WO1998057989A1 - Heregulin-like factor - Google Patents
Heregulin-like factor Download PDFInfo
- Publication number
- WO1998057989A1 WO1998057989A1 PCT/US1998/012403 US9812403W WO9857989A1 WO 1998057989 A1 WO1998057989 A1 WO 1998057989A1 US 9812403 W US9812403 W US 9812403W WO 9857989 A1 WO9857989 A1 WO 9857989A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hlf
- amino acid
- seq
- polypeptide
- sequence
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
Definitions
- the present invention relates to a novel human gene encoding a polypeptide which is a novel member of the heregulin family. More specifically, isolated nucleic acid molecules are provided encoding a human polypeptide named heregulin-like factor, hereinafter referred to as "HLF". HLF polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to primary cancers, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of HLF activity.
- erb 2 The proto-oncogene termed erb 2 (or HER2) encodes a 185 kDa transmembrane tyrosine kinase molecule designated pi 85erbB2.
- the overexpression of this receptor molecule correlates strongly with a poor prognosis in a number of human cancers including, among others, breast, ovarian, endometrium, fallopian tube, cervix, and colon (Nowak, F., et al., Exp. Cell Res. 231:251-259; 1997; Cirisano, F. D. and Karlan, B. Y., J. Soc. Gynecol. Investig. 3(3):99-105; 1996).
- HRG heregulin
- a second, related HRG molecule of 52 kDa which may be the product of a novel gene, rather than a novel HRG gene splice product, has been identified which exhibits similar characteristics including induction of transient membrane ruffling, lamellipodia formation, cell motility and proliferation of human breast cancer cells (Kung, W., et al, Biochem. Biophys. Res. Commun. 202(3): 1357-1365; 1994).
- heregulins can induce tyrosine phosphorylation not only of pl85erbB2, but of several additional EGFR-related family members including erbB3 and pl80erbB4 (Tzahar, E., et al, J. Biol Chem. 269:25226-25223; 1994; Plowman, G. D., et al, Nature 366:473-475; 1993).
- HRG were also compared to EGF and to the growth-inhibitory anti-ErbB2 antibody 4D5.
- HRG stimulation of DNA synthesis correlated with positive effects on cell cycle progression and cell number and with enhancement of colony formation in soft agar.
- similar effects have also been recently observed on human Schwann cells (Levi, A. D., et al, J. Neurosci. 15(2): 1329-1340; 1995; Morrissey, T. K., et al, Proc. Natl. Acad. Sci.
- the heregulin family of proteins consists at least of a number of splice variants of heregulin, the Neu differentiating factor, the glial growth factors-I, -II, and -III, and a protein that stimulates muscle acetylcholine receptor synthsis (ARIA).
- polypeptides that function as regulators of oncogenic events and existing tumors. Therefore, there is a need for identification and characterization of such human polypeptides which can play a role in detecting, preventing, ameliorating or correcting such disorders.
- the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of the HLF polypeptide having the complete amino acid sequence shown in S ⁇ Q ID NO:2 or the complete amino acid sequence encoded by the cDNA clone deposited was deposited as plasmid DNA with the American Type Culture Collection ("ATCC") on June 19, 1997, and assigned ATCC Deposit Number 209123.
- ATCC American Type Culture Collection
- the ATCC is located at 10801 University Boulevard, Manassas, Virginia 20110-2209.
- nucleotide sequence determined by sequencing the deposited HLF clone which is shown in Figures 1 A and IB (SEQ ID NO: 1), contains an open reading frame encoding a complete polypeptide of 157 amino acid residues, beginning in frame with a serine residue at the amino-terminal end of the polypeptide corresponding to nucleotide positions 2-4, and a predicted molecular weight of about 17.7 kDa.
- Nucleic acid molecules of the invention include those encoding the complete amino acid sequence shown in SEQ ID NO:2, or the complete amino acid sequence encoded by the cDNA clone in ATCC Deposit Number 209123, which molecules also can encode additional amino acids fused to the N-terminus of the HLF amino acid sequence.
- the HLF protein of the present invention shares sequence homology with the translation product of the human mRNA for heregulin (Figure 2; SEQ ID NO:3), including the following conserved domains: (a) the predicted extracellular domain of about 101 amino acids; (b) the predicted transmembrane domain of about 19 amino acids, and (c) the predicted intracellular domain of about 35 amino acids. Heregulin is thought to be important in oncogenesis.
- one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the HLF polypeptide having the complete amino acid sequence in SEQ ID NO:2 (i.e., positions 1 to 157 of SEQ ID NO:2) or the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
- nucleotide sequence encoding the predicted intracellular domain of the HLF polypeptide having the amino acid sequence in SEQ ID NO:2 (i.e., positions 122 to 157 of SEQ ID NO:2) or as encoded by the cDNA clone contained in ATCC Deposit No. 209123; (e) a nucleotide sequence encoding a soluble HLF polypeptide having the extracellular and intracellular domains but lacking the transmembrane domain; and (f) a nucleotide sequence complementary to any of the nucleotide sequences in (a) through (e) above.
- nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to (or as stated in another way, a nucleotide sequence at most 10% different, and more preferably 5%, 4%, 3%, 2% or 1% different from), any of the nucleotide sequences in (a) through (f) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a) through (f) above.
- the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of HLF polypeptides or peptides by recombinant techniques.
- the invention further provides an isolated HLF polypeptide comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of the HLF polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 (i.e., positions 1 to 157 of SEQ ID NO:2) or the complete amino acid sequence encoded by the cDNA clone contained in the ATCC Deposit No.
- polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical (or at most 20% different), more preferably at least 90% identical (or at most 10% different), and still more preferably 95%, 96%, 97%, 98% or 99% identical to (or 5%, 4%, 3%, 2% or 1 % different from) those described in (a), (b), (c), (d), or (e) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above.
- An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a HLF polypeptide having an amino acid sequence described in (a), (b), (c), (d), or (e) above.
- Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a HLF polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.
- the invention provides an isolated antibody that binds specifically to a HLF polypeptide having an amino acid sequence described in (a), (b), (c), (d), or (e) above.
- the invention further provides methods for isolating antibodies that bind specifically to a HLF polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.
- compositions comprising a HLF polynucleotide or an HLF polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism.
- the compositions comprise a HLF polynucleotide for expression of a HLF polypeptide in a host organism for treatment of disease.
- Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of a HLF
- the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a biological activity of the HLF polypeptide, which involves contacting a receptor which is inhibited or enhanced by the HLF polypeptide with the candidate compound in the presence of an HLF polypeptide, assaying changes in tyrosine phosphorylation states of the receptor and/or other molecules downstream in the corresponding signal transduction cascade in the presence of the candidate compound and of HLF polypeptide, and comparing the receptor activation state to a standard level, the standard being assayed when contact is made between the receptor and in the presence of the HLF polypeptide and the absence of the candidate compound In this assay, an increase in receptor activation state over the standard indicates that the candidate compound is an agonist of HLF activity and a decrease in receptor activation state compared to the standard indicates that the compound is an antagonist of HLF activity.
- a screening assay for agonists and antagonists involves determining the effect a candidate compound has on HLF binding to a receptor.
- the method involves contacting the receptor with an HLF polypeptide and a candidate compound and determining whether HLF polypeptide binding to the receptor is increased or decreased due to the presence of the candidate compound.
- an increase in binding of HLF over the standard binding indicates that the candidate compound is an agonist of HLF binding activity and a decrease in HLF binding compared to the standard indicates that the compound is an antagonist of HLF binding activity.
- HLF gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" HLF gene expression level, i.e., the HLF expression level in healthy tissue from an individual not having the neural system disorder.
- tissues e.g., cancerous and wounded tissues
- bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
- the invention provides a diagnostic method useful during diagnosis of such a disorder, which involves: (a) assaying HLF gene expression level in cells or body fluid of an individual; (b) comparing the HLF gene expression level with a standard HLF gene expression level, whereby an increase or decrease in the assayed HLF gene expression level compared to the standard expression level is indicative of disorder in the neural system.
- An additional aspect of the invention is related to a method for treating an individual in need of an increased level of HLF activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated HLF polypeptide of the invention or an agonist thereof.
- a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of HLF activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of an HLF antagonist.
- Preferred antagonists for use in the present invention are HLF-specific antibodies.
- Figures 1A and IB shows the nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO:2) of HLF.
- SEQ ID NO: 1 nucleotide sequence
- SEQ ID NO:2 deduced amino acid sequence
- EGF epidermal growth factor
- Figure 2 shows the regions of identity between the amino acid sequences of the HLF protein and translation product of the human mRNA for heregulin (SEQ ID NO:3), determined by the computer program Bestfit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) using the default parameters.
