WO1999021891A1 - Invertebrate octopamine receptor - Google Patents

Abstract

The present invention provides a novel octopamine receptor comprised of an invertebrate receptor which binds octopamine and is coupled to adenylyl cyclase system. The invention also includes methods of using the octopamine receptor to screen for agonists, antagonists and pesticides. In this method the octopamine receptor is inserted into invertebrate or vertebrate cells, test compound is added and the activity of the octopamine receptor coupled to the adenylyl cyclase system or the internal Ca2+ system is measured. Also included is an expression system for production of the octopamine receptor.

Description

Invertebrate Octopamine Receptor

This invention was made with government support. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

1. Field of the Invention.

The present invention relates generally to the field of the molecular biology of invertebrate octopamine receptors and their genes. More specifically, the present invention relates to an octopamine receptor which, upon activation, activates the adenylyl cyclase system.

2. Description of the Related Art.

Although octopamine is a principal neuromediator in insects, its receptors have proven difficult to clone and thus, the molecular nature of its receptors has not been elucidated. Pharmacological profiles of octopamine receptors are rather well characterized in locust, classifying one neuronal and three non-neuronal receptor types with distinct ligand binding affinities and their effectors (Roeder, 1995) . One octopamine-sensitive receptor was cloned from Drosophila heads, however for this receptor, tyramine is two orders of magnitude more potent than octopamine in inhibiting adenylyl cyclase activity through the receptor. However, both octopamine and tyramine both show similar potencies to increase [Ca²⁺]_i. Thus, the receptor has been classified as a tyramine/octopamine receptor (Saudou et al , 1990, Robb et al, 1994) .

U.S. Patent No. 5,344,776 issued to Venter, et al . on September 6, 1994 and U.S. Patent No. 5,474,899 issued on December 12, 1995 to the same inventors, describe a DNA sequence and protein sequence for an invertebrate octopamine receptor. Octopamine is a major stimulator of adenylyl cyclase in insects. Octopamine activation of this receptor, however, does not activate the adenylyl cyclase system, indicating that this octopamine receptor is not coupled to the activation of adenylyl cyclase activity. Further, the Background Information of these patents provide a summary of the status of octopamine receptors that have been demonstrated in invertebrates using biochemical and pharmaceutical assays. There have been numerous reports on subtyping of octopamine receptors, though none of these reports have shown specific isolation of an insect octopamine receptor which is coupled to the activation of adenylyl cyclase.

Biochemical studies of fly head homogenates display high affinity octopamine binding sites distinct from that for tyramine (Dudai and Zvi , 1984) and adenylyl cyclase activation induced by octopamine (Uzzan and Dudai, 1982) . Recently, two octopamine receptors (Lym oa-*_ (Gerhardt et al, 1997a) and Lym oa₂ (Gerhardt et al , 1997b) were cloned from the pond snail Lymnaea . While Ly oa₂ is coupled to chloride channels in HEK cells, Lym oa_α, like OAMB, can stimulate both adenylyl cyclase and phospholipase C.

Studies of octopamine ' s functions are carried out primarily in invertebrates. Octopamine is a major neurotransmitter, neuromodulator and neurohormone , mediating diverse physiological processes in peripheral and central nervous system of invertebrates. Octopamine acts as a neurotransmitter for light production in firefly lantern, has excitatory modulatory functions in locust somatic and visceral muscles, and regulates carbohydrate and fatty acid metabolism (David and Coulon, 1985). The octopamine-less fruitfly females ( tbh) are sterile due to an egg retention phenotype, suggesting its modulatory role in oviductal muscle contraction

(Monastirioti et al , 1996). Octopamine is also involved in displaying submissive postures in lobsters

(Livingstone et al , 1980), escape behavior of crayfish

(Glanzman and Krasne, 1983) , and feeding behaviors of blowflies (Long et al , 1986) and honeybees (Braun and

Bicker, 1992) . In Drosophila, inactive mutants containing 15% wild-type levels of octopamine display hypoactivity

(O'Dell, 1993). Conversely, octopamine application to decapitated flies induces strong stimulation of locomotion and grooming behavior (Yellman et al , 1997) .

Moreover, crucial roles of octopamine are implicated in complex behaviors including conditioned courtship and olfactory learning (O'Dell, 1994; Dudai et al , 1987) . These observations altogether indicate octopamine ' s diverse functions in reflex, motivation, motor control and associative learning. Octopamine-containing neurons are widely spread out in optic lobes, antennal lobes, clusters of neurons in brain cortex, thoracic and abdominal ganglia of Drosophila (Monastirioti et al , 1995) . Biochemical studies using Drosophila head homogenates reveal high affinity octopamine binding sites (Dudai and Zvi , 1984) and strong potency of octopamine to stimulate adenylyl cyclase activities (Uzzan and Dudai, 1982) . However, the molecular nature of such receptors has yet to be identified.

About 10,000 species of insects eat crops grown on farms around the world. This is very costly. In addition to the damage caused to crops, insects cause substantial harm to livestock, wooden structures, and are a persistent household pest. The insect pests have produced a constant need for the discovery of new pesticides due to the inefficacy of some pesticides, the development of resistance by the insects, and the harmful effect upon the environment of some pesticides.

The identification and cloning of the adenylyl cyclase-coupled octopamine receptor from insects offers a tremendous opportunity to use the cloned receptor to screen for new pesticides. Agonists and/or antagonists to the receptor can be used to control insects and other pests through their neurotoxic effects. Although this is widely recognized in the agricultural industry and extensive efforts have been made to clone this important receptor, all previous attempts have failed. An octopamine receptor as an pesticide target has the additional advantage that octopamine is rarely used as a neurotransmitter in ertebrates, so that novel pesticides developed against this receptor would have a low probability of exhibiting toxicity to vertebrate species.

The present invention of a novel octopamine receptor named OAMB (octopamine receptor in mushroom bodies) provides a solution to these long-standing problems. This receptor is capable of stimulating cAMP and intracellular Ca²⁺ ( [Ca²⁺]i) accumulation upon octopamine application and is highly enriched in the mushroom bodies of Drosophila CNS . OAMB is the first receptor cloned from insects with high affinity to octopamine to activate cAMP signaling cascades. This receptor offers the missing component for establishing biological assay systems to identify agonists or antagonists of these receptors as potential pesticides. This receptor is easily expressed in existing expression systems and the resulting cells are utilized to screen for novel pesticides. SUMMARY OF THE INVENTION

An object of the present invention is an octopamine receptor which binds octopamine and activates the adenylyl cyclase enzyme. An additional object of the present invention is a nucleic acid sequence which encodes an octopamine receptor whose activity is coupled to adenylyl cyclase activity.

A further object of the present invention is a method for screening for agonists of the octopamine receptor.

An additional object of the present invention is a method for screening for antagonists for the octopamine receptor. A further object of the present invention is a method for screening for pesticides effective against invertebrate organisms.

An additional object of the present invention is the provision of an expression system for the octopamine receptor.

Thus, in accomplishing the foregoing objects there is provided in accordance with one aspect of the present invention a purified octopamine receptor comprising an invertebrate receptor having seven transmembrane domains, said receptor activated by octopamine and coupled to adenylyl cyclase.

In a specific embodiment the octopamine receptor is also coupled to the pathway that increases internal Ca²⁺ levels . In additional embodiments the invertebrate is an insect, an arachnid, or a mollusk. In specific embodiments the invertebrate is selected from pests, including, but not limited to, cockroaches, termites, ants, mosquitos, and moths, fireants, tobacco hornworms, rice planthoppers, weevils, grasshoppers, leafhoppers, aphids, two-spotted spider mite, ticks, spiders, and scorpions . A specific embodiment includes an octopamine receptor comprising the amino acid sequence of SEQ. ID. NO. 2 and fragments or derivatives thereof wherein said fragments or derivatives thereof bind octopamine and upon binding activate the adenylyl cyclase enzyme. Another specific embodiment includes a DNA sequence comprising the nucleic acid sequence of SEQ. ID. NO. 1 its anti-sense sequence and fragments or derivatives thereof, wherein said fragments or derivatives thereof encode for a peptide which binds octopamine and upon binding activates the adenylyl cyclase enzyme. Other embodiments may utilize a RNA sequence complementary to SEQ. ID. NO. 1 to any DNA sequence or fragment mentioned in the foregoing.

