WO1999000496A1

WO1999000496A1 - Novel osteoclast differentiation promoting factor and its gene

Info

Publication number: WO1999000496A1
Application number: PCT/JP1998/002869
Authority: WO
Inventors: Yasuyuki Ishiduka
Original assignee: Sumitomo Pharmaceuticals Company, Limited
Priority date: 1997-06-26
Filing date: 1998-06-26
Publication date: 1999-01-07

Abstract

OPF-U-8 having the activity of promoting osteclast differentiation and proteins similar thereto; peptide fragments of these proteins; the antibodies thereof; drugs containing as the active ingredient these proteins; genes encoding these proteins; expression vectors of these genes; transformants having these expression vectors transferred thereinto; a process for producing recombinant proteins with the use of these transformants; transgenic animals relating to the transfer or defect of these genes; and use of the above proteins in screening osteclast differentiation promoting activity inhibitors. Because of having the activity of promoting osteoclast differentiation, the above novel protein OPF-U-8 is usable as an osteoclast differentiation promoter. Further, OPF-U-8 is useful as a material in screening osteoclast differentiation promoting activity inhibitors. The osteoclast differentiation promoting activity inhibitors thus screened are also usable as drugs.

Description

Description New osteoclast differentiation promoting factor and its gene

TECHNICAL FIELD The present invention relates to a novel osteoclast differentiation promoting factor designated as PF8 and its gene. More specifically, OPF-8 having an osteoclast differentiation promoting activity, a protein similar to OPF-8, a peptide fragment of these proteins, an antibody, a medicament containing these proteins as active ingredients, or these proteins A gene to be encoded, an expression vector for the gene, a transformant into which the expression vector has been introduced, a method for producing a recombinant protein using the transformant, a transgenic animal related to the introduction and deletion of the gene, The present invention relates to use of the protein in screening for an osteoclast differentiation promoting activity inhibitor.

Background art

Bone tissue is replaced by new bone without changing its basic shape due to bone formation by osteoblasts and bone resorption by osteoclasts. This process is called bone remodeling (bone remodeling). Osteoblasts, which play an important role in maintaining the function of living organisms, play a central role in bone formation, and are derived from mesenchymal-derived undifferentiated cells. Differentiate and form bone matrix.

On the other hand, osteoclasts, which play a central role in bone resorption, are derived from bone marrow cells and are formed by differentiation through cell-to-cell contact with osteoblasts. Mature osteoclasts are multinucleated, poorly proliferating giant cells that express the calcitonin receptor and tartrate-resistant acid phosphatase (TRAP). It also has the activity of absorbing calcified tissues such as bone and dentin. -

The balance between bone remodeling by osteoclasts and osteoblasts is balanced by repeated bone resorption by osteoclasts and bone formation by osteoblasts. However, once this imbalance is lost, bone tissue becomes abnormal and presents various diseases.

Osteoporosis is known as a typical disease caused by abnormal bone remodeling. Osteoporosis is classified into high-turn osteoporosis, which is observed in early menopause or hyperthyroidism, and low-turn osteoporosis, which is observed in senile, steroid, and diabetic osteoporosis, based on the turnover rate of bone remodeling. ing. Other than these, diseases such as hypercalcemia and bone destruction associated with bone metastasis of cancer or bone destruction associated with rheumatoid arthritis are known as diseases caused by abnormal bone remodeling. Bone metastasis of these cancers and bone destruction associated with rheumatoid arthritis are diseases resulting from abnormally enhanced functions of osteoclasts.

There have been various searches for effective therapeutic agents for the above diseases, but no definitive therapeutic agent has yet been found. As one of the approaches, a factor that promotes the differentiation of bone marrow cells into osteoclasts or an inhibitor thereof may be a therapeutic agent for the above-mentioned diseases. In other words, the factor that promotes osteoclast differentiation may restore the low turnover of bone remodeling seen in low turnover osteoporosis as described above (J. Bone Miner Res., 7, p65 (1992)). ) However, it is considered that this will be an effective therapeutic agent for low-rotation osteoporosis. On the other hand, an inhibitor of an osteoclast differentiation promoting factor is considered to restore the normal rotation of bone remodeling in high-rotation osteoporosis as described above (Am.J.Med.Sci., 305). (1), p40 (1993) and Mebio., 11 (2), p24 (1994)), are considered to be effective treatments for this high-speed osteoporosis. In addition, bone destruction of cancer patients due to the enhancement of osteoclast function as described above, -

It is conceivable that the inhibitor of osteoclast differentiation promoting factor may also be effective for bone destruction in patients with bone damage.

The osteoclast differentiation promoting factor is also called a bone resorbing factor, and active forms of biminmin D 3, parathyroid hormone (PTH), interleukin 1, and prosthetic grandein have been known so far. However, these factors have various problems, and have not yet become therapeutic agents, and the emergence of new osteoclast differentiation promoting factors is desired.

Disclosure of the invention

An object of the present invention is to provide a novel protein OPF8 having an activity to promote osteoclast differentiation and its gene. More specifically, OPF8 having an osteoclast differentiation promoting activity, a similar protein of OPF8, a peptide fragment of these proteins, an antibody, a medicament containing these proteins as an active ingredient, or these proteins A gene encoding the same, an expression vector for the gene, a transformant into which the expression vector has been introduced, a method for producing a recombinant protein using the transformant, a transgenic animal related to the introduction and deletion of the gene, The present invention provides a use of the protein in screening for an inhibitor of osteoclast differentiation promoting activity.

The present inventors searched for an osteoclast differentiation promoting factor from the BW514 cells, which are bone metastatic cells, by the expression cloning method, and found that `` TRAP staining '', a marker enzyme for osteoclasts, and We succeeded in discovering a factor that induces bone marrow cells to differentiate into osteoclasts, which have two well-known properties, “ivory degradation activity”. We named this proteinaceous factor having osteoclast differentiation promoting activity OPF8, and completed further studies to complete the present invention. That is, the gist of the present invention is:

(1) DNA encoding the following protein (a) or (b),

(a) a protein consisting of the amino acid sequence of SEQ ID NO: 2

(b) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added from the amino acid sequence of SEQ ID NO: 2, and which has an activity of promoting osteoclast differentiation;

(2) DNA comprising the nucleotide sequence of SEQ ID NO: 1, or a DNA which hybridizes with the DNA under stringent conditions and encodes a protein having osteoclast differentiation promoting activity;

(3) a protein encoded by the DNA according to (1) or (2),

(4) the protein of (3), which comprises the amino acid sequence of SEQ ID NO: 2;

(5) An expression vector containing the DNA according to (1) or (2),

(6) a transformant transformed by the expression vector according to (5),

(7) A method for producing a recombinant protein, comprising culturing the transformant according to (6) under conditions that allow expression of the expression vector according to (5).

(8) a medicine containing the protein according to (3) or (4) as an active ingredient;

(9) a peptide fragment of the protein according to the above (3) or (4), comprising a portion of at least 6 amino acids or more;

(10) an antibody against any one of the protein according to (3) or (4) or the peptide fragment according to (9),

(11) The protein according to (3) or (4) is used. A method for screening for an osteoclast differentiation promoting activity inhibitor,

(12) an osteoclast differentiation promoting activity inhibitor obtained by the screening method according to (11),

(13) The osteoclast differentiation promoting activity inhibitor according to (12), comprising the peptide fragment according to (9) or the antibody according to (10); and

(14) A transgenic animal in which the DNA of the above (1) or (2) is artificially introduced into a chromosome, or any of which is deleted from the chromosome.