- Figure 3 shows an analysis of the HLF amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
- the positive peaks indicate locations of the highly antigenic regions of the HLF protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
- Figure 4 shows a demonstration of the biochemical activity of a recombinant EGF domain of the HLF protein (designated "H" in the figure; as described in Example 5).
- the figure shows a Western blot of MCF-7 cell lysates prepared from cultures which were treated or mock-treated with recombinant EGF domain of the HLF protein or with recombinant heregulin. The blots were immunoblotted with an anti-phosphotyrosine monoclonal antibody.
- FIG. 5 shows the amino acid sequences of the EGF/heregulin family of growth factors and of the NRG-3 novel sequences. Cysteines (C) defining the basic structure of the EGF domain and highly conserved amino acids are in bold. Listed are sequences for the EGF-like domains of transforming growth factor (TGF)-a (SEQ ID NO: 11); epidermal growth factor (EGF; SEQ ID NO: 12; SEQ ID NO: 12; SEQ ID NO: 11
- HB-EGF heparin-binding EGF
- amphiregulin heparin-binding EGF
- the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a HLF polypeptide having the amino acid sequence shown in SEQ ID NO:2, which was determined by sequencing a cloned cDNA.
- the nucleotide sequence shown in Figures 1A and IB (SEQ ID NO: l) was obtained by sequencing the HAGFE38 clone, which was deposited on June 19, 1997 at the American Type Culture Collection, 12301 Park Lawn
- the ATCC is now located at 10801 University Boulevard., Manassas, VA 20110-2209), and given accession number ATCC 209123.
- the deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
- the HLF protein of the present invention shares sequence homology with the translation product of the human mRNA for heregulin (Figure 2; SEQ ID NO:3). Heregulin is thought to be an important molecule in the activation pathways of the erbB family of cell surface receptors.
- NDF neu differentiation factor
- HLF is a member of the same heregulin family of proteins and has, at least, activities similar to those described above for heregulin and NDF.
- nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical (or 10% different), more typically at least about 95% to at least about 99.9% identical to (or at most about 5% to at most about 0.1 % different from) the actual nucleotide sequence of the sequenced DNA molecule.
- nucleotide sequence of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U).
- nucleic acid molecule of the present invention encoding a HLF polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
- standard cloning and screening procedures such as those for cloning cDNAs using mRNA as starting material.
- nucleic acid molecule described in Figures 1A and IB was discovered in a cDNA library derived from human amygdala.
- the determined nucleotide sequence of the HLF cDNA of Figures 1A and IB contains an open reading frame encoding a protein of 157 amino acid residues, with an amino-terminal serine codon at nucleotide positions 2-4 of the nucleotide sequence in Figure 1A (SEQ ID NO:l), and a deduced molecular weight of about 17J kDa.
- HLF protein shown in SEQ ID NO:2 is about 32.7% identical to human mRNA for heregulin ( Figure 2).
- the nucleotide and amino acid sequence of human heregulin has been reported by Holmes and colleagues (Science 256: 1205- 1210; 1992; GenBank Accession No. M94166).
- the open reading frame of the HLF gene shares sequence homology with the translation product of the human mRNA for heregulin ( Figure 2; SEQ ID NO:3), including the conserved EGF domain in HLF of about 67 amino acids (amino acids 26-93 of SEQ ID NO:2).
- Heregulin is thought to be important in the regulation of the activation state of the erbB family of cell surface receptors, in the regulation of cellular growth control, and ultimately in the regulation of oncogenesis.
- HLF may also be involved in the regulation of the activation state of the erbB family of cell surface receptors, in the regulation of cellular growth control, and ultimately in the regulation of oncogenesis.
- the actual complete HLF polypeptide encoded by the deposited cDNA which comprises about 157 amino acids, may be somewhat longer or shorter. More generally, the actual open reading frame may be anywhere in the range of ⁇ 100 amino acids, ⁇ 20 amino acids, more likely in the range of ⁇ 10 amino acids, of that predicted from the serine codon at the N-terminus shown in Figure 1 A (SEQ ID NO: 1).
- the exact "address" of the extracellular, EGF, transmembrane, and intracellular domains of the HLF polypeptide may differ slightly from the predicted positions above.
- the exact location of the HLF EGF domain in SEQ ID NO:2 may vary slightly (e.g., the address may "shift" by about 1 to about 20 residues, more likely about 1 to about 5 residues) depending on the criteria used to define the domain.
- the ends of the transmembrane domain and the beginning of the EGF domain were predicted on the basis of the identification of the conserved cysteine residues at positions 35,
- the invention further provides polypeptides having various residues deleted from the N-terminus of the complete polypeptide, including polypeptides lacking one or more amino acids from the N-terminus of the extracellular EGF domain described herein, which constitute soluble forms of the extracellular EGF domain of the HLF protein.
- nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
- the DNA may be double-stranded or single-stranded.
- Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
- isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment
- recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
- Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
- Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
- Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) beginning in frame with a serine codon at positions 2-4 of the nucleotide sequence shown in Figure 1A (SEQ ID NO: 1).
- isolated nucleic acid molecules of the invention include
- DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the HLF protein.
- the genetic code and species-specific codon preferences are well known in the art.
- the invention provides isolated nucleic acid molecules encoding the HLF polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 209123 on June 19, 1997.
- the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figures 1A and IB (SEQ ID NO:l) or the nucleotide sequence of the HLF cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
- isolated molecules particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the HLF gene in human tissue, for instance, by Northern blot analysis.
- the present invention is further directed to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as to fragments of the isolated nucleic acid molecules described herein.
- the invention provides a polynucleotide having a nucleotide sequence representing the portion of SEQ ID NO: l which consists of positions 1-2199 of SEQ ID NO: 1.
- the invention provides nucleic acid molecules having nucleotide sequences related to a portion of SEQ ID NO: 1 which has been determined from the following related cDNA clone: HAGFE38R.
- the invention includes a polynucleotide comprising any portion of at least about 30 nucleotides, preferably at least about 50 nucleotides, of SEQ ID NO: 1 from residue about 1 to about 220 and from about 400 to 2199. More preferably, the invention includes a polynucleotide comprising nucleotide residues 1 to 2199, 1 to 1500, 1 to 1000, 1 to 500, 1 to 250, 250 to 2199, 250 to 1500, 250 to 1000, 250 to 500, 500 to 2199, 500 to 1500, 500 to 1000, 1000 to 2199, and 1000 to 1500.
- nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the HLF polypeptide as identified in Figure 3 and described in more detail below.
- the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit No. 209123, or, for example, any specific HLF polynucleotide fragment described above (a non-limiting example is a Chou-Fasman alpha turn region).
- stringent hybridization conditions is intended overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65° C.
- a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
- a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly (A) tract of the HLF cDNA shown in Figure IB (SEQ ID NO: 1)
- a complementary stretch of T (or U) residues would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
- nucleic acid molecules of the present invention which encode an HLF polypeptide may include, but are not limited to those encoding the amino acid sequence of the complete polypeptide, by itself; and the coding sequence for the complete polypeptide and additional sequences, such as those encoding an added secretory leader sequence, such as a pre-, or pro- or prepro- protein sequence.
- nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
- additional, non-coding sequences including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
- the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
- the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
- hexa-histidine provides for convenient purification of the fusion protein.
- the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the HLF protein. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant” is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II,
- Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
- variants include those produced by nucleotide substitutions, deletions or additions.
- the substitutions, deletions or additions may involve one or more nucleotides.
- the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the HLF protein or portions thereof. Also especially preferred in this regard are conservative substitutions.
- nucleic acid molecules encoding the EGF domain of the protein having the amino acid sequence shown in SEQ ID NO:2 or the EGF domain of the HLF amino acid sequence encoded by the deposited cDNA clone (nucleotides 77-280 of SEQ ID NO: 1).
- one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the HLF polypeptide having the complete amino acid sequence in SEQ ID NO:2 (i.e., positions 1 to 157 of SEQ ID NO:2) or the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
- nucleotide sequence encoding a soluble HLF polypeptide having the extracellular and intracellular domains but lacking the transmembrane domain; and (f) a nucleotide sequence complementary to any of the nucleotide sequences in (a) through (e) above.
- nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e) or (f), above.
- This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
- An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of an HLF polypeptide having an amino acid sequence in (a), (b), (c), (d) or (e), above.
- the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of HLF polypeptides or peptides by recombinant techniques.
- a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence encoding an HLF polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the HLF polypeptide.
- a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
- These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
- nucleotide sequence shown in Figures 1A and IB or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences.
- the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
- nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the HLF polypeptide.
- a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
- the query sequence may be an entire sequence shown in SEQ ID NO: 1 , the ORF (open reading frame), or any fragement specified as described herein.
