WO1999009180A2

WO1999009180A2 - Method for enzymatically producing guanosine diphosphate-6-desoxyhexoses and the use thereof for producing oligosaccharides

Info

Publication number: WO1999009180A2
Application number: PCT/EP1998/005242
Authority: WO
Inventors: Wolfgang Piepersberg; Jürgen Distler; Christoph Albermann; Wilhelm Tischer
Original assignee: Roche Diagnostics Gmbh
Priority date: 1997-08-19
Filing date: 1998-08-18
Publication date: 1999-02-25
Also published as: JP2001514896A; DE19735994A1; EP1005554A2; WO1999009180A3

Abstract

The invention relates to a method for preparatively, enzymatically producing GDP-6-desoxyhoses from GDP-D-mannose, mannose-1-phosphate or mannose-6-phosphate in the presence of suitable enzymes, such as a GDP-D-mannose-4,6-dehydratase and optionally a GDP-4-keto-6-desoxy-D-mannose-3.5-epimerase-4-reductase or a GDP-4-keto-6-desoxy-D-mannose-4-reductase. The invention also relates to a method for coupling the resulting GDP-activated hexoses with oligo- or polysaccharides using glycosyl transferases, e.g., fucosyl transferases.

Description

Process for the enzymatic production of guanosine diphosphate-6-deoxyhexoses and their use for the production of oligosaccharides

The present invention relates to a process for the enzymatic synthesis of guanosine diphosphate (GDP) -6-deoxyhexoses, for example GDP-4-keto-6-deoxy-D-mannose, GDP-L-fucose and GDP-L-perosamine, starting from simple nutrients or GDP-D-Mannose. The method further relates to the use of GDP-6-deoxy-hexoses formed in microorganisms or in vitro for the synthesis of oligo- or polysaccharides by means of glycosyltransferases.

Simple hexoses occurring in nature in large quantities, for example D-glucose, D-glucosamine, D-mannose and D-galactose, are incorporated into oligosaccharides or polysaccharides by first using nucleoside triphosphates (NTP) to form NDP-hexoses ( UDP, dTDP, GDP, CDP hexoses) are activated and then transferred to corresponding precursor molecules by specific glycosyltransferases. In many cases, however, these simple sugars are initially converted biosynthetically into secondary-modified NDP-activated hexose derivatives. A large group of these sugar molecules, NDP-6-deoxyhexoses (mostly dTDP-, GDP- or CDP-activated hexose derivatives), is characterized by the loss of the 6-hydroxyl group and is incorporated in many modifications into many biological molecules with a characteristic function. Typical representatives of this group of substances are L-fucose (from GDP-D-mannose), L-rhamnose (from dTDP-D-glucose) and 3,6-dideoxyhexoses of enterobacteria (e.g. D-colitose; from CDP-D- Glucose). Sugar derivatives made from GDP-D-mannose, such as L-fucose and D-perosamine, are produced using numerous enzymes (approx. 30), many of which are end product-inhibited. An advantage for the overproduction in a host organism are those enzymes which show only a weak or almost no end product inhibition, such as the ManB (phosphomannomutase), ManC (mannose-1-phosphate guanylyl transferase [GDP-mannose pyrophosphorylase or synthase] ) and Enzymes from the gram-negative bacterium Escherichia coli (Stevenson, G. et al., J. Bacteriol. 178 (16), 4885-4893, 1996).

The biosynthetic pathway of 6-deoxyhexoses typically starts with a dehydration reaction catalyzed by an NAD (+) -dependent NDP-hexose-4,6-dehydratase, which produces an NDP-6-deoxy-D-4-hexulose (Figure 1; Piepersberg. W., Crit. Rev. Biotechnol. 14, 251-285, 1994; Liu, H.-W. and Thorson, JS, Ann. Rev. Microbiol. 48, 223-256, 1994; Piepersberg, W. and Distler, J. In: Biotechnology (2nd Ed.), Vol. 7, Products of Secondary Metabolism (Rehm, H.-J., Reed, G., Pühler, A., Stadler, P., Eds.), S 397-488. 1997). Further modification reactions can take place at the level of the D configuration and use, for example, the 4-keto compound either for transamination, dehydroxylation of the neighboring 3-hydroxy group via a dehydrase reaction or for enantioselective reduction to the 4-hydroxy group. Other biosynthetic pathways first convert the NDP-6-deoxy-D-4-hexulose into an NDP-6-deoxy-L-4-hexulose via an epimerase reaction. usually besides position 5, the position 3 of the hexose is reversed in its stereospecificity (Figure 1).

The direct production of fucose from mannose can only take place in the nucleotide-activated form in the metabolism. The biosynthetic enzymes are therefore sensitive to activation, i. H. the nucleotide part. The biosynthesis of other secondary, i.e. H. strongly modified sugar also takes place in the nucleotide-activated form, as was shown using the example of dTDP-L-rhamnose (DE 195 37 217.4; Verseck, S. .. dissertation, University of Wuppertal. 1997). DTDP-6-deoxy-D-xylo-4-hexulose represents an intermediate of the biosynthetic pathway. The enzymatic synthesis and isolation of this substance has also been described (Marumo, K. et al, Eur. J. Biochem. 204, 539-545 , 1992).