In the present invention, the DNA is not particularly limited as long as it is DNA of OPF8 or DNA similar to the OPF8 DNA and encoding a protein having osteoclast differentiation promoting activity. For example, DNA encoding the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or the DNA encoding the protein comprising the amino acid sequence of SEQ ID NO: 2 is exemplified. Furthermore, DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in the amino acid sequence described in SEQ ID NO: 2, or the base described in SEQ ID NO: 1 DNAs that hybridize under stringent conditions to DNAs consisting of sequences are also included in the DNA of the present invention as long as they encode proteins having osteoclast differentiation promoting activity. Hereinafter, these DNAs will be sequentially described.

1) DNA encoding OPF8

Among the above DNAs, “a DNA comprising the nucleotide sequence shown in SEQ ID NO: 1 or a DNA encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2” refers to the DNA encoding the OPF 8 of the present invention. DNA that The DNA can be obtained, for example, by the “expression cloning method” described below. That is, first, bone metastatic cells are used as cells that produce an osteoclast differentiation promoting factor. Therefore, total RNA is prepared from the bone metastatic cells, and then mRNA is prepared from the total RNA. The bone metastasis cell used here includes, for example, a mouse BW5147 cell line. Total RNA can be prepared by a conventional method such as the AGPC method (acid guamdium thiocyanate-phenol-chloroform method; Tuji, Nakamura: Experimental Medicine 9, p99 (1991)). The mRNA can be prepared using an oligo dT cellulose column, for example, by the method described in Molecular Cloning 2nd Ed. Cold Spring Harbor Laboratory Press (1989) and the like.

Next, a cDNA library is prepared based on the obtained mRNA. The cDNA library may be prepared based on total mRNA or

It may be prepared based on the mRNA fraction comprising a part of A. This mRNA fraction is obtained by collecting only the fraction having the osteoclast differentiation promoting activity and the fractions before and after it, among the mRNA fractionated by a conventional method such as sucrose density gradient centrifugation. It can also be prepared (the method of measuring the osteoclast differentiation promoting activity will be described later). One example of a cDNA library is

It can be prepared by a conventional method such as the Gubler & Hoffman method (Gene, 25, p263 (1983)).

Next, the above cDNA library is divided into a plurality of pools. Here, the number of cDNA clones per pool can be arbitrarily determined according to the number of independent clones constituting the cDNA library.For example, it is composed of about ⁶ × 10 ⁵ independent clones. In the case of the cDNA library, it is appropriate to divide it into about 60 pools with lxlO ⁴ clones as one pool for the subsequent operation.

Subsequently, DNA is prepared from each pool by a conventional method, and cRNA is prepared using this DNA as a template. cRNA is, for example, commercially available mRNA It can be easily prepared using the capping kit (Stratagene). Next, translation of cRNA into protein is performed by injecting the cDNA of each pool into the oocytes of Africa frog. The injection into the oocyte can be performed, for example, by the following method. In other words, an egg mass of oocytes was removed from a female African Megafrog, about 10 cm in length, and the oocytes were cut off one by one under a microscope. Stage V or VI intact living cells were selected, and the eggs were selected. Inject cRNA from the capillary into the mother cells using a digital microdispenser or the like. The injection volume per oocyte is preferably 50 nl or less. After culturing for several days, collect the culture supernatant. Since the translation product (protein) translated from cRNA is present in the culture supernatant, this culture supernatant can be used as an assay sample.

Next, the following assay is performed using the culture supernatant sample.

First of all, cells for Atsushi. Since osteoclasts are considered to be cells induced and differentiated from myeloid cells, it is desirable to use these myeloid cells as Atsushi cells. Specifically, for example, the epiphyses of femurs and tibias of 6- to 12-week-old mice were cut off, and bone marrows were collected in a 1 ml Hi-MEM medium using a syringe with a 26 G needle once from each end. The extruded cells are beveled, and the supernatant portion excluding the precipitated bone debris can be used as bone marrow cells. The prepared bone marrow cells are suspended in a culture solution containing active vitamin D, adjusted to an appropriate concentration (eg, 2 × 10 ⁶ cells / ml), and spread on a plate (eg, a 96-well plate). Then, the above-mentioned Africa Megafell culture supernatant sample (sample for Atsey) was added thereto, and subjected to TRAP staining, which is a known method for identifying osteoclasts, and a method for forming a resorption pit (pit) using ivory, and Pools that show positive results in any of the identification methods are selected. Here, TRAP staining is carried out, for example, according to Endocrinology, 122, pl373 (1988), etc. First, bone marrow cells treated with the sample for Atsusei as described above are fixed with acetonitrile buffer, and then the substrate (Naphtholol) is added in the presence of tartaric acid. The reaction can be detected by reacting AS-Mxphosphate) with a dye (Fastredviolet LB salt) at 37 ° C for about 1 hour. For the pit formation measurement, for example, a dentin slice of about 6 thighs and about 1 thigh in thickness was laid on the bottom of a 96-well el-plate, and the above-mentioned assay was performed on this well. After the bone marrow cells have been treated with the sample for the appropriate period, the cells on the dentin slice are stained with TRAP, treated with 0.25% trypsin-0.02% EDTA, overnight, and the cells on the slice are siliconized. After scraping with a scraper, the pits (absorbent pits) on the dentin slice can be observed under a microscope and counted.

A pool that shows a positive result in the above identification method is further divided into subpools, and the same procedure is repeated to finally obtain a clone encoding the 0PF8 of the present invention.

The nucleotide sequence of the 0PF DNA cloned by the expression cloning method as described above can be determined by a sequencer using, for example, an Auto Read Sequencin kit (Pharmacia), or BcaBEST Sequencing using the dideoxy method. With a kit (TAKARA), the nucleotide sequence can also be determined using RI.

Even without using such an "expression-cloning method", with the release of the nucleotide sequence of the 0PF8 cDNA of the present invention, all or a part of the cDNA can be used as a probe or PCR primer, The 0PF DNA of the present invention can be cloned. The cloning is performed, for example, by Molecular Cloning 2nd Edt. Cold Spring Harbor Laboratory According to Press (1989) and the like, it can be easily performed by those skilled in the art.

2) DNA encoding a modified protein or allelic variant of OPF8

Among the above DNAs, “consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added from the amino acid sequence described in SEQ ID NO: 2, and having osteoclast differentiation promoting activity "DNA encoding protein" refers to a DNA that encodes a protein having an osteoclast differentiation promoting activity among artificially produced so-called modified proteins and allelic variants present in vivo. . The DNA encoding the protein can be obtained by techniques such as site-directed mutagenesis (Methods in Enzymology, 100, p468 (1983)) and PCR (Molecular Cloning 2nd Edt. Chapter 15, Cold Spring Harbor Laboratory Press (1989)). deletion, the here _c Note that can be easily fabricated by those skilled in the art, deletions, number of amino acid residues to be substituted and / or added, by a known method such as the site-directed mutagenesis, Refers to the number that can be replaced and / or added.