- nucleic acid molecule or polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%, 3%, 2% or 1% different from) a nucleotide sequence of the presence invention can be determined conventionally using known computer programs.
- a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the
- RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity.
- the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the
- 5' and 3' bases of the subject sequence are calculated for the purposes of manually adjusting the percent identity score.
- a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
- the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/ alignement of the first 10 bases at 5' end.
- the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining
- a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
- the present application is directed to nucleic acid molecules at least
- nucleic acid sequence shown in Figures 1A and IB SEQ ID NO:l
- nucleic acid sequence of the deposited cDNA irrespective of whether they encode a polypeptide having HLF activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having HLF activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
- PCR polymerase chain reaction
- nucleic acid molecules of the present invention that do not encode a polypeptide having HLF activity include, inter alia, ( 1 ) isolating the HLF gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the HLF gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and Northern Blot analysis for detecting HLF mRNA expression in specific tissues.
- FISH in situ hybridization
- nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%,
- a polypeptide having HLF protein activity includes polypeptides that also exhibit any of the same binding and phosphorylation state altering activities in the above-described assays in a dose-dependent manner.
- the degree of dose-dependent activity need not be identical to that of the HLF protein, preferably, "a polypeptide having HLF protein activity” will exhibit substantially similar dose-dependence in a given activity as compared to the HLF protein (i.e.. the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference HLF protein).
- HLF binding of HLF, or variants thereof, to a particular receptor molecule
- binding of HLF, or variants thereof, to a particular receptor molecule may be assayed by cross-linking HLF, or an HLF variant, to whichever receptor it binds on the cell surface and then immunoprecipitating the resulting ligand/receptor complex with a specific antiserum.
- Such an assay will thereby indicate a specific receptor binding profile for the HLF protein(s).
- 12 T- labeled HLF, or HLF variant, protein is cross-linked to any of a variety of cells or cell lines by incubating a suspension of cells and 10 6 CPM of 125 I-labeled
- Immunoprecipitations are then performed using portions of treated and mock-treated cultures combined with antisera to specific cellular receptor molecules. Samples are then prepared in SDS sample buffer, analyzed by SDS-PAGE (5.5% polyacrylamide gels), and visualized by autoradiography.
- nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to (or at most 10%, 5%, 4%, 3%, 2% or 1% different from) the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figures 1A and IB (SEQ ID NO:l) will encode a polypeptide "having
- the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of HLF polypeptides or fragments thereof by recombinant techniques.
- the vector may be, for example, a phage, plasmid, viral or retroviral vector.
- Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
- the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
- a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
- the expression vectors will preferably include at least one selectable marker.
- markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
- bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium cells
- fungal cells such as yeast cells
- insect cells such as Drosophila S2 and Spodoptera Sf9 cells
- animal cells such as CHO, COS, 293 and Bowes melanoma cells
- plant cells Appropriate culture mediums and conditions for the above-described host cells are known in the art.
- vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc., supra; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
- preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
- Other suitable vectors will be readily apparent to the skilled artisan.
- Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
- the polypeptide may be expressed in a modified form, such as a fusion protein (comprising the polypeptide joined via a peptide bond to a heterologous protein sequence (of a different protein)), and may include not only secretion signals, but also additional heterologous functional regions.
- a fusion protein comprising the polypeptide joined via a peptide bond to a heterologous protein sequence (of a different protein)
- heterologous protein sequence of a different protein
- Such a protein can be made by ligating polynucleotides of the invention and the desired nucleic acid sequence encoding the desired amino acid sequence to each other, by methods known in the art, in the proper reading frame, and expressing the fusion protein product by methods known in the art.
- a fusion protein can be made by protein synthetic techniques, e.g. by use of a peptide synthesizer.
- EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
- the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
- HLF protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography
- Polypeptides of the present invention include: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
- N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
- the invention further provides an isolated HLF polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
- HLF polypeptides may be employed.
- Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins including single or multiple amino acid substitutions, deletions, additions or fusion proteins.
- modified polypeptides can show, e.g., enhanced activity or increased stability.
- they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
- N-terminal amino acids up to the cysteine at position 35 of SEQ ID NO:2 may retain some biological activity such as receptor binding and the inititation of the corresponding signal transduction cascade.
- Polypeptides having further N-terminal deletions including the cysteine residue at position 35 of SEQ ID NO:2 would not be expected to retain such biological activities because it is known that this residue in an EGF-like, or heregulin, polypeptide is one of six conserved cysteine residues required for both structure and biological activity. That is to say, the first cysteine is required for forming one of several disulfide bridges needed to provide structural stability which is, in turn, necessary for receptor binding and the inititiation of the signal transduction cascade.
- the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of HLF shown in SEQ ID NO: 2, up to the cysteine residue at position number 35, and polynucleotides encoding such polypeptides.
- the present invention provides polypeptides comprising the amino acid sequence of residues n-35 of SEQ ID NO:2, where n is an integer in the range of 1-35, and 35 is the position of the first residue from the N-terminus of the complete HLF polypeptide (shown in SEQ ID NO:2) believed to be required for the HLG protein to bind its receptor and initiate the corresponding signal transduction cascade.
- the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of 1-157, 2-157, 3-157, 4-157, 5-157, 6-157, 7-157, 8-157, 9- 157, 10-157, 11-157, 12-157, 13-157, 14-157, 15-157, 16-157, 17-157, 18- 157, 19-157, 20-157, 21-157, 22-157, 23-157, 24-157, 25-157, 26-157, 27-
- C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other biological activities may still be retained.
- the ability of the shortened protein to induce and/or bind to antibodies which recognize the complete or extracellular domain of the protein generally will be retained when less than the majority of the residues of the complete or extracellular domain protein are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete protein retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art.
- the present invention further provides polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of the HLF shown in SEQ ID NO:2, up to the cysteine residue at position 73 of
- polypeptides having the amino acid sequence of residues 1-m of the amino acid sequence in SEQ ID NO:2, where m is any integer in the range of 73 to 101, and residue 73 is the position of the first residue from the C- terminus of the complete HLF polypeptide (shown in SEQ ID NO:2,
- the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n-m of SEQ ID NO:2, where n and m are integers as described above.
- nucleotide sequence encoding a polypeptide consisting of a portion of the complete HLF amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209123, where this portion excludes from 1 to about 34 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209123, or from 1 to about 83 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209123.
- Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided.
- the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of S-2 to K-157; S-3 to K-157; S-4 to K-157; S-5 to K-157; A-6 to
- the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the HLF shown in SEQ ID NO:2, up to the alanine residue at position number 6, and polynucleotides encoding such polypeptides.
- the present invention provides polypeptides comprising the amino acid sequence of residues 1-m' of SEQ ID NO:2, where m' is an integer in the range of 7-156, and 6 is the position of the first residue from the C-terminus of the complete HLF polypeptide believed to be required for at least immunogenic activity of the HLF protein.
- the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues S-l to D-156; S-l to Q-155; S-l to Q-154; S-l to L-153; S-l to N-152; S-l to P-151; S-l to E-150; S-l to Q-149; S-l to S-148; S-l to P-147; S-l to L-146; S-l to G-145; S-l to K-144; S-l to W-143; S-l to R-142; S-l to E-141; S-l to E-140; S-l to S-139; S-l to V-138; S-l to S-137; S-l to N-136; S-l to A-135; S-l to T-134; S-l to 1-133; S-l to N-132; S-l to R-131; S-l to K-130; S-
- polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of an HLF polypeptide, which may be described generally as having residues n'-m' of SEQ ID NO:2, where n' and m' are integers as described above.
- the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of the HLF shown in SEQ ID NO:22, up to the aspartic acid residue at position number 715 and polynucleotides encoding such polypeptides.
- the present invention provides polypeptides comprising the amino acid sequence of residues n"-715 of SEQ ID NO:22, where n" is an integer in the range of 2-715, and 716 is the position of the first residue from the N-terminus of the complete HLF polypeptide believed to be required for at least immunogenic activity of the HLF protein.
- the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of S-2 to K-720; E-3 to K-720; G-4 to K-720; A-5 to K-720; A-6 to K-720; A-7 to K-720; A-8 to K-720; S-9 to K-720; P-10 to K-720; P-l 1 to K-720; G-l 2 to K-720; A- 13 to K-720; A- 14 to K-720; S-l 5 to K-720; A- 16 to
- K-720 1-77 to K-720; G-78 to K-720; L-79 to K-720; G-80 to K-720; L-81 to K-720; S-82 to K-720; L-83 to K-720; M-84 to K-720; L-85 to K-720; L-86 to K-720; K-87 to K-720; W-88 to K-720; 1-89 to K-720; V-90 to K-720; V-91 to K-720; G-92 to K-720; S-93 to K-720; V-94 to K-720; K-95 to K-720; E-96 to K-720; Y-97 to K-720; V-98 to K-720; P-99 to K-720; T-100 to K-720; D-101 to K-720; L-102 to K-720; V-l 03 to K-720; D-104 to K-720; S-l 05 to K-720; K-106 to K-720; G-l 07 to K-720;
- Polynucleotides encoding these polypeptides are also encompassed by the invention.