For example, GDP-L-fucose is produced from GDP-D-mannose in two to three successive enzymatic steps, as described by Chang et al. using the example of porcine salivary glands (J. Biol. Chem., 263, 1693-1697, 1988) and in analogy to the biosynthesis of L-rhamnose and L- (dihydro-) streptose in bacteria (Marumo, K. et al., Eur. J. Biochem. 204, 539-545, 1992; Verseck, S., Dissertation, Wuppertal, 1997). Reeves et al. (J. Bacteriol. 178, 4885-4893, 1996) accept due to the genetic instructs in Escherichia coli that the two genes gmd (GDP-D-mannose-4,6-dehydratase) and wcaG (GDP-4-keto-6-deoxy-D-mannose 3,5-epimeraseII-4-ketoreductase) sufficient in the gene cluster for the synthesis of colanic acid to accomplish the conversion to GDP-L-fucose. Consequently, in contrast to the synthesis of dTDP-L-rhamnose from dTDP-D-glucose, two instead of three enzymes would be sufficient for GDP-L-fucose synthesis from GDP-D-mannose (Marumo, K. et al., Eur. J Biochem. 5 204, 539-545, 1992; Verseck, S., Dissertation, Wuppertal, 1997). In addition, Chang et al. (J. Biol. Chem. 263, 1693-1697. 1988) already the conversion of GDP-D-mannose by means of a specific dehydratase into GDP-4-keto-6-deoxy-D-mannose, which was subsequently by means of an epimerase - and Keto-reductase activity enzyme is converted to GDP-L-fucose. Of the common intermediate. GDP-4-keto-6-deoxy-D-mannose, other deoxyhexoses are also likely to be derived, such as the transamination product GDP-D-perosamine. which is attributed to the presence of the rfbE gene in the enterobacterium Vibrio cholerae (Manning, PA et al., Gene 158, 1-7, 1995). In contrast, the direct production of L-fucose, D-perosamine and other derivatives of the GDP-6-deoxyhexose biosynthetic pathway from D-mannose is not possible in economically interesting amounts in the absence of the specific nucleotide group.

L-fucose and D-perosamine are important building blocks of extracellular polysaccharides, glycoproteins and other cell surface glycoconjugates, for example of tetrasaccharides. like Sialyl LewisX. In addition, L-fucose and D-perosamine are important components of other natural products, such as the macrolide antibiotic perimycin. The transfer of the sugars from the GDP-activated precursors into such (pseudo) saccharidic end products usually takes place via specific glycosyltransferases. Many sources of fucosyltransferases are known, including human samples: Futl (Flegel WA, Dissertation Universität Ulm, 1998, Fut2 (Kelly, RJ et al., J. Biol. Chem. 270 (9), 4640-4649, 1995) or Fut3 (Cameron, HS et al., J. Biol. Chem. 270 (34), 20112-20122. 1995) and various bacteria, e.g. from Escherichia coli (Stevenson, G. et al., J. Bacteriol. 178 (16 ), 4885-4893 (1996)), from Yersinia enterocolitica (Zhang, L. et al., Mol. Microbiol. 23, 63-76, 1997) or from Helicobacter pylori (Martin, SL, Glycobiology (in press)). The object of the invention was therefore to provide a simple process for the production of guanosine diphosphate (GDP) -6-deoxyhexose compounds consisting of as few steps as possible.

The object is achieved by a process for the enzymatic production of a GDP-D-hexose, the starting compound being GDP-D-mannose or a compound which can be converted into GDP-D-mannose in the presence of one or more enzymes, the GDP-D-mannose. 4,6-dehydratase (Gmd, RfbD) - and optionally GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4 reductase (WcaG) - or GDP-4-keto-6- have deoxy-D-mannose-4-aminotransferase (RfbE) activity, incubated and the desired product is isolated. According to the invention, the enzymes required for the enzymatic synthesis are preferably obtained by cloning the genes or coding DNA fragments coding for these enzymes, insertion into one or more vector (s) and transformation into a bacterial or fungal host cell. The method is particularly suitable for the preparative in vitro extraction and purification of GDP-4-keto-6-deoxy-D-mannose or GDP-L-fucose by overproduction of the corresponding biosynthetic enzymes in suitable host organisms, such as, for example, in E. coli. The biosynthetic enzymes are phosphomannomutase (ManB), GDP-D-mannose synthesis (ManC or pyrophosphorylase. Mannose-1-phosphate-guanyltransferase), GDP-D-mannose-4,6-dehydratase (Gmd. RfbD) and / or GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-keto reductase (WcaG. or GDP-L-fucose synthase), which are preferably derived from E. coli (Stevenson, G. et al., J. Bacteriol. 178, 4885-4893. 1996).

Furthermore, the method according to the invention is suitable for the preparative production of GDP-D-perosamine, an overproduction of the GDP-D-perosamine synthase (RfbE, GDP-4-Kto-6-deoxy-D-mannose-4-aminotransferase) from Vibrio cholerase 01 occurs.

Accordingly, the following genes or DNA fragments coding for corresponding enzymes are preferred according to the invention: manB, manC, gmd, rfbD, rfbE and wcaG. If necessary, the genes or corresponding DNA regions are specifically amplified, for example using suitable primers in a PCR reaction, before they are used for expression. Suitable bacterial or fungal host organisms are, for example, E. coli, Bacillus subtilis, Corynebacterium sp., Staphylococcus carnosus, Streptomyces lividans, Saccharromyces cerevisiae, Schizosaccharamyces pombe, Hansenula polymorpha and Pichia stipidis.