In addition a further embodiment includes a method of detecting whether a test compound has agonistic or antagonistic activity to an octopamine receptor comprising the steps of inserting a DNA sequence of the octopamine receptor into test cells in culture under conditions wherein said sequence expresses an octopamine receptor and said octopamine receptor localizes to the cell membranes of said test cell; adding the test compound to the cell culture or cell homogenates ; measuring the effect of the test compound on the activity of the octopamine receptor; and determining whether a compound is an agonist or antagonist of octopamine by comparing the effect of test compound with the effect of octopamine .

In specific embodiments of the method the test cells are selected from the group inclduing, but not limited to, mammalian cells, insect cells, bacteria and yeast and the measuring step includes a procedure selected from a number of assays known in the art, including, but not limited to, a displacement assay for measuring the level of octopamine binding to the octopamine receptor, measurement of internal cAMP levels, monitoring the change in internal cellular calcium level, measuring the growth of the cells and monitoring the expression of a reporter gene linked to a cAMP responsive promotor. One specific embodiment includes a method of detecting whether a test compound has agonistic or antagonistic activity to a octopamine receptor comprising the steps of inserting a DNA sequence of the octopamine receptor into yeast cells under conditions where said sequence is expressed in the yeast cells and wherein said yeast cells exhibit a temperature sensitivity to cAMP levels; adding the test compound to the yeast cells; and measuring the growth of the yeast cells to determine agonistic or antagonistic activity. A further embodiment includes a method for screening test compounds for use as an pesticide comprising the steps of inserting a DNA sequence of into test cells in culture under conditions wherein said sequence expresses an octopamine receptor; adding the test compound to the cell culture; measuring the effect of the test compound on the activity of the octopamine receptor; and determining to what extent the test compound inhibits or increases the activity of the octopamine receptor by comparing the effect of the test compound with the effect of octopamine.

In specific embodiments for testing for pesticide, the octopamine receptor localizes to the cell membranes of the test cells. An additional embodiment of the present invention includes an expression system comprised of the DNA sequence of an octopamine receptor inserted into cells in culture under conditions wherein the sequence is expressed by the cells in culture. In specific embodiments, the cells are selected from the group consisting of invertebrate cells, vertebrate cells, yeast and bacteria.

Other and further objects, features, and advantages will be apparent from the following description of the presently preferred embodiments of the invention, which are given for the purpose of disclosure, when taken in conjunction with the accompanying drawings.

DESCRIPTION OF THE DRAWINGS

Figure 1 shows PCR and SSCP analysis. PCR products were generated from fly head cDNA (H) , body cDNA (B) or genomic DNA (G) and resolved on 4% non-denaturing gels. The cDNAs for the tyramine/octopamine receptor (TYR) and three different serotonin receptors (DROl, DR02A and DR02B) were used for counter-screening . The arrowheads mark some of unique PCR products identified with head cDNA.

Figure 2 shows the deduced amino acid sequence of OAMB. The seven putative transmembranes are indicated by overlining and roman numerals. The putative N-linked glycosylation sites (circles) , protein kinase A phosphorylation sites (asterisks) , protein kinase C phosphorylation sites (triangles) , and calcium/calmodulin dependent protein kinase II phosphorylation sites (squares) are shown. The serine (S) (diamond) is a putative phosphorylation site for all of the above kinases . The aspartic acid residue (D) in transmembrane domain III and two serine residues (S) in transmembrane domain IV are for octopamine binding and are indicated in bold type.

Figure 3 shows the alignment of OAMB with other biogenic amine receptors. The deduced amino acid sequence of OAMB is aligned with the barnacle G protein-coupled receptor (GPR-BAR) , the Drosophila tyramine receptor (TYRR-DRO) , the human αl adrenergic receptor (A1AB-HUM) , the 2 adrenergic receptor (A2AA-HUM) , the βl adrenergic receptor (B1AR-HUM) , and the Drosophila dopamine DAMB receptor (DAMB-DRO) . The predicted transmembrane domains (I to VII) are overlined. Numbers in parentheses correspond to the number of amino acids at the amino- and the carboxy- termini and in the second and the third cytoplasmic loops, that are not represented in the figure. The amino acids conserved in all receptors being compared are shaded.

Figures 4A, 4B and 4C show agonist activity to octopamine modulation of cAMP and [Ca²⁺]_i levels in Drosophila S2 cells and human HEK cells. Agonists were applied to a level of 10 μM. Figure 4A shows agonist- induced elevation in cAMP levels in transiently transfected HEK cells. Figure 4B shows dose-response curves for agonist-induced elevation in cAMP levels in stably transfected S2 cells. All data points are the means of duplicate samples and have been normalized to the response with octopamine at 10^~3 M and fitted by least -squares method. The mean calculated EC₅₀ value for octopamine is 0.19 ± 0.05 μM. Figure 4C shows agonist-induced elevation of [Ca²⁺] _± in untransfected (bottom panels) and transiently transfected (top panels) HEK-OAMB cells loaded with fura2-AM. Agonists were applied at a level of 10 μM. Increase in [Ca²⁺] _± is represented by the measured fluorescence ratio (340/380 nm) .

Figures 5A and 5B show RNA blotting of OAMB. Ten μg of poly(A⁺) RNAs from heads (H) or bodies (B) were resolved by gel electrophoresis, transferred to a nylon membrane and hybridized with a ³²P-labeled OAMB cDNA clone

(Figure 5A) or a ribosomal protein rp49 cDNA clone

(Figure 5B) as a loading control. Molecular weight markers (Kb) are indicated. Figures 6A, 6B, 6C, 6D, 6E, 6F, 6G and 6H show expression of OAMB in the brain using: (i) in si tu hybridization: Figure 6A is a frontal section at the posterior brain. Figure 6B is a frontal section at the anterior brain. Figure 6C is a frontal section at the level of calyces. Figure 6D is a frontal section at the level of calyces. Figures 6A, 6B and 6C were hybridized with an antisense OAMB probe and Figure 6D with a sense OAMB probe; or (ii) immunohistochemistry : Figure 6E is a frontal section at the level of calyces. Figure 6F is a frontal section at the level of the lobes. Figure 6G is a horizontal section; c=calyces, p=pedunculus . Figure 6H is a sagittal section. The head sections were incubated with anti -OAMB antibody. Sections incubated with preimmune serum produced no detectable staining in the cortex. For all frontal sections dorsal is up. Anterior is up in a horizontal section and to the right in sagittal sections. Magnification, 200x Figures 6D and 6F, 400x Figures 6A, 6B, 6C, 6E, 6G and 6H.

Figure 7 shows a model for the cAMP cascade triggered by OAMB during olfactory conditioning.

Drawings are not necessary to scale. Certain features of the invention may be exaggerated in scale or shown in schematic form in the interest of clarity and conciseness . DETAILED DESCRIPTION OF THE INVENTION

It will be readily apparent to one skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.

The term "agonist" as used herein refers to a compound with interacts with the OAMB receptor and increases the activity of the receptor. This could include increased expression of adenylyl cyclase enzyme that leads to increased cAMP or increase in the [Ca²⁺] i level .

The term "antagonist" as used herein refers to a compound which interacts with or binds to the OAMB receptor and blocks the activity of the receptor or an agonist of the receptor.

The term "mutant" as used herein refers to an alteration of the primary sequence of the OAMB receptor thus that it differs from the wild type or naturally occurring sequence. In the nucleic acid sequence, mutant can be any change in the sequence, for example changed base, deletion, addition which results in an altered protein. In the amino acid sequence, the mutant is a peptide or protein whose sequence is altered from the native sequence. The term "expression system" as used herein refers to a vector, plasmid or cell that contains all the information necessary to produce a protein from the OAMB gene sequence .

The term "transfection/transfected" as used herein describes the process of directly introducing the DNA into cells including vertebrate cells, invertebrate cells, and yeast. This includes introducing DNA by typically transfection of insect cells and mammalian cells, but can include any eukaryotic cells.

The term "coupled" as used herein refers to the process whereby when the octopamine receptor is activated or deactivated it will cause the coupled enzyme system to also become activated or deactivated. For example, binding octopamine to the receptor activates the receptor which in turn activates the adenylyl cyclase enzyme which leads to increased cAMP . Similarly, the internal Ca²⁺ levels are coupled to the octopamine receptor.

