WO1999024607A2 - DETECTION AND TYPING OF THE iceA GENE OF $i(HELICOBACTER PYLORI) - Google Patents

Abstract

The present invention relates to a method for detection and/or typing of alleles of the iceA gene of H. pylori present in a biological sample, with said method comprising: i) amplifying polynucleic acids of the iceA gene by use of primers that permit specific amplification either of a fragment of iceA1 variants or of a fragment of iceA2 variants, and/or ii) hybridizing polynucleic acids of the iceA gene, possibly after amplification as in step i), with at least one probe that specifically hybridizes to either iceA1 variants or to iceA2 variants. In order to enable this method, the present invention discloses nucleic acid sequences of iceA1 and iceA2 variants. Primers and probes that can be used to carry out said method are also disclosed. The present invention further relates to diagnostic kits that allow to perform said method. IceA1 and IceA2 protein sequences are also disclosed, as well as antibodies directed against these sequences.

Description

Detection and typing of the iceA gene oϊ Helicobacter pylori

The present invention relates to the field of detection and typing of Helicobacter pylori infections in clinical samples.

BACKGROUND OF THE INVENTION

Helicobacter pylori {H. pylori) is an important human pathogen that colonizes the human stomach and can establish a long-term infection of the gastric and duodenal mucosa. Infection with H. pylori increases the risk of developing gastritis, duodenal and gastric ulcers and is associated with malignancies including adenocarcinoma of the distal stomach and gastric carcinoma. The genomic variability of H. pylori is higher than in most bacteria (Go et al., 1996) and

DNA fingeφrinting has revealed extreme heterogeneity among different isolates (Marshall et al., 1996, van der Ende et al, 1996).

Apart from the general genomic heterogeneity a number of specific genes have been recently identified that play a role in the pathogenicity of H. pylori, i.e. cagA, vac A type si, and bab (Blaser 1997, Athenon, 1997a, liver et al., 1998). The cagA gene (cytotoxity associated gene) is considered to be a marker for the presence of a genomic pathogenicity island of about 35 kbp (Logan and Berg, 1996, Censini et al., 1997). The vacA gene encodes a vacuolating toxin, that damages epithelial cells by formation of vacuoles. This gene is present in every H. pylori strain, but the level of the toxin production in vitro and risk of the disease are each related to the strain's particular vacA genotype (Atherton et al., 1995, 1997b, Blaser et al., 1995). The products of the bab genes are involved in mediating adherence of H.pylori to the gastric epithelium via the fticosylated Lewis b (Le^b) histo-blood group antigen. In addition, the H.pylori Le^b-binding phenotype is associated with the presence of the cag pathogenicity island (liver et al., 1998). Recently, a novel gene was discovered (Peek et al., 1996). This gene was designated iceA

(Induced upon contact with epithelium). There are 2 main allelic variants of the gene, iceAl and iceA2. The expression of the iceAl allelic variant is upregulated upon contact between H. pylori and human epithelial cells. It has been suggested - and confirmed by data disclosed in the present invention (see example 5) - that the presence of the iceAl gene is associated with the presence of peptic ulcers (Peek et al, 1996).

Therefore, there is a need for a diagnostic method that allows to determine which allelic variant of the iceA gene is present in a biological sample from a patient infected by H. pylori.

DETAILED DESCRIPTION OF THE INVENTION

It is an aim of the present invention to provide a method for detection and/or typing of alleles of the iceA gene present in a biological sample. Said method can be based on specific amplification of polynucleic acids of alleles that belong either to the group of iceAl variants or to the group of iceA2 variants. Said method can also be based on hybridization with a probe that specifically detects alleles that belong either to the group of iceAl variants or to the group of iceA2 variants. It is therefore another aim of the present invention to provide primers and probes for the above- mentioned amplification and hybridization steps. It is thus also an aim of this invention to provide sequences of iceAl and iceAl alleles, on the basis of which the above-mentioned primers and probes can be designed. It is another aim to provide techniques according to which said method for detection and/or typing can be performed. It is another aim to provide kits that will allow to perform said methods according to said techniques. It is another aim to provide amino acid sequences and fragments thereof encoded by iceAl and iceAl genes. It is thus also an aim of this invention to provide antigenic amino acid sequences of IceAl and IceA2, and antibodies raised against these antigenic amino acid sequences. It is another aim of the invention to provide an assay to detect these anti-Ice A 1 and/or anti-IceA2 antibodies. It is another aim of the present invention to provide a method to screen for molecules, as well as to provide the latter molecules, which modulate the binding between said IceAl or IceA2 proteins and said anti-IceAl or anti- Ice A2 antibodies, respectively. Pathogenicity of H.pylori is dependent on several genes. Therefore, it is an aim of this invention to provide a method for the detection and/or typing of iceA alleles as above mentioned, further characterized in that also the vacA gene, and/or cagA gene, and or bab A gene are detected and/or typed. All the aims of the present invention are met by the following embodiments.

According to one embodiment, the present invention provides a method for detection and/or typing of alleles of the iceA gene of H. pylori present in a biological sample, with said method comprising: i) amplifying polynucleic acids of the iceA gene by use of primers that permit specific amplification either of a fragment of iceAl variants or of a fragment of iceAl variants, and/or ii) hybridizing polynucleic acids of the iceA gene, possibly after amplification as in step i), with at least one probe that specifically hybridizes either to iceAl variants or to iceAl variants. Said method may be performed directly on the sample, or the polynucleic acids of the sample can be enriched and/or purified prior to amplification.

In order to enable said method, the present invention discloses a number of sequences of iceA alleles that were isolated from patients from different geographic origins, as is shown in examples 1, 2, and 5. Sequence alignments of these alleles, as shown in figures 1, 2, 5, and 6 demonstrate that all of these alleles either belong to the group of iceAl variants or to the group of iceAl variants. These sequence alignments also show that within either group of variants the sequence of some regions is conserved among the different alleles, but is not conserved between the two groups of variants. These conserved regions are prefened target regions for the primers and the probes of the invention. It is funher ore to be understood that the sequences of figures 2 and 6, defined by SEQ ID NO 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 30, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 65, 67, 69, 71, 73, 75, and 77 have not been previously disclosed and are part of this invention.

According to a prefened embodiment, the present invention thus provides a method as defined above, further characterized in that said primers and/or said probe specifically hybridize to target regions that are derived from the polynucleic acids that are shown in figures 2 or 6, whereby said target regions:

1. are sufficiently conserved within the group of iceAl variants or within the group of iceAl variants, as can be deduced from the alignment of the sequences of said variants, to enable detection of all alleles within either group of variants; 2. are sufficiently different between the two groups of varians, to enable differential detection of either iceAl variants or iceAl variants.

When having knowledge of the sequences of the iceAl variants and iceAl variants disclosed in the present invention, the skilled man will be able to design suitable primers and probes to carry out the method defined above. Relying on principles well known in the art, the skilled man will be able to select primers that allow specific amplification of either iceAl or iceAl variants under given experimental conditions, such as temperature, buffer composition, polymerase chain reaction cycle etc. Likewise the skilled man will be able to select probes that specifically hybridize to either iceAl or iceAl variants under given experimental conditions such as temperature, buffer composition etc. Having chosen primers and/or probes, the skilled man will furthermore be able to assess the efficacy of these primers or probes without undue experimentation. It is also obvious that the skilled man may chose to combine more than one primer pair or more than one probe to cany out the method defined above. In some cases, one may not wish to detect all known iceAl alleles or all known iceAl alleles, for instance if one intends to detect alleles found in a certain geographic region.