Here, the “osteoclastic differentiation promoting activity” refers to, for example, the action of the modified protein of the present invention (the expression product of DNA encoding the modified protein of the present invention) on bone marrow cells prepared as described above. After that, it can be easily measured by examining the known action of osteoclasts—that is, TRAP staining and ivory degradation activity. Specifically, in item 1) above or 2.

Please refer to 3.1-2.3.2.2. By providing various modified proteins and the like to such a method for measuring osteoclast differentiation promoting activity, modified proteins having osteoclast differentiation promoting activity can be easily selected.

3) DNA that hybridizes under stringent conditions with 0PF Among the above-mentioned DNAs, “DNA that hybridizes with DNA consisting of the nucleotide sequence of SEQ ID NO: 1 under stringent conditions and encodes a protein having osteoclast differentiation promoting activity” This refers to DNA that hybridizes under stringent conditions to mouse OPF8 DNA consisting of the nucleotide sequence of SEQ ID NO: 1 such as OPF8 cDNA of all vertebrates such as human and rat.

Here, “DNA that hybridizes under stringent conditions” refers to, for example, the sequence number under standard hybridization conditions (formamide concentration: 50%, salt concentration: 5 XSSC, temperature: 42 ° C). : Refers to DNA that hybridizes with the DNA of 1.

These DNAs are cloned by, for example, hybridization with the DNA of SEQ ID NO: 1, but specific cDNA library preparation, hybridization, selection of positive colonies, and base sequence All operations such as determination are known and can be easily performed with reference to, for example, Molecular Cloning 2nd Edt. Cold Spring Harbor Laboratory Press (1989). One example of a cDNA library is a cDNA library derived from human bone tissue or kidney. Examples of the probe used for hybridization include, for example, DNA having the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the protein is a protein encoded by the above-described various DNAs of the present invention, and has an activity of promoting osteoclast differentiation. The protein of the present invention having an amino acid sequence, such as OPF8, is mentioned.

These proteins are expressed and produced by, for example, ligating the DNA of the present invention to a known expression vector such as pBK-CMV, and then introducing the protein into an appropriate host. By doing so, it can be obtained. The host may be a prokaryotic or eukaryotic cell. For example, Escherichia coli strains and animal cell strains are already widely spread and readily available unless otherwise specified. For example, animal cell hosts include COS-1, COS-7, and CHO cells. To transform an appropriate animal cell host using the expression plasmid, a known method such as the LIPOFECTIN method (Feigner PL, et al, Proc. Natl. Acad. Sci. USA, 84, p7413 (1987)) is used. I just need. Since the culture supernatant of the transformed cells contains the expressed protein to the extent that it can be directly used in various assays by appropriate dilution, the osteoclast differentiation promoting activity should be measured using the culture supernatant. (See above for activity assay). The expressed protein produced in the culture supernatant can be easily purified by a known method using zinc chelate agarose, concanavalin A agarose, Sephadex G-150, or the like.

The protein of the present invention can also be used as an active ingredient of a medicament. That is, a “medicine” containing the protein of the present invention as an active ingredient can be used, for example, as an osteoclast differentiation promoting agent. More specifically, as described in the section of “Prior Art”, it can be an effective therapeutic agent for low-rotation osteoporosis and the like observed in senile, steroid, and diabetic osteoporosis.

As a method of administering such an osteoclast differentiation promoting agent to a patient, intravenous injection is preferable, but oral administration, administration as a suppository, subcutaneous injection, intramuscular injection, local injection, intraperitoneal administration and the like can be performed. The osteoclast differentiation promoting agent of the present invention can be administered in various unit dosage forms depending on the above-mentioned administration method. For example, for intravenous administration, the protein of the present invention is used by dissolving or suspending it in a pharmaceutically acceptable carrier, preferably an aqueous carrier. be able to. As the aqueous carrier, for example, water, buffered water, 0.4% physiological saline, and the like can be used. The aqueous solution thus prepared can be packaged as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous solution before administration.

The above preparations may contain pharmaceutically acceptable auxiliaries, such as ph regulators or buffers, tonicity regulators, infiltrants, and more specifically, for example, sodium acetate, sodium lactate, chloride It can contain sodium, potassium chloride, calcium chloride, sorbine monolaurate, triethanolamine oleate and the like.

For oral administration, the proteins of the present invention can be used in unit dosage forms of powders, tablets, pills, capsules and sugars. For local administration, a unit dosage form containing, for example, azoles may be used.

For subcutaneous injection, intramuscular injection, local injection, and intraperitoneal administration, the protein of the present invention can be used by dissolving or suspending it in an aqueous or oil carrier. Alternatively, it can be administered as a sustained-release preparation using a biocompatible material such as collagen.

The dose of the above-mentioned osteoclast differentiation promoting agent can be administered at a daily dose of about 0.0001 to 100 mg until the symptoms are improved.

In the present invention, the peptide fragment refers to a peptide fragment comprising at least 6 amino acids or more in the amino acid sequence of the protein of the present invention. Here, the limitation of "at least 6 amino acids or more" is based on the fact that the minimum size that can take a stable structure is 6 amino acids, but preferably a peptide having a length of 8 amino acids or more, more preferably 1 amino acid or more. Peptides having a length of about 0 to 20 amino acids are exemplified. Note that the peptide is 10 to If it is as short as about 20 pieces, it can be synthesized with a peptide synthesizer. If it is long, DNA prepared by ordinary genetic engineering techniques (for example, by treatment with restriction enzymes) can be used for animal cells, etc. It can be obtained by expressing the protein in E. coli. It should be noted that the peptide thus produced can be modified by a usual method.

These peptide fragments can be applied to pharmaceuticals as described below, and can also be used for producing antibodies.

In the present invention, an antibody is an antibody against any of the protein of the present invention or a peptide fragment thereof. The antibody can be easily prepared, for example, by immunizing rabbits and the like using the method described in New Cell Engineering Experimental Protocol p210 Shujunsha (1993). Monoclonal antibodies can be easily produced, for example, by using the method described in Protein Experimental Methods for Molecular Biology Research, Chapter 4, Yodosha (1994). Furthermore, it can be a humanized antibody according to Japanese Patent Application No. 62-296890. Examples of the use of the antibody include affinity chromatography, screening of a cDNA library, diagnostic agents and experimental reagents. Furthermore, as described later, it can be used as a medicine.

The protein of the present invention can also be used for screening of an osteoclast differentiation promoting activity inhibitor. Here, the “inhibitor of osteoclast differentiation promoting activity” refers to an agent that inhibits the osteoclast differentiation promoting activity of the protein of the present invention. The “screening method for an osteoclast differentiation promoting activity” can be carried out by adding a candidate inhibitor, which is a test substance, to the above-described system for measuring osteoclast differentiation promoting activity.

For example, among the above-described methods for measuring osteoclast differentiation promoting activity, when screening for an inhibitor by the method of forming resorption pits (pits) using ivory, As described above, the protein of the present invention and the candidate inhibitor are allowed to act on mouse bone marrow cells on the dentin slice. At that time, if the inhibitor candidate substance has an inhibitory action, no resorption pit is formed in the dentin. Inhibitors can be easily screened using the formation of the resorption pits as an indicator.