- the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the HLF shown in SEQ ID NO:22, up to the alanine residue at position number 6, and polynucleotides encoding such polypeptides.
- the present invention provides polypeptides comprising the amino acid sequence of residues 1-m" of SEQ ID NO:22, where m" is an integer in the range of 7-718, and 6 is the position of the first residue from the C-terminus of the complete HLF polypeptide believed to be required for at least immunogenic activity of the HLF protein.
- the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues M-l to T-719; M-l to L-718; M-l to A-717; M-l to S-716; M-l to D-715; M-l to R-714; M-l to Q-713; M-l to 1-712; M-l to E-711; M-l to N-710; M-l to R-709; M-l to L-708; M-l to V-707; M-l to F-706; M-l to Q-705; M-l to A-704; M-l to E-703; M-l to R-702; M-l to E-701; M-l to S-700; M-l to K-699; M-l to A-698; M-l to T-697; M-l to P-696; M-l to
- polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of an HLF polypeptide which may be described generally as having residues n"-m" of SEQ ID NO:22, where n" and m" are integers as described above.
- the fragment, derivative or analog of the polypeptide of SEQ ID NO:2, or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which one or more of the amino acid residues includes a substituent group, (iii) one in which the extracellular domain of the HLF polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), (iv) one in which the EGF domain of the HLF polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
- a conserved or non- conserved amino acid residue preferably a conserved amino acid residue
- substituted amino acid residue may or may not be one encoded
- the number of substitutions, deletions or additions in the amino acid sequence of Figure 1A and/or any of the polypeptide fragments described herein is 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12 ,1 1, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 30-20, 20-10, 20-15, 15-10, 10-5 or 1-5.
- Replacement of amino acids can also change the selectivity of the binding of a ligand to cell surface receptors.
- Ostade et al Nature 361 :266-268 (1993) describes certain mutations resulting in selective binding of TNF- ⁇ to only one of the two known types of TNF receptors.
- Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).
- the invention further provides an isolated HLF polypeptide comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of the HLF polypeptide having the complete amino acid sequence shown in SEQ ID NO:2 (i.e., positions 1 to 157 of SEQ ID NO:2) or the complete amino acid sequence encoded by the cDNA clone contained in the ATCC Deposit No. 209123; (b) the amino acid sequence of the predicted extracellular domain of the HLF polypeptide having the amino acid sequence shown in SEQ ID NO:2 (i.e., positions 1 to 101 of SEQ ID NO:2) or as encoded by the cDNA clone contained in the ATCC Deposit No.
- polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to (or at most 20% different, more preferably at most 10% different, and still more preferably 5%, 4%, 3%, 2% or 1% different from) those described in (a), (b), (c), (d), or (e) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above.
- polypeptides of the present invention include polypeptides which have at least 90% similarity, more preferably at least 95% similarity, and still more preferably at least 96%, 97%, 98% or 99% similarity to those described above.
- the polypeptides of the invention also comprise those which are at least 80% identical, more preferably at least 90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to (or at most 20% different, more preferably at most 10% or 5% different, still more preferably at most 4%, 3%. 2% or 1% different from) the polypeptide encoded by the deposited cDNA or to the polypeptide of SEQ ID NO:2, and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
- % similarity for two polypeptides is intended a similarity score produced by comparing the amino acid sequences of the two polypeptides using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) and the default settings for determining similarity. Bestfit uses the local homology algorithm of Smith and Waterman (Adv. Appl Math. 2:482-489; 1981) to find the best segment of similarity between two sequences.
- polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of an HLF polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the HLF polypeptide.
- up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
- These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
- any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%, 3%, 2% or 1 % different from), for instance, the amino acid sequence shown in SEQ ID NO:2 or to the amino acid sequence encoded by deposited cDNA clone can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to (or
- polypeptide having an amino acid sequence at least, for example, 95% "identical" to (or 5% different from) a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
- the amino acid sequence of the subject polypeptide may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
- up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
- These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
- any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to (or at most 10%, 5%, 4%, 3%, 2% or 1% different from) for instance, the amino acid sequences shown in SEQ ID NO: 1
- a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245).
- a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
- the result of said global sequence alignment is in percent identity.
- Penalty l
- Joining Penalty 20
- Randomization Group Length 0
- Cutoff Score l
- Window Size sequence length
- Gap Penalty 5
- Gap Size Penalty 0.05
- Window Size 500 or the length of the subject amino acid sequence, whichever is shorter. If the subject sequence is shorter than the query sequence due to N- or
- the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity.
- the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C- terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
- This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
- This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.
- a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
- the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
- the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 900c.
- a 90 residue subject sequence is compared with a 100 residue query sequence.
- deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
- percent identity calculated by FASTDB is not manually corrected.
- residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
- polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
- polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting HLF protein expression as described below or as agonists and antagonists capable of enhancing or inhibiting HLF protein function.
- polypeptides can be used in the yeast two-hybrid system to "capture" HLF protein binding proteins which are also candidate agonists and antagonists according to the present invention.
- the yeast two hybrid system is described in Fields and Song, Nature 340:245-246 (1989).
- the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
- the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
- An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
- a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
- the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes (Geysen et al, Proc. Natl. Acad. Sci. USA 81:3998-4002; 1983).
- Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
- Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al, Cell 37:161-118 (1984) at 777.
- Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
- Non-limiting examples of antigenic polypeptides or peptides that can be used to generate HLF-specific antibodies include: a polypeptide comprising amino acid residues from about Ser-1 to about Thr-8, about Thr-9 to about Lys- 18, about Thr-23 to about His-31, about Phe-32 to about Leu-40, about Cys-43 to about Val-51, about Thr-56 to aboutTyr-68, about Gln-75 to about Leu-84, about Tyr- 126 to about Ala- 135, about Ser- 137 to about Leu- 146, and about Ser- 148 to about Lys- 157.
- These polypeptide fragments have been determined to bear antigenic epitopes of the HLF protein by the analysis of the Jameson-Wolf antigenic index, as shown in Figure 3, above.
- the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. See, e.g., Houghten, R. A. (1985) "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids.” Proc. Natl. Acad. Sci. USA 52:5131-5135; this "Simultaneous Multiple Peptide Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631.211 to Houghten et al. (1986).
- SMPS Simultaneous Multiple Peptide Synthesis
- Epitope-bearing peptides and polypeptides of the invention are used to induce antibodies according to methods well known in the art. See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow, M. et al, Proc. Natl. Acad. Sci. USA 52:910-914; and Bittle, F. J. et al, J. Gen. Virol. 66:2347-2354 (1985).
- Immunogenic epitope-bearing peptides of the invention i.e., those parts of a protein that elicit an antibody response when the whole protein is the immunogen, are identified according to methods known in the art.
- U.S. Patent No. 5,194,392 to Geysen (1990) describes a general method of detecting or determining the sequence of monomers (amino acids or other compounds) which is a topological equivalent of the epitope (i.e., a "mimotope") which is complementary to a particular paratope (antigen binding site) of an antibody of interest. More generally, U.S. Patent No. 4,433,092 to Geysen (1989) describes a method of detecting or determining a sequence of monomers which is a topographical equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest. Similarly, U.S. Patent No. 5,480,971 to Houghten, R. A. et al. (1996) on Peralkylated Oligopeptide
- HLF polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
- IgG immunoglobulins
- These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EP A 394,827; Traunecker et al, Nature 331:84-86; 1988).
- Fusion proteins that have a disulfide -linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric HLF protein or protein fragment alone (Fountoulakis, et al, J. Biochem. 270:3958-3964; 1995).
- HLF polypeptides of interest of the present invention can be combined with a recombinant toxin.
- a fusion polypeptide can be used to target the toxin, for example Pseudomonas exotoxin A, to a tumor through the efficient binding of the extracellular or smaller soluble domains of the HLF molecule of the present invention.
- Jeschke and colleagues Int. J. Cancer 60:730-739; 1995
- Fiddes and coworkers Cell Growth Differ.
- HLF-protein specific antibodies for use in the present invention can be raised against the intact HLF protein or an antigenic polypeptide fragment thereof, which may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
- a carrier protein such as an albumin
- antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as. for example, Fab and F(ab')2 fragments) which are capable of specifically binding to HLF protein. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Thus, these fragments are preferred.
- the antibodies of the present invention may be prepared by any of a variety of methods.