According to a more prefened embodiment, the present invention relates to a method as defined above, further characterized in that the aforementioned target regions to which the primers and/or probes specifically hybridize are situated: -between positions 97 and 124, or between 146 and 163 , or between 177 and 219, or between 285 and 311. or between 328 and 364, or beuveen 405 and 430, or between 433 and 480, or between 490 and 510. or between 516 and 539, or between 543 and 602, or between 642 and 678, or between 681 and 712, or between 776 and 795 of the sequence of the iceAl variant, and/or -between positions 189 and 293 or between 410 and 447 of the sequence of the iceAl variant, with said positions being according to the numbering of HPICEA1F2 (figure 2) in the case of the iceAl variant and according to the numbering of HPICEA2MOD (figure 6) in the case of the iceAl variant. It is to be understood that fragments 277 to 381 and 603 to 640 of the iceA2 nucleic acid sequence of isolate AU1 (figure 6b) correspond to fragments 189 to 293 and 410 to 447 of HPICEA2MOD (figure 6a). Other suitable target regions than those defined above can be chosen bv the man skilled in the art. According to a more prefened embodiment, the present invention provides a method as defined above, further characterized in that:

-the target region of the forward primer used for specific amplification of a fragment of iceAl variants, is situated between position 177 and position 219 or between position 328 and position 347 of the sequence of the iceAl variant, and/or

-the target region of the reverse primer used for specific amplification of a fragment of iceAl variants, is situated between position 555 and position 580 or between position 776 and position

795 of the sequence of the iceAl variant, and/or

-the target region of the probe that specifically hybridizes to iceAl variants, is situated between position 516 and position 539 of the sequence of the iceAl variant, and/or

-the target region of the forward primer used for specific amplification of a fragment of iceAl variants, is situated between position 201 and position 231 of the sequence of the iceAl variant, and/or

-the target region of the reverse primer used for specific amplification of a fragment of iceAl variants, is situated between position 410 and position 435 of the sequence of the iceAl variant, and/or

-the target region of the probe that specifically hybridizes to iceAl variants, is situated between position 252 and position 278 of the sequence of the iceAl variant, with said positions being according to the numbering of HPICEA1F2 (figure 2) in the case of the iceAl variant and according to the numbering of HPICEA2MOD (figure 6) in the case of the iceAl variant. Other suitable target regions than those defined above can be chosen by the man skilled in the art.

According to an even more prefened embodiment, the present invention provides a method as defined above, further characterized in that: -said forward primer for iceAl variants is IceAlF4 or IceAlF5, and/or

-said reverse primer for iceAl variants is IceAlR3 or IceAlR4, and/or

-said probe for iceAl variants is IceAlprl, and/or

-said forward primer for iceAl variants is IceA2F6, and/or

-said reverse primer for iceAl variants is IceA2R5, and/or -said probe for iceAl variants is IceA2pr 1 , with the sequence of said primers and probes being given below (see also Table 2):

name sequence (5* to 3') SEQ ID NO

IceAl

IceAlF4 GGATTACAGCTAGGTAATGGG 1 IceAlF5 GTGTTTTTAACCAAAGTATC 2 IceAl R3 CCGATGTAGTTCATTRCAAC 3 IceAlR4 CTATAGCCASTYTCTTTGCA 4 IceAlpr AAGCTTGTAAYGAYGAGAAACGC 5

IceAl

IceA2F6 GTTGGGTATATCACAATTTAT 6 IceA2R5 TTRCCCTATTTTCTAGTAGGT 7 IceA2prl GTCGTTAATGGCAAAATACAGG 8

The above-mentioned primers allow amplification of iceA sequences from the great majority (>99%) of isolates tested so far (see example 6). These include isolates from multiple geographic origins, suggesting broad applicability of said primers. The skilled man will recognize that the probes and primers with SEQ ID NO 1 to 8 may be adapted by adding or deleting one or more nucleotides at their extremities. Such adaptations may be required, for instance, if the conditions of amplification or hybridization are changed, or if the amplified material is RNA and not DNA as is the case in the NASB A system.

Different techniques can be applied to perform the methods of the present invention. These techniques may comprise immobilizing the iceA polynucleic acids, possibly after amplification, on a solid support and performing a hybridization with labelled oligonucleotide probes of the present invention. Alternatively, said probes may be immobilized on a solid support and hybridization may be performed with labelled iceA polynucleic acids, possibly after amplification (i.e. a reverse hybridization).

The well-known technique of Southern blotting is one example of a hybridization assay that can be used to perform the methods of the present invention. Another example of a hybridization technique is the DNA enzyme immuno assay (DEIA). According to this method, PCR products are generated by a primer set, of which either the forward or the reverse primer contain biotin at the 5' end. This allows binding of the biotinylated a plimers to streptavidin-coated microtiter wells. PCR products are denatured by sodium hydroxide, which allows removal of the non- biotinylated strand. Specific digoxigenin (DIG)-labelled oligonucleotide probes are hybridized to the single-stranded immobilized PCR product and hybrids are detected by enzyme-labelled conjugate and colorimetric methods.

A convenient reverse hybridization technique is the LiPA assay. The LiPA uses oligonucleotide probes immobilized as parallel lines on a solid support strip (Stuyver et al. 1993; international application WO 94/12670). This approach is particularly advantageous since it is fast and simple to perform.

It is to be understood that any other type of hybridization assay or hybridization format using any of the selected probes as described further in the invention, is also covered by the present invention.

According to another prefened embodiment, the present invention relates to a composition of at least one primer as defined in any of the methods mentioned above.

According to another prefened embodiment, the present invention relates to a composition of at least one probe as defined in any of the methods mentioned above.

According to another prefened embodiment, the present invention relates to a composition of at least one primer and at least one probe as defined in any of the methods mentioned above.

According to another prefened embodiment, the present invention relates to a kit for detection and/or typing of alleles of the iceA gene of H. pylori present in a biological sample, comprising: i) at least one suitable primer as defined in any of the methods mentioned above, and/or ii) at least one suitable probe as defined in any of the methods mentioned above, with said probe possibly immobilized on a solid support Optionally the kit may also comprise: - a buffer or components necessary to produce the buffer enabling the amplification or the hybridization reactions:

- when appropriate a means for detecting the hybrids resulting from the hybridization reaction.

According to another prefened embodiment, the present invention relates to an isolated iceAl polynucleic acid sequence defined by SEQ ID NO 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 30, 53, 55, 57, 59 and 61, or any fragment thereof that can be used as a primer or as a probe in a method for detection and/or typing of an iceAl allele.

According to another prefened embodiment, the present invention relates to an isolated iceA2 polynucleic acid sequence defined by SEQ ID NO 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 65, 67, 69. 71, 73, 75, and 77, or any fragment thereof that can be used as a primer or as a probe in a method for detection and/or typing of an iceAl allele.

The present invention also provides sequences of IceAl and IceA2 proteins, as shown in figures 3 and 7, with SEQ ID NO 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52. 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, 72, 74, and 76. In addition to the IceAl and IceA2 proteins shown in figures 3 and 7, respectively, the present invention also relates to other IceAl and IceA2 proteins that result from translation of the iceAl and iceAl nucleic acid sequences shown in figures 2 and 6, with said translation using the same reading frame but a different start and/or stop codon. One particular class of other IceAl or IceA2 proteins are IceAl or IceA2 proteins having the same carboxy-terminus as the proteins in figure 3 or 7, respectively, but with a different amino -terminus. The present invention thus relates to said proteins or any subfragments of said proteins, with said subfragments consisting of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 contiguous amino acids of an IceAl or IceA2 protein. It is furthermore to be understood that the sequences of figures 3 and 7, defined by SEQ ID NO 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52. 54, 56, 58, 60, 62, 63, 64, 66, 68, 70, 72, 74, and 76 have not been previously disclosed and are part of this invention.

According to a prefened embodiment, the present invention relates to antigenic subfragments derived from the above-mentioned IceAl and IceA2 proteins, said subfragments being recognized either by antibodies specific for IceAl proteins or by antibodies specific for IceA2 proteins. Said subfragments can be used in an assay enabling differential detection of antibodies specific for either IceAl or IceA2 proteins in a biological sample. According to a prefened embodiment, the present invention relates to an assay enabling differential detection of antibodies specific for either IceAl or IceA2 proteins in a biological sample, comprising contacting anti- IceAl and/or anti-IceA2 antibodies within a biological sample with a protein, or a fragment, or subfragment thereof as described above, and/or determining the binding of anti-IceAl and/or anti-IceA2 antibodies within a biological sample with a protein, or a fragment, or subfragment thereof as described above. Said assay thus permitting to determine if a patient was infected with a H. pylori strain carrying an iceAl allele or with a H. pylori strain carrying an iceAl allele. Suitable antigenic subfragments can be selected from those regions of the IceA proteins that:

1. are sufficiently conserved within the group of IceAl proteins or within the group of IceA2 proteins, as can be deduced from the alignment of the sequences of said proteins;

2. are sufficiently different between the two groups of proteins, as can be deduced from the alignment of the sequences of said proteins.

The antigenicity of the selected subfragments can subsequently be assessed by determinig their reactivity with serum antibodies against IceA. The specificity of the subfragments can be checked by determinig their reactivity with serum samples from patients known to be infected with either an H. pylori strain canying an iceAl allele or an H. pylori strain carrying an iceAl allele.

The present invention also relates to polyclonal antisera and monoclonal antibodies raised against the above-mentioned antigenic subfragments. The techniques to raise antisera or monoclonal antibodies to a given peptide fragment are well known in the art.