In the present invention, the osteoclast differentiation promoting activity inhibitor is found by the above screening method, and as described above, means an agent that inhibits the osteoclast differentiation promoting activity of the protein of the present invention. Specific examples of such an osteoclast differentiation promoting activity inhibitor include, for example, those having an inhibitory effect among the peptide fragments of the present invention prepared above and those having a neutralizing activity among the antibodies of the present invention. Is mentioned. As described in the “prior art”, such an inhibitor of osteoclast differentiation promoting activity is used as a therapeutic agent for high-rotation osteoporosis observed in early menopause or hyperthyroidism, etc. It is considered to be an effective therapeutic agent for diseases such as hypercalcemia and bone destruction associated with metastasis, or bone destruction associated with chronic rheumatoid arthritis. The administration method and administration form of the osteoclast differentiation promoting agent may be the same as the administration method and administration form of the osteoclast differentiation promoting agent. The daily dose can be about 0.0001 to 100 mg until the symptom is improved.

In the present invention, a transgenic animal refers to a so-called transgenic animal in which the DNA of the present invention has been artificially introduced into a chromosome, or a so-called knockout animal in which the DNA has been deleted from the chromosome. These transgenic animals can be easily prepared by those skilled in the art based on, for example, disease model mice: Molecular Medicine Extra Edition, Nakayama Shoten (1994). The transgenic animal can be used, for example, as a model animal for the development of a drug such as osteoporosis, or as an animal for screening the drug. Very useful as an object. .

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is an electrophoretogram of the results of Northern blot analysis of the expression distribution of 8 mRNA of OPF in each mouse tissue.

FIG. 2 is an electrophoresis photograph showing the results of Northern blot analysis of the expression distribution of OPF mRNA from mouse 7-day embryo to mouse 17-day embryo.

FIG. 3 is an electrophoretic photograph of the result of examining the tissue distribution of 8 mRNA of human OPF by dot blot analysis of human RNA.

FIG. 4 is an electrophoretic photograph showing the results of RT-PCR analysis of the expression of 8 mRNA of OPF in an osteoblast cell line (osteoblast-like cell line). Figure

In 4, the OPF 8 is indicated as OPFu 8.

Fig. 5 (upper) is a micrograph of the activity of the culture supernatant in which the OPF8 cDNA was expressed in COS cells, as determined by TRAP staining and the formation of pit. Figure 5 (bottom) is a photomicrograph of the results of a similar experiment with the introduction of Vector-1.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in more detail by way of examples as examples of the present invention, but the present invention is not limited to these examples. Example 1

Construction of mouse cDNA library

1.1 Isolation of mRNA from mouse BW5147 cells

1.1.1 Isolation of total RNA

Mouse BW5147 cell line (ATCC CRL 1588) 1 10 ⁸ cells were subjected to AGPC method, acid guanidium thiocyanate-phenol-chloroform method; Experimental RNA 9, 15, p99 (1991)). First, 10 ml of 4 M guanidine isothionate was added to the cell pellet, immediately shaken vigorously, and the solution was partially sheared by passing the solution five times back and forth through 21 dollars of 18 G. . To this solution was added 2M sodium acetate lm1, water-saturated phenol 10ml and black form-isoamyl alcohol

(49: 1) 2 ml were added sequentially and mixed after each addition. Then, the mixture was shaken vigorously, cooled on ice for 15 minutes, and centrifuged at 10,000 g for 20 minutes at 4 ° C. The aqueous layer was separated, added with an equal amount of isopropanol, and mixed well. After placing at --20 ° C for 1 hour, centrifuge at 10,000g for 10 minutes at 4 ° C. C After centrifugation, add 3 ml of 4M guanidine thiocyanate to the RNA precipitate to completely dissolve. Then, an equal volume of isopropanol was added, and the mixture was left at —20 ° C. for 1 hour. Then, after centrifugation at 10,000 g for 15 minutes at 4 ° C, the supernatant was discarded, and the RNA precipitate was washed with 75% ethanol to obtain total RNA. 1.1.2 Isolation of mRNA

Repeat the above procedure several times to collect 15 mg of total RNA and use elution buffer.

(10 mM Tris-HCl (pH 7.5), ImMEDTA and 0.2% SDS) was dissolved in 5 ml, heated at 65 ° C for 2 minutes, and immediately cooled to room temperature. After adding 0.55 ml of 5M NaCl, the solution was washed with a washing buffer (0.5 M NaCl, 10 mM Tris-HC1 (pH 7.5), ImMEDTA, and 0.2% SDS) and oligo dT cellulose (type 7). , Pharmacia Biotech). The mRNA was bound to the column by adding 0.5 g of the column to the column and adding the permeate to the column twice more. After washing the column with 15 ml of wash buffer, the bound RNA was eluted with 4 ml of elution buffer. The eluate was heated at 65 ° C for 2 minutes, then cooled, adjusted to 0.5 M NaCl 1, added to the re-equilibration column again, and the elution procedure was performed in the same manner. So The mRNA was recovered from the eluate by ethanol precipitation and washed with 75% ethanol.

1.1.3 Fractionation of mRNA by sucrose gradient centrifugation

Density gradient fraction (one day; DGF-U) and centrifuge tube treated with getylbirokaone, two different concentrations of RNase-free sucrose solution (5% and 20% (w / v) sucrose) ), 0.1 mM NaCl, 10 mM Tris-HC1 (pH 7.5), lmMEDTA, 0.5% SDS, and make a sucrose gradient in a tube for Beckman SW41 Ti in a density gradient fractionator overnight. Leave at room temperature above to eliminate the discontinuity of the gradient. Next, the mRNA was dissolved in a 200/1 TE solution (99% dimethyl sulfoxide, 10 mM Tris-HC1 (pH 7.5), lmMEDTA, 0.1% SDS) and treated at 37 ° C for 5 minutes. The non-specific association was dissociated by adding 400 1 of 5 mM Tris-HC1 (pH 7.5), lmMEDTA, and 0.5% SDS and heat-treating at 65 ° C. for 10 minutes. Then quench, place on a sucrose density gradient, Beckman SW4

Centrifugation was performed at 20,000 rpm and 14 ° C. for 1 hour at 25 ° C. overnight. After centrifugation, 0.5 ml was fractionated from the tube by fractionation overnight and precipitated with ethanol. mRNA was washed at least three times with 75% ethanol.

1.1.4 Identification of mRNA

A part of the mRNA fractionated into 50 fractions was injected into oocytes of African frogs according to the method described later in 2.1.3, and was translated into protein. The culture supernatant containing this translation product is added to mouse bone marrow cells for use in the assay according to the method described in 2.2.2 described below, and cultured, and then the osteoclasts are differentiated by the TRAP staining method described in 2.3.1. Whether it was formed (ie, which mRNA fraction Whether a factor having osteoclast differentiation-promoting activity is contained therein). As a result, peaks of activity were present in the 27th and 32nd fractions.