- cells expressing the HLF protein or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
- a preparation of HLF protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
- the antibodies of the present invention are monoclonal antibodies (or HLF protein binding fragments thereof).
- monoclonal antibodies can be prepared using hybridoma technology (Kohler et al, Nature 256:495 (1975); Kohler et al, Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al, in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., (1981) pp. 563-681 ).
- such procedures involve immunizing an animal (preferably a mouse) with a HLF protein antigen or, more preferably, with a
- HLF protein-expressing cell Suitable cells can be recognized by their capacity to bind anti-HLF protein antibody.
- Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g/ml of streptomycin.
- the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
- Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the American Type Culture
- hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the HLF protein antigen.
- additional antibodies capable of binding to the HLF protein antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
- Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody.
- HLF-protein specific antibodies are used to immunize an animal, preferably a mouse.
- the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the HLF protein-specific antibody can be blocked by the HLF protein antigen.
- Such antibodies comprise anti-idiotypic antibodies to the HLF protein-specific antibody and can be used to immunize an animal to induce formation of further HLF protein-specific antibodies.
- Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
- Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
- enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
- HLF protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
- chimeric monoclonal antibodies For in vivo use of anti-HLF in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art (Morrison, Science 229: 1202; 1985); Oi, et al, BioTechniques 4:214; 1986; Cabilly, et al, U.S. Patent No.
- HLF is apparently expressed detectably only in the amygdala, whole brain, and primary breast culture tissue.
- substantially altered (increased or decreased) levels of HLF gene expression can be detected in tissues or other cells or bodily fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" HLF gene expression level, that is, the HLF expression level in such tissues or bodily fluids from an individual not having the disorder.
- bodily fluids e.g., sera, plasma, urine, synovial fluid or spinal fluid
- the invention provides a diagnostic method useful during diagnosis of a disorder related to the regulation of cell growth, which involves measuring the expression level of the gene encoding the HLF protein in such tissues or other cells or bodily fluids from an individual and comparing the measured gene expression level with a standard HLF gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a such a disorder.
- certain tissues in mammals with breast or brain cancers express significantly enhanced levels of the HLF protein and mRNA encoding the HLF protein when compared to a corresponding "standard" level.
- enhanced levels of the HLF protein can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with such a cancer when compared to sera from mammals of the same species not having the cancer.
- the invention provides a diagnostic method useful during diagnosis of a disorder of the regulation of cell growth, including several types of cancers which involves measuring the expression level of the gene encoding the HLF protein in tissues or other cells or bodily fluids from an individual and comparing the measured gene expression level with a standard HLF gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of such a disorder.
- the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced HLF gene expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.
- saying the expression level of the gene encoding the HLF protein is intended qualitatively or quantitatively measuring or estimating the level of the HLF protein or the level of the mRNA encoding the HLF protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the HLF protein level or mRNA level in a second biological sample).
- the HLF protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard HLF protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder of the regulation of cell growth.
- a standard HLF protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
- biological sample is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains HLF protein or mRNA.
- biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain free HLF protein, or the extracellular or EGF domains of the HLF protein, cancerous tissue, and other tissue sources found to express complete HLF protein, or the extracellular or EGF domains of the HLF protein, or an HLF receptor.
- body fluids such as sera, plasma, urine, synovial fluid and spinal fluid
- tissue biopsies and body fluids from mammals are well known in the art.
- tissue biopsy is the preferred source.
- the present invention is useful for diagnosis or treatment of various disorders of the regulation of cell growth in mammals, preferably humans.
- disorders include breast cancer, brain cancers, including neuroblastomas and glioblastomas, developmental disorders, ovarian cancer, endometrial cancer, some types of colon cancers, and the like.
- Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol- chloroform method described by Chomczynski and Sacchi (Anal Biochem. 162: 156-159; 1987). Levels of mRNA encoding the HLF protein are then assayed using any appropriate method. These include Northern blot analysis,
- HLF protein levels in a biological sample can occur using antibody-based techniques. For example, HLF protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, M., et al, J. Cell. Biol. 101:916-985 (1985); Jalkanen, M., et al, J. Cell . Biol. 105:3081-3096 (1987)).
- HLF protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
- Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine ( 125 I, ,21 I), carbon ( 14 C), sulfur ( 35 S), tritium ( ⁇ ), indium ( 112 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
- enzyme labels such as, glucose oxidase, and radioisotopes, such as iodine ( 125 I, ,21 I), carbon ( 14 C), sulfur ( 35 S), tritium ( ⁇ ), indium ( 112 In), and technetium ( 99m Tc)
- fluorescent labels such as fluorescein and rhodamine, and biotin.
- HLF protein can also be detected in
- Antibody labels or markers for in vivo imaging of HLF protein include those detectable by X-radiography, NMR or ESR.
- suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
- Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.
- a HLF protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example, 131 1, 112 In, 99m Tc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally. subcutaneously or intraperitoneally) into the mammal to be examined for immune system disorder.
- a radioisotope for example, 131 1, 112 In, 99m Tc
- a radio-opaque substance for example, parenterally. subcutaneously or intraperitoneally
- the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99m Tc.
- the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain HLF protein.
- In vivo tumor imaging is described in S.W. Burchiel et al, "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical
- HLF polynucleotides and polypeptides are useful for diagnosis of conditions involving abnormally high or low expression of HLF activities. Given the cells and tissues where HLF is expressed as well as the activities modulated by HLF, it is readily apparent that a substantially altered (increased or decreased) level of expression of HLF in an individual compared to the standard or "normal" level produces pathological conditions related to the bodily system(s) in which HLF is expressed and/or is active.
- the extracellular domain of the protein may be released in soluble form from the cells which express the HLF by proteolytic cleavage. Therefore, when HLF soluble extracellular domain is added from an exogenous source to cells, tissues or the body of an individual, the protein will exert its physiological activities on its target cells of that individual.
- the invention also provides a method of treatment of an individual in need of an increased level of HLF activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated HLF polypeptide of the invention, particularly an extracellular form of the HLF protein of the invention, effective to increase the HLF activity level in such an individual.
- HLF activity An individual who is in need of increased HLF activity will not express a sufficient amount of functional HLF protein, administration of recombinant HLF protein, or more simply, of the active extracellular or the active EGF domain, to such an individual will result in the presence of a sufficient concentration of HLF activity in the bloodstream.
- an individual who has an abnormally increased level of HLF activity will require the use of an HLF antibody or antagonist, as described in the present invention.
- HLF antagonists will result in a therapeutic lowering of the effective level of HLF activity in the bloodstream.
- the affected individual will have an effective concentration of HLF activity which is much closer to that of what is deemed "normal".
- HLF may be used as an additive or supplement for the in vitro culture of certain types of eukaryotic cells.
- Many cell types including primary cell cultures, are highly fastidious and require a complex mixture of additives to the standard culture medium to result in successful culture and survival of the cells.
- a number of known growth factors and related molecules are currently used as supplements to the medium of various cells. Such factors may include molecules as epidermal growth factor (EGF), keratinocyte growth factor (KGF), acidic fibroblast growth factor (aFGF), insulin-like growth factor (IGF)-I, nerve growth factor (NGF), and many others.
- EGF epidermal growth factor
- KGF keratinocyte growth factor
- aFGF acidic fibroblast growth factor
- IGF insulin-like growth factor
- NGF nerve growth factor
- HLF is useful as an additive or growth factor in the culture of neural and a number of other cells and cell types. It will be further appreciated by the skilled artisan, that many cells and cell types require the absence of a specific growth factor or related molecule from the culture medium. In the case of culturing cells which require the absence of HLF from the culture medium, antagonists or antibodies of HLF described herein may be used to bind to and remove HLF from culture medium preparations thus resulting in "HLF-free" culture media.
- the HLF polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with
- HLF polypeptide alone
- the "effective amount" of HLF polypeptide for purposes herein is thus determined by such considerations.
- HLF polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
- the HLF polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
- compositions containing the HLF of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
- pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
- parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
- sustained-release compositions include semi- permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
- Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L- glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res. 15: 161-
- Sustained-release HLF polypeptide compositions also include liposomally entrapped HLF polypeptide.
- Liposomes containing HLF polypeptide are prepared by methods known per se: DE 3,218,121 ; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
- the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal HLF polypeptide therapy.
- the HLF polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
- the formulations are prepared by contacting the HLF polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
- the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
- the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
- additives such as substances that enhance isotonicity and chemical stability.
- Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
- the HLF polypeptide is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of HLF polypeptide salts.
- HLF polypeptide to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
- Therapeutic HLF polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
- HLF polypeptide ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
- a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous
- HLF polypeptide solution and the resulting mixture is lyophilized.
- the infusion solution is prepared by reconstituting the lyophilized HLF polypeptide using bacteriostatic Water-for-Injection.