A preferred embodiment of the method is that first mannose-6-phosphate and GTP are incubated in the presence of phosphormannomutase (ManB) and GDP-D-mannose synthase (ManC), GDP-D-mannose is separated if necessary and used for further synthase and that desired subsequent product, for example GDP-L-fucose, is isolated.

Furthermore, a preferred embodiment of the method according to the invention is when a buffer solution containing all the starting materials or substrates is continuously percolated over a solid carrier material on which the (synthesis) enzymes are immobilized.

Furthermore, it has proven advantageous according to the invention if the process is carried out continuously in a batch process or in an enzyme membrane reactor.

Another object of the invention is a method for coupling the GDP-6 deoxyhexose produced according to the invention to glycosides. Oligosaccharides or polysaccharides in the presence of a protein having glycosyltransferase activity. In particular, the invention relates to a process for L-fucosylation or D-perosaminylation by glycosyl transfer to suitable substrates and by providing sufficient amounts of GDP-activated hexose, such as GDP-L-fucose. The glycosyl transfer is preferably carried out enzymatically, specifically by proteins which have fucosyl transferase and / or perosamine transferase activity.

The GDP-L-fucose can be used, for example, for the enzymatic synthesis of oligosaccharides, e.g. B of 2-fucosyl-beta-galactosides or 3-fucosyl-beta-N-acetylgalactosamines can be used by means of suitable fucosyltransferases; the GDP-D-perosamine can also be used for glycosylating suitable receptor molecules such as oligosaccharides or secondary metabolites (e.g. macrolides such as perimycin) using suitable glycosyltransferases, e.g. the perosaminyltransferase from Vibrio cholerae 01 or other gram-negative or gram-positive bacteria, be used. Thus, in addition to a process for the recombinant production of enzymes for the biosynthesis and transfer (glycosyltransferases) of GDP-hexoses, the present invention relates. a process for the enzymatic production of guanosine diphosphate-D-mannose, guanosine-diphosphate-6-deoxy-D-hexose (e.g. GDP-4-keto-6-deoxy-D-mannose), guanosine diphosphate-6-deoxy-L-hexose ( e.g. GDP-L-fucose) and guanosine diphosphate-4,6-dideoxy-D-hexosamine (e.g. GDP-D-perosamine). The invention is associated in particular with the advantage that GDP-activated sugars which have not previously been able to be produced in large quantities are now accessible on a preparative scale and that the building blocks obtained are further used for the in vitro or in vivo synthesis of valuable active ingredients can. The method is characterized by the isolation of suitable genes from bacteria and their genetic incorporation into new recipient organisms, preferably under the control of suitable control elements (for example promoters) for stronger or controllable expression of the gene products, or in new metabolic relationships with other genes, in particular for the purposes mentioned and possible uses to be usable.

Legends for the illustrations

Figure 1 Enzymatic synthesis of GDP-ß-L-fucose and GDP-D-perosamine Figure 2 Recombinant plasmid pCAW20.1 Figure 3 Recombinant plasmid pCAW19.1 Figure 4 Recombinant plasmid pCAW21.1 Figure 5 Recombinant plasmid pCAW22.1 Figure 6 Recombinant plasmid pCAW13.1 Figure 7 Recombinant plasmid pCAW14.1 Figure 8 Recombinant plasmid pCAW21.2 Figure 9 Recombinant plasmid pCAW22.2

The method according to the present invention is described in more detail below with the aid of examples. example 1

Cultivation of E-coli strains, preparation of the plasmid DNA and isolation of DNA fragments

E. coli DH5α and E. coli BL21 (DE3) were preferably incubated in LB medium (trypton 10 g / 1, yeast extract 5 g / 1, sodium chloride 5 g / 1) at 37 ° C. Plasmid-bearing bacteria were kept under selection pressure of antibiotics (ampicillin 100 μl / ml; chloramphenicol 30 μl / ml). The cultivation was carried out on a rotary shaker at 270 rpm. Approaches which were incubated for at least 12 h were referred to as overnight culture.

The cells from a 1.5 ml overnight culture, incubated under selection pressure, were used for the preparation of plasmid DNA. The plasmids were isolated by the method of alkaline SDS lysis (Birnboim, H.C., Doly, J., Nucleic Acid Res. 7, 1513, 1979).

Only restriction endonucleases according to the manufacturer's instructions (Gibco BRL, Eggenstein) were used for the hydrolysis of vector DNA. To restrict 10 μg plasmid DNA, 5 U (Uni) of the respective restriction endonuclease were used and incubated at 37 ° C. for 2 h. To ensure complete hydrolysis, the same amount of restriction endonuclease was added a second time and incubated again for at least 1 h.

The digested DNA was electrophoresed using a 1% horizontal agarose gel. For elution, the gel pieces containing the DNA fragments were cut out with a sterile scalpel. The DNA fragments from the agarose were eluted according to the instructions using the JETsorb kit (Genomed, Bad Oeynhausen).