1.2 Preparation of cDNA library

The 27th to 33rd peaks of the activity peak fraction were collected as the active fraction, and a cDNA library for this fraction was prepared by a modified method of the Gubler & Hoffman method (Gene, 25, p263 (1983)). That is, a first strand was synthesized from M-MuLV reverse transcriptase using an oligo dT primer having an XhoI site based on 2 g of the mRNA of the active fraction. Subsequently, a second strand was synthesized with DNA Polymerase I, and ligated with EcoRI adapter 1 and XhoI digested. Thereafter, the adapter and the primer were removed by gel filtration (Sephacryl Spin Column; Pharmacia). The above cDNA synthesis step was performed using Stratagene's ZAP cDNA synthesis kit, and the reverse transcriptase was performed using BRL's Superscript II.

Next, EcoRI and Xhol-cut ZAP Express ^™ vector were ligated with the previously prepared cDNA, and then packaged using Gigapack II Gold packing extract (mcrA ヽ mcrBmmr; Stratagene). And infected E. coli strain PLK-F '. As a result, the average length was 2.26 kb, and the number of independent clones was 6.

One 3 × 10 ⁵ cDNA library was obtained.

Example 2

Expression cloning

Overview

The cDNA library prepared in 1. Were divided into a total of 63 pools, and the cDNA of each pool was injected into oocytes of Africa megafrog by the method described in 2.1.2 to 2.1.3 described below, and translated into protein. . The culture supernatant containing this translation product was added to mouse bone marrow cells for Atsey according to the method described in 2.2.2 described below, and subjected to each of the Assay methods described below, and a pool determined to be positive was selected. Furthermore, the positive pool was divided into 10 subpools, cRNA was prepared in the same manner, expressed in oocytes, its activity was measured, and the positive pool was selected. I got a clone.

That is, as a specific assay, in the primary screening, the osteoclast differentiation promoting activity was determined by the TRAP staining method described in 2.3.1 described later, and three positive pools were selected from 63 pools. From the second screening onwards, positive reactions were observed in both the two types of osteoclast differentiation-promoting activity measurement methods described later in 2.3.1, TRAP staining method, and 2.3.2, pit formation method using ivory. The pools shown were selected. First, each of the three pools described above was divided into 10 subpools (1000 clones Z pool) and subjected to each assay.

As a result, the top 3 pools were selected in the order of the strength of the positive reaction, and these 3 pools were further divided into 10 subpools (200 clones / pool), and a third screening was performed. As a result, three positive pools were selected in the order of the strength of the positive reaction, which were divided into 10 subpools (24 clones / pool), and further subjected to a fourth screening. As a result, the top 2 pools were selected in the order of TRAP staining and intense it-forming activity, and the 2 pools were further divided into 36 individual clones and subjected to fifth screening. As a result of the fifth screening, the top three clones were selected in descending order of TRAP staining and pit formation activity. One of the three clones was designated OPF8. The results of each of the OPF 8 tests are described in (Results) below. 2.1 Preparation of samples for Atsushi

2.1.1 DNA preparation

E. coli XL1-B1ue was infected with 1 × 10 ⁴ pfu of lambda phage from each pool and spread on a 15-cm petri dish to form plaques. A plate lysate was prepared by adding 13 ml of SM buffer to this plate. To this phage lysate, DE52 (DEAE cellulose; Petman) was added to adsorb other than phage DNA, and the centrifuged supernatant was re-added with DE52, and the phage DNA in the supernatant was recovered. This DNA was extracted once each with phenol and phenol-chloroform (1: 1), and recovered by ethanol precipitation to obtain phage DNA. The prepared DNA was digested with a restriction enzyme NotI, and 1/50 of the DNA was quantified by 1% agarose electrophoresis.

2.1.2 Synthesis of cRNA

2. At least 1 μg of phage DNA from each pool prepared in 1.1.1 is treated with proteinase K (Stratagene) for 1 hour at 37 ° C, treated with phenolic-monochrome form, and recovered by ethanol precipitation. By doing the template

-The DNA was prepared. Using this DNA, cDNA was synthesized according to the mRNAcapping kit (Stratagene). This was subjected to phenol-chloroform treatment and ethanol precipitation to recover cRNA, and 1/10 of the cRNA was quantified by 1% agarose gel electrophoresis. Then, it was adjusted to a concentration of 〃1 to obtain cRNA for microinjection.

2.1.3 Expression in African oocytes

Out of the § African clawed frog body length 10 cm approximately female Ri preparative egg masses of ^{oocytes, MBS (+ Ca 2+; 88.} OmM NaCl, 1. OmM KC 1, 2. 4mM Na 2 S0 3, 0. 3 _{_{mM C a (N0 3) 2}} 4 H 2 0, 0. 4 ImM CaC 1 2 4H 2 0, 0.82 mM MgS0 4 7 H 2 0, Transfer to a Petri dish containing 10 μg / ml penicillin, 10 μg / ml streptomycin, 50 U / ml varnish, 15 mM Tris-HC1 (pH 7.6)), and use a precision iron and tweezers under a stereomicroscope. The oocytes were dissected out one at a time and live cells without stage V or VI damage were selected. Using a 10-1 digital microdispenser (Drummond), these oocytes were injected with 5 On 1 cRNA per oocyte per capillaries. After that, cells that had died or were damaged were removed, and cultured at 20 ° C. for 3 days in MBS containing 2% FCS. The culture supernatant was centrifuged and further passed through a 0.22 m filter to remove the residue and at the same time to remove bacteria. The supernatant was used as an Atsushi sample.

2.2 Atsushi

2.2.1 Preparation of mouse bone marrow cells

The femur and tibia of a 6-12 week old mouse (C3H / He J; CLEA Japan) were aseptically removed, their epiphyses were cut off, and lml syringes with a 26G needle were applied once from both ends. — MEM medium (10% fetal calf serum, 1

Bone marrow cells were extruded with 00 units / ml 1-nicillin G and 100 μg / ml 1 streptomycin), pipetted well, waited until the bone residue precipitated, and the supernatant was collected. It was further washed once or twice with fresh medium to prepare bone marrow cells for Atsushi.

2.2.2 Osteoclast differentiation and formation method

Additional active vitamin D in bone marrow cells 10- ⁸ M a _{[1, 25 (OH) 2 D} 3 ] Fukumuhi - allowed tendon Nigosa in MEM medium, adjusted to a concentration of 2 X 10 ⁶ cells / ml Then, add 20 を 1 of the assay sample prepared in 180〃1 and 2.1.3 to a 96-well plate, and 37. Under 5% CO _z, and cultured for one or two weeks. During that time, replace the 3Z4 medium with new medium every 3-4 days Then, the same amount of a case sample was newly added. .

2.3 Identification of osteoclasts

2.3.1 TRAP staining method

Trap (tartrate-resistant acid phosphatase), a marker enzyme of osteoclasts, was stained with a substrate. That is, after fixation of the cultured bone marrow cells of 2.2.2 with acetone-citrate buffer, the substrate (Naphthol AS-MXphosphate) and the dye (Fastredviolet LB salt) are reacted at 37 ° C for 1 hour in the presence of tartaric acid. Thus, it was stained (Endocrinology, 122, ρ1373, (1988)). (Result)

OPF8 is a known osteoclast differentiation factor IL-11? Bone marrow cells were treated with (50 ηg / ml) or LIF (25 U / ml) and compared to the TRAP staining of a positive control in which osteoclasts were differentiated and formed.