The present invention also pertains to a method to screen for molecules which modulate the binding between IceAl proteins and an anti-IceAl antibody, as well as between IceA2 proteins and an anti-IceA2 antibody, respectively, with all proteins and antibodies as defined above.

Moreover, the present invention pertains to a molecule modulating the above-mentioned binding.

Finally, the present invention relates to a method for detection and/or typing of H.pylori strains comprising the steps of detection and or typing alleles of the iceA gene of H.pylori as defined above, and, detection and or typing the vacA gene of H.pylori, and/or, detection and/or typing the cagA gene of H.pylori, and/or detection and/or typing the bab A gene of H.pylori.

The following definitions and explanations will permit a better understanding of the present invention. According to the present invention, an allele of the iceA locus is considered to be an iceAl variant if its sequence between the stop codon of the cysE gene and the start codon of the M.Hpyl gene is more homologous to the conesponding sequence of the HPICEA1F2 (Genbank U43917) than to the conesponding sequence of the HPICEA2MOD (Miller et al., USSN 08/650,528). Conversely, an allele of the iceA locus is considered to be an iceAl variant if its sequence between the stop codon of the cysE gene and the start codon of the M.Hpyl gene (also called hpylM) is more homologous to the conesponding sequence of the HPICEA2MOD than to the conesponding sequence of the HPICEA1F2.

The target material in the samples to be analysed may either be DNA or RNA, e.g. genomic DNA, messenger RNA, viral RNA or amplified versions thereof. These molecules are in this application also termed "polynucleic acids" .

Well-known extraction and purification procedures are available for the isolation of RNA or DNA from a sample (e.g. in Sambrook et al.,1989).

The term "probe" according to the present invention refers to a single-stranded oligonucleotide which is designed to specifically hybridize to H. pylori polynucleic acids. The term "primer" refers to a single stranded oligonucleotide sequence capable of acting as a point of initiation for synthesis of a primer extension product which is complementary to the nucleic acid strand to be copied. The length and the sequence of the primer must be such that they allow to prime the synthesis of the extension products. Preferably the primer is about 5-50 nucleotides long. Specific length and sequence will depend on the complexity of the required DNA or RNA targets, as well as on the conditions at which the primer is used, such as temperature and ionic strength. It is to be understood that the primers of the present invention may be used as probes and vice versa, provided that the experimental conditions are adapted. The expression "suitable primer pair" in this invention refers to a pair of primers allowing specific amplification of a H. pylori polynucleic acid fragment. The term "target region" of a probe or a primer according to the present invention is a sequence within the H. pylori polynucleic acids to which the probe or the primer is completely complementary or partially complementary (i.e. with some degree of mismatch). It is to be understood that the complement of said target sequence is also a suitable target sequence in some cases. " Specific hybridization" of a probe to a target region of the H. pylori polynucleic acids means that said probe forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said probe does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed. "Specific hybridization" of a primer to a target region of the H. pylori polynucleic acids means that, during the amplification step, said primer forms a duplex with part of this region or with the entire region under the experimental conditions used, and that under those conditions said primer does not form a duplex with other regions of the polynucleic acids present in the sample to be analysed. It is to be understood that "duplex" as used hereby, means a duplex that will lead to specific amplification. " Specific amplification" of a fragment of the H pylori polynucleic acids means amplification of the fragment for which the primers were designed, and not of any other fragment of the polynucleic acids present in a sample.

The fact that amplification primers do not have to match exactly with the conesponding target sequence in the template to wanant proper amplification is amply documented in the literature (Kwok et al, 1990). However, when the primers are not completely complementary to their target sequence, it should be taken into account that the amplified fragments will have the sequence of the primers and not of the target sequence. Primers may be labelled with a label of choice (e.g. biotine). The amplification method used can be either polymerase chain reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR; Landgren et al., 1988; Wu & Wallace, 1989; Barany, 1991), nucleic acid sequence-based amplification (NASBA; Guatelli et al., 1990; Compton, 1991), transcription-based amplification system (TAS; Kwoh et al., 1989), strand displacement amplification (SDA; Duck, 1990) or amplification by means of Q^β replicase (Lomeli et al., 1989) or any other suitable method to amplify nucleic acid molecules known in the art. Preferably, the probes of the invention are about 5 to 50 nucleotides long, more preferably from about 10 to 25 nucleotides. Particularly preferred lengths of probes include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. The nucleotides as used in the present invention may be ribonucleotides, deoxyribonucleotides and modified nucleotides such as inosine or nucleotides containing modified groups which do not essentially alter their hybridization characteristics. Probe and primer sequences are represented throughout the specification as single stranded DNA oligonucleotides from the 5' to the 3' end. It is obvious to the man skilled in the art that any of the below-specified probes can be used as such, or in their complementary form, or in their RNA form (wherein T is replaced by U). The probes according to the invention can be prepared by cloning of recombinant plasmids containing inserts including the conesponding nucleotide sequences, if need be by excision of the latter from the cloned plasmids by use of the adequate nucleases and recovering them, e.g. by fractionation according to molecular weight. The probes according to the present invention can also be synthesized chemically, for instance by the conventional phospho-triester method. The oligonucleotides used as primers or probes may also comprise nucleotide analogues such as phosphorothiates (Matsukura et al., 1987), alkylphosphorothiates (Miller et al., 1979) or peptide nucleic acids (Nielsen et al., 1991; Nielsen et al., 1993) or may contain intercalating agents (Asseline et al, 1984). As most other variations or modifications introduced into the original DNA sequences of the invention these variations will necessitate adaptions with respect to the conditions under which the oligonucleotide should be used to obtain the required specificity and sensitivity. However, the eventual results of hybridization will be essentially the same as those obtained with the unmodified oligonucleotides. The introduction of these modifications may be advantageous in order to positively influence characteristics such as hybridization kinetics, reversibility of the hybrid-formation, biological stability of the oligonucleotide molecules, etc. The term "solid support" can refer to any substrate to which an oligonucleotide probe can be coupled, provided that it retains its hybridization characteristics and provided that the background level of hybridization remains low. Usually the solid substrate will be a microtiter plate, a membrane (e.g. nylon or nitrocellulose) or a microsphere (bead) or a chip. Prior to application to the membrane or fixation it may be convenient to modify the nucleic acid probe in order to facilitate fixation or improve the hybridization efficiency. Such modifications may encompass homopolymer tailing, coupling with different reactive groups such as aliphatic groups, NH₂ groups, SH groups, carboxylic groups, or coupling with biotin, haptens or proteins. The term "labelled" refers to the use of labelled nucleic acids. Labelling may be canied out by the use of labelled nucleotides incoφorated during the polymerase step of the amplification such as illustrated by Saiki et al. (1988) or Bej et al. (1990) or labelled primers, or by any other method known to the person skilled in the art. The nature of the label may be isotopic (³²P, ³⁵S, etc.) or non-isotopic (biotin, digoxigenin, etc.).

The "biological sample" may be for instance cultured H. pylori strains, gastric or duodenal biopsies, faeces, saliva, gastric juice or urine.

For designing probes with desired characteristics, the following useful guidelines known to the person skilled in the ait can be applied. Because the extent and specificity of hybridization reactions such as those described herein are affected by a number of factors, manipulation of one or more of those factors will determine the exact sensitivity and specificity of a particular probe, whether perfectly complementary to its target or not. The importance and effect of various assay conditions are explained further herein.

**The stability of the [probe : target] nucleic acid hybrid should be chosen to be compatible with the assay conditions. This may be accomplished by avoiding long AT-rich sequences, by terminating the hybrids with G:C base pairs, and by designing the probe with an appropriate Tm. The beginning and end points of the probe should be chosen so that the length and %GC result in a Tm about 2-10°C higher than the temperature at which the final assay will be performed. The base composition of the probe is significant because G-C base pairs exhibit greater thermal stability as compared to A-T base pairs due to additional hydrogen bonding. Thus, hybridization involving complementary nucleic acids of higher G-C content will be more stable at higher temperatures.

** Conditions such as ionic strength and incubation temperature under which a probe will be used should also be taken into account when designing a probe. It is known that the degree of hybridization will increase as the ionic strength of the reaction mixture increases, and that the thermal stability of the hybrids will increase with increasing ionic strength. On the other hand, chemical reagents, such as formamide, urea, DMSO and alcohols, which disrupt hydrogen bonds, will increase the stringency of hybridization. Destabilization of the hydrogen bonds by such reagents can greatly reduce the Tm. In general, optimal hybridization for synthetic oligonucleotide probes of about 10-50 bases in length occurs approximately 5°C below the melting temperature for a given duplex. Incubation at temperatures below the optimum may allow mismatched base sequences to hybridize and can therefore result in reduced specificity.