Example 2

Isolation of chromosomal DNA (modified, Pospiech, A., Neumann, B., TIG 1 1, 217-218, 1995)

For E. coli DH5α cells, a 1.5 ml UN culture was grown at 37 ° C. in LB medium and harvested by centrifugation (5 min, 7000 rpm). The cell sediment was resuspended in 567 ul TE buffer and together with 30 ul SDS (10%), 20 ul lysozyme solution (20 mg / ml) and 3 ul Proteinase K (20 mg / ml) incubated for 1 h at 37 ° C. Then 100 μl of 5 M sodium chloride solution and 80 μl of CTAB solution (hexadecyltrimethylammonium bromide) were added and inverted several times and incubated at 65 ° C. for 10 min. After the addition of 800 μl chloroform / isoamyl alcohol, the mixture was centrifuged for 5 min (3000 rpm) and the aqueous phase was mixed in a new vessel with the same volume of phenol / chloroform. The phases were separated again by centrifugation and the aqueous phase was combined with 0.6 parts by volume of 2-propanol and the precipitated DNA was centrifuged off. The DNA was washed once with 1 ml of ethanol (70%) and, after drying at RT, resuspended in 100 μl of TE buffer (Tris / HCl pH8 10 mM, EDTA 1 mM).

Example 3

Polymerase chain reaction

The PCR is used for the specific in vitro multiplication of selected DNA areas.

Vent DNA polymerase was used for the reactions according to the manufacturer's instructions (New England Biolabs, Schwalbach). The reaction was carried out in a thermal cycler (Biometra, Göttingen).

The amplification of a DNA section using the PCR technique (Polymerase Chain Reaction, Saiki et al. 1985) was carried out in a 100 μl standard batch (Table 1.

Table 1

Composition of the PCR batches

* The primers were applied before they were used in the PCR. Diluted 1:10. The concentration in the PCR approach corresponded to 50 pmol / 100 μl. OD260 = 1.0 / 100 μl = 100 pmol. The total volume of the PCR mixture was 100 μl and was overlaid with 60 μl sterile mineral oil.

The PCR approaches for the amplification of certain DNA areas were subjected to the temperature programs listed in the table (Table 2).

Table 2

Summary of the PCR program data

* The temperature change (ramping rate) between the individual steps was 2 ° C / s. ** The polymerase was added after a "hot start" during the first 95 ° C

Step.

The course of the PCR program was chosen so that steps 2-4 were repeated 6 times in one run, and steps 5-7 were repeated 30 times.

Table 3: PCR primers used

* Newly formed interfaces are given in the table and underlined in the nucleotide sequence.

Example 4

Cloning of manB, manC, gmd, rfl> D, rfbE and wcaG reading frames in expression vectors

For overexpression of ManB, ManC, Gmd, RfbD, RfbE μ and WcaG in E. coli, the reading frames isolated by PCR were cloned into expression vectors. In this case, the expression vectors pETlla and pET16b from Novagen (Studier. F. W., et al., Methods Enzymol. 189, 113-130, 1990). These vectors are powerful cloning and expression systems for recombinant proteins in E. coli.

For cloning into the vectors, this was linearized with the aid of hydrolysis by the restriction endonucleases Ndel or Ncol and BamHl. The fragments of the PCR products from manB, manC, gmd and wcaG hydrolyzed with Ndel or Ncol and Bg / II or BamHl were lined into the expression vectors previously hydrolyzed by Ndel or Νcol and BamHl (pCAW13.1 (O); pCAW14. 1 (rfbE); pCAW19.1 (manB); pCAW20.1 (manC); pCAW21.1 (gmd); pCAW22.1 (wcaG); pCAW21.2 (his-gmd); pCAW22.2 (his-wcaG) , see Fig. 2-9) and transformed into E. coli. The cloning into the NdeI or the Ncol interface of the pET vectors ensured that the start codon is retained and lies on the vector at an optimal distance from the Shine-Dalgarno sequence.

Due to its leader sequence (his), the vector pETlόb enables 12 histidine residues to be fused to the Ν-terminus of the overexpressed protein, which were a prerequisite for purification of the protein via an Νi-agarose column. The recombinant proteins produced in this way are referred to below as His-Gmd or His-WcaG and the genes coding for them as his-gmd or as his-wcaG.

Ligation: The fragments and vectors to be ligated were purified from the agarose gels by elution (Example 1). For ligations of DΝA fragments with protruding ends ("sticky end"), the fragment to be ligated was used in a fourfold excess to the cut vector and incubated at RT with 1 U T4-DΝA ligase for 4 h.

Transformation in E. coli cells: The competent cells (Hanahan, D., J. Mol. Biol. 166, 557-580, 1983) were thawed on ice and mixed with 2-20 μl DNA solution. After an incubation period of at least 30 min on ice, the cells were placed at 42 ° C. (heat shock) for 90 s and then on ice for at least 2 min. For regeneration, 800 μl SOC medium (2.0% tryptone, 10 mM NaCl, 2.5 mM KC1, 0.5% yeast extract, 10 mM MgCl ₂ , 10 mM MgSO ₄ , 20 mM D-glucose) was added to the cells. pipetted in and incubated at 37 ° C. for 45 min. From this cell suspension, 100-1000 μl were plated on selection agar plates and stored at 37 ° C. Example 5

