WO1998056936A9 - Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations - Google Patents

Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations

Info

Publication number
WO1998056936A9
WO1998056936A9 PCT/EP1998/003517 EP9803517W WO9856936A9 WO 1998056936 A9 WO1998056936 A9 WO 1998056936A9 EP 9803517 W EP9803517 W EP 9803517W WO 9856936 A9 WO9856936 A9 WO 9856936A9
Authority
WO
WIPO (PCT)
Prior art keywords
recombinant dna
hypoxia
cell
expression
dna molecule
Prior art date
Application number
PCT/EP1998/003517
Other languages
English (en)
Other versions
WO1998056936A1 (fr
Inventor
Werner Risau
Annette Damert
Karl Plate
Original Assignee
Max Planck Gesellschaft
Werner Risau
Annette Damert
Karl Plate
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Max Planck Gesellschaft, Werner Risau, Annette Damert, Karl Plate filed Critical Max Planck Gesellschaft
Priority to AU85369/98A priority Critical patent/AU8536998A/en
Priority to EP98936322A priority patent/EP0990042A1/fr
Publication of WO1998056936A1 publication Critical patent/WO1998056936A1/fr
Publication of WO1998056936A9 publication Critical patent/WO1998056936A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian

Definitions

  • the present invention relates to recombinant DNA molecules comprising regulatory sequence(s) of the Vascular Endothelial Growth Factor (VEGF) gene or of a gene homologous to the VEGF gene, being capable of modulating hypoxia inducible expression of a heterologous DNA sequence in vivo.
  • the present invention also provides vectors comprising said recombinant DNA molecules.
  • the present invention additionally relates to pharmaceutical and diagnostic compositions comprising such recombinant DNA molecules and vectors.
  • the present invention relates to cells and transgenic non-human animals, comprising the aforementioned recombinant DNA molecules or vectors stably integrated into their genome and their use for the identification of substances capable of suppressing or activating transcription of a hypoxia inducible gene.
  • the present invention also relates to the use of the before described recombinant DNA molecules and vectors for the preparation of pharmaceutical compositions for treating, preventing, and/or delaying a vascular or tumorous disease in a subject.
  • the recombinant DNA molecules and vectors of the invention can be used for the preparation of pharmaceutical compositions for inducing a vascular or tumorous disease in a non- human animal.
  • the present invention relates to a method for identifying agonists/activators or antagonists/inhibitors of genes or gene products involved in hypoxia and/or ischemia, to compounds identifiable by said method, to antibodies directed to said compounds as well as to pharmaceutical and diagnostic compositions comprising said agonists/activators, antagonists/inhibitors and/or antibodies.
  • compositions may be useful for the treatment or prevention or for diagnosing of vascular diseases.