As used herein, the term "transform/transformation" refers to the result of introducing DNA into a cell where the presence of the DNA genotypically and phenotypically alters a cell in a heritable manner. The term "OAMB" refers to the octopamine receptor in the present invention. Said receptor from Drosophila binds octopamine and activates adenylyl cyclase and the system responsible for internal Ca²⁺ levels.

The term "fragments or derivatives" as used herein refers to mutant sequences, degenerate sequences, fragments of the sequences or derivatives of the native sequence. In the present invention, the nucleic acid sequence will encode a peptide or protein and the peptide or protein sequence which is mutant, degenerate, fragment or derivative sequence will bind to octopamine and will function in a coupled fashion to either activate the adenylyl cyclase enzyme system or the enzyme system that increases the internal Ca²⁺ concentration in cells. One skilled in the art readily recognizes how to make fragments, derivatives, mutants and degenerate sequences. These are standard procedures in the art of molecular biology and protein chemistry. In addition, the skilled artisan following the procedures described herein and known in the art can easily and accurately screen for the appropriate coupling activity described herein.

The term "reporter" refers to the insertion of a nucleotide sequence downstream from a promoter such that when the promoter is activated the nucleotide sequence is produced in the cell . To be an effective reporter the nucleotide sequence must produce a peptide, protein or other change which can be monitored. For example it could produce a protein which causes the cells to fluorescence, cause the cells to change color or can be linked to some type of enzyme or antibody reaction in order to detect the presence of the reporter. A skilled artisan readily recognizes that a variety of reporter genes are available for use in the present invention. The term "[Ca²⁺]₁" as used herein refers to the internal calcium ion concentration in cells.

One specific embodiment of the present invention is a purified or isolated octopamine receptor comprising an invertebrate receptor having seven transmembrane domains, said receptor activated by octopamine and coupled to adenylyl cyclase. This octopamine receptor can be further coupled to the pathway that increases or regulates internal Ca²⁺ levels.

In certain embodiments, the invertebrate is an insect, or an arachnid. Specific insects and arachnids which are useful sources for octopamine receptor include, but are not limited to, cockroaches, termites, ants, mosquitos, moths, fireants, locust, tobacco hornworms, rice planthoppers, weevils, grasshoppers, leafhoppers, aphids, two- spotted spider mites, ticks, spiders, and scorpions. The weevils can be of a variety of types but they also include weevils for rice, grain and beans. The leafhoppers can be of a variety of types and include leafhoppers for potatoes and rice. The aphids can be of a variety of types including those for wheat, citrus and ornamental plants.

In certain embodiments, the invertebrate is a helmet, mollusk, or other non- insect invertebrate organism.

In a specific embodiment of the present invention, the octopamine receptor comprises the amino acid sequence of SEQ. ID. NO. 2 and fragments or derivatives thereof wherein the fragments or derivatives thereof bind octopamine and are coupled to the adenylyl cyclase enzyme system.

Another specific embodiment is a DNA sequence comprising the nucleic acid sequence of SEQ. ID. NO. 1 and fragments or derivatives thereof wherein said fragments or derivatives thereof encode a peptide or protein which binds octopamine and is coupled to the adenylyl cyclase enzyme system. As used herein, the DNA sequence of SEQ. ID. NO. 1 includes both the sequence in the sequence listing as well as an anti-sense sequence, or corresponding RNA sequences.

An additional embodiment of the present invention is a method of detecting whether a test compound has agonistic or antagonistic activity to an invertebrate octopamine receptor. This method comprises the steps of inserting the octopamine receptor sequence into test cells in culture under conditions where such sequence expresses an octopamine receptor and the octopamine receptor localizes to the cell membranes of the test cell . Then adding the test compound to the cell culture or cell homogenates and measuring the effect of the test compound upon the activity of the octopamine receptor. To determine whether the compound is an agonist or an antagonist for octopamine the effect of the test is compared to compound with the effect of octopamine. In specific embodiments of the present invention, the method includes test cells selected from the group including, but not limited to, mammalian cells, insect cells, bacteria, yeast or other eukaryotic cells. One skilled in the art readily recognizes there are a variety of ways of measuring the test compound activity. This can include a displacement assay which measures the level of octopamine binding to the octopamine receptor. In this assay the competitive binding to the receptor of the test compound versus octopamine is measured. One skilled in the art recognizes that octopamine or its derivates can be used in such assays . Another way of measuring the effect of the compound is to measure the internal cAMP levels. Since this receptor is coupled to the adenylyl cyclase system inhibition of or increased activity of the receptor will result in changes in the cAMP levels. One skilled in the art also readily recognizes that the effect of the test compounds can be determined by measuring the [Ca²⁺] i level, since this receptor is coupled to the enzyme system responsible for modulating internal calcium levels. Thus by measuring internal calcium levels one can determine whether the compound has agonist or antagonist activity to the receptor. An additional way of determining agonist and antagonist activity is measuring the growth of the cells. In certain cells, for example yeast which are sensitive to the levels of cAMP, agonist or antagonist activity can increase or decrease the cAMP and thus affect the growth rates for the cells. One skilled in the art will also recognize that a reporter gene can be inserted downstream from a promoter to a gene which is directly or indirectly coupled to the octopamine receptor, for example reporter gene linked to the cAMP responsive promoter. Thus when the octopamine receptor responds or fails to respond one can measure the product from the reporter gene. Indirect coupling would be a promoter which is activated or inhibited by cAMP levels . In a specific embodiment the method of detecting whether a test compound has agonistic or antagonistic activity to an octopamine receptor can include the insertion of the sequence into yeast cells under conditions where such sequence is expressed in the yeast cells wherein said yeast cells exhibit a sensitivity to cAMP levels. The test compound is then added to the yeast cells and the growth rate of the yeast cells is measured to determine whether agnostic or antagonistic activity is present. It is also known that this test system can be used to screen for compounds to use as pesticides. In this procedure, the octopamine receptor is inserted into the test cells in culture under conditions wherein the sequence expresses an octopamine receptor. The compound to be tested for pesticide activity is added to the cell culture or cell homogenates and the effect of said compound on the activity of octopamine receptor is measured. One can determine the extent that the test compound inhibits or increases the activity of the octopamine receptor by comparing the effect of the test compound with the effect of octopamine. Those compounds which show alterations in the activity of the receptor can then be screened for further pesticide activity. In a specific embodiment of the pesticide screening method, the octopamine receptor localizes to the cell membranes of the test cell thus facilitating the ease at which the test compound can interact with the receptor. As in the tests for agonists and antagonists described above, similar or the same detecting procedure can be use. In other specific embodiments, the test system can be used to screen for potential drug candidates to treat medical conditions cause by invertebrates, including, but not limited to a wide range of parasitic infections. Another embodiment of the present invention is the expression system comprised of the octopamine sequence inserted into cells in culture under conditions wherein the sequence is expressed by the cells. The expression system can consist of cells selected from invertebrate cells, vertebrate cells, yeast and bacteria.

In specific embodiments, the cells are either HEK mammalian cells, Drosophila cells or yeast cells.

Another embodiment utilizes a method of detecting whether a test compound has agonistic or antagonistic activity to an octopamine receptor comprising the steps of: contacting the receptor, fragment or derivative of claim 8 with a test compound; adding octopamine; measuring the effect of the test compound on the binding of octopamine to the octopamine receptor; and determining whether said test compound exhibits agonistic or antagonistic effects on octopamine binding. The effect can be measured by any of a number of binding assay techniques that are known in the art, including competitive binding assays. In one embodiment, the effect is measured in the presence of an adenylyl cyclase enzyme and substrate .

Example 1 PCR and SSCP analysis

The primers used for PCR were 5 ' T T C G T C A T C T G C T G G C G C C C T T C T T C 3 ' and

5'TGGCTGGGCTACATCAACTCG3 These correspond to sequences in transmembrane domains VI and VII, of the Drosophila tyramine receptor (Saudou et al , 1990) . Using procedures known in the art, total RNA from heads or bodies was isolated from CsCl gradients and served as template to make cDNAs . (Davis and Davidson, 1986; and Han and Kulesz-Martin, 1992) . The genomic DNA was prepared from Canton-S flies (Davis and Davidson, 1986) . The cDNA clones corresponding to TYR, DR01 , DR02A and DR02B were kindly provided by Dr. R. Hen (Columbia University, School of Medicine) . PCRs were performed in the presence of 0.2 mM dNTPs, 0.5 μM of sense and antisense primers, 0.25 U/μl Taq polymerase (Boehringer) , 10 mM Tris-HCl (pH 8.3), 50 mM KC1 and 1.5 mM MgCl₂ and 100 ng of genomic DNA or cDNA. The reaction was carried out for 35 cycles with denaturation at 94° for 30 sec, annealing at 55° for 1 min. and extension at 72° for 2 min. Five μCi ³²P-dCTP was added to PCR solution for SSCP analysis (Orita et al . , 1989) . For SSCP analysis, the PCR products were diluted 10 fold in 0.1% SDS and 10 mM EDTA, denatured at 95° for 5 min. after adding equal volume of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol) , and resolved on 4% non-denaturing acrylamide. gels. PCR products made from head cDNA were cloned into pBluescript SK (Stratagene) and transformed into the E. coli XLl-Blue strain (Sambrook et al, 1989) .