2.3.2 Pit formation method using ivory

A dentin slice 6 mm in diameter and 1 mm thick from ivory was prepared and

Sterilized by sonication in 0% alcohol. After washing with Hi-MEM, each slice was transferred to the bottom of a 96-well plate, and then osteoclasts were induced from bone marrow cells according to the method described in 2.2.2. After one or two weeks, the osteoclasts on the dentin slice are stained using the TRAP staining method described in 2.3.1, treated with 0.25% trypsin and 0.02% EDTA overnight, and The cells were scraped off with a silicon scraper. The pits (resorption pits) on the dentin slices are observed under a microscope, and the number of the pits or the number of meshes per pit is measured. Activity).

(result) The number of pits formed on the dentin slice of the cells differentiated and formed by OPF8 was 100, and the activity was equal to or higher than that of 35 cells of the positive control LIF (19 U / m1). Turned out to be. (Conclusion)

Since the positive results were obtained in both of the above two identification methods, the OPF

Cells differentiated from bone marrow cells by 8 were osteoclasts, and OPF8 was determined to be a factor having osteoclast differentiation promoting activity.

Example 3

Conversion of recombinant phage DNA to phagemid DNA

ZAP Express vectors can be subcloned by ex vivo insertion of the insert DNA into pBK-CMV. XL1-BlueMRF 'Escherichia coli was infected with ZAP Express phage and ExAssist helper phage to produce pBK-CMV phagemid, killed by heat treatment of the original E. coli, and newly infected with XL0LR E. coli. . The medium was added thereto, cultured for 45 minutes, plated on an LB plate, and cultured.

Example 4

Preparation of plasmid DNA

Positive colonies were picked with a toothpick, cultured overnight in 2 ml of LB (kanamycin 100 µg / ml), and then plasmid was prepared by the alkali-SDS method. This plasmid DNA was cleaved with an appropriate restriction enzyme and subjected to electrophoresis in a 1% agarose gel to confirm insertion of the OPF8 cDNA into the vector. Example 5

決定 Base sequence determination of PF8 cDNA

The nucleotide sequence of the OPF cDNA 8 obtained in Example 4 was determined by Sang This was done by the dideoxy method proposed by Er.

As a result, a cDNA comprising 1400 bp described in SEQ ID NO: 1 in the sequence listing was obtained, and the amino acid sequence of SEQ ID NO: 2 comprising 439 amino acids was determined.

Example 6

Northern blot and dot plot analysis of organ-specific gene expression of OPF8

Total RNA from various tissues such as mouse bone, bone marrow cells and muscle was prepared according to 1.1.1. Then, 10-20 µg of total RNA was dissolved in sample buffer, denatured by heating at 65 ° C for 5 minutes, and subjected to 6% formaldehyde agarose electrophoresis. Then, a nylon filter (Hybond N +, Amersham) ). In addition, MTN blot membrane and human RNA mass spectroscopy (Clontech), in which poly-A + RNA from various tissues had already been blocked, were used. As the probe, the full-length OPF ぅ 8 cDNA (about 1.5 kbp) was labeled with ³² P and used.

The above probe was applied to RNA fixed at 50% (v / v) formaldehyde Z5 XSSC / 5 X Denhardt / 1% (w / v) SDS / 0.01% (w / v) denatured salmon sperm DNA. Hybridized at 42 ° C. and washed in 2 × SSC / 0.1% SDS, 50 ° C., then in 0.1% SSC / 0.1% SDS, 50 ° C. After draining, autoradiography was performed at -80 ° C for 1-3 days. The X-ray film used was Kodak SB5 or Fuji AIF, RX in the presence of an intensifying screen.

(Result)

A of FIG. 1 shows the results of Northern plot analysis of each mouse tissue (10 total RNAs). OPF 8 band (arrow) is slightly in all tissues However, it was expressed. BW5147 cells, a cloning source of OPF8, and osteoblast-like ST2 cells showed higher expression.

FIG. 1B shows the results of Northern blot analysis of mouse and rat bone tissue (20 / g mRNA). As a result, OPF mRNA 8 mRNA is expressed in bone tissues of normal mice, collagen arthritis (CIA) mice, osteopetrosis (op / op) mice, and normal rats and ovariectomized (ovx) rats. Figure 1 shows that OPF8 is widely expressed in bone tissue. Figure 2 shows that OPF8 was expressed in mouse 7-day to 17-day embryos (2 / g mRNA). The result of Xan blot analysis is shown. As a result, the expression level was reduced in the 11-day embryo, but was high in other days.

Figure 3 shows the results of RNA dot plots for human tissues (100-500 ng mRNA). As a result, human OPF mRNA was strongly expressed in kidney and weakly expressed in ovary, liver and lung. From the results of FIG. 3 and FIG. 1, it is preferable to use a cDNA library derived from a kidney or a cDNA library derived from a bone tissue to clone the human OPF8 gene. Example 7

RT-PCR analysis of organ-specific gene expression in 0 P F 8

From total RNA (l〃g) prepared from various cells and tissues according to 1.1.1: First, according to RT-PCR kit (manufactured by PERKIN ELMER), first synthesize double-stranded DNA and use it as template. To perform a PCR reaction. The primer sequence for amplification of this gene is 5, Primer (5'-

TGTCCTCACGCTCACGCTCT —3 ') and 3, Primer (5, 1

TGTGGATACGCCTACTATCA-3 ') was synthesized. The DNA size amplified with these primer combinations is 252 base pairs. G 3 PDH (glyceraldehyde-3-phosphate dehydrogenase) Imaichi (5 'primer is (5' — TGAAGGT CGGTGTGAA

CGGATTTGGC- 3 '), 3, primer (5' - CATGT AGGCCATGAGGTCCACCAC-3 5), DNA Sa I's to be amplified using a 983 bp). The reaction composition and the like are determined according to standard procedures using a DNA cycler under the conditions of heat denaturation at 94 ° C for 1 minute, annealing at 60 ° C for 1 minute, and chain elongation at 72 ° C for 2 minutes. The reaction was performed in cycles. The 1Z10 amount of the reaction mixture was electrophoresed on a 1% agarose gel, and a band was confirmed.

(Result)

Figure 4 shows the results of using all MAI〃g of each tissue as a template. As a result, OPF8 was expressed in four types of osteoblasts and osteoblast-like cells (in FIG. 4, the arrow in the photograph labeled OPFu8). These results were not inconsistent with the results of the Northern blot analysis in FIG. 1, confirming that OPF8 was widely expressed in bone tissue and osteoblasts. In addition, using the same RNA, control G3PDH RT-PC

R was also performed, and this was used as an index of the degree of degradation of each RNA.

Example 8

Expression of OPF8 cDNA in cultured mammalian cells.

The OPF ぅ 8 cDNA obtained in Example 2 was subcloned in pBK-CMV vector and transformed into E. coli JM109 strain. Alkali—S

DNA was prepared by the DS method and purified by two ultracentrifugation methods. The purified DNA was transfected into COS-7 cells using LIPOFECTAMINE (GIBCO BRL). Thereafter, the cells were cultured in a serum-free medium for 5 days, and the culture supernatant was collected to obtain a 0 P F 8 culture supernatant sample.