**It is desirable to have probes which hybridize only under conditions of high stringency.

Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. The degree of stringency is chosen such as to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid.

**Regions in the target DNA or RNA which are known to form strong internal structures inhibitory to hybridization are less prefened. Likewise, probes with extensive self- complementarity should be avoided. As explained above, hybridization is the association of two single strands of complementary nucleic acids to form a hydrogen bonded double strand. It is implicit that if one of the two strands is wholly or partially involved in a hybrid that it will be less able to participate in formation of a new hybrid. There can be intramolecular and intermolecular hybrids formed within the molecules of one type of probe if there is sufficient self complementarity. Such structures can be avoided through careful probe design. By designing a probe so that a substantial portion of the sequence of interest is single stranded, the rate and extent of hybridization may be greatly increased. Computer programs are available to search for this type of interaction. However, in certain instances, it may not be possible to avoid this type of interaction. ** Standard hybridization and wash conditions are disclosed in the Examples section.

Other conditions are for instance 3X SSC (Sodium Saline Citrate), 20% deionized FA (Formamide) at 50 °C. Other solutions (SSPE (Sodium saline phosphate EDTA), TMAC (Tetramethyl ammonium Chloride), etc.) and temperatures can also be used provided that the specificity and sensitivity of the probes is maintained. When needed, slight modifications of the probes in length or in sequence have to be canied out to maintain the specificity and sensitivity required under the given circumstances.

The term "hybridization buffer" means a buffer allowing a hybridization reaction between the probes and the polynucleic acids present in the sample, or the amplified products, under the appropriate stringency conditions. The term "wash solution" means a solution enabling washing of the hybrids formed under the appropriate stringency conditions. The term "a method to screen for molecules" refers to any assay known in the art suitable for screening. In particular, the term refers to any immunoassay as described in WO 96/13590. The term "modulate" as used herein refers to both upregulation (i.e., activation or stimulation (e.g., by agonizing or potentiating)) and downregulation (i.e. inhibition or suppression (e.g. by antagonizing, decreasing or inhibiting) of the binding between an IceA protein as described above and an according antibody.

The term "molecule" refers to any compound targetting or binding an IceA protein as defined above. The term "a molecule which modulates the binding between an antibody and a protein" refers to any molecule derived from the screening method as described above.

The term "antibody" refers to polyclonal or monoclonal antibodies. The term "monoclonal antibody" refers to an antibody composition having a homogeneous antibody population. The term is not limiting regarding the species or source of the antibody, nor is it intended to be limited by the manner in which it is made. In addition, the term "antibody" also refers to humanized antibodies in which at least a portion of the framework regions of an immunoglobulin are derived from human immunoglobulin sequences and single chain antibodies as described in U.S. patent N° 4,946,778 and to fragments of antibodies such as F_ab, F._(ab)2, F_v, and other fragments which retain the antigen binding function and specificity of the parental antibody. The term "antigenic subfragment" refers to a linear as well as a conformational epitope of an IceA amino acid sequence capable of binding to an anti-IceA antibody, or of eliciting an immune response in a host.

FIGURE AND TABLE LEGENDS

Figure 1: Schematic representation of the genetic organization of iceAl.

Schematic representation of the genetic organization of iceAl. Parts of the flanking genes, cysE and hpylM also are shown. The top scheme represents the outline of Genbank sequence U43917 from US strain 60190, and schematics of several representative variants are shown below. Positions of PCR primers are indicated by anows. The positions of putative -10 and -35 boxes are indicated also. The number of amino acids in each of the coding segments, represented by hatched boxes, is shown below. In-frame deletions, relative to U43917, are-shown by a Δ and the number of deleted amino acids. The duplication of 3 amino acids (AEY) in NL5825 and PL95 is indicated. The inter genie distance between cysE and iceAl, as well as the deduced size of the IceAl protein are indicated. For strains CR3, P017, and US 166, an alternative ORF, starting at an internal ATG codon, created by the insertion of a single T at position 1060 (T₁₀₆₀) is shown by a separate box. The distance between the stop codon of iceAl and hpylM was exactly 8bp in all analyzed strains. For U43917, the ORF beginning at ATG₉₁₉ would also encode a 127 aa protein (in parentheses). ND = not determined. Note that the drawings are not on scale.

Figure 2: iceAl nucleic acid sequences

A: Alignment of iceAl nucleic acid sequences. The sequences of the iceAl alleles from 12 isolates of different geographic origins are aligned with HPICEA1F2, an iceAl sequence extracted from Genbank (U43917). Hyphens indicate gaps that were introduced to preserve alignment. Indicated are: the positions of primers IceAlF4 (HPIceAlF4), IceAlFS (HPIceAlF5), IceAlR3 (HPIceAlR3) and IceAlR4 (HPIceAlR4) and of probe IceAlpr (HPIceAlprl). Also indicated are: the putative start codon of the IceAl protein according to U43917; the putative -35 box; the putative -10 box; the putative start codon according to the present invention; the stop codon of the IceAl protein. B: iceAl nucleic acid sequences. The sequences and conesponding SEQ ID NOs, ie 53, 55, 57, 59 and 61, of different iceAl alleles from 5 isolates of different geographic origins are depicted.

Figure 3: IceAl amino acid sequences

A: Alignment of IceAl amino acid sequences. The sequences of 10 IceAl proteins from isolates from different geographic origins are aligned with HPICEA1PR (Genbank U43917). Hyphens indicate gaps that were introduced to preserve alignment. Asterisks below the sequences indicate perfect homology; dots below the sequences indicate partial conservation. B: IceAl amino acid sequences. The deduced amino acid sequences and conesponding SEQ ID NOs, ie 54, 56, 58, 60, 62, 63, and 64 of different iceAl alleles from 7 isolates of different geographic origins are depicted.

Figure 4. Alignment of the nucleotide sequences of different *^'ce,4i strains with nlalll.

Alignment of the nucleotide sequences from 7 iceAl strains, showing the various iceAl ORF^'s and the partial homology with nlalll (U59398) encoding a restriction endonuclease (NlalllR) in Neisseria lactamica. The ATG of nlalllR conesponds to the ATG at position 617 in iceAl from strain 60190 (Genbank accession number U43917). Several notable features are shaded in the alignment. (I) shows the ATG start codon of nlalll, which also is present in most iceAl sequences. (II) indicates the first stop codon in PL95 and J166. (Ill) shows the first stop codon in strain 26695. (IV) indicates the putative TTG start codon of iceAl, as postulated in U43917. (V) is the first stop codon in U43917. The putative ATG codon of iceAl is indicated by (IX) in HK11 and by (X) in the other iceAl strains. This ATG codon is preceded by a putative -10 sequence (VIII) and a putative -35 sequence (VI) in most strains. (Nil) is the first stop codon in CR3 and HK11. The insertion of T₁₀₆₀ in strains CR3 and Jl 66 creates a stopcodon (XII), but this places the upstream ATG_]055 start codon (XI) to be in frame. The 9 bp duplication in PL95 is shown by (XIII). The stop codon of nlalll is shown at (XIV).

Figure 5. Schematic representation of the genetic organization of iceA2.

Schematic representation of the genetic organization of iceAl. The flanking genes cysE and hpylM are shown also. Positions of PCR primers are indicated by anows. The top schematic represents the outline of the prototype iceAl ORF from US strain J178, encoding a protein of 59 aa, and the schematics below represent four other genetic organizations. The vertical anow indicates the relative position of the variable number of tandem repeats (VΝTR's) of 8 bps. For each isolate, the 8 bps repeated sequence and number of repeats is shown. Each of the 5 iceAl peptide motifs of 14, 13, 16, 6, and 10 amino acids is represented by a box. The existence of two distinct 16 aa domains is indicated by differently hatched boxes. The total number of amino acids in each iceAl ORF is shown for each variant. Intergenic distances between cysE and iceAl, as well as between iceAl and hpylM are provided in separate columns. IceAl subtypes iceAlA, iceAlB, iceAlC, iceAlD and iceAlE are indicated. (ND = not determined). Note that the drawings are not on scale.