Example 2 Isolation of OAMB cDNA clone and RNA blotting

A cDNA library made from Canton-S head poly(A⁺) RNA was screened using a ³²P-labeled 3.5 Kb genomic DNA fragment that hybridized to the OAMB PCR clone (Davis and

Davidson, 1986) . The OAMB cDNA was subcloned and both strands were sequenced using the Sequenase kit (USB) after timed exonuclease III reactions to generate nested deletions (Sambrook et al , 1989) .

Poly(A⁺) RNA was isolated from total RNA obtained from heads or bodies by oligo-dT (Pharmacia) column chromatography. Ten μg of poly (A⁺) RNA was resolved on 1% formaldehyde agarose gels, transferred to nylon membrane (Bio-Rad) and hybridized with ³²P-labeled full-length OAMB cDNA clone or rp49 cDNA clone (O'Connell and Rosbash, 1984) as described (Davis and Davidson, 1986) .

Example 3 Pharmacology

A 2461 bp fragment (nt 919-3380) of OAMB cDNA containing the ORF was subcloned into the Drosophila expression vector pRmHa3 (Bunch et al , 1988) and transfected into the Drosophila S2 cell line (Millar et al , 1994) . The same OAMB cDNA fragment was also subcloned into the mammalian expression vector pcDNAl/Amp (Invitrogen) and transfected into Human HEK 293 cells (Chen and Okayama, 1987) . Stably transfected S2-OAMB cells and transiently transfected HEK-OAMB cells were assayed for agonist-induced changes in cAMP levels using a cAMP [³H] assay system (Amersham) (Han et al , 1996) . The changes in [Ca²⁺] _λ were measured in the HEK-OAMB cells loaded with 4 μM fura2-AM (Molecular Probes) after ligand treatment using a Perkin-Elmer LS50B fluorescence spectrometer (Cooper and Millar, 1997) .

Example 4 In si tu hybridization A clone containing the 5' half of the OAMB cDNA (nt

1-1614) was utilized to make antisense and sense RNA probes in the presence of digoxigenin-UTP (Boehringer) with either T7 or T3 RNA polymerase according to the manufacturer's instruction (Promega) . Ten μm frontal sections of Canton-S flies fixed in 4% paraformaldehyde in PBS were hybridized with riboprobes and processed for the immunological detection of hybridized transcripts (Han et al . , 1996) .

Example 5 Immunohistochemistry

A 542 bp fragment (nt 1916-2458) of the OAMB cDNA coding for the third cytoplasmic loop was subcloned in pGEX-KT to generate a fusion protein in XLl-Blue cells. The cloning site was sequenced to confirm the in- frame insertion with glutathione-S-transferase . The fusion protein was injected intradermally into a SPF rabbit (Harlow and Lane, 1988) . After the third boost, the antiserum was collected and the anti-OAMB antibody was affinity-purified (Tejedor, et al , 1995) using the fusion protein. Canton-S flies were fixed in 2% paraformaldehyde in

PBS containing 40 mM lysine for 3 hr. and soaked in 25% sucrose solution in PBS overnight at 4° C. Ten μm cryosections were incubated with the affinity-purified anti-OAMB antibody or the preimmune serum, followed by biotinylated goat anti-rabbit IgG antibody (Han et al . , 1996) . Horse radish peroxidase-conjugated biotin-avidin complex (Vector) was applied according to manufacturer's instructions and the immunoreactivity was visualized after staining with 1 mg/ml diaminobenzidine and 0.03% hydrogen peroxide. Example 6 Isolation of novel biogenic amine receptors

New Biogenic amine receptors were identified by reverse transcription-polymerase chain reaction (PCR) experiments with fly head RNA and the primers made from conserved amino acids in transmembrane domains VI and VII of a Drosophila tyramine/octopamine receptor (Arakawa et al . , 1990; Saudou et al . 1990). Because known biogenic amine receptors are relatively uniform in length between transmembrane domains VI and VII, the differential amplification of receptor subsets due to heterogeneity in length between the PCR primers is minimized. This, however, can make distinguishing novel PCR products from known products on the basis of size on nondenaturing gels problematic. To circumvent these problems, single-strand conformation polymorphism (SSCP; Orita et al . , 1989) was used to screen the PCR products. In this procedure, the PCR products were denatured to generate single strands and then subjected to nondenaturing gel electrophoresis. Denatured single-stranded DNA species form folded structures based upon primary sequence, thus, the procedure resolves DNA fragments by length and secondary structure .

The resolution and sensitivity of SSCP was shown using PCR products made from head and body cDNAs as well as genomic DNA (Figure 1) . Independent PCR reactions using the same templates were loaded on the gel to eliminate PCR artifacts and to align the bands in the various lanes . About a dozen strongly labeled bands were observed using head cDNA as a template (Figure 1) . The spectrum of bands observed with body cDNA, however, was quite different. Thus, the predominant receptor types found in the body are generally non-overlapping with the predominant receptors found in the head.

The PCR products from genomic DNA would be expected to be the sum of those produced from head and body cDNA. Although this was observed, the bands representing body receptor products from genomic DNA were very weak and most major products were identical to those using head cDNA as a template. The primers used for PCR were not degenerate, but represented the sequences of the tyramine receptor. Since receptor RNAs with the highest sequence identity would be amplified preferentially, this indicates that head cDNA contains receptor sequences more similar to the primers used than does the body.

The cDNA clones representing four known biogenic amine receptors identified from Drosophila were also used in the analysis. These include one tyramine receptor (TYR; Saudou et al . 1990) and three serotonin receptors (DR01, DR02A, DR02B; Witz et al . , 1990; Saudou et al . , 1992) . These known receptors produced PCR products that co-migrated with about two-thirds of the major PCR products using head cDNA as a template (Figure 1) . This indicated that several unidentified receptor RNAs exist in the head RNA population with high sequence similarity with the primers. To identify these RNAs and others that might not be resolved in the gel, the complete population of PCR products made from head cDNA was cloned and screened by SSCP for unique mobilities against the four known receptors. Isolation of corresponding cDNAs and sequencing identified the novel receptor genes.

Example 7

OAMB sequence predicts a biogenic amine receptor

The 114 bp clone of OAMB obtained by PCR was used to screen a genomic DNA library. A 3.5 Kb phage DNA fragment positive to the OAMB PCR clone was in turn used to screen a head cDNA library. A subsequently identified cDNA clone (OAMB) of 3387 bp contained a methionine followed by a long open reading frame (ORF) predicting a protein of 637 amino acids (Figure 2) . Hydropathy profiles revealed seven hydrophobic domains with striking similarity to the transmembrane domains of G protein-coupled receptors. An aspartic acid residue was found in transmembrane domain III and two serine residues in transmembrane domain V (Figure 2) . The skilled artisan recognizes that these residues comprise part of the binding site for biogenic amines of other receptors indicating that OAMB belongs to the biogenic amine receptor superfamily. This receptor clone also contained two consensus sites for N-linked glycosylation (N-X-S/T) in the extracellular amino-terminal and second extracellular domain, ten consensus phosphorylation sequences for protein kinase C (R/K—S/T-X-R/K) in the cytoplasmic loops, and two consensus sequences for protein kinase A (K/R-R-X-T/S) in the third cytoplasmic loop. Five consensus sequences for phosphorylation by calcium/calmodulin dependent protein kinase II (R-X-Y-S/T) were also found in all of cytoplasmic domains except the carboxy-terminus . A unique feature of OAMB is its long second extracellular loop (130 amino acids) between transmembrane domains IV and V. This is incumbent to most known biogenic amine receptors containing a relatively short stretch ranging 10 to 30 amino acids .