The activity of the above culture supernatant preparation was determined by the TRAP staining property described in 2.3.1 and 2.3.3. Pit formation activity using two dentin slices was measured by two different identification methods. As a result, bone marrow cells cultured on dentin slices in the presence of the culture supernatant preparation were stained red-brown and showed TRAP positive. Next, as a result of physically scraping the TRAP-positive cells on the ivory slice, pits were formed although TRAP-positive cell residues remained as shown in Fig. 5 (top). As shown in (bottom), when a similar experiment was performed using the culture supernatant of cells into which only one vector had been introduced, neither TRAP-positive cells nor pits were formed.

From the above results, it was clarified that the culture supernatant obtained by introducing OPF8 cDNA into cultured mammalian cells has osteoclast differentiation promoting activity. The invention's effect

According to the present invention, OPF8 having osteoclast differentiation promoting activity, a protein similar to OPF8, a peptide fragment of these proteins, an antibody, a medicament containing these proteins as an active ingredient, or encoding these proteins Gene, an expression vector of the gene, a transformant into which the expression vector has been introduced, a method for producing a recombinant protein using the transformant, a transgenic animal related to the introduction and deletion of the gene, The use of the protein in screening for an inhibitor of osteoclast differentiation promoting activity is provided.

Sequence list SEQ ID NO: 1

Array length: 1 4 0 0

Sequence type: nucleic acid

Number of chains: double strand

Topology: linear

Sequence type: c D N A

Array features

How the features were determined: E

Array

TCACGTTTTT TTTGTACGGT TTGTCTCTAC CCGGGAGGAC CTTGGTTGTC CACCCGTGGG 60 TAGGCAGTGG AGTGCC ATG AAG CGG GCA GCG ATA CGG CTT TGG ACC TTG 109

Met Lys Arg Ala Ala lie Arg Leu Trp Thr Leu

5 10

AAC AAG GGG CTT CTT ACT CAT GGC AGA GGA CTG TCT CAA GGA TCC CAA 157 Asn Lys Gly Leu Leu Thr His Gly Arg Gly Leu Ser Gin Gly Ser Gin

15 20 25

TAC AAA ATA AGT GAA CCC TTA CAC ATC CAT CAA GTT CGA GAC AAG CTG 205 Tyr Lys lie Ser Glu Pro Leu His lie His Gin Val Arg Asp Lys Leu

30 35 40

CGG GAG ATA GTA GGC GTA TCC ACA GTC TGG AGA GAC CAT GTA AAA GCA 253 Arg Glu He Val Gly Val Ser Thr Val Trp Arg Asp His Val Lys Ala

45 50 55

ATG GAG GAA AGG AAG TTA CTT CAT AGT TTT TTG CCT AAA TCA CAG AAA 301 6Z 3W A 9 J¾ ¾iv dsy n9i ΐ¾Λ ojj dJi α ^ χ nt9 dsy usy STH Z 989 9IV VIS III 00V V39 IVO 911 XIO 100 991 XVI VW 3V0 IVD IW OVD

S8T 08 T I

Π9Ί ui9 9i s s ^ i Ι¾Λ nig J usy Λ dJI S9 010 OVO Oil 3IV VW 9IV 9W 919 WO 9IV DDI VOV IW V90 119 991

0 Ϊ 991 09Ϊ Z

J9S ΐ¾Λ STH ^ ΐθ J¾ 9Hd 3Π dsy uig nig oaj J9S ngq s STH

689 DDV 1X9 IVD 09D IDV Oil 9W XXV 0V9 OVD W9 103 09V VXI 39V DVD

T OST ^ 1 on s ^ is ^ dsy an dsy η ^η9 ΐ ΐ ^ Λ J¾ ΐ¾Λ ⁸ II J9S ^ g OJJ

ItS WV XOX 9XV IV9 I1V 9W OVD 9X9 9X0 019 VOV 119 VXV VOX VII 130 9T

9 I OCT Z \

J9S s q J¾ s SIH usy STH usy SIH J s m

131 9IV 9W 00V XOI IVO IW OVO OW OVO 9XV OVl 001 XI9 113 XIO

ozi on

^ ΐΰ ΠΘΊ J9S dsy Π97 dsy naq 9 Π Say ^ ΐ9 a Say ΐ¾Λ J¾ usy 0Ϊ V09 VIO DDV 0V9 1X0 3V9 9V9 XIO XXV 99V 099 IIX V9V VIO VOV IW

90Ϊ 001 36

UI9 ΐ¾Λ J Ι¾Λ J s dsy Say n ^ g OJJ dsy J¾ OJJ 6S WO XI9 I0V 919 IVX VW 3V9 V9D VI3 WD 133 OVO I3V 199 911 X03

06 98 08 9

Ti9q ΙΙΘΊ A nig d \ \ αΑ J9S dsy Say ^ Θ ^ S ^ I Say OJJ OJJ ΓΙΘΙ

m VIO 310 119 W9 OIV OVl I9V IV9 99V 9IV WV 99V ODD V03 VXD 319

9A 99 09 sXq u ^ g J9S sX ^ OJJ na 9 J8S STH sXq S y n | 0 n ^ g

698Z0 / 86df / XDd 96W0 / 66 OW 190 195 200

GTG GCT CGA GAT TCT GAA AAT AAG GGG CCG GCA TTT GTA AAT CCA CTC 733 Val Ala Arg Asp Ser Glu Asn Lys Gly Pro Ala Phe Val Asn Pro Leu

205 210 215

ATT CCG GAA AAT AAA GAG GAA GAA GAG CTC TTT AAA CAA GGA GAA TTG 781 lie Pro Glu Asn Lys Glu Glu Glu Glu Leu Phe Lys Gin Gly Glu Leu

220 225 230 235

AAC AAG AGC CGA AGG ATT GCC TTT AGC ACC AGT TCA TTA CTG AAA GTG 829 Asn Lys Ser Arg Arg lie Ala Phe Ser Thr Ser Ser Leu Leu Lys Val

240 245 250

GCT CCC AGT TCT GAG GAG AGG AAT ATC ATA CAT GAA CTG TTC CTT ACC 877 Ala Pro Ser Ser Glu Glu Glu Arg Asn lie lie His Glu Leu Phe Leu Thr

255 260 265

ACA CTG GAT CCA AAG ACT ATA AGT TTT CAG AGT CGA ATT TTG CCT CCT 925 Thr Leu Asp Pro Lys Thr lie Ser Phe Gin Ser Arg lie Leu Pro Pro

270 275 280

AAA GCA GTG TGG ATG GAG GAT ACA AAA CTC AAG AGC TTG GAT ATT TGT 973 Lys Ala Val Trp Met Glu Asp Thr Lys Leu Lys Ser Leu Asp lie Cys

285 290 295

CAC CCT CAG GAA CGA AAC GTA TTC AAT CGG ATC TTT GGT GGT TTT CTT 1021 His Pro Gin Glu Arg Asn Val Phe Asn Arg lie Phe Gly Gly Phe Leu

300 305 310 315

ATG AGA AAA GCA TAT GAA CTT GCA TGG GCT ACT GCT TGT AGC TTT GGC 1069 Met Arg Lys Ala Tyr Glu Leu Ala Trp Ala Thr Ala Cys Ser Phe Gly