DNA sequencing

The DNA sequencing, the isolated reading frame, was carried out with recombinant pETlla plasmids according to the method of Sanger et al. (Sanger, F. et al., Proc. Natl. Acad. Sci. USA 74, 5463-5467, 1977). For automated sequence analysis with the A.L.F. Express Sequencer (Pharmacia, Freiburg), the sequence reaction with fluorescein labeled "termi" and "promo'x primers and the Thermo Sequenase fluorescent labeled primer cycle sequencing kit with 7-deaza-dGTP was carried out according to the manufacturer's instructions (Amersham, Braunschweig).

termi-primer 5 'GCTAGTTATTGCTCAGCGGTG 3' promo-primer 5'GAAATAAATACGACTCACTATAGGG 3 '

Example 6

Overexpression of ManB, ManC, Gmd, RfbD, RfbE. WcaG. His-Gmd and His-WcaG

The gene products can preferably be overexpressed in E. coli BL21 (DE3) using a T7 RNA polymerase / promoter system (Studier et al. 1990). For this purpose, the corresponding gene was cloned into the MCS of the vectors pETl όb and pETlla behind the φ10 promoter (see Example 4), which have a suitable SD sequence at an optimal distance from the start codon of the target gene. The resulting recombinant plasmids were introduced into competent cells of the E. coli strain BL21 (DE3) by transformation.

Overexpression in E. coli BL21 (DE3) pLysS: LB medium (with ampicillin, chloramphenicol) was inoculated from a culture of the strain of the strain with the corresponding plasmid to an OD _{540 nm} of 0.05 and in a shaker at 37 ° C. up to one OD _540nm , incubated from 0.6-0.8. The T7 RNA polymerase was induced by adding 1.0 mM isopropylthiogalactoside (IPTG). The cells are harvested 90 min after the addition of IPTG.

For protein extracts from E. coli overexpression clones, the cells were ^" harvested by centrifugation and washed twice with cell disruption buffer. 1.5 ml Cell disruption buffer added to 1.0 g cells. Two methods were used alternatively to disrupt the cells, the choice being based on how much buffer was required for resuspending. At a volume of less than 5 ml, the cells were disrupted using ultrasound, the cells being sonicated for 5 min (50 cycles, 15 s pulses and 15 s pause) and simultaneously cooled with an ice / water mixture. To check the completeness of the digestion, the extract was checked under a microscope.

When the cells have been resuspended in a volume greater than 5 ml digestion buffer. they were opened twice at 1300 psi by a French press (American Instrument Company, Maryland, USA).

The suspensions with the disrupted cells were centrifuged in the SS-34 rotor (Sorvall, DuPont. Bad Nauheim) between 30-45 min at 16000 rpm. whereby cell fragments sediment. The enzyme proteins were prepared using conventional methods of enzyme preparation or alternatively as His-Tag fusion proteins (see Example 7) in a highly enriched form and preserved in a stable form.

Table 4

Data on genes and expected gene products

Example 7

Purification of recombinant proteins

The accumulation of recombinant proteins can preferably be made possible by a C- or N-terminal fusion with histidine-containing oligopeptides (Example 4). The enrichment was carried out using the Ni-NTA agarose from Qiagen (Haan) and in accordance with the QIAexpress protocol. This affinity chromatography is based on the binding of the nickel ions of the Ni-NTA agarose with the His tag of the specially constructed, recombinant protein (His-Gmd, His-WcaG). For the purification, an FPLC system consisting of a Liquid Chromatography Controller (LCC-500 Plus, Pharmacia), two piston pumps (P500, Pharmacia), a flow UV monitor (UV-1, l ₂₈ o _nm> Pharmacia) ), a 2-channel recorder (Rec 482, Pharmacia) and a fraction collector (Frac 100, Pharmacia) were used.

Example 8

Gel electrophoretic representation of proteins

Denaturing separation of proteins in SDS polyacrylamide gels and their staining with the Coomassie dye

Table 5

Composition of an acrylamide / bisacrylamide protein gel

The electrophoresis was carried out using the SERVA Blue-Vertical 100 / C apparatus (BioRad. Munich) (gel form, 80 x 100 x 0.75 mm). The protein concentration of the samples to be analyzed was determined using the protein assay (BioRad, Munich), a calibration line being established using BSA. The "VIIL Dalton marker" (14.2 kDa - 66 kDa) from Sigma (Deisenhofen) served as the standard for the molecular weights of the separated proteins.

Example 9

Determination of enzyme activities

Determination of phosphomannomutase activity

The phosphomannomutase activity was determined according to (Verseck. S. et al., Glycobiology ό, 591-597, 1996).

Enzyme batch:

Tris / CHl, pH 8.0 50 mM

MgCl ₂ 10 mM

NADP ⁺ 1mM

Glucose 1,6-bisphosphate 0.25 mM

Mannose-1-phosphate I mM

Raw extr. ManB variable

Glucose-6-phosphate dehydrogenase 0.5 U / ml

Phosphomannose isomerase 0.5 U / ml

Phosphoglucose isomerase 0.5 U / ml

Final volume 500 μl

The reaction was started by adding mannose-1-phosphate. The course of the reaction was monitored spectroscopically at 30 ° C. by the extinction at λ _{340 nm} .