Comparison of the predicted amino acid sequence of OAMB with protein data banks revealed the highest sequence identity (39%) with the barnacle G protein- coupled receptor (GPR) with unknown ligand specificity. Other biogenic amine receptors displayed similar overall identity (25-30%) with OAMB, confined primarily to the seven transmembrane domains. When only transmembrane domains were compared (Figure 3) , the degree of sequence identity increased to 72% for the barnacle GPR, 52-55% for the human αl adrenergic receptors (Ramarao et al , 1992), the Drosophila tyramine

(Saudou et al . 1990) and the dopamine DAMB receptor (Han et al, 1996), and 45-50% for human 2 and β adrenergic receptors (Fraser et al , 1989; Frielle et al , 1987) .

Phylogenetic analysis revealed that OAMB is evolutionally divergent from other Drosophila biogenic amine receptors and mammalian adrenergic receptors. The failure to find a high identity to any one receptor subfamily indicates that OAMB represents the prototypic member of a new receptor subfamily.

Example 8

Preparation of Antibody to OAMB

A 542 bp fragment (nt 1916-2458) of the OAMB cDNA coding for the third cytoplasmic loop was subcloned in pGEX-KT to generate a fusion protein in E.coli XLl-Blue cells. The fusion protein was injected intradermally into a SPF rabbit 4 times every 5 weeks. Two weeks after the fourth injection, the serum was collected and tested by western blot analysis using the OAMB receptor fragment. The serum specifically recognized the OAMB receptor fragment after 1:1000 dilution, while the preimmune serum from the same animal gave no immunoreactivity to the OAMB receptor. This indicates that the anti-OAMB antibody was present in the serum at a high titer. This antibody also specifically recognized the OAMB receptor expressed in Drosophila heads. Example 9 Octopamine induced cAMP accumulation through OAMB

1. HEK cells.

To investigate the functional properties of OAMB, a fragment containing the ORF was cloned into the mammalian expression vector pcDNAl/amp or Drosophila vector pRmHa3. Human embryonic kidney (HEK) 293 cells transiently transfected with OAMB responded to 10 μM of octopamine with a significant increase in cAMP, while dopamine, histamine and 5-HT did not produce any significant cAMP accumulation (Figure 4A) . Untransfected HEK cells also failed to respond to any of the ligands tested (Figure 4A) . The effects of norepinephrine and epinephrine could not be resolved since non-transfected HEK cells also produced significant cAMP accumulation.

2. Drosophila S2 cells.

The effects of the neuromodulators in Drosophila S2 cells were examined. Drosophila S2 cells were stably transfected with the OAMB cDNA construct. The cells were assayed for intracellular cAMP accumulation in the presence of various neuromodulators. No significant changes in cAMP levels were detected in either transfected (S2-OAMB) or untransfected S2 cells treated with serotonin (5-HT) , dopamine, or histamine up to 10 μM. In contrast, octopamine at 10 μM stimulated cAMP accumulation approximately 10 fold in transfected cells and showed no significant effect in the untransfected cells at the same concentration (Figure 4B) . The o c t op ami ne - i nduc e d cAMP increase was concentration-dependent and was saturable, with an EC₅₀ of

1.9 +/- 0.5 x 10^"7 M (Figure 4B) . Tyramine and norepinephrine also produced smaller but significant elevations of cAMP in transfected cells (Figures 4B) but not in untransfected cells. However, they were about 100 fold less potent than octopamine and generated about 70-80% of the maximal response to octopamine. Together, these results indicate that OAMB represents a functional octopamine receptor, which is positively coupled with adenylyl cyclase in both human HEK and Drosophila S2 cells to stimulate cAMP production.

3. Internal Ca²⁺ ([Ca²⁺]₁) measurement. OAMB ' s ability to alter [Ca²⁺] _x was measured in HEK cells expressing OAMB. After loading cells with the Ca²⁺ sensitive dye fura2-AM, a clear increase in [C Zi was observed in response to octopamine or tyramine at 10^~5 M but not to dopamine (Figure 4C) . There was no response in non-transfected cells, indicating that the increase in [Ca²⁺]_x is mediated by OAMB. Thus, activation of the octopamine receptor, OAMB, stimulates accumulations of cAMP and Ca²Z

The novel OAMB receptor of the present invention stimulates adenylyl cyclase with higher efficacy to octopamine than tyramine in both mammalian and insect cell lines. Furthermore, OAMB also exhibited the ability to increase [CA²⁺] in response to octopamine.

Example 10 Screening for agonists, antagonists and pesticides

Since activated OAMB triggers cAMP accumulation through adenylyl cyclase or intracellular Ca²⁺ through phospholipase C, it can be used to test for potential agonists, antagonists and pesticide activity. In this testing system, the OAMB gene sequence can be inserted into either invertebrate, or vertebrate cells. Useful vertebrate cells include human embryonic kidney cells, COS cells, NIH 3T3 cells, and CHO cells. Useful invertebrate cells include Drosophila S2 cells and Spodoptea SF9 cells with baculovirus vectors. In addition, yeast cells can be used. Two specific examples of this can be seen by inserting the OAMB gene into HEK cells as described in Example 9 or Drosophila S2 cells as described in Example 9. In this example, the procedures of Example 9 are followed and test compounds that are potential candidates for agonists, antagonists or pesticide activity rather than octopamine are then applied to the cell cultures. In the case of HEK cells the cAMP levels are measured. In the case of the Drosophila S2 cells, the cAMP level is also measured. In addition, the OAMB has been inserted into the HEK cells and a Ca²⁺-sensitive dye is added to the cell. As the agonist and antagonist and potential pesticide are added, interaction with the receptor causes a change in the color or fluorescence of the cells.

Example 11

The OAMB receptor is preferentially expressed in mushroom bodies

To examine the tissue distribution of OAMB, RNA blots of head and body fractions were probed with the OAMB cDNA clone. Two mRNA species of 4.2 and 3.5 Kb were detected in the head fraction, but not in the body fraction (Figure 5) , indicating that the OAMB RNA was highly enriched in fly heads. Example 12 In si tu hybridization of OAMB

In si tu hybridization was performed to determine the cell types that express OAMB RNA. A series of frontal head sections was hybridized with digoxigenin- labeled riboprobes representing the 5' half of the OAMB cDNA (Figures 6A thru 6D) . The OAMB transcripts, detected with antisense (Figures 6A-6C) but not sense (Figure 6D) RNA probes, were present preferentially in the perikarya of mushroom bodies situated in the dorsal and posterior brain cortex (Figure 6A) . However, the OAMB expression in the mushroom body neurons was not uniform (Figure 6C) . Similarly, the clusters of cells located at the anterior brain cortex near mushroom body lobes stained for OAMB transcripts (Figure 6B) . The low signal relative to that in mushroom bodies was also observed in cells scattered in central brain and medulla of optic lobes (Figure 6A) . However, no significant signal was detectable in other tissues including muscles and fat cells. To determine the distribution of OAMB within mushroom bodies and other brain structures, a polyclonal antibody was generated against the third cytoplasmic loop of the receptor, affinity-purified and used to stain head sections . Canton-S flies are fixed in 2% paraformaldehyde in

PBS containing 40 mM lysine for 3 hours and soaked in 25% sucrose solution in PBS overnight at 4°C. Ten μm cryosections were incubated with the affinity-purified anti-OAMB antibody or the preimmune serum, followed by biotinylated goat anti-rabbit IgG antibody (Han et al . , 1996) . Horse radish peroxidase-conjugated immuno- reactivity was visualized after staining with 1 mg/ml diaminobenzidine and 0.03% hydrogen peroxide. The results from serial frontal, horizontal and sagittal sections revealed strong immunoreactivity in the neuropils that house the mushroom body dendrites

(calyces, Figures 6E-6H) , and axons (pedunculi, Figures 6G and 6H) and axon terminals ( , β and y lobes, Figures

6F-6H) . Distinct immunoreactivity was also detected in ellipsoid body of central complex (Figure 6G) . No immunoreactivity was observed in other regions of heads and bodies above the background staining obtained with the preimmune serum, even under various fixation and staining conditions. Thus, the octopamine receptor, OAMB, is highly enriched in the mushroom body and ellipsoid body neuropils.