Figure 6. iceAl nucleic acid sequences

A: Alignment of iceAl nucleic acid sequences. The sequences of the iceAl alleles from 3 isolates of different geographic origins are aligned with HPICEA2MOD. Hyphens indicate gaps that were introduced to preserve alignment. Indicated are: the positions of primers IceA2F6 (HPIceA2F6) and IceA2R5 (HPIceA2R5) and of probe IceA2prl (HPIceA2pr); the start codon of the IceA2 protein according to the present invention; the stop codon of the IceA2 protein. B: Alignment of iceAl nucleic acid sequences. The sequences of the iceAl alleles from 8 isolates of different geographic origins are aligned. Hyphens indicate gaps that were introduced to preserve alignment. Asterisks below the sequences indicate perfect homology; dots below the sequences indicate partial conservation. Further indicated are: the positions of primers IceA2F6 (HPIceA2F6) and IceA2R5 (HPIceA2R5) and of probe IceA2pr 1 (HPIceA2pr); the start codon of the IceA2 protein according to the present invention; the stop codon of the IceA2 protein. C: iceAl nucleic acid sequences. The sequences and conesponding SEQ ID NOs, ie 65, 67, 69, 71, 73, and 75 of different iceAl alleles from 6 isolates of different geographic origins are depicted.

Figure 7. amino acid sequences of Ice/12 variants.

A: Alignment of the deduced amino acid sequences of different IceA2 variants. The different peptide domains are shown as separate blocks, and are identified by numbers at the top. Dashes indicate gaps in the sequence to obtain proper alignment of homologous amino acid residues. The subtypes of IceA2 (A to E) are indicated in parenthesis after each strain name. Anows indicate the (partial) direct repeat in the 13aa and lOaa domains.

B: Amino acid sequences of IceA2 variants. The deduced amino acid sequences and conesponding SEQ ID NOs, ie 66, 68, 70, 72, 74, and 76 of different iceAl alleles from 7 isolates of different geographic origins are depicted. Figure 8. Agarose gel electrophoresis of iceAl- and ce 12-specific fragments.

PCR with allele specific primers for iceAl (Al) and iceAl (A2), respectively, was canied out on on DNA from different strains. Lanes 1 contain DNA from an iceAl strain; lanes 2 contain DNA from an iceAl strain possessing an allele that encodes an IceA2 protein of 59 aa; lanes 3 contain DNA from an iceAl strain possessing an allele that encodes an IceA2 protein of 94 aa; lanes 4 contain DNA from a mixed infection, containing both iceAl and iceAl. Lanes 5 show negative control samples.

Table 1. Primers to amplify the iceA region

Table 2. Allele-specific primers, ie iceAl- and z^'ce/42-specific PCR primers and probes

Table 3. Presence of iceAl or iceAl in a panel 51 of Dutch patients with known clinical status

Table 4. Presence of iceAl or iceAl in a panel 45 of Dutch patients with known clinical status

EXAMPLES

The following examples serve to illustrate the present invention and are in no way intended to limit the scope of the invention.

Example 1. Sequence analysis of the iceA genes

The sequence variability and genetic organization of iceA was investigated in H. pylori isolates from different geographic origins. At the onset of the study, there was one sequence of iceA {iceAl variant) available (Genbank accession number U43917, obtained from US strain 60190). Another iceAl sequence (HP1209) was published recently as part of the complete genome sequence of the UK H. pylori strain 26695 (Tomb et al., 1997). iceA is flanked upstream by cysE (serine acetyltransferase homolog) and downstream by hpylM (a DNA adenine methylase). Since these flanking genes were reported to be highly conserved, the initial amplification strategy was based on using different combinations of forward and reverse primers, located in these flanking genes (Table 1).

Table 1. Primers to amplify the iceA region

PCR was performed in a volume of 50 μl, containing 1 μl DNA from isolate or biopsy, 10 mM Tris-HCl pH 8.3, 50 mM KC1. 2.5 mM MgCl₂, 200μM dNTPs, 1.5 U AmpliTaq Gold, and 50 pmoles of both forward and reverse primers. Reaction mixtures were covered with mineral oil, and PCR was performed in a BioMed-60 thermocycler, with 9 minutes pre-denaturation at 94°C (to activate the AmpliTaq Gold), followed by 40 cycles of 30 sec at 94°C 45 sec at 50°C, and 45 sec at 72°C. Final extension was performed for 5 minutes at 72°C.

Combinations of these primers were initially used to amplify a fragment, spanning the complete iceA locus, from a panel of strains from different countries. PCR fragments were obtained from approximately half of the initially tested strains, whereas no amplimers were obtained from the remaining strains (data not shown). Amplimers of variable length (800-1 OOObp) from isolates from diverse geographic origins (Australia, China, Costa Rica, Hong Kong, the Netherlands, Portugal, Thailand, and USA) were selected randomly for sequence analysis. More specifically, the obtained PCR products were analysed on standard 2% agarose TBE gels. The PCR products were isolated from 1% TBE low-melting point agarose gels, and used for direct cycle sequencing with fluorescent primers (Amersham cycle sequencing kit) on a Pharmacia ALF express automatic sequencer. The sequences were analysed with the Intelligenetics PCGene Software. Alignment of the resulting sequences, and examination of the open reading frames (ORFs), showed the clear presence of 2 distinct variants. One of the variants was homologous to iceAl, and the 2 previously reported sequences fit well within the iceAl grouping established by the other strains. The other variant was very different and represents iceAl. These two groups of allelic variants were further analysed separately, as is shown in the following examples.

Example 2. Analysis of the sequences of the iceAl alleles

Alignments of the 19 independent iceAl sequences from Australia (n=3), Costa Rica (n= 2), Hong Kong (n=5), Portugal (n=3), Netherlands (n=l), China (n=l), Poland (n=l), United Kingdom (HP 1209 from strain 26695) and the United States (n=2, including U43917 from strain 60190) showed several notable features (Figures 1 and 2).

These sequences have been given SEQ ID NOs 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 30, 53, 55, 57, 59 and 61. The top scheme in Figure 1 represents the outline of Genbank sequence U43917 from US strain 60190, and schematics of several representative variants are shown below.

The following features were observed:

1. The first three nucleotides in the alignments of figures 1 and 2 are the stop-codon of the cysE gene, flanking iceAl at the 5' -end.

2.Between the stop codon of the upstream cysE and the start codon of iceAl, there is a highly variable region, ranging from 315 to 397 bp in length.

3. The start codon of iceAl was postulated to be at position 766 of the prototype iceAl sequence (all indicated nucleotide positions are based on this prototype from strain 60190 (Genbank accession number U43917).

However, there are at least 3 arguments against this claim.

(i) this putative start codon is not conserved, since 4 of the 19 studied sequences (AU8, AU18,

UK26695, and PL95) contain TTA at this position. (ii) 3 Hong Kong strains (HKl 1 , HK41 and HK42) have identical 5 bp deletions downstream of this TTG (between positions 808 and 813), that result in a frameshift and early termination of the open reading frame (ORF).

(iii) there are no upstream sequences resembling the conserved -10 and -35 motifs at the expected positions relative to this putative TTG start codon.

According to the data disclosed by the present invention, the start codon of iceAl is postulated to be located further downstream at position 919, based on the following observations: (i) The start codon is the more usual ATG instead of TTG and is completely conserved in all 19 sequences analyzed thus far. (ii) Frameshifts and early termination of the ORF starting from this codon were found in only 4 (CR3, P017, L5825, and US166) of the 19 sequences.

(iii) A sequence matching the putative TATA-box (-10) motif at positions -21 to -18, relative to this ATG start codon was present in 18 of the 19 sequences studied. In all 19 sequences studied, a TTGATA sequence is present at positions -98 to -93, (relative to this ATG start codon), approximating the -35 consensus (TTGACA) sequence.

Consequently, the predicted iceAl ORF would be 127 aa, and is identical to the 178 aa iceAl protein as postulated in sequence U43917 from strain 60190, but 51 amino acids smaller at the N-terminus, since a more downstream ATG is the putative start codon. Example 3. Deduced IceAl proteins

Overall, a putative 127 aa protein could be encoded by 8 (42.1%) of the 19 IceAl regions examined. In 2 strains (NL5825 and PL95), a 9-bp (CTGAATATG) sequence is repeated, resulting in duplication of 3 amino acids (Ala-Glu-Tyr at aa positions 81-83 of the ORF). The 6 iceAl sequences from Hong Kong (HK) strains that were studied each contained in-frame deletions. Isolate HK41 has 2 in-frame deletions of 55 and 8 amino-acids, resulting in a predicted product of only 64 amino acids. Strains HKl 1, HK9, HKl 9, HK42, HK46 showed identical 24 bp in-frame deletion near the 3 ' end of the ORF, resulting in a deletion of 8 aa (Figures 1 and 3). HKl 1 and HK46 contain a single aa insertion (Leu) at position 2 of the ORF, resulting in a deduced protein of 120 aa. In 3 strains (CR3, US166 and PO17), the presence of an additional T at exactly the same position (1060, based on the U43917 sequence) results in early termination and a predicted truncated IceAl protein of only 47 aa. As a consequence of the insertion of this T at position 1149, an ATG codon at position 1055 (and originally in the +1 ORF) would now permit translation of a 92 aa-encoding ORF (Figures 1, 2 and 3). This internal ATG₁₀₅₅ in the +1 ORF is not conserved in every iceAl strain but is present in all 3 strains that contain the T₁₀₆₀ insertion.