Determination of GDP-D Mannose Pyrophosphorylase Activity

The GDP-D-mannose pyrophosphorylase activity was determined using the PP, reagent from Sigma (Deisenhofen). Enzyme batch:

PP _r reagent 170 μl

Tris / HCl, pH 8.0 50 mM

MgCl ₂ 10 mM

GTP 2 mM

Mannose-1-phosphate 10 mM

Raw extr. ManC variable

Final volume 500 μl

The reaction was started by adding mannose-1-phosphate. The decrease, at 37 ° C, of NADH was monitored spectroscopically at λ _340nm . The molar extinction coefficient for NADH ₂ was ε ₃₄₀ = 6.22 x 10 "l / (mol x cm).

Determination of GDP-D-mannose-4.6-dehydratase activity

The GDP-D-mannose-4.6-dehydratase activity was determined according to (Kornfeld et al ..

1965).

Enzyme batch:

Tris / HCl, pH 7.5 50 mM

GDP-D-mannose 4 mM

Raw extr. Gmd or RfbD variable

Final volume 300 ml

50 μl of sample were taken at defined times, added to 950 μl of 1 N NaOH and incubated at 37 ° C. for a further 20 min. The absorbance was measured at λ _320πι _. (ε ₃₂₀ = 4600 l / (mol x cm)). In the negative control, GDP-D-mannose was replaced by water.

Determinations of GDP-4-keto-6-deoxymannose-3.5-epimerase-4-reductase activity

Enzyme batch:

Tris / CHl, pH 7.5 50 mM

GDP-4-keto-6-deoxymannose 2 mM NADPH ₂ 1 mM

Raw extr. WcaG variable

Final volume 0.5 ml

The reactions were started by adding the raw extract to be tested. The decrease in NADPH _{2 was} measured at λ _340mn (ε ₃₄₀ = 6.22 x 10 ⁶ 1 / mol x cm), at a temperature of 37 ° C.

Determinations of GDP-D-Perosamine Synthase Activity

Enzyme approach

Tris / HCl. pH 7.5 50 mM

GDP-4-keto-6-deoxymannose 2 mM

L-glutamate 2.5 mM

Pyridoxal phosphate 8 mM

Magnesium chloride 1 inM

Crude Extr.RfbE variable

Final volume 0.5 ml

The amino acid L-glutamate was used as the amino donor.

The enzyme batch was incubated at 37 ° C. and the reaction was stopped by heating to 100 ° C. in a water bath for 1 min. After centrifuging the protein, the solution was subjected to HPLC analysis.

The respective overexpression clones are designated with RfbD, RfbE, ManB, ManC, WcaG and Gmd (see Example 6).

Example 10

Approach to the preparative conversion of D-mannose-6-phosphate to GDP-D-mannose

Approach for preparative implementation with ManB and ManC Tris / HCl, pH 8.0 50 mM Mannose-6-phosphate 150 µmol

MgCl ₂ 10 MM

Raw extr. ManB 120 nat

Raw extr. ManC 120 nat

GTP 150 µmol

Final volume 6 ml

Crude extract from E. coli BL21 (DE3) pLysS pCAW19.1 or pCAW20.1 was used for the conversion to GDP-D-mannose. The mixture was incubated for 1 h at 37 ° C. The reaction was stopped by boiling for 1 min. The proteins were separated by ultrafiltration in microsep tubes (cut-off size 3 kDa; Amicon. Heidelberg) at 8000 rpm (SS-34 rotor; Sorvall DuPont, Bad Nauheim) overnight.

Example 1 1

Preparative implementation of GDP-D-mannose to GDP-4-keto-6-deoxymannose

Approach for preparative implementation with Gmd or RfbD Tris / HCl, pH 7.5 300 μmol

GDP-D-Mannose 165 μmol (100 mg)

Crude Extr.Gmd or RfbD 120 nkat

Final volume 6 ml

Crude extract from E. coli BL21 (DE3) / pLysS pCAW21.1 or 2 or pCAW13.1 was used for the conversion of GDP-D-mannose. The mixture was incubated for 1 h at 37 ° C. The reaction was stopped by boiling for 1 min. The proteins were separated by ultrafiltration in microsep tubes (cut-off size 3 kDa; Amicon, Heidelberg) at 8000 rpm (SS-34 rotor; Sorvall DuPont, Bad Nauheim) overnight. The supernatant was used for the preparative synthesis of further GDP-hexoses such as GDP-L-fucose or GDP-D-perosamine. Example 12

Preparative implementation of GDP-4-keto-6-deoxymannose to GDP-L-fucose

Approach to preparative implementation with WcaG:

Tris / HCl, pH 7.5 400 μmol

GDP-4-keto-6-deoxymannose 82 μmol (50 mg)

NADPH ₂ 123 μmol

Crude extract WcaG 3.5 U

Final volume 8 ml

To regenerate oxidized nicotinamide adenine dinucleotide phosphate (NADP ^{1 "} ) or nicotinamide adenine dinucleotide (NAD ⁺ ), this is reduced, for example, by the enzymatic reaction with isocitrate with catalysis by isocitrate dehydrogenase.

The GDP-4-keto-6-deoxymannose comes from the approach described in Example 11. Crude extracts from E. coli BL21 (DE3) / pLysS pCAW22.1 (WcaG) were used for the reactions. These batches were incubated at 37 ° C for 1 h. The reaction mixture was then cooled on ice and 150 μl of 0.3 M perchloric acid were added. The proteins thus precipitated were centrifuged at 30,000 g for h. The supernatant was then neutralized with 1 M potassium hydroxide.