Example 13 Isolation of Octopamine Receptor from Insects and Arachnids

The Drosophila OAMB clone is used for the isolation of cDNA clones for receptors with similar properties from other insects and arachnids. In these experiments, DNA from the Drosophila OAMB clone is labeled by random- priming and used to screen cDNA libraries made from other insects and arachnids at several different stringencies by procedures known in the art and described in Davis et al . , 1989. Clones that are highly related but with some differences in sequence to OAMB are isolated. The positive clones are picked and rescreened to isolate pure. DNA from these pure clones are sequenced to elucidate the sequence homology between the Drosophila OAMB receptor and related receptors from other species. One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned as well as those inherent therein. The octopamine receptor along with the DNA and protein sequences, methods, procedures, assays, molecules and specific compounds described herein are presently representative of the preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the claims.

REFERENCES

All patents and publications mentioned in this specification are indicative of the level of those skilled in the art to which the invention pertains. All patents, publications herein are incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. All of the following references have been cited in this application:

U.S Patent No. 5,344,776 to Venter et al on September 6, 1994.

U.S Patent No. 5,474,899 to Venter et al on December 12, 1995.

Arakawa, S., Gocayne, J. D., McCombie, W, R.,

Urquhar, T. D. A., Hall, L. M Fraser, C M. and Venter, J. C. (1990) .

Braun, G. and Bicker, G. (1992) . J. Neurophysiol 67, 588-598.

Chen, C, and Okayama, H. (1987). Mol. Cell. Biol 7, 2745-2752. Cooper, S. T. and Millar, N. S. (1997) . J. Neurochem. 68, 2140-2151.

David, J.-C. and Coulon, J.-F., (1985) . Progress in Neurobiology 24, 141-185. Davis, R. L., and Davidson, N. (1986). Mol. Cell.

Biol. 6, 1464-1470.

Davis, R. L. (1996) . Physiol . Rev. 76, 299-317.

Davis, R. L., Takayasu, H., Eberwine, M. and Myres, J. (1989) . Proc. Natl. Acad. Sci. USA 86:3604-3608. Dudai, Y. and Zvi , S. (1984) . Comp . Biochem. &

Physiol - C: Comp. Pharmacol. & Toxicol . 77, 145-151.

Dudai, Y., Buxbaum, J., Corfas, G. , and Ofarim, M. (1987) . J. Comp. Physiol. A 161, 739-746.

Fraser, C. M., Arakawa, S., McCombie, W. R. and Venter, J. C. (1989) . J. Biol. Chem. 264, 11754-11761.

Frielle, T., Collins, S., Daniel, K. W., Caron, M. G., Lefkowitz, R. J. and Kobilka, B. K. (1987) . Proc. Natl. Aca. Sci. USA. 84, 7920-7924.

Gerhardt, C. C, Bakker, R. A., Piek, G. J. , Planta, R. J. , Vreugdenhil, E., Leysen, J. E. and Van Heerikhuizen, H. (1997) . Mol. Pharmacol. 51, 293-300.

Gerhardt, C. C, Lodder, H. C, Vincent, M. , Bakke, r. R. A., Planta, R. J., Vreugdenhil, E., Kits, K. S. and van Heerikhuizen, H. (1997) . J. Biol. Chem. 272, 6201-6207.

Glanzman, D. L. and Kranse, F. B. (1983) . J. Neurosci. 3, 2263-2269.

Han, K.-A., and Kulesz-Martin, M. F. (1992). Cancer Res. 52, 749-753. Han, K.-A., Millar, N. S., Grotewiel, M. S. and

Davis, R. L. (1996) . Neuron 16, 1127-1135.

Harlow, E., and Lane, D. (1988). (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press) . Isoai, A., Kawahara, H., Y., 0. and Shizuri, Y. (1996). Gene 175, 95-100.

Livingstone, M. , Harris-Warrick, R. M. and Kravitz, E. A. (1980) . Science 208, 76-79. Long, T. F., Edgecomb, R. S. and Murdock, L. L.

(1986) . Comp. Biochem. & Physiol -C: Comp. Pharmacol. & Toxicol. 83, 201-209.

Millar, N. S., Buckingham, S. D., and Sattelle, D. B. (1994). Proc. R. Soc. Lond. B 258, 307-314. Monastirioti, M., Gorczyca, M. , Rapus, J. , Eckert ,

M., White, K. and Budnik, V. (1995). J. Comp. Neurol . 356, 275-287.

Monastirioti, M. , Linn, J., C. E. and White, K. (1996). J. Neurosci. 16, 3900-3911. O'Connell, P. O. and Rosbash, M. (1984). Nucl. Acids

Res. 12, 5495-5513.

O'Dell, K. M. (1993). Heredity 70, 393-399. O'Dell, K. M. (1994). Behav. Genet. 24, 381-388. O'Dell, K. M. C, Armstrong, J. D. , Yang, M. Y. and Kaiser, K. (1995) . Neuron 15, 55-61.

Orita, M. , Suzuki, Y., Sekiya, T., and Hayashi, K. (1989) . Genomics 5, 874-879.

Osborne, R. H. (1996). Pharmacol. & Therapeutics. 69, 117-142. Ramarao, C. S., Denker, J. M. , Perez, D. M. , Gaivin,

R. J., Riek, R. P. and Graham, R. M. (1992). J. Biol. Chem. 267, 21936-21945.

Robb, S., Cheek, T. R. , Hannan, F. L., Hall, L. M. , Midgley, J. M. and Evans, P. D. (1994) . EMBO J. 13, 1325-1330.

Roeder, T., Degen, J. , Dyczkowski, C. and Gewecke, M. (1995). Prog. Brain Res. 106, 249-258.

Sambrook, J. , Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press) .

Saudou, F., Amlaiky, N. , Plassat, J. L., Borrelli, E., and Hen, R. (1990) . EMBO J. 9, 3611-3617. Saudou, F., Boschert, U. , Amlaiky, N. , Plassat, J.

L. and Hen, R. (1992) . EMBO J. 11, 7-17.

Tejedor, F., Zhu, X. R. , Kaltenbach, E., Ackermann, A., Baumann, A., Canal, I., Heisenberg, M., Fischbach, K. F., and Pongs, O. (1995) . Neuron 14, 287-301. Uzzan, A. and Dudai, Y. (1982) . J. Neurochem. 38,

1542-1550.

Vernier, P., Philippe, H. , Samama, P., and Mallet, J. (1993) . EXS 63, 297-337.

Witz, P., Amlaiky, N. , Plassat, J.-L., Maroteaux, L., Borrelli, E. and Hen, R. (1990) . Proc. Natl. Acad. Sci. USA 87, 8940-8944.

Yellman, C, Tao, H., He, B. and Hirsh, J. (1997) . Proc. Natl. Acad. Sci. USA. 94, 4131-4136.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Davis, Ronald L. Han, Kyung-An Millar, Neil S.

(ii) TITLE OF INVENTION: Insect Octopamine Receptor (iii) NUMBER OF SEQUENCES: 2 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Fulbright & Jaworski L.L.P. (B) STREET: 1301 McKinney, Suite 5100

(C) CITY: Houston

(D) STATE : Texas

(E) COUNTRY: U.S.A.

(F) ZIP: 77010-3095 (v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US

(B) FILING DATE:

(C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Paul, Thomas D.