- the invention also provides a method of screening compounds to identify those which enhance or block the action of HLF on cells, such as its interaction with HLF-binding molecules such as receptor molecules.
- An agonist is a compound which increases the natural biological functions of HLF or which functions in a manner similar to HLF, while antagonists decrease or eliminate such functions.
- the invention provides a method for identifying a receptor protein or other ligand-binding protein which binds specifically to a HLF polypeptide.
- a cellular compartment such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds HLF. The preparation is incubated with labeled HLF. HLF and complexes of HLF bound to the receptor or other binding protein are isolated and characterized according to routine methods known in the art.
- the HLF polypeptide may be bound to a solid support so that binding molecules solubilized from cells are bound to the column and then eluted and characterized according to routine methods.
- a cellular compartment such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds HLF, such as a molecule of a signaling or regulatory pathway modulated by HLF.
- the preparation is incubated with labeled HLF in the absence or the presence of a candidate molecule which may be a HLF agonist or antagonist.
- the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand.
- Molecules which bind gratuitously, i.e., without inducing the effects of HLF on binding the HLF binding molecule are most likely to be good antagonists.
- Molecules that bind well and elicit effects that are the same as or closely related to HLF are agonists.
- Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing HLF-induced activities, thereby preventing the action of HLF by excluding HLF from binding.
- chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
- the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
- sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as short as 50 or 60 bp. For a review of this technique, see Verma et al, Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York (1988).
- FISH Fluorescence in situ hybridization
- the bacterial expression vector pGEX-3X was used for bacterial expression in this example (Pharmacia, Inc., Uppsala, Sweden).
- pGEX-3X encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, and a sequence that encodes an N-terminal, in frame, glutathione S-transferase (GST) tag that allows affinity purification using one of the GST Purification Modules, and several suitable single restriction enzyme cleavage sites. These elements are arranged such that an inserted DNA fragment encoding a polypeptide expresses that polypeptide with an N-terminal GST-fusion protein.
- the amplified HLF DNA fragment and the vector pGEX-3X were digested with Bam HI and Eco RI and the digested DNAs were then ligated together. Insertion of the HLF DNA into the restricted pGEX-3X vector placed the HLF protein coding region downstream from the IPTG-inducible promoter
- the ligation mixture was transformed into competent E. coli cells using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). Plasmid DNA was isolated from resistant E. coli cells.
- Clones containing the desired constructs were grown overnight ("O/N") in liquid culture in LB media supplemented with ampicillin (100 ⁇ g/ml). The O/N culture was used to inoculate a large culture, at a dilution of approximately
- the cells were grown to an optical density at 600 nm ("OD600”) of approximately 0.4. Isopropyl- ⁇ -D-thiogalactopyranoside (“IPTG”) was then added to a final concentration of 0.1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently were incubated further for 3 to 4 hours. Cells then were harvested by centrifugation, resuspended in IX PBS, and lysed by sonication.
- IPTG Isopropyl- ⁇ -D-thiogalactopyranoside
- the expressed GST-HLF(EGF domain) fusion protein was purified using glutathione sepharose 4B essentially as described by the manufacturer (Pharmacia, Uppsala, Sweden). Briefly, cell lysates were combined with the glutathione sepharose 4B. The mixture was pelleted by centrifugation and washed. The GST fusion portion of the polypeptide was cleaved by the addition of thrombin site-specific protease for 18 hours. Following cleavage, thrombin was bound to p-Aminobenzmidine agarose beads.
- the thrombin-p-Aminobenzmidine agarose bead complexes and the GST-glutathione sepharose complexes were pelleted by centrifugation. The supernatant then contained the purified EGF domain of the HLF protein. Purity of the protein preparation was analyzed by SDS-PAGE. The purified protein was then stored frozen at -20° C.
- Example 2 Cloning and Expression of HLF protein in a Baculovirus Expression System
- the plasmid shuttle vector pA2GP is used to insert the cloned DNA encoding the mature protein, lacking its naturally associated secretory signal (leader) sequence, into a baculovirus to express the mature HLF protein, using a baculovirus leader and standard methods as described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
- the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that expresses the cloned polynucleotide.
- Many other baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the ait would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
- Such vectors are described, for instance, in Luckow et al., Virology 170:31-39 (1989).
- TCTCCATGAATTCAATCCCC 3' (SEQ ID NO: 8) containing the underlined Asp 718 restriction site followed by 33 nucleotides complementary to the 3' coding sequence in Figure 1A.
- the plasmid is digested with the restriction enzymes Bam HI and Asp 718 and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
- the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "VI ".
- Fragment FI and the dephosphorylated plasmid VI are ligated together with T4 DNA ligase.
- E. coli HB101 or other suitable E. coli hosts such as XL- 1 Blue (Statagene Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture and spread on culture plates.
- Bacteria are identified that contain the plasmid with the human HLF gene by digesting DNA from individual colonies using Bam HI and Asp 718 and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pA2GPHLF.
- plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, supra.
- An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques.
- a detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf).
- Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
- the cells are infected with the recombinant baculovirus V-HLF at a multiplicity of infection ("MOI") of about 2.
- MOI multiplicity of infection
- the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD).
- 5 ⁇ Ci of 5 S-methionine and 5 ⁇ Ci 5 S-cysteine available from Amersham
- the cells are further incubated for 16 hours and then are harvested by centrifugation.
- the proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).
- Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the extracellular domain of the HLF protein.
- the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome.
- a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
- the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al, Cell 47:521-530 (1985)). Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest.
- the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
- the expression plasmid, pHLFHA is made by cloning a portion of the cDNA encoding the extracelluar domain of the HLF protein into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.). To produce a soluble, secreted form of the polypeptide, the extracellular domain is fused to the secretory leader sequence of the human IL-6 gene.
- the expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E.
- coli and other prokaryotic cells (2) an ampicillin resistance gene for selection of plas id-containing prokaryotic cells; (3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed by a termination codon and polyadenylation signal arranged so that a cDNA can be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
- the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell
- pcDNAIII contains, in addition, the selectable neomycin marker.
- a DNA fragment encoding the extracellular domain of the HLF polypeptide is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
- the plasmid construction strategy is as follows. The HLF cDNA of the deposited clone is amplified
- Suitable primers include the following, which are used in this example.
- the 5' primer containing the underlined Bam HI site, a Kozak sequence, an AUG start codon, a sequence encoding the secretory leader peptide from the human IL-6 gene, and
- JO 16 nucleotides of the 5' coding region of the extracellular domain of the HLF polypeptide has the following sequence: 5' GCCGGATCCGCCACCATGAAC
- 33 of nucleotides complementary to the 3' coding sequence immediately before the stop codon has the following sequence: 5' GGCTCTAGATAAACTTCTTCAC TCTCCATGAATTCAATCCCC 3' (S ⁇ Q ID NO: 10).
- Plasmid DNA is isolated from resistant colonies and examined by restriction analysis or other means for the presence of the fragment encoding the extracellular domain of the HLF polypeptide
- COS cells are transfected with an
- Plasmid pC4 is used for the expression of HLF polypeptide.
- Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146).
- the extracellular domain is fused to the secretory leader sequence of the human EL-6 gene.
- the plasmid contains the mouse DHFR gene under control of the SV40 early promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plas ids can be selected by growing the cells in a
- Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al., Molecular and Cellular Biology, March 1985:438-447) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell 47:521-530 (1985)).
- LTR long terminal repeat
- CMV cytomegalovirus
- Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI, Xba I, and As ⁇ 718. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
- Other high efficiency promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
- Clontech 's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the HLF polypeptide in a regulated way in mammalian cells (Gossen, M., & Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89:5541- 5551).
- Other signals e.g., from the human growth hormone or globin genes can be used as well.
- Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
- the plasmid pC4 is digested with the restriction enzymes Bam HI and Asp 718 and then dephosphorylated using calf intestinal phosphates by procedures known in the art.
- the vector is then isolated from a 1% agarose gel.
- the DNA sequence encoding the extracellular domain of the HLF polypeptide is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the desired portion of the gene.
- the 5' primer containing the underlined Bam HI site, a Kozak sequence, an AUG start codon, a sequence encoding the secretory leader peptide from the human IL-6 gene, and 16 nucleotides of the 5' coding region of the extracellular domain of the HLF polypeptide, has the following sequence (where Kozak is in italics):
- the 3' primer containing the underlined Asp 718 restriction site and 33 nucleotides complementary to the 3' coding sequence immediately before the stop codon as shown in Figure 1A (SEQ ID NO: 1), has the following sequence:
- the amplified fragment is digested with the endonucleases Bam HI and
- the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks
- Northern blot analysis is carried out to examine HLF gene expression in human tissues, using methods described by, among others, Sambrook et al, 30 cited above.