To determine whether other H. pylori isolates from Hong Kong also contained deletions,

15 strains were examined using primers IceAlprl and IceAlKl that amplify the 3' region of the iceAl ORF. Distinct variants were observed. Amplimers were absent in 3 strains, which is consistent with a deletion, including the target sequence for the forward primer IceAlprl, as observed in strain HK41.

Amplimers of 278 bp, concordant with the complete (127aa) iceAl ORF, as in strain UK26695, were observed in 2 Hong Kong strains. An amplimer of 254 bp, concordant with the in-frame deletion of 24 bp, as in strain HK42, was observed in 8 strains. A PCR product of approximately 220 bp was observed in the 2 other strains; sequence analysis of the PCR product, generated with primers IceAF5 and IceAR3, revealed the same 8 aa deletion found in HK42, but also in-frame deletions of 9 or 7 amino acids (HK9 and HKl 9, respectively; Figure 1, compare with Figure 3).

The intergenic sequence between the stop codon of iceAl and the start codon of hpylM was highly conserved at exactly 8 bp (CGGTTGYA) in all isolates. Example 4. Homology between iceAl and nlalllR

As previously reported (Xu et al., 1997), we confirmed the significant nucleotide sequence homology (± 60%) between iceAl (beginning at ATG₉₁₉) and nlalllR, a restriction endonuclease (Nlalll) encoding-gene from Neisseria lactamica (Genbank accession number U59398). Beginning from the nlalll ATG, which conesponds to the ATG_6I7 of the H. pylori iceAl locus, there is strong homology at the nucleotide level. However, due the variety of frameshifts present upstream of the ATG₉₁₉ , the homolog^y between the ORFs of iceAl and nlalllR at the amino acid level is limited (Figure 4). A possible ORF, starting at an upstream ATG₆₁₇ codon was observed in only 5 (P031, AU8, NL5825, AU18 and CH4) of the 19 sequences analyzed. In all sequences studied, containing a non-truncated ORF, there was no variation in the C-terminal 9 amino acids. The deduced amino acid sequences (228 aa) are highly homologous among these 5 cases (» 78%)and are nearly the same length as NlalllR (230 aa; except NL5825, which has a premature stop codon at position 1069, yielding a protein of only 151 amino acids) but the homology between the deduced IceAl proteins and NLAIIIR is only 52.1%. In each of the remaining 14 iceAl sequences, the ORFs showed frameshift mutations between ATG₆₁₇ and ATG₉₁₉, resulting in premature termination. Thus, this ATG₆₁₇ serves as a start codon for expression of iceAl in some H. pylori strains. However, IceAl proteins of 228, or 127 aa can be expressed both from the ATG₆₁₇ or from the ATG₉₁₉ startcodon, respectively (data not shown), indicating that both represent true ORFs.

Example S. Analysis of iceAl

A total of 17 sequences from iceAl strains were determined, including isolates from Australia (n=3), Canada (n=l), Costa Rica (n=5), the Netherlands (n=4), Portugal (n=l), Thailand (n=l), USA (n=2), as represented schematically in Figure 5. Alignments of iceAl sequences are depicted in Figure 6. The sequences have been given SEQ ID NO 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 65, 67, 69, 71, 73, 75 and 77. As a reference the sequence from USSN 08/650,528 is shown and denoted here HPICEA2MOD. The first three nucleotides (Figure 6A and 6B) are the stop codon of the cysE gene, flanking iceAl at the 5' end. The following features were observed:

Between the stop codon of cysE and the start codon of iceAl, the sequences are highly diverse (224 bps to 338 bps) in length. In particular, an 8-bps sequence (VNTR, AAATACTC, AAATACTT, or AAACACTT) occurs in a variable number of tandem repeats, ranging from 1 to 15 copies. The start codon of iceAl appears to be completely conserved in all sequenced isolates; no frame-shift mutations were observed in any case. A -10 consensus sequence (TATA) is present at positions -20 to -17 relative to the ATG start codon, but no putative -35 sequence was found. Comparisons of the deduced amino acid sequence of iceAl from these strains revealed a particular cassette structure (Figures 5 and 7). In its shortest form {iceAlA), iceAl encodes a protein of only 24 aa, consisting of a 14 and a 10 aa peptide domain. More frequently, iceAl encodes a protein of 59 amino acids, which can be divided into the flanking domains of 14 and 10 aa, and 3 internal peptide domains of 13, 16, and 6 aa, respectively. There is partial identity (NGIHKRTY) between the 13 aa domain and the 10 aa domain (Figure 5 and 7). Two different forms {iceAlB and iceAlC) were found that are identical, except that they completely differed in the composition of the central 16 aa domain. In 3 isolates (AU1, AU2, and NL79), a 35 aa cassette (comprising the 13, 16, 6 aa domains) was repeated, resulting in a deduced protein of 94 amino acids {iceA2O). The repeated domains of 13 and 6 aa were identical: however, the two 16 aa domains were those observed in iceAlB and iceAlC, respectively. In a single strain from the Netherlands (NL22153), a PCR fragment of approximately 425 bp was produced by the z^'ce;42-specific primers IceA2F6 and IceA2R5. Sequence analysis showed that this particular strain contained an iceAl variant, designated as iceAlE, comprising three 35 aa motifs, resulting in a deduced protein of 129 aa. Of its three 16 aa domains, two were identical to those observed in iceAlB, whereas one was identical to the motif in iceA2C (Figure 1).

Thus, on the basis of these sequences, iceAl can be divided into 5 subtypes, designated as iceAlA (n=5), iceA2B (n=5), iceAlC (n=4), iceAlD (n=3) and iceAlE (n=19 based on its cassette structure) (Figure 7).

The intergenic sequence between the stop codon of iceAl and the start codon of hpylM has a consistent size of approximately 335 bps, except for TH8828, which has a single deletion of 72 bps. This region is partially conserved with >77% nucleotide sequence homology. A sequence matching the -10 consensus (TATA-box) was present, but no -35 consensus sequence was found upstream of the hpylM start codon. For each strain, the 8 bps immediately upstream of the hpylM start codon is completely different from the highly conserved 8 bps intergenic region in the iceAl strains.

Example 6. Development of novel specific PCR primers and probes for iceAl and iceAl.

Since sequence alignments showed the presence of highly conserved parts within both iceAl and in iceAl, PCR primers were deduced based on these sequences (Table 2) for use in type-specific PCR of iceAl and iceAl. Novel probes specific for either iceAl or iceAl alleles were also designed. A total of 321 H. pylori isolates from different geographic origins were tested. Overall, PCR products of the expected sizes were obtained from 318 (99.1%) of the 321 strains, and showed that both iceAl and iceA2 have a worldwide distribution. In the remaining 3 cases, no PCR products were obtained with either of the type-specific primer sets. Eighty-two (25.5%) samples yielded both iceAl and iceAl amplimers, suggesting the presence of multiple strains in the culture from which the DNA was obtained. An example of PCR products for iceAl and iceAl is shown in Figure 8.

The iceA 1 -specific PCR using primers iceAFS and iceAR4. consistently yielded a 246 bps fragment in 132 (55.9%) of the 236 strains, that contained a single iceA genotype. The iceAl- specific PCR, using primers iceAF6 and iceARS, yielded fragments from the other 104 (44.1%) of these cases. Amplimers of 124 bps, 229 bps, 334 bps, and 439 bps were obtained from 6 (5.8%), 45 (43.2%), 52 (50.0%), and 1 (1.0%) of the 104 iceAl strains, respectively. These conespond to the 4 different sizes of iceA2 types, containing either 0, 1, 2, or 3 copies of the 35 aa cassette.

^a Y = C or T, R = G or A, S = C or G. ^b Orientation in relation to transcription of the iceAl open reading frame. ^c Position in relation to iceAl sequence, as deposited in Genbank accession number U43917. No Genbank reference sequence is yet available for iceAl. ^d SIN = SEQ ID NO

To exclude the possibility that the differing amplimer sizes were caused by misprinting of reverse PCR primer iceA2R5 at an unexpected site within iceAl, PCR analysis was performed with different primer combinations, which confirmed the above results (data not shown). The 2 novel PCR amplifications (for iceAl and iceAl, respectively), allow amplification of iceA sequences from the great majority, ie over 99%, of isolates tested so far. These include isolates from multiple geographic origins, suggesting broad applicability of these primers.