(B) REGISTRATION NUMBER: 32,714

(C) REFERENCE/DOCKET NUMBER: P-01440US0 (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 713/651-5325 (B) TELEFAX: 713/651-5346

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3387 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: double

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 :

GAATTCCGTT CTTGCCGACG GCACATAACG CGCAAACAAA CTATTAATTT CACAAAACCC

GGCCTAGTCA CGCCCAATCG AAAAGATCAA CAAACCACCA AGCACTGAAA ACTAAACACT 120

CAAAACTTAG GCACTGCAAA ACTGAGTAGT GAATATCGAA AACCAAATGC TGAGTATGGA 180

GATTTTAGGC AAAATGCGTG CAATTATTCA ACGCATGACA ACCAATTAAT TGGCCAAAGA 240

GAGCGAGAGC ACACGAGACC CGGGGCAACA AGTCGATATA GCAATAGCTT TTGAAAATAT 300

ATAGCTATCT GGTGAGCCGG TTAACGCCAG CAAGTGCATC GGAAAACCAG CAACAAACAA 360

AAACTTGACC GATTTTCCAA GCGATTCGGT GACGGGCTCT CGCTAATCTC GCCCAGAAAA 420

CTCAGATCAC AACCGCCATC GACATCGCGA TGATTTATGC AGCTATTTCC TGCAGCTTAT 480

GTGCAATATC CTGCGGGACT CGCAAATAAC TACCATCAAA ATGTTGCTAT CGCACTTGTT 540

TGGCATGTGA ACCGCGGGTC GTGTAAACAA GCACCGACAA AGCACTCCAC GATTCGACTA 600

TTAGGGGCAC ATACACTGAC ACTGTCACCC CGGAACGCAG TTGGTCTGCA TGGAGATAAC 660

CTGCGGGTGG CGGGGCCCAC TAGACGCACA GGACTCCACT AAAGCGACCG CATCACCATC 720

GACAAAGGGA TCGCTTTTGG TCCAAAACAC GGCCATCATC AGCGGCAGTG GCCACCGGTT 780

GCCAGGAACA ACCGCAGCTT TAACATCGCC AGCCACATCA ACAACATGGC CATAAAGCAA 840 CAGCTCTGTA ATTCATGGTT ACAACTACCC AACGAACTGC TGATATTGGT GGTGAACTCA 900

GATACACACC CATCTCAAAA GTACCGCCAT GAATGAAACA GAGTGCGAGG ATCTCATCAA 960

ATCTGTGAAA TGGACGGAAC CAGCCAATCT GATCTCCCTG GCCGTACTCG AGTTCATCAA 1020

CGTTCTGGTC ATCGGTGGCA ACTGCCTCGT GATTGCCGCC GTCTTCTGTT CGAATAAGTT 1080

GAGGAGTGTG ACGAACTTCT TTATTGTCAA CCTAGCTGTG GCCGATCTTC TGGTGGGTTT 1140

GGCCGTCCTA CCCTTCTCAG CCACCTGGGA AGTCTTCAAG GTTTGGATAT TCGGCGATCT 1200

CTGGTGCCGC ATTTGGTTGG CTGTCGATGT CTGGATGTGC ACGGCATCGA TCCTGAATCT 1260

GTGTGCCATA TCACTGGACC GCTATGTGGC GGTCACACGA CCCGTCACCT ACCCAAGCAT 1320

AATGTCCACG AAGAAGGCCA AGTCCTTAAT CGCCGGCATT TGGGTACTCT CATTTTTTAT 1380

TTGCTTTCCG CCGCTAGTCG GCTGGAAGGA TCAAAAGGCG GTTATACAGC CGACCTATCC 1440

AAAGGGAAAC CATACGCTTT ACTACATCAC CACGATGTCA AGCTCGGAGG ATGGTCAACT 1500

AGGGTTAGAT AGCATTAAGG ACCAGGGCGA GGCATCCTTG CCTCCATCCC CGCCCCATAT 1560

CGGCAACGGC AACGCCTACA ATCCCTACGA TCCCGGTTTC GCACCCATCG ATGGATCCGC 1620

GGAGATTCGG ATTGCGGCCA TTGACTCGAC CAGTACTTCA ACAACCGCAA CCACCACGAC 1680

GACAGCGTCC AGCTCGAGCA CCACGGAAAC GGAAATGGAC CTCGATCTAC TGAACGCACC 1740

GCCGCAGAAC AGACCCCAAA CAATTTCCGG CAGTTGTCCG TGGAAGTGCG AGCTGACCAA 1800

CGATCGGGGT TATGTCCTGT ACTCCGCTCT GGGTTCATTC TATATACCCA TGTTCGTGAT 1860

GCTCTTCTTC TACTGGCGCA TCTACCGGGC TGCCGTGAGA ACCACGAGGG CCATCAACCA 1920 GGGCTTCAAG ACCACCAAGG GCAGTCCCCG CGAGTCGGGC AACAATCGAG TGGACGAGTC 1980

CCAGCTCATA TTGCGCATTC ACCGAGGAAG ACCTTGCTCC ACCCCCCAGC GCACGCCCCT 2040

CTCGGTGCAC TCAATGTCCT CGACTCTCAG CGTGAACAGC AACGGGGGCG GGGGTGGAGC 2100

CGTGGCCTCG GGACTGGGTG CCTCCACCGA GGATCACCTT CAGGGAGGCG CCCCCAAGCG 2160

GGCCACATCG ATGCGCGTCT GCCGACAGCG ACACGAGAAG GTGGCCATCA AGGTGTCCTT 2220

TCCCTCCTCC GAGAATGTCC TCGACGCAGG ACAGCAGCCA CAGGCATCGC CACACTATGC 2280

GGTAATCAGT AGCGCCAACG GACGTCGTGC CTCCTTTAAG ACGAGCCTCT TCGACATTGG 2340

CGAGACCACC TTTAATTTGG ACGCAGCTGC GTCCGGTCCC GGAGACCTAG AGACCGGACT 2400

CTCGACCACC TCACTGTCGG CCAAGAAGCG GGCAGGCAAG CGCAGCGCCA AGTTTCAGGT 2460

GAAGCGGTTC CGAATGGAGA CCAAGGCAGC CAAGACGCTG GCCATCATTG TGGGCGGCTT 2520

CATCGTTTGC TGGCTGCCCT TCTTCACGAT GTATCTGATC CGGGCCTTCT GCGACCACTG 2580

CATTCAGCCG ACGGTCTTTT CGGTGCTCTT CTGGCTGGGC TACTGCAACT CGGCCATTAA 2640

TCCGATGATC TATGCGCTCT TCTCGAATGA GTTTCGCATC GCCTTCAAGC GGATAGTGTG 2700

CAGATGCGTC TGCACCCGCA GTGGCTTCCG GGCGTCGGAG AATTTCCAGA TGATAGCGGC 2760

GCGTGCCCTG ATGGCACCGG CAACATTCCA CAAGACCATA TCCGGATGCT CGGACGACGG 2820

CGAGGGCGTG GACTTCAGCT GACTAATCGG CAGCTATGAG CCGAGTCCGC TGCAAAGGAG 2880

CTCCTCCCTG CCGCAGGAGG CGGAATGCTC CGCATCCGTG TCGGGATCGG GACGGCGAAT 2940

CCGGCGGGGA GGATTCTGCA AGGGACGCGT CCTCTAATGC ATTTTGCTCT TTTGATACTT 3000 TTGTAAGCTC CGCCAGACGC AGAGGCAGAC GCAGTGCATC CCACTTCTCA AAACTGTCAG 3060

TATTCGCATT GAACGACGTT GTAACTGTAT GGCAATAATT TTCATGTATT TACCTAGACC 3120

TAAGGCTACG TTTAACTATA TAGTACTATA CCTACCACAT GAGATACAGA TACAGCAGTA 3180

TGAGATATAA TACATAGATT AGACGTAAGC AGACCATTGT TTTCAGTTCC GATGTGTATG 3240

TACATGTATT AGTCGCTGAG GACACTCATT CGCATAAGTT AATCCAGATA TTATATATAT 3300

TGAATGTATA TGTATGTGTG TATCGCAGCA GGGTAAGTTG GCTGCGTTTT CAATAAAAGT 3360

AAAATCGAAC AAAACAAAAA AAAAAAA 3387

(2) INFORMATION FOR SEQ ID NO : 2 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 637 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS:

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Asn Glu Thr Glu Cys Glu Asp Leu lie Lys Ser Val Lys Trp Thr 1 5 10 15

Glu Pro Ala Asn Leu lie Ser Leu Ala Val Leu Glu Phe lie Asn Val

20 25 30

Leu Val lie Gly Gly Asn Cys Leu Val lie Ala Ala Val Phe Cys Ser 35 40 45 Asn Lys Leu Arg Ser Val Thr Asn Phe Phe lie Val Asn Leu Ala Val 50 55 60