320 325 330 GGT TCC CGG CCA TAT GTG GTA ACA GTG GAT GAT ATC ATG TTT CAG AAG 1117 Gly Ser Arg Pro Tyr Val Val Thr Val Asp Asp lie Met Phe Gin Lys

335 340 345

CCT GTT GAA GTT GGT TCA TTG CTC TTT CTT TCT TCA CAG GTA TGC TTC 1165 Pro Val Glu Val Gly Ser Leu Leu Phe Leu Ser Ser Gin Val Cys Phe

350 355 360

ACC CAG GAC AAT TAC ATC C GTC AGA GTC CAT AGT GAA GTG TCT TCT 1213 Thr Gin Asp Asn Tyr lie Gin Val Arg Val His Ser Glu Val Ser Ser

365 370 375

CTT GAC AGT CGT GAG CAT ATG ACC ACC AAT GTC TTT CAT TTT ACA TTC 1261 Leu Asp Ser Arg Glu His Met Thr Thr Asn Val Phe His Phe Thr Phe

380 385 390 395

ATG TCG GAA AAA GAA GTA CCC TTG ATT TTC CCT AAA ACA TAT GGA GAG 1309 Met Ser Glu Lys Glu Val Pro Leu lie Phe Pro Lys Thr Tyr Gly Glu

400 405 410

TCC ATG TTG TAT TTA GAT GGA CAG CGA CAT TTC AAG TCT ATG AGT ACC 1357 Ser Met Leu Tyr Leu Asp Gly Gin Arg His Phe Lys Ser Met Ser Thr

415 420 425

CCA GTG ACC TTG AAA AAG GAC TAC CCT GTG GAG CCC TAGGATA 1400 Pro Val Thr Leu Lys Lys Asp Tyr Pro Val Glu Pro

430 435

SEQ ID NO: 2

Array length: 4 3 9

Sequence type: amino acid

Topology: linear Sequence type: peptide

Array

Met Lys Arg Ala Ala lie Arg Leu Trp Thr Leu Asn Lys Gly Leu Leu

5 10 15 Thr His Gly Arg Gly Leu Ser Gin Gly Ser Gin Tyr Lys lie Ser Glu

20 25 30

Pro Leu His lie His Gin Val Arg Asp Lys Leu Arg Glu lie Val Gly

35 40 45

Val Ser Thr Val Trp Arg Asp His Val Lys Ala Met Glu Glu Arg Lys 50 55 60

Leu Leu His Ser Phe Leu Pro Lys Ser Gin Lys Val Leu Pro Pro Arg 65 70 75 80

Lys Met Arg Asp Ser Tyr lie Glu Val Leu Leu Pro Leu Gly Thr Asp

85 90 95 Pro Glu Leu Arg Asp Lys Tyr Val Thr Val Gin Asn Thr Val Arg Phe

100 105 110

Gly Arg lie Leu Glu Asp Leu Asp Ser Leu Gly Val Leu Val Cys Tyr

115 120 125

Met His Asn His Asn His Ser Thr Lys Met Ser Pro Leu Ser lie Val 130 135 140

Thr Val Leu Val Asp Lys lie Asp Met Cys Lys His Ser Leu Ser Pro 145 150 155 160

Glu Gin Asp lie Lys Phe Thr Gly His Val Ser Trp Val Gly Asn Thr

165 170 175 Ser Met Glu Val Lys Met Lys Met Phe Gin Leu His Asn Asp Glu Lys 180 185 190

Tyr Trp Pro Val Leu Asp Ala Thr Phe Val Met Val Ala Arg Asp Ser

195 200 205

Glu Asn Lys Gly Pro Ala Phe Val Asn Pro Leulie Pro Glu Asn Lys 210 215 220

Glu Glu Glu Glu Leu Phe Lys Gin Gly Glu Leu Asn Lys Ser Arg Arg 225 230 235 240 lie Ala Phe Ser Thr Ser Ser Leu Leu Lys Val Ala Pro Ser Ser Glu

245 250 255 Glu Arg Asn lie lie His Glu Leu Phe Leu Thr Thr Leu Asp Pro Lys

260 265 270

Thr lie Ser Phe Gin Ser Arg lie Leu Pro Pro Lys Ala Val Trp Met

275 280 285

Glu Asp Thr Lys Leu Lys Ser Leu Asp lie Cys His Pro Gin Glu Arg 290 295 300

Asn Val Phe Asn Arg lie Phe Gly Gly Phe Leu Met Arg Lys Ala Tyr 305 310 315 320

Glu Leu Ala Trp Ala Thr Ala Cys Ser Phe Gly Gly Ser Arg Pro Tyr

325 330 335 Val Val Thr Val Asp Asp lie Met Phe Gin Lys Pro Val Glu Val Gly

340 345 350

Ser Leu Leu Phe Leu Ser Ser Gin Val Cys Phe Thr Gin Asp Asn Tyr

355 360 365

lie Gin Val Arg Val His Ser Glu Val Ser Ser Leu Asp Ser Arg Glu 370 375 380

01

OJd nig Ϊ¾Λ OJd J dsy s

0 f Z OZf

sXl ΙΙΘΊ J¾ ΐ¾Λ OJd J¾ s J9 sXq ai ^ STH Say UT9 dsy

1 ^ OTt- 90

J τΐθΐ ^ 9W J8S nig Xt9 J J¾ s οα ^ 3¾ 311 ngq oaj

00, S6C 06S 98G ητΰ s ^ i nig JQS J¾ 9¾d STH «sy J¾ J¾ STH

8rO / 86d / XDJ 96ΙΌ0 / 66 OAV

Claims

The scope of the claims

1. DNA encoding the following protein (a) or (b):

(a) a protein consisting of the amino acid sequence of SEQ ID NO: 2

(b) a protein comprising an amino acid sequence in which one or more amino acids of the amino acid sequence described in SEQ ID NO: 2 have been deleted, substituted and / or added, and which has osteoclast differentiation promoting activity

2. DNA comprising the nucleotide sequence of SEQ ID NO: 1, or a DNA which hybridizes with the DNA under stringent conditions and encodes a protein having osteoclast differentiation promoting activity.

3. A protein encoded by the DNA according to claim 1 or 2.

4. The protein according to claim 3, consisting of the amino acid sequence of SEQ ID NO: 2.

5. An expression vector containing the DNA of claim 1 or 2.

6. A transformant transformed by the expression vector according to claim 5.

7. A method for producing a recombinant protein, comprising culturing the transformant according to claim 6 under conditions that allow expression of the expression vector according to claim 5.

8. A medicament comprising the protein according to claim 3 or 4 as an active ingredient.

9. A peptide fragment comprising at least 6 amino acids or more of the protein of claim 3 or 4.

10. An antibody against any one of the protein according to claim 3 or 4, or the peptide fragment according to claim 9.

11. A method for screening for an osteoclast differentiation promoting activity inhibitor, comprising using the protein according to claim 3 or 4.

12. An osteoclast obtained by the screening method according to claim 11. Differentiation promoting activity inhibitor.

13. The osteoclast differentiation promoting activity inhibitor according to claim 12, comprising the peptide fragment according to claim 9 or the antibody according to claim 10.

14. A transgenic animal in which the DNA according to claim 1 or 2 is artificially introduced into a chromosome, or one of which is deleted from the chromosome.