- HLF protein (SEQ ID NO: 1) is labeled with 32 P using the re /primeTM DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PTl 200-1. The purified labeled probe is then used to examine various human tissues for HLF mRNA.
- a tyrosine kinase activation assay was used as follows.
- a human breast cancer cell line MCF-7
- Exogenous recombinant EGF domain of the HLF protein (10 mg.mL) or recombinant heregulin (0.1 mg.mL) were added to the growth medium, and cell culture was continued in the presence or absence of exogenous protein for 30 minutes.
- Cells were harvested and lysed by the addition of SDS-containing sample buffer (1% SDS, 0.15M Tris, pH 8.6, 5% BME, and 1 mM sodium ortho-vanadate).
- EGF/Heregulin family Increased activity of members of the erbB family has been implicated in the development of cancer. Different molecular mechanisms of activation have been identified. The ligands of the EGF/Heregulin family are inappropriately expressed in breast cancers. EGF, a-TGF, amphiregulin and heregulin are expressed in breast cancers containing appropriate receptors thus leading to autocrine growth stimulation. The importance of autocrine growth stimulation is required for the transformation of NIH/3T3 cells with high levels of EGF receptor, since full morphological transformation requires the co-expression of a-TGF.
- the erbB receptors bind their ligands as dimers - formed from two identical erbB proteins (homodimers) or from two different proteins (heterodimers).
- EGF can bind homodimers of erbB 1 (EGFR) or heterodimers of erbB 1 and erbB2.
- Heregulinlb can bind homodimers of erbB4 or heterodimers of erbB 2 and erbB 3.
- Other ligands of the EGF/Heregulin family have receptors formed by homo and heterodimers of erbB proteins. Ligand binding and dimer formation leads to increased autophosphorylation of the receptor proteins and substrates activating intracellular signalling pathways.
- EGF and a-TGF can stimulate the growth of many cells in culture, but in cases of breast cancers that overexpress the EGF Receptor, EGF can be growth inhibitory at concentrations above approximately 10 nM.
- heregulin can both stimulate growth of some human cancer cells as well as inhibit those that overexpress erbBl.
- the display of erbB proteins on breast cancer cells is not uniform. Many cells lack one or more of the family and others greatly overexpress erbBl or erbB2.
- Heregulin clearly has effects on cell morphology as evidenced by changes in the actin cytoskeleton.
- EGF/Heregulin is apparently the product of the same gene as NRG-2.
- HLF Activates multiple erbB proteins.
- HLF can activate erbBl homodimers (the EGF receptor), erbB4 homodimers, and erbBl + erbB3 heterodimers.
- the results of 32D experiments indicate that the receptor binding pattern of HLF is complex.
- HLF activates proteins other than erbB4 in MCF-7 cells
- erbB 3 is phosphorylated on tyrosine as a consequence of HLF stimulation.
- HLF Biological Activity of HLF.
- the effects of the EGF/Heregulin family vary significantly. Differing cellular phenotypes.can be induced by different ligands in the same cell system and the same ligand can cause differing effects among different cells. Mitogenic activity of HLF has been detected in 32D cell experiments.
- the MCF-7 cell is dependent on estrogens in the media either in the form of phenol red or present in the fetal bovine serum. Little proliferation is seen in phenol red free media containing serum treated with charcoal to remove steroids. Heregulin is able to promote growth in the absence of estrogen. When HLF is added there is also a clear growth stimulation. Growth inhibitory effects have also been observed. HLF inhibits the growth of the breast cancer cell line MDA-MB-468.
- HLF overexpress the EGF receptor and can be stimulated by EGF at low concentrations ( ⁇ 10 nM) and growth inhibited at higher concentrations (>10 nM).
- HLF was found to inhibit growth of MDA-MB-468 under conditions similar to those producing growth stimulation of 32D cells containing EGF Receptor. No growth suppression or stimulation are seen when HLF is applied to MCF-7 cells when they are grown in media containing agonists for the estrogen receptor.
- HLF MRNA expression in breast cancer Preliminary experiments using northern blotting methods showed a weak signal for HLF mRNA in adult brain with a size of approximately 2 kD (data not shown). Similar northern blot results are reported in the recent HLF study. Because of the weakness of this signal we have used RT-PCR to detect HLF mRNA. We have confirmed expression in the brain and detect equivalent signals in samples of normal and breast cancer tissue. RT-PCR employed two primer sets. The two primer sets generated concordant results. This indicates that the bands observed by RT-PCR were due to actual HLF mRNA. In addition all assays included control reactions lacking reverse transcriptase in order to detect the presence of contaminating DNA.
- the observed band at 340 bp corresponds to the predicted size based on the HLF cDNA. It was cloned sequenced and shown to contain HLF coding information. Bands at 500 bp and 120 bp were also sequenced. These do do not contain HLF coding information and thus likely represent mispriming by the RT-PCR oligonucleotides on unrelated mRNAs. These results are strong evidence that HLF can be expressed in human breast cancer cell lines.
- HLF can bind and activate erbB 1 and heterodimers of erbB2 + erbB 3.
- erbB3 can be phosphorylated as a consequence of HLF binding.
- the HLF induced increases in tyrosine phosphorylation on erbB3 suggests that the erbB3 protein can be part of an HLF receptor.
- Our studies of 32D cells supports this conclusion where erbB2 is the other member of the heterodimeric receptor with erbB3.
- HLF can bind to erbB 1 + erbB3 heterodimers or erbB3 + erbB4 heterodimers or erbB2 + erbB4 heterodimers.
- Our preliminary data does conclusively demonstrate that HLF is a new ligand for the erbB family of receptors. These results suggest that HLF may have a receptor specificity somewhat analogous to b-cellulin. In adult tissue expression levels of HLF are low but detectable using sensitive methods such as RT-PCR. HLF is expressed at the highest levels in brain where it is likely to play a critical role in morphogenesis.
- HLF human lung cancer cell line
- MCF-7 breast cancer cell line
- HLF can cause alteration of growth of MCF-7 cancer cells in vitro.
- the ability to cause growth of MCF-7 cells in the absence of estrogen is similar to that previously reported for heregulin.
- Our results suggest that effects on cell phenotype by HLF may depend on the cell line.
- MDA-MB-468 which has high levels of EGFR are growth inhibited by HLF in vitro.
- Recombinant protein was collected by incubation with glutathione beads. After washing the recombinant HLF protein was cleaved from the GST bound to the beads by thrombin cleavage for 18 hours. Thrombin was removed by incubation with p-Aminobenzamidine agarose beads. Refolding followed the methods used for the preparation of recombinant antibody fragments. Briefly, recombinant HLF was denatured in 6 M guanidine HCL containing 65 mM DTE.
- 32D cells containing expression constructs for erbBl, erbB2, erbB3, erbB4 and erbB2 and erbB3 together were grown in IL-3 containing (WEHI conditioned media) or Hrg-lb prior to the experiment. Expression of the erbB proteins was verified by FACS analysis using erbB-specific antisera.
- Cells (10 4 per well) were plated in 24 well dishes in the absence of IL-3 containing media (DMEM, 10% FCS) or in the presence of the indicated growth factors, heregulin-lb (100 ng/ml), EGF (100 ng/ml), and HLF (10 ⁇ g/ml). Cells were allowed to grow for 3 days and viable cells counted using a hemocytometer.
- DMEM fetal calf serum
- IMEM+ 10% FBS were plated in IMEM+ 10% FBS at 3000 cells per well in 96 well dishes. Cells were allowed to become quiescent in serum free IMEM for 24 hours and growth factors EGF (2 ng/ml) and HLF (10 ⁇ g/ml) were added to the media. Growth of cells at 1, 3, and 5 days was monitored using the XTT assay method. XTT was added at 10 ⁇ g/ml in IMEM and PMS (1.5 mg/ml in PBS) to 25% of volume of well for 4 hours at 37°C. OD monitored at 540 nra.
- RNA pellet was resuspended in 135 ⁇ l DEPC treated H .0.
- DNase treatment was performed using the SNAP RNA isolation kit (Invitrogen, K1950-01). Briefly, 10X DNase buffer and RNase free DNase I was added to each sample and incubated for 20 min at 37°C. RNA purification was performed as indicated in the kit. Concentration of each sample was determined, samples were dried and resuspended to give a final concentration of 2 ⁇ g/ul.