Example 13

Preparative implementation of GDP-4-keto-6-deoxymannose to GDP-D-perosamine

Approach to preparative implementation with RfbE:

Tris / HCl, pH 7.5 400 μmol

GDP4-keto-6-deoxymannose 82 μmol (50 mg)

L-glutamate 123 μmol

Crude extract RfbE 3.5 U

Pyridoxal phosphate 100 μmol

Final volume 8 ml The GDP-4-keto-6-deoxymannose comes from the approach described in Example 11. Crude extracts from E. coli BL21 (DE3) / pLysS pCAW14.1 (RfbE) were used for the reactions. These batches were incubated at 37 ° C for 1 h. The reaction mixture was then cooled on ice and 150 μl of 0.3 M perchloric acid were added. The proteins thus precipitated were centrifuged at 30,000 g for 1 h. The supernatant was then neutralized with 1 M potassium hydroxide.

Example 14

In addition to the enzyme reactions described in Examples 10-13 in a batch process, the reaction is also achieved with immobilized enzymes, which are from the substrate and buffer solution, preferably at a temperature of 30-37 ° C. is washed around. Immobilization of the enzymes is e.g. achieved by binding the His-Taq fusion proteins (HisGmd, His-WcaG) to a Ni-NTA agarose column (Qiagen, Hilden) or by using a membrane reactor.

Example 15

Purification of GDP hexoses

DOWEX ion exchange chromatography

The by-product NADP ⁺ or NAD "and the residual substrate XADPH- or NADH ₂ in the synthesis of GDP-L-fucose or pyridoxal-phosphate. L-glutamate and α-ketogutarate in the synthesis of GDP-D- To separate perosamine, an anion exchange chromatography using a 1 x 8 DOWEX resin ("mesh" = 200-400; Serva. Heidelberg) with formate as the counter ion was chosen. The resin was placed in an SR 25/50 column ( Pharmacia, Freiburg) The gel bed height was 12.5 cm and the total volume was 61 ml. An FPLC system (Pharmacia, Freiburg) with a UV monitor filter for λ _{; 5 ι} _ was used for the separation follows:

Elution volume (ml): Dowex buffer A (%):

1200 50

1400 100 1 The total volume was 1400 ml and the flow rate was 6 ml / min. Fractions of 5 ml were collected. The elution was carried out at 5 ° C. An HPLC analysis of the fractions followed, after which the fractions containing the GDP-activated hexose were pooled. This solution was then concentrated to 10-20 ml in a high vacuum (rotary vane vacuum pump RD4, Vakuubrand GmbH + Co, Wertheim) with stirring at approx. 25 ° C. After each run, the column was regenerated with 185 ml of 4 M formic acid and rinsed with H ₂ 0 until a neutral pH was measured.

Gel filtration

A Sephadex G-10 column (SR 25/100 column; Pharmacia. Freiburg) was used to desalt the fraction obtained after ion exchange chromatography. The gel bed height was 81 cm and the total volume was 398 ml. The GDP-activated hexose was detected using a UV monitor (Uvicord SII. I _{254 nm} , Pharmacia. Freiburg) and a 2-channel recorder (Rec 482, Pharmacia. Freiburg ). The samples were collected with a fraction collector (Frac 100, Pharmacia, Freiburg). The concentrated fraction of the anion exchange chromatography was applied to the column using a peristaltic pump (Pump Pl; Pharmacia, Freiburg) and a foot rate of 0.5 ml / min. Elution was carried out with H ₂ 0 first at a flow rate of 0.5 ml / min for 20-30 ml, then at 1 ml / min. An HPLC analysis of the fractions followed, after which the fractions containing the GDP-activated hexose were pooled.

Salting with an anion exchange membrane

In order to exchange the residues of the ammonium formate for NaCl, the fraction of the gel filtration was pumped at 10 ml / min onto the membrane anion exchange module Q15 (Sartorius, Göttingen) (Pump Pl; Pharmacia, Freiburg). Then the anion exchange module was rinsed with 20-50 ml of H ₂ O and then the activated hexose was eluted from the membrane with 150 mM NaCl. The flow rate was 10 ml / min. This solution was then concentrated to 10-20 ml in a high vacuum (rotary vane vacuum pump RD4, Vakuubrand GmbH + Co, Wertheim) with stirring at approx. 25 ° C. After each run, the membrane was regenerated with 20-30 ml of 0.2 M NaOH and rinsed with H ₂ 0 until a neutral pH was measured.

Gel filtration and freeze drying The desalting of the solution obtained after desalting was carried out with a Sephadex G-10 column as described above.

After desalting, the pool of GDP-activated hexose was frozen in liquid nitrogen and freeze-dried at RT (Cryograph LCD-1, Christ GmbH, Osterode am Harz and rotary vane vacuum pump RD4, Vakuubrand GmbH + Co, Wertheim).

