mice have neighter rod- nor cone-mediated responses to light. At one month, Crx +/- mice showed reduced ERGs under both dark- and light-adapted conditions, After six months, both Crx+/+ and Crx +/- mice showed similar ERGs under both dark-and light-adapted conditions. These results indicated that Crx +/- mice had a delay of development of the rod and cone phototransduction pathways.

On the basis of putative CRX-binding sites in the regulatory regions of many photoreceptor-specific genes, it is likely that CRX has a central role in the regulation of these and other genes. Promoters containing putative CRX-binding sites can be bound by, and transactivated by, CRX in in vitro assays (described herein). Likely CRX targets include rhodopsin, cone opsin, IRBP, arrestin, alpha-transducin, and phosphodiesterase. We examined the RNA levels of rhodopsin, arrestin, IRBP, alpha- transducin, and cone opsin by Northern blot hybridization using total RNA extracted from retinae of Crx +/+ and Crx -I- mice at the age of 10 days. We observed that the amount of rhodopsin transcript was reduced 10-fold in Crx -I- retina. Arrestin was reduced to approximately 65% in Crx -I- retina, relative to that of Crx +/+. Red/green cone opsin, blue cone opsin, and rod alpha-transducin are also decreased in expression in the retina of Crx -I- mice. In contrast, the expression of the gene encoding the metabolic component protein, IRBP, was not affected by the loss of CRX function.

Other putative target genes, including those encoding the structural proteins peripherin/rds, ROM1, and ABCR, can be readily examined using identical methods.

In summary, loss of both alleles of Crx results in an absence of OS, no ERG response for both rod and cone pathways, and reduced expression of several photoreceptor transduction genes. The Crx mutant mice provide a useful model for photoreceptor diseases, including LCA, AMD, and adCRD. These mice will be a valuable tool for exploration of diagnostic strategies, examination of gene interactions in multigenic diseases, and providing a model for therapies directed towards photoreceptor degenerative diseases.

EXAMPLE XII: REGULATION OF SEROTONIN N-ACETYL-TRANSFERASE

BY CRX IN THE PINEAL GLAND Our observation that CRX was expressed in the pineal gland, in conjunction of reports that of putative CRX-binding sites in the upstream sequences flanking several pineal gland-specific genes including serotonin N-acetyltransferase (NAT), hydroxyindole-O-methyltransferase, and pineal night-specific ATPase (X. Li et al., supra), suggested that CRX in the pineal gland may serve to regulate circadian rhythms through the regulation of expression of these genes.

We examined the expression of NAT in Crx -I- and Crx +/+ mice by RT-PCR, using standard methods described in Ausubel et al., supra. Pineal gland cDNA from 1 month old mice was used as the template for the first PCR reaction (40 cycles) using the primers NAT51 (5 '-CCGAATTCCCATGTTGAACATCAA

CTCCCTGA-3'; SEQ ID NO: 43) and NAT31 (5'-CCCTCGAGGTCAGCAGCC GCTGTTCCTGCGCAG-3' (SEQ ID NO: 44). The amplified product was then amplified (40 cycles) with internal primers NAT54 (5'-CCGAATTCTTCCTAGG CTGCCAAGCGGCGCCACA-3'; SEQ ID NO:45) and NAT34 (5'-CCCTCGAG CCCACGGTGATGGCACATG GGCCCAC-3 '; SEQ ID NO: 46). Levels of NAT were decreased dramatically in the Crx -I- pineal gland, relative to Crx +/+ controls.

Other Embodiments

All publications and patent applications mentioned in this specification are herein incoφorated by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incoφorated by reference.

While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the appended claims.

What is claimed is:

Claims

1). A substantially pure CRX polypeptide.

2). The polypeptide of claim 1, said polypeptide being a mammalian polypeptide.

3). The polypeptide of claim 2, said polypeptide being a human polypeptide, a murine polypeptide, or a canine polypeptide.

4). The polypeptide of claim 1, wherein said polypeptide is the polypeptide set forth in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO 3.

5). The polypeptide of claim 1, said polypeptide having the biological activity of a CRX polypeptide.

6). Substantially pure nucleic acid encoding a CRX polypeptide.

7). The nucleic acid of claim 10, wherein said nucleic acid hybridizes to sequences found within the nucleic acid of SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 under high stringency conditions.

8). The nucleic acid of claim 7, wherein said nucleic acid hybridizes to sequences found within the nucleic acid of SEQ ID NO: 4 under high stringency conditions.