Example 7. Genotyping of iceA locus of H. pylori by specific PCR

Direct testing of clinical samples for the presence of iceAl or iceAl often revealed the presence of both variants. Theoretically, this could be due to the presence of multiple H. pylori strains, each carrying a single iceA allele, or to the presence of a single H. pylori strain, containing both iceAl and iceAl.

To assess this issue further, we investigated 40 H. pylori cultures from the Netherlands and the USA, that initially showed the presence of both iceAl and iceAl. Each of these strains was cultured on plates and single colonies were transfened to fresh plates. This was repeated 3 times, thus purifying the strains to single colonies. Each of the purified strains was then tested for iceAl and iceAl again, and all of the strains now showed the presence of either iceAl or iceAl, but never both. This confirms that most, if not all, H. pylori strains contain a single iceA locus, and that iceAl and iceAl appear to be mutually exclusive.

Example 8. Testing of clinical relevance of the allelic variation of the iceA gene

PCR amplification reactions, specific for either iceAl or iceAl were applied to a panel of 51 Dutch patients, with known clinical status. The PCR was performed on DNA from gastric biopsies.

The results are summarized in table 3.

Table 3. Presence of iceAl or iceAl in a panel of 51 Dutch patients with known clinical status

Four isolates were positive for both iceAl and iceAl. Two of these contained also multiple vacA types, suggesting the presence of multiple strains. Six isolates did not yield any PCR product.

Of these, two were also negative for vac A, indicating the complete absence of H. pylori. Lack of sensitivity of the assay may explain why the four other samples remained negative. Among the 41 biopsies with a single iceA allelic tye, the conelation between the presence of iceAl and the occurrence of ulcers is statistically significant (P=±0.01).

iceAl /iceAl typing was also performed on a second panel of biopsies from 45 Dutch patients. The results are summarized in table 4.

Table 4. Presence of iceAl or iceAl in a panel of 45 Dutch patients with known clinical status

Eight isolates were positive for both iceAl and iceAl. Four of these strains contained also multiple vacA types, suggesting the presence of multiple strains. Two isolates did not yield any PCR product but were positive for vac A, indicating the presence of H. pylori. Lack of sensitivity of the assay may be the reason for these negatives. Among the 35 biopsies with a single iceA allelic type, the correlation between the presence of iceAl and ulcers is just not significant (P= ±0.07).

If both panels of patents are taken together, the correlation between the presence of iceAl and the occurrence of ulcers is highly significant (P= ±0.001). REFERENCES

Asseline U, Delarue M, Lancelot G, Toulme F, Thuong N (1984) Nucleic acid-binding molecules with high affinity and base sequence specificity : intercalating agents covalently linked to oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 81(11):3297-301.

Atherton J C Cao P, Peek R M, Tummuru, M K R, Blaser, M J and Cover T L. (1995) Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori: association of specific vacA types with cytotoxin production and peptic ulceration. J. Biol. Chem. 270: 17771-17777

Atherton, J C . (1997a) The clinical relevance of strain types of Helicobacter pylori. Gut 40: 701- 703.

Atherton J C, Peek, R M, Tham K T, Cover, T L and Blaser M J. (1997b) Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 112: 92-99

Bej A, Mahbuba i M, Miller R, Di Cesare J, Haff L, Atlas R. (1990) Multiplex PCR amplification and immobilized capture probes for detection of bacterial pathogens and indicators in water. Mol Cell Probes 4:353-365.

Blaser M J. (1997) Not all Helicobacter pylori strains are created equal: should all be eliminated? Lancet 34: 1020-1022.

Boom R., Sol C.J.A., Salimans M.M.M. (1990) Rapid and simple method for purification of nucleic acids. J Clin Microbiol 28: 495-503. Censini S, Lange C, Xiang, Z, Crabtree, J E, Ghiara, P, Borodovsky, M, Rappuoli, R and Covacci, A. (1996) Cag, a pathogenicity island of Helicobacter pylori, encodes type 1 -specific and disease-associated virulence factors. Proc. Natl. Acad. Sci. USA 93: 14648-14653.

Compton J. (1991) Nucleic acid sequence-based amplification. Nature 350: 91-92.

Duck P. (1990) Probe amplifier system based on chimeric cycling oligonucleotides. Biotechniques 9: 142-147.

Go M F, Kapur, V, Graham, D Y, Musser, J M. (1996) Population genetic analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic diversity and recombinant population structure. J. Bacteriology 178, 13: 3934-3938

Guatelli J, Whitfield K, Kwoh D, Barringer K, Richman D, Gengeras T. (1990) Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc Natl Acad Sci USA 87: 1874-1878.

liver, D., Arnqvist, A., Oegren, J., Frick, I.-M., Kersulyte, D., Incecik, E.T., Berg, D.E., Covacci, A., Engstrand, L. and Boren, T. (1998) Helicobacter pylori Adhesin binding fucosylated histo- blood group antigens revealed by retagging. Science 279: 373 -377 ^'.

Kwoh D, Davis G, Whitfield K, Chappelle H, Dimichele L, Gingeras T. (1989)Transcription- based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Proc Natl Acad Sci USA 86: 1173-1177.

Kwok S, Kellogg D, McKinney N, Spasic D, Goda L, Levenson C, Sinisky J. (1990) Effects of primer-template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies. Nucl. Acids Res. 18: 999. Landgren U. Kaiser R, Sanders J, Hood L. (1988) A ligase-mediated gene detection technique. Science 241 :1077-1080.

Logan R P H and Berg D E. (1996) Genetic diversity of Helicobacter pylori. Lancet 384: 1462- 1463

Lomeli H, Tyagi S, Pritchard C, Lisardi P. Kramer F. (1989) Quantitative assays based on the use of replicatable hybridization probes. Clin Chem 35: 1826-1831.

Marshall D G, Coleman D C, Sullivan. D J, Xia, H, O'Morain, C A and Smyth C J. (1996) Genomic fingerprinting of clinical isolates of Helicobacter pylori using short oligonucleotide probes containing repetitive sequences. J. Appl. Bact. 81: 509-517.

Matsukura M, Shinozuka K, Zon G, Mitsuya H, Reitz M, Cohen J, Broder S (1987) Phosphorothioate analogs of oligodeoxynucleotides : inhibitors of replication and cytopathic effects of human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 84(21):7706-10.

Miller P, Yano J, Yano E, Canoll C. Jayaram K, Ts'o P (1979) Nonionic nucleic acid analogues. Synthesis and characterization of dideoxyribonucleoside methylphosphonates. Biochemistry 18(23):5134-43.

Nielsen P, Egholm M, Berg R, Buchardt O (1991) Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science 254(5037): 1497-500.

Nielsen P, Egholm M. Berg R, Buchardt O (1993) Sequence specific inhibition of DNA restriction enzyme cleavage by PNA. Nucleic-Acids-Res. 21(2): 197-200. Peek R M, Thompson S A, Aherton J C, Blaser M J, Miller G G. (1996) Expression of a novel ulcer-related H. pylori gene, iceA, following adherence to gastric epithelial cells. Digestive Disease Week May 1996, abstract #2432.

Saiki R, Walsh P, Levenson C, Eiiich H. (1989) Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes Proc Natl Acad Sci USA 86:6230-6234.

Sambrook J, Fritsch E, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Stuyver L, Rossau R, Wyseur A, et al. (1993) Typing of hepatitis C virus isolates and characterization of new subtypes using a line probe assay. J. Gen. Virol. 74 : 1093-1102.

Tomb J. F., O. White, A. R. Keriavage, R. A. Clayton, G. G. Sutton, R. D. Fleischmann, K. A.

Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F.

Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K.

McKenney, L. M. Fitzegerald, N. Lee. M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne,

T. R. Utterback. J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Wattey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M.

Fraser, and J. C. Venter. (1997). The complete genome sequence of the gastric pathogen

Helicobacter pylori. Nature 388:539-47.

van der Ende A, Rauws EAJ, Feller M, Mulder CJJ, Tytgat GNJ, Dankert J. (1996) Heterogeneous Helicobacter pylori isolates from members of a family with' a history of peptic ulcer disease. Gastroenterology 111: 638-647.