- RT-PCR was performed using 2 ⁇ g of total RNA in the Gene Amp RNA PCR Core kit (Perkin Elmer, N808-0143). cDNA was synthesized using the downstream primer 5'-CCA CGA TGA CAA TTC CAA AG-3' (SEQ ID NO:
- MOLECULE TYPE DNA (genomic)
- CAAGGG 536 AGTGAAGAAG TTTTNNCCAA AGGGCAGGTG NTGTNCAATT TCCAAGTGNN CAACTTTGGG 360 GATTGGTNCN TCGTGGGGGC NTGTTTNNGG TGGCAGCATT TCNTAACTNC CAAAAAGCCA 423 AAAAGGGATT TTTNACCGGC AAATTTCCGT GNTCTGAAGG GAAAATTGGG AAGGGTCTTG 480 CCCTTTCCCC AGGAGGCCCA ATTNGGNCAA CAAGGCCAAT NATGGCNTAA CAAGGG 536
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
- MOLECULE TYPE DNA (genomic)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hospice & Palliative Care (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP50463499A JP2002503967A (en) | 1997-06-17 | 1998-06-16 | Heregulin-like factor |
AU80724/98A AU8072498A (en) | 1997-06-17 | 1998-06-16 | Heregulin-like factor |
EP98929072A EP1001981A4 (en) | 1997-06-17 | 1998-06-16 | Heregulin-like factor |
CA002295317A CA2295317A1 (en) | 1997-06-17 | 1998-06-16 | Heregulin-like factor |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US4994297P | 1997-06-17 | 1997-06-17 | |
US60/049,942 | 1997-06-17 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998057989A1 true WO1998057989A1 (en) | 1998-12-23 |
Family
ID=21962588
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/012403 WO1998057989A1 (en) | 1997-06-17 | 1998-06-16 | Heregulin-like factor |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1001981A4 (en) |
JP (1) | JP2002503967A (en) |
AU (1) | AU8072498A (en) |
CA (1) | CA2295317A1 (en) |
WO (1) | WO1998057989A1 (en) |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001001748A2 (en) * | 1999-07-02 | 2001-01-11 | Genentech, Inc. | Peptide compounds that bind her2 |
US6844170B1 (en) | 1998-03-19 | 2005-01-18 | Human Genome Sciences, Inc. | Cytokine receptor common gamma chain like |
US6861227B2 (en) | 1998-03-19 | 2005-03-01 | Human Genome Sciences, Inc. | Antibodies to cytokine receptor common gamma chain like |
US6982320B2 (en) | 1998-03-19 | 2006-01-03 | Human Genome Sciences, Inc. | Cytokine receptor common gamma chain like |
JP2009077716A (en) * | 1997-07-09 | 2009-04-16 | Genentech Inc | ErbB4 RECEPTOR-SPECIFIC NEUREGULIN RELATED LIGAND AND USE THEREOF |
US7662585B2 (en) | 1997-07-09 | 2010-02-16 | Genentech, Inc. | ErbB4 receptor-specific neuregulin related ligands and uses therefor |
CN114720689A (en) * | 2022-04-07 | 2022-07-08 | 南京中医药大学 | Pinellia agglutinin protein enzyme-linked immunosorbent assay (Elisa) kit and application thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PL2037758T3 (en) * | 2006-07-12 | 2019-04-30 | Purac Biochem Bv | Partially neutralized acid coated food-grade particles |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6121415A (en) * | 1997-07-09 | 2000-09-19 | Genentech, Inc. | ErbB4 receptor-specific neuregolin related ligands and uses therefor |
-
1998
- 1998-06-16 EP EP98929072A patent/EP1001981A4/en not_active Withdrawn
- 1998-06-16 AU AU80724/98A patent/AU8072498A/en not_active Abandoned
- 1998-06-16 WO PCT/US1998/012403 patent/WO1998057989A1/en not_active Application Discontinuation
- 1998-06-16 JP JP50463499A patent/JP2002503967A/en active Pending
- 1998-06-16 CA CA002295317A patent/CA2295317A1/en not_active Abandoned
Non-Patent Citations (4)
Title |
---|
HOLMES W. E., ET AL.: "IDENTIFICATION OF HEREGULIN, A SPECIFIC ACTIVATOR OF P185ERB2.", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, vol. 256., 22 May 1992 (1992-05-22), pages 1205 - 1210., XP002910613, ISSN: 0036-8075, DOI: 10.1126/science.256.5060.1205 * |
LEWIS G. D., ET AL.: "GROWTH REGULATION OF HUMAN BREAST AND OVARIAN TUMOR CELLS BY HEREGULIN: EVIDENCE FOR THE REQUIREMENT OF ERBB2 AS A CRITICAL COMPONENT IN MEDIATING HEREGULIN RESPONSIVENESS.", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 56., 15 March 1996 (1996-03-15), US, pages 1457 - 1465., XP002910611, ISSN: 0008-5472 * |
See also references of EP1001981A4 * |
ZHANG D., ET AL.: "NEUREGULIN-3 (NRG3): A NOVEL NEURAL TISSUE-ENRICHED PROTEIN THAT BINDS AND ACTIVATES ERBB4.", PROCEEDINGS NATIONAL ACADEMY OF SCIENCES PNAS, NATIONAL ACADEMY OF SCIENCES, US, vol. 94., 1 September 1997 (1997-09-01), US, pages 9562 - 9567., XP002910612, ISSN: 0027-8424, DOI: 10.1073/pnas.94.18.9562 * |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2009077716A (en) * | 1997-07-09 | 2009-04-16 | Genentech Inc | ErbB4 RECEPTOR-SPECIFIC NEUREGULIN RELATED LIGAND AND USE THEREOF |
US7662585B2 (en) | 1997-07-09 | 2010-02-16 | Genentech, Inc. | ErbB4 receptor-specific neuregulin related ligands and uses therefor |
US7846453B2 (en) | 1997-07-09 | 2010-12-07 | Genentech, Inc. | Methods of stimulating ErbB4 receptor phosphorylation |
US6844170B1 (en) | 1998-03-19 | 2005-01-18 | Human Genome Sciences, Inc. | Cytokine receptor common gamma chain like |
US6861227B2 (en) | 1998-03-19 | 2005-03-01 | Human Genome Sciences, Inc. | Antibodies to cytokine receptor common gamma chain like |
US6982320B2 (en) | 1998-03-19 | 2006-01-03 | Human Genome Sciences, Inc. | Cytokine receptor common gamma chain like |
US7504105B2 (en) | 1998-03-19 | 2009-03-17 | Human Genome Sciences, Inc. | Treatment using antibodies to cytokine receptor common gamma chain like |
WO2001001748A2 (en) * | 1999-07-02 | 2001-01-11 | Genentech, Inc. | Peptide compounds that bind her2 |
WO2001001748A3 (en) * | 1999-07-02 | 2001-07-26 | Genentech Inc | Peptide compounds that bind her2 |
US6987088B2 (en) | 1999-07-02 | 2006-01-17 | Genentech, Inc. | Compounds that bind HER2 |
CN114720689A (en) * | 2022-04-07 | 2022-07-08 | 南京中医药大学 | Pinellia agglutinin protein enzyme-linked immunosorbent assay (Elisa) kit and application thereof |
CN114720689B (en) * | 2022-04-07 | 2024-04-09 | 南京中医药大学 | Pinellia ternate lectin protease-linked immunosorbent assay Elisa kit and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CA2295317A1 (en) | 1998-12-23 |
EP1001981A4 (en) | 2000-09-27 |
EP1001981A1 (en) | 2000-05-24 |
JP2002503967A (en) | 2002-02-05 |
AU8072498A (en) | 1999-01-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6372454B2 (en) | Nucleic acid molecules encoding Follistatin-3 | |
US6635443B1 (en) | Polynucleotides encoding a novel interleukin receptor termed interleukin-17 receptor-like protein | |
US7611846B2 (en) | Diagnostic methods involving human growth factor huXAG-1 | |
US5942417A (en) | CD44-like protein and nucleic acids | |
CA2220036A1 (en) | Human neuropeptide receptor | |
EP1012266A1 (en) | Galectin 8, 9, 10 and 10sv | |
EP1001981A1 (en) | Heregulin-like factor | |
US7335738B2 (en) | Heregulin-like factor | |
US20080026989A1 (en) | Human Ependymin | |
US6727077B1 (en) | Heregulin-like factor | |
EP1012262A1 (en) | Human frezzled-like protein | |
WO1998029438A9 (en) | Cortistatin polypeptides | |
WO1998029438A2 (en) | Cortistatin polypeptides | |
WO2001014415A2 (en) | Egfh2 genes and gene products | |
EP0814661A1 (en) | UBIQUITIN CONJUGATING ENZYMES 7, 8 and 9 | |
US7109306B2 (en) | Antibodies to human oncogene induced secreted protein I | |
CA2284846A1 (en) | Human muscle derived growth factor - cardiac and pancreatic protein (capp) and gene | |
WO1996027009A1 (en) | Human amine transporter |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2295317 Country of ref document: CA Ref country code: CA Ref document number: 2295317 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998929072 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1998929072 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1998929072 Country of ref document: EP |