9). The nucleic acid of claim B, wherein said nucleic acid is DNA. 10). The DNA of claim 9, wherein said DNA is genomic DNA; cDNA; wherein said DNA encodes a CRX polypeptide having conservative amino acid substitutions, wherein said polypeptide has CRX biological activity; encodes the amino acid sequence of SEQ ID NO: 1; encodes the amino acid sequence of SEQ ID NO: 2; or encodes the amino acid sequence of SEQ ID NO: 3.

11). A probe for analyzing the CRN nucleic acid of an animal, said probe having a sequence complementary to at least 50% of at least 60 nucleotides of the nucleic acid encoding the CRX polypeptide or complementary to the nucleic acid encoding the CRX polypeptide, said probe sufficient to allow nucleic acid hybridization to at least a portion of CRN nucleic acid under high stringency conditions.

12). The probe of claim 11, wherein said sequence is complementary to at least 90% of at least 18 nucleotides of the nucleic acid encoding the CRX polypeptide.

13). The nucleic acid of claim 1, wherein the sequence of said nucleic acid comprises the antisense sequence of a CRX ribonucleic acid or deoxyribonucleic acid coding strand, or a fragment thereof, sufficient to decrease CRX biological activity when present in a cell having CRX biological activity, but for the presence of said sequence.

14). The nucleic acid of claim 13, wherein said CRX biological activity is wild-type CRX biological activity.

15). The nucleic acid of claim 13, wherein said CRX biological activity is mutant CRX biological activity. 16). The antisense sequence of claim 15, wherein said antisense sequence is specific for a mutant CRX coding region; comprises the transversion of an A nucleotide to a C nucleotide at base pair 239, said nucleotide being within the codon for gutamic acid at CRX amino acid position 80; the deletion of a G nucleotide usually present at base pair 502, said nucleotide being within the codon for glutamic acid at CRX amino acid position 168, or the transversion of a C nucleotide to a T nucleotide at base pair 551, said nucleotide being within the codon for proline at CRX amino acid position 184.

17). The nucleic of claim 9, wherein said DNA is operably linked to regulatory sequences for expression of said polypeptide; and wherein said regulatory sequences comprise a promoter.

18). The promoter of claim 19, wherein said promoter is inducible, or is the CRX promoter.

19). Substantially pure DNA containing regulatory sequences sufficient for the transcriptional regulation of the CRX gene in vivo.

20). The DNA of claim 19, wherein said DNA comprises the region from the CRN transcriptional start site to 1 kilobase upstream from said start site, 4 kilobases upstream from said start site, 6 kilobases upstream from said start site, 10 kilobases upstream from said start site, 25 kilobases upstream from said start site, 40 kilobases upstream from said start site, or 50 kilobases upstream from said start site.

21). A vector for gene therapy, said vector comprising the DΝA of claim 19. 22). The vector of claim 21, wherein said DNA is operably linked to DNA encoding a polypeptide.

23). The vector of claim 22, wherein said polypeptide is a therapeutic polypeptide or a CRX polypeptide.

24). An antibody that specifically binds a CRX polypeptide.

25). The antibody of claim 24, wherein said antibody specifically binds a polypeptide sequence of amino acids 1 through 38 of a CRX polypeptide, of at least ten amino acids present in CRX between amino acids 99 through 299, of at least ten amino acids present in CRX between amino acids 99 through 157, or of at least ten amino acids present in CRX between amino acids 171 through 299.

26). A method of generating an antibody that specifically binds a CRX polypeptide, said method comprising administering a CRX polypeptide, or fragment thereof, said administering to an animal capable of generating an immune response, and isolating said antibody from said animal.

27). A method of claim 26, wherein said CRX polypeptide isa mutant CRX polypeptide.

28). The method of claim 27, wherein said mutant CRX polypeptide or fragment thereof has an alanine residue at CRX amino acid position 80, or a leucine at amino acid position 184, or has at its carboxy terminus the amino acid sequence of SEQ ID NO: 7 (ser pro leu cys leu arg arg ser gly leu gly tyr tyr pro gin gly arg leu). 29). A method of detecting the presence of a CRX polypeptide, said method comprising contacting a sample with the antibody that specifically binds a CRX polypeptide and assaying for binding of said antibody to said polypeptide.

30). An antibody that specifically binds a CRX polypeptide having an alanine residue at CRX amino acid position 80 or a leucine residue at CRX amino acid position 184, or having at its carboxy terminus the amino acid sequence of SEQ ID NO: 7.