Wu D, Wallace B. (1989) The ligation amplification reaction (LAR) - amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4:560-569. Xu Q., R. M. J. Peek, G. G. Miller, and M. J. Blaser (1997). The Helicobacter pylori genome is modified at CATG by the product of hpylM. J.Bacteriol. 179:6807-15.

Claims

1. Method for detection and/or typing of alleles of the iceA gene of H. pylori present in a biological sample, with said method comprising: i) amplifying polynucleic acids of the iceA gene by use of primers that permit specific amplification either of a fragment of iceA 1 variants or of a fragment of iceAl variants, and/or ii) hybridizing polynucleic acids of the iceA gene, possibly after amplification as in step i), with at least one probe that specifically hybridizes to either iceAl variants or to iceAl variants, with an iceAl variant being defined as an allele of the iceA locus having a sequence that is more homologous to the corresponding sequence of the HPICEA1F2 (Genbank U43917) than to the conesponding sequence of the HPICEA2MOD (USSN 08/650,528), and with an iceAl variant being defined as an allele of the iceA locus having a sequence that is more homologous to the corresponding sequence of the HPICEA2MOD than to the conesponding sequence of the HPICEA1F2.

2. Method according to claim 1, further characterized in that said primers and/or said probe specifically hybridize to target regions that are derived from the polynucleic acids that are shown in figure 2 or 6, whereby said target regions: a) are sufficiently conserved within the group of iceAl variants or within the group of iceAl variants, as can be deduced from the alignment of the sequences of said variants, to enable detection of all alleles within either group of variants; b) are sufficiently different between the two groups of variants, to enable differential detection of either iceAl variants or iceAl variants.

3. Method according to claim 2, further characterized in that said target regions are situated:

- between positions 97 and 124, or between 146 and 163, or between 177 and 219, or between

285 and 311, or between 328 and 364, or between 405 and 430, or between 433 and 480, or between 490 and 510, or between 516 and 539, or between 543 and 602, or between 642 and 678, or between 681 and 712, or between 776 and 795 of the sequence of the iceAl variant, and/or

- between positions 189 and 293 or between 410 and 447 of the sequence of the iceAl variant, with said positions being according to the numbering of HPICEA1F2 (as shown in figure 2) in the case of the iceAl variant and according to the numbering of HPICEA2MOD (as shown in figure 6) in the case of the iceA2 variant.

4. Method according to claim 3, further characterized in that:

- the target region of the forward primer used for specific amplification of a fragment of iceAl variants, is situated between position 177 and position 219 or between position 328 and position 347 of the sequence of the iceAl variant, and/or

- the target region of the reverse primer used for specific amplification of a fragment of iceAl variants, is situated between position 555 and position 580 or between position 775 and position 795 of the sequence of the iceAl variant, and/or

- the target region of the probe that specifically hybridizes to iceAl variants, is situated between position 516 and position 538 of the sequence of the iceAl variant, and/or

- the target region of the forward primer used for specific amplification of a fragment of iceAl variants, is situated between position 201 and position 231 of the sequence of the iceAl variant, and/or

- the target region of the reverse primer used for specific amplification of a fragment of iceAl variants, is situated between position 410 and position 435 of the sequence of the iceAl variant, and/or

- the target region of the probe that specifically hybridizes to iceAl variants, is situated between position 252 and position 278 of the sequence of the iceAl variant; with said positions being according the numbering of HPICEA1F2 (as shown in figure 2) in the case of the iceAl variant and according to the numbering of HPICEA2MOD (as shown in figure 6) in the case of the iceAl variant.

5. Method according to claim 4, further characterized in that:

- said foward primer for iceAl variants is IceAlF4 (SEQ ID NO 1) or IceAlF5 (SEQ ID NO 2), and/or,

- said reverse primer for iceAl variants is IceAIRS (SEQ ID NO 3) or IceAlR4 (SEQ ID NO 4), and/or,

- said probe for iceAl variants is IceAlpr (SEQ ID NO 5), and/or

- said forward primer for iceAl variants is IceA2F6 (SEQ ID NO 6), and/or

- said reverse primer for iceAl variants is IceA2R5 (SEQ ID NO 7), and/or

- said probe for iceAl variants is IceA2prl (SEQ ID NO 8).

6. A primer as defined in any of claims 1 to 5.

7. A probe as defined in any of claims 1 to 5.

8. A kit for detection and/or typing of alleles of the iceA gene of H. pylori present in a biological sample, comprising: i) at least one primer according to claim 6, and/or ii) at least one probe according to claim 7.

9. An isolated iceAl polynucleic acid sequence defined by SEQ ID NO 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 30, 53, 55, 57, 59 and 61, or any fragment thereof that can be used as a specific primer or as a specific probe in a method for the specific detection and/or typing of an iceAl allele.

10. An isolated /^'ceA2 polynucleic acid sequence defined by SEQ ID NO 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 65, 67, 69, 71, 73, 75, and 77, or any fragment thereof that can be used as a specific primer or as a specific probe in a method for the specific detection and/or typing of an iceA 2 allele.

11. An isolated IceAl protein sequence defined by SEQ ID NO 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 54, 56, 58, 60, 62, 63 or 64.

12. An isolated IceAl protein sequence characterized by resulting from translation of the iceAl nucleic acid sequences as shown in figure 2, with said translation using the same reading frame but a different start and/or stop codon.

13. An isolated IceAl protein sequence according to claim 11, in which said protein sequence has the same carboxy-terminus but a different amino-terminus.

14. An isolated fragment of an IceAl protein sequence according to any of the claims 11 to 13, characterized in that said fragment consists of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 contiguous amino acids of an IceAl protein, comprising at least one amino acid which is unique to said protein sequence it is derived from.

15. An isolated IceA2 protein sequence defined by SEQ ID NO 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 66, 68, 70, 72, 74, or 76.

16. An isolated IceA2 protein sequence characterized by resulting from translation of the iceAl nucleic acid sequences as shown in figure 6, with said translation using the same reading frame but a different start and/or stop codon.

17. An isolated IceA2 protein sequence according to claim 15, in which said protein sequence has the same carboxy-terminus but a different amino-terminus.

18. An isolated fragment of an IceA2 protein sequence according to any of the claims 15 to 17, characterized in that said fragment consists of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 contiguous amino acids of an IceA2 protein, comprising at least one amino acid which is unique to said protein sequence it is derived from.

19. An antigenic subfragment of an IceAl protein sequence or fragment thereof according to any of the claims 11 to 14, characterized in that said subfragment is recognized by antibodies specific for IceAl proteins,

20. An antigenic subfragment of an IceA2 protein sequence or fragment thereof according to any of the claims 15 to 18, characterized in that said subfragment is recognized by antibodies specific for IceA2 proteins.

21. An assay for the differential detection of antibodies specific for either IceAl or IceA2 proteins in a biological sample, comprising:

-contacting anti-IceAl and/or anti-IceA2 antibodies within a biological sample with a protein, or a fragment, or subfragment thereof according to any of the claims 11 to 20, and/or

-determining the binding of anti-IceAl and/or anti-IceA2 antibodies within a biological sample with a protein, or a fragment, or subfragment thereof according to any of the claims 11 to 20.

22. An antibody raised against an IceAl protein, or a fragment, or subfragment thereof according to any of the claims 11 to 14, or 19, further characterized in that said antibody reacts specifically with said IceAl protein.

23. An antibody raised against an IceA2 protein, or a fragment, or subfragment thereof according to any of the claims 15 to 18, or 20, further charaterized in that said antibody reacts specifically with said IceA2 protein.

24. A method to screen for molecules which modulate the binding between IceAl proteins according to any of the claims 11 to 14 or 19, and an anti-IceAl antibody according to any of the claims 22 or 23.

25. A method to produce a mlecule which modulates the binding between IceAl proteins according to any of the claims 11 to 14 or 19, and an anti-IceAl antibody according to any of the claims 22 or 23. .

26. A method for detection and/or typing of H.pylori strains comprising the steps of

-detection and/or typing alleles of the iceA gene of H.pylori according to any of the claims 1 to 5, and,

-detection and/or typing the vac A gene of H.pylori, and/or, -detection and/or typing the cagA gene of H.pylori, and/or -detection and/or typing the bab A gene of H.pylori.

27. A method to screen for molecules which modulate the binding between IceA2 proteins according to any of the claims 15 to 18 or 20, and an anti-IceA2 antibody according to any of the claims 22 or 23.

28. A method to produce a molecule which modulates the binding between an antibody and a protein as defined in claim 27.

29. A composition containing at least one primer, according to any of the claims 1 to 5, and at least one probe, according to any of the claims 1 to 5.