Example 16

High pressure liquid chromatography (HPLC)

High-pressure liquid chromatography was used to control the reaction and to analyze the nucleotide-activated sugars. The HPLC separations were carried out using a device from Beckmann (Beckmann Instruments, Munich), consisting of UV detector 166, pump module 125 and autosampler 502. The following separation system (Payne, SM and Arnes, BN, Anal. Biochem. 123, 151 -161, 1982) were used:

"Reversed" phase chromatography:

Column: Eurospher 100 C 18; Grain size 5 mm; 250 x 4.6 mm (Knauer, Berlin)

Mobile solvent A: Potassium phosphate buffer, pH 6 30 rnM

Tetrabutylammonium hydrogen sulfate 5 mM

Acetonitrile 2%

Solvent B: acetonitrile 100%

Elution program:

Flow rate: 1.5 ml / min from 0% to 40% barrel B: 60 min

100% solvent A: 15 min

All solvents were filtered and degassed in a sterile filter unit with an MF12 membrane (diameter 0.2 μm; Schleicher & Schüll, Dassel) before use. In all chromatographies, the sample loop had a volume of 20 μl. The detection took place at 260 nm instead of. The elution profiles were evaluated using the gold version 7.11U computer program (Beckmann Instruments, Munich). The nucleotide-activated sugars were identified by cochromatography and by comparing the retention times with standard substances. For the quantification of the sugars, a three-point calibration of the peak areas depending on the concentration was carried out with standard substances.

Table 6

Retention times of UV-active substances. .

Example 17

NMR spectroscopy

The GDP-activated sugars were identified by NMR spectroscopy. The Η, ^I3 C and ^3I P spectra were recorded on a 400 MHz device (Bruker AC 400, Bruker-Franzen Analytik, Bremen). The samples to be measured were dissolved in D ₂ 0. The measurements were made at room temperature. The Η-NMR data of bis (triethylammonium) -ß-L-fucopyranosyl-guanosine-5'-pyrophosphate from chemical synthesis were available as a reference for GDP-ß-L-fucose (Schmidt, R. et al., Liebigs Ann. Chem., 121-124, 1991). Example 18

In vivo production of GDP hexoses or of fucosylated or perosaminylated oligosaccharides

Cloned genes (see Example 4) are cloned in vectors under the control of consumable or inducible promoters in a common transcription unit and in microorganisms, preferably E. coli, Slreptomyces sp. or Saccharomyces cerevisiae transformed. The genes are preferred under the control of promoters with lower expression performance, e.g. lacP is cloned to ensure a consistently optimal synthesis of the enzymes in a fermenter culture or a reactor with immobilized cells. Alternatively, the natural genes with their own promoters are used. The activated sugars are applied intracellularly with the aid of suitable glycosyltransferases e.g. WcbH (galactoside-2-L-fucosyltransferase) from Yersinia enterocolitica or from Escherichia coli (RffT) on suitable substrates e.g. Transfer β-galactosides that are either produced biosynthetically in the host cell or added from outside.

Claims

claims

1. A process for the enzymatic production of a guanosine diphosphate (GDP) -6-deoxy-hexose, characterized in that GDP-D-mannose or a related precursor in the presence of one or more enzymes (s), which (s) GDP-D-mannose -4.6-dehydratase (Gmd, RfbD) activity and possibly GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase- (WcaG) or GDP-4-keto-6 -deoxy-D-mannose-4-aminotransferase (RfbE) activity, incubated and the desired product is isolated.

2. The method according to claim 1, characterized in that GDP-4-keto-6-deoxy-D-man-nose, GDP-L-fucose or GDP-L-perosamine are produced from GDP-D-mannose.

3. The method according to claim 1 or 2, characterized in that the enzymes required for the enzymatic synthesis by cloning the genes coding for these enzymes or coding DNA fragments, insertion into one or more vector (s) and transformation into a bacterial or a fungal host cell are available.

4. The method according to claim 3, characterized in that the genes or corresponding DNA regions are first amplified.

5. The method according to claim 3 or 4, characterized gekennzeiclmet. that the genes or DNA fragments are manB, manC, gmd, rfbD, rfbE and / or wcaG.

6. The method according to any one of claims 3 to 5, characterized in that the host cell is E. coli, Bacillus subtilis, Corynebacterium sp .. Staphylococcus carnosus, Streptomyces lividans, Saccharomyces cerevisiae, Schizosaccaramyces pombe, Hansenula polymorpha, Pichia stipidis .

7. The method according to claim 1, characterized in that mannose-6-phosphate and GTP are incubated in the presence of phosphomannomutase (ManB) and GDP-D-mannose synthase (ManC) and GDP-D-mannose or a related product is isolated .

8. The method according to any one of claims 1-7, characterized in that the method is carried out as a batch process.

9. The method according to any one of claims 1-7, characterized in that the method is carried out continuously in an enzyme membrane reactor.

10. The method according to any one of claims 1-7 and 9, characterized in that a buffer solution containing the substrates or other starting materials is continuously percolated over a solid carrier material on which the enzymes are immobilized.

11. Use of a GDP-6-desxoyhexose produced according to one of claims 1 to 10 for coupling to glycosides, oligosaccharides or polysaccharides.

12. Use according to claim 1 1, wherein the coupling takes place in the presence of a protein having glycosyltransferase activity.

13. A process for the production of fucose or perosamine-containing oligo- or polysaccharides, characterized in that a GDP-activated hexose is transferred to an oligo- or polysaccharide by means of a protein which has fucosyl transferase or perosamine transferase activity.