31). A method of diagnosing an increased likelihood of developing a retinal disease, said method comprising analyzing the DNA of a test subject to determine whether said test subject contains a mutation in a CRN gene, wherein the presence of said mutation is an indication that said test subject has an increased likelihood of developing a retinal disease.

32). The method of claim 31 , wherein primers used for detecting said mutation are selected from: J3 (SEQ ID NO: 8); J6 (SEQ ID NO: 9); J7 (SEQ ID NO: 10); JIO (SEQ ID NO: 11); Jl l (SEQ ID NO: 12); J13 (SEQ ID NO: 13); Jl 5 (SEQ ID NO: 14); J31 (SEQ ID NO: 15); J32 (SEQ ID NO: 16); J33 (SEQ ID NO: 17); J34 (SEQ ID NO: 18); J35 (SEQ ID NO: 19); J36 (SEQ ID NO: 20); J37 (SEQ ID NO: 21); JH1 (SEQ ID NO: 22); and JH2 (SEQ ID NO: 23).

33). The method of 31 , wherein said method further comprises the step of sequencing nucleic acid encoding CRX from said test subject, the step of using nucleic acid primers specific for the CRX gene and wherein said primers are used for DNA amplification by the polymerase chain reaction, or the step of single strand conformational polymoφhism (SSCP) analysis. 34). The method of claim 33, wherein said nucleic acid is genomic DNA, cDNA, or RNA.

35). The method of claim 33, wherein said nucleic acid is amplified by the polymerase chain reaction.

36). The method of 35, wherein the primers used in said polymerase chain reaction are selected from: J3 (SEQ ID NO: 8); J6 (SEQ ID NO: 9); J7 (SEQ ID NO: 10); JIO (SEQ ID NO: 11); Jl l (SEQ ID NO: 12); J13 (SEQ ID NO: 13); J15 (SEQ ID NO: 14); J31 (SEQ ID NO: 15); J32 (SEQ ID NO: 16); J33 (SEQ ID NO: 17); J34 (SEQ ID NO: 18); J35 (SEQ ID NO: 19); J36 (SEQ ID NO: 20); J37 (SEQ ID NO: 21); JH1 (SEQ ID NO: 22); and JH2 (SEQ ID NO: 23).

37). The method of claim 31, wherein said test subject is a mammal.

38). The method of claim 31 , wherein said test subject is human or canine

39). The method of claim 31, wherein said analyzing detects a missense mutation.

40). The method of claim 39, wherein said analyzing detects a mutation converting the glutamic acid residue at position 80 of CRN into alanine or a mutation converting the proline residue at position 184 of CRX into leucine.

41). The method of claim 31 , wherein said analyzing detects a frameshift mutation. 42). The method of claim 41, wherein said analyzing detects a frameshift mutation comprising a deletion of a G nucleotide within codon eleven of the thirteen codons specifying the WSP amino acid motif of CRX.

43). The method of claim 31, wherein said analyzing detects a mutation resulting in a truncated protein.

44). The method of claim 31 , wherein said method is carried out by restriction length polymoφhism (RFLP) analysis.

45). The method of claim 31 , wherein said method is for the diagnosis of a genetic predisposition for autosomal dominant cone-rod dystrophy (CRD), Leber's Congenital Amaurosis, retinitis pigmentosa, or age-related macular degeneration.

46). A kit for the analysis of CRN nucleic acid, said kit comprising nucleic acid probes for analyzing the nucleic acid of an animal, said analyzing sufficient to determine whether said animal contains a mutation in said CRN nucleic acid.

47). A kit for the analysis of CRN nucleic acid, said kit comprising antibodies for analyzing the CRX protein of an animal, said analyzing to determine whether said animal contains a mutation in a CRN gene.

48). A method of detecting a compound useful for the treatment of retinal disease, said method comprising assaying transcription levels of a reporter gene operably linked to a promoter, said promoter selected from: the rhodopsin promoter, the inteφhotoreceptor retinoid binding protein (IRBP) promoter, the cone-opsin promoter, the arrestin promoter, the serotonin Ν-acetyl-transferase promoter, the hydroxyindole-O-methyltransferase promoter, the pineal gland-specific ATPase promoter and the CRX promoter, said method comprising the steps of:

(a) exposing said reporter gene to said compound, and

49). The method of claim 48, wherein said reporter gene is in a cell.

50). The method of claim 49, wherein said cell is in an animal.