Ala Asp Leu Leu Val Gly Leu Ala Val Leu Pro Phe Ser Ala Thr Trp 65 70 75 80

Glu Val Phe Lys Val Trp lie Phe Gly Asp Leu Trp Cys Arg lie Trp

85 90 95

Leu Ala Val Asp Val Trp Met Cys Thr Ala Ser lie Leu Asn Leu Cys 100 105 110

Ala lie Ser Leu Asp Arg Tyr Val Ala Val Thr Arg Pro Val Thr Tyr 115 120 125

Pro Ser lie Met Ser Thr Lys Lys Ala Lys Ser Leu lie Ala Gly lie 130 135 140

Trp Val Leu Ser Phe Phe lie Cys Phe Pro Pro Leu Val Gly Trp Lys 145 150 155 160

Asp Gin Lys Ala Val lie Gin Pro Thr Tyr Pro Lys Gly Asn His Thr

165 170 175

Leu Tyr Tyr lie Thr Thr Met Ser Ser Ser Glu Asp Gly Gin Leu Gly 180 185 190

Leu Asp Ser lie Lys Asp Gin Gly Glu Ala Ser Leu Pro Pro Ser Pro 195 200 205

Pro His lie Gly Asn Gly Asn Ala Tyr Asn Pro Tyr Asp Pro Gly Phe 210 215 220

Ala Pro lie Asp Gly Ser Ala Glu lie Arg lie Ala Ala lie Asp Ser

225 230 235 240 Thr Ser Thr Ser Thr Thr Ala Thr Thr Thr Thr Thr Ala Ser Ser Ser 245 250 255

Ser Thr Thr Glu Thr Glu Met Asp Leu Asp Leu Leu Asn Ala Pro Pro 260 265 270

Gin Asn Arg Pro Gin Thr lie Ser Gly Ser Cys Pro Trp Lys Cys Glu 275 280 285

Leu Thr Asn Asp Arg Gly Tyr Val Leu Tyr Ser Ala Leu Gly Ser Phe 290 295 300

Tyr lie Pro Met Phe Val Met Leu Phe Phe Tyr Trp Arg lie Tyr Arg 305 310 315 320

Ala Ala Val Arg Thr Thr Arg Ala lie Asn Gin Gly Phe Lys Thr Thr 325 330 335

Lys Gly Ser Pro Arg Glu Ser Gly Asn Asn Arg Val Asp Glu Ser Gin 340 345 350

Leu lie Leu Arg lie His Arg Gly Arg Pro Cys Ser Thr Pro Gin Arg 355 360 365

Thr Pro Leu Ser Val His Ser Met Ser Ser Thr Leu Ser Val Asn Ser 370 375 380

Asn Gly Gly Gly Gly Gly Ala Val Ala Ser Gly Leu Gly Ala Ser Thr 385 390 395 400

Glu Asp His Leu Gin Gly Gly Ala Pro Lys Arg Ala Thr Ser Met Arg 405 410 415

Val Cys Arg Gin Arg His Glu Lys Val Ala lie Lys Val Ser Phe Pro

420 425 430 Ser Ser Glu Asn Val Leu Asp Ala Gly Gin Gin Pro Gin Ala Ser Pro 435 440 445

His Tyr Ala Val lie Ser Ser Ala Asn Gly Arg Arg Ala Ser Phe Lys 450 455 460

Thr Ser Leu Phe Asp lie Gly Glu Thr Thr Phe Asn Leu Asp Ala Ala 465 470 475 480

Ala Ser Gly Pro Gly Asp Leu Glu Thr Gly Leu Ser Thr Thr Ser Leu 485 490 495

Ser Ala Lys Lys Arg Ala Gly Lys Arg Ser Ala Lys Phe Gin Val Lys 500 505 510

Arg Phe Arg Met Glu Thr Lys Ala Ala Lys Thr Leu Ala lie lie Val 515 520 525

Gly Gly Phe lie Val Cys Trp Leu Pro Phe Phe Thr Met Tyr Leu lie 530 535 540

Arg Ala Phe Cys Asp His Cys lie Gin Pro Thr Val Phe Ser Val Leu 545 550 555 560

Phe Trp Leu Gly Tyr Cys Asn Ser Ala lie Asn Pro Met lie Tyr Ala 565 570 575

Leu Phe Ser Asn Glu Phe Arg lie Ala Phe Lys Arg lie Val Cys Arg 580 585 590

Cys Val Cys Thr Arg Ser Gly Phe Arg Ala Ser Glu Asn Phe Gin Met 595 600 605

lie Ala Ala Arg Ala Leu Met Ala Pro Ala Thr Phe His Lys Thr lie

610 615 620 Ser Gly Cys Ser Asp Asp Gly Glu Gly Val Asp Phe Ser 625 630 635

Claims

We claim :

1. A purified octopamine receptor comprising an invertebrate receptor having seven transmembrane domains, said receptor activated by octopamine and coupled to adenylyl cyclase.

2. The octopamine receptor of claim 1, further comprising the octopamine receptor coupled to the pathway that increases internal Ca²⁺ levels.

3. The receptor of claim 1, wherein the invertebrate is an insect .

4. The receptor of claim 3, wherein the insect is selected from the group consisting of cockroaches, termites, ants, mosquitos and moths.

5. The receptor of claim 3, wherein the insect is selected from the group consisting of fireants, tobacco hornworms, rice planthoppers, weevils, grasshoppers, leafhoppers and aphids .

6. The receptor of claim 1, wherein the invertebrate is an arachnid.

7. The receptor of claim 6, wherein the arachnid is selected from the group consisting of two-spotted spider mites, other mites, spiders, ticks, and scorpions.

8. An octopamine receptor comprising the amino acid sequence of SEQ. ID. NO. 2 and fragments or derivatives thereof wherein said fragments or derivatives thereof bind octopamine and are coupled to the adenylyl cyclase enzyme .

9. A DNA sequence comprising the nucleic acid sequence of SEQ. ID. NO. 1 and fragments or derivatives thereof, wherein said fragments or derivatives thereof encode for a peptide which binds octopamine and is coupled to the adenylyl cyclase enzyme.

10. A method of detecting whether a test compound has agonistic or antagonistic activity to an octopamine receptor comprising the steps of: inserting the sequence of claim 9 into test cells in culture under conditions wherein said sequence expresses an octopamine receptor and said octopamine receptor localizes to the cell membranes of said test cell; adding the test compound to the cell culture or cell homogenates; measuring the effect of the test compound on the activity of the octopamine receptor; and determining whether a compound is an agonist or antagonist of octopamine by comparing the effect of test compound with the effect of octopamine.

11. The method of claim 10, wherein the test cells are selected from the group consisting of invertebrate cells, vertebrate cells, bacteria and yeast.

12. The method of Claim 10 wherein the test cells are insect cells or mammalian cells.

13. The method of claim 10, wherein the measuring step includes a procedure selected from the group consisting of a displacement assay for measuring the level of octopamine binding to the octopamine receptor, measurement of internal cAMP levels, monitoring the change in internal cellular calcium level, measuring the growth of the cells and monitoring the expression of a reporter gene linked to a cAMP responsive promotor.

14. A method of detecting whether a test compound has agonist or antagonist activity to a octopamine receptor comprising the steps of: inserting the sequence of claim 9 into yeast cells under conditions where said sequence is expressed in the yeast cells and wherein said yeast cells exhibit a temperature sensitivity to cAMP levels; adding the test compound to the yeast cells; and measuring the growth of the yeast cells to determine agonist or antagonist activity.

15. A method for screening test compounds for use as an pesticide comprising the steps of: inserting the sequence of claim 9 into test cells in culture under conditions wherein said sequence expresses an octopamine receptor; adding the test compound to the cell culture or cell homogenates; measuring the effect of the test compound on the activity of the octopamine receptor; and determining to what extent the test compound inhibits or increases the activity of the octopamine receptor by comparing the effect of the test compound with the effect of octopamine.

16. The method of claim 15 wherein the octopamine receptor localizes to the cell membranes of said test cell.

17. An expression system comprised of the sequence of claim 9 inserted into the genome of cells in culture under conditions wherein the sequence is expressed by the cells in culture.

18. The expression system of claim 15, wherein the cells are selected from the group consisting of invertebrate cells, vertebrate cells, yeast and bacteria.

19. A stably transfected S2 cell line containing the sequence for the OAMB receptor.

20. An antibody to the protein sequence of the OAMB receptor.

21. A method of detecting whether a test compound has agonistic or antagonistic activity to an octopamine receptor comprising the steps of: contacting the receptor, fragment or derivative of claim 8 with said test compound; adding octopamine; measuring the effect of the test compound on the binding of octopamine to the octopamine receptor; and determining whether said test compound exhibits agonistic or antagonistic effects on octopamine binding.

22. The method of Claim 21 wherein said effect is measured by a competitive binding assay.

23. The method of Claim 21 wherein said effect is measured in the presence of an adenylyl cyclase emzyme and substrate .