51). The method of claim 50, wherein an increase or decrease in said transcription indicates a compound useful for the treatment of retinal disease.

52). The method of claim 49, wherein said cell is a retinal cell or a pineal cell.

53). The method of claim 48, wherein said promoter is the rhodopsin promoter, the inteφhotoreceptor retinoid binding protein (IRBP) promoter, the cone opsin promoter, the arrestin promoter, or the CRX promoter.

54). The method of claim 48, wherein said promoter is the the serotonin N- acetyl-transferase promoter, the hydroxyindole-O-methyltransferase promoter, or the pineal gland-specific ATPase promoter.

55). The method of claim 48, wherein said method comprises assaying transcription levels of at least two of the said reporter genes.

56). A method of detecting a compound useful for the treatment of retinal disease, said method comprising the steps of: (a) exposing a cell to a test compound, and

(b) assaying said cell for an alteration in the level of rhodopsin, inteφhotoreceptor retinoid binding protein (IRBP), cone-opsin, arrestin, or CRX polypeptides, relative to a cell not exposed to said compound.

57). The method of claim 56, wherein said cell is in an animal.

58). The method of claim 56, wherein said method comprises assaying levels of at least two of the said polypeptides.

59). The method of claim 56, wherein said polypeptide is rhodopsin, inteφhotoreceptor retinoid binding protein (IRBP), cone-opsin, arrestin, or CRX.

60). A method of detecting a compound useful for the treatment of retinal disease, said method comprising assaying binding of a CRX polypeptide to a promoter, said promoter selected from: the rhodopsin promoter, the inteφhotoreceptor retinoid binding protein (IRBP) promoter, the cone-opsin promoter, the anestin promoter, the serotonin N-acetyl-transferase promoter, the hydroxyindole-O- methyltransferase promoter, the pineal gland-specific ATPase promoter and the CRX promoter, said method comprising the steps of:

(a) exposing said promoter to said compound and said CRX polypeptide, and

(b) assaying binding of said CRX polypeptide to said promoter for an alteration in binding activity relative to a reporter gene not exposed to said compound.

61). A method of preventing a retinal disease, said method comprising introducing into a retina an expression vector comprising a CRX gene operably linked to a promoter, said CRN gene encoding a CRX polypeptide having CRX biological activity. 62). A method of preventing or ameliorating the effects of a disease-causing mutation in a CRX gene, said method comprising introducing into a retina an expression vector comprising a CRX gene operably linked to a promoter, said gene encoding a functional CRX polypeptide.

63). A method of treating or preventing a retinal disease, said method comprising administering to an animal a compound that mimes the activity of wild- type CRX.

64). A method of treating or preventing a retinal disease, said method comprising administering to an animal a compound that modulates the levels of endogenous CRX.

65). The method of claim 64, wherein said modulation results in an increase or decrease of said CRX.

66). The method of claim 64, wherein said modulation results from changes in transcriptional activity of the CRN gene.

67). The method of claim 64, wherein said disease is CRD, Leber's Congenital Amaurosis, retinitis pigmentosa, or age-related macular degeneration.

68). A nonhuman transgenic animal expressing a retinal disease-causing CRX polypeptide.

69). A transgenic animal expressing transgenic DΝA encoding a CRX polypeptide having biological activity. 70). A non-human animal wherein one or both genetic alleles encoding a CRX polypeptide are mutated.

71). The transgenic animal of claim 69, wherein said DNA comprises the CRX missense mutation shown in Fig. IC or ID or Fig. 2B or 2C

72). The transgenic animal of claim 69, wherein said DNA comprises the CRX sequence of SEQ ID NO: 1.

73). The transgenic animal of claim 69, wherein said DNA comprises a CRX mutation such that the first nucleotide of codon 56 is altered, resulting in an amino acid change at position 56, a CRX mutation such that the first or second nucleotide of codon 217 is deleted, a CRX mutation such that the third nucleotide of codon 167 and the first nucleotide of codon 168 are deleted, or a CRX mutation such that the second nucleotide of codon 551 is altered, resulting in an amino acid change at position 184.

74). A non-human animal wherein one or both genetic alleles encoding a CRX polypeptide are mutated.

75). The animal of claim 74, wherein one or both genetic alleles encoding a CRX polypeptide are disrupted, deleted, or otherwise rendered nonfunctional.

76). Cells from the animal of claim 74.

77). The animal of claim 74, wherein said animal is a mouse.

78). Cells which comprise the DNA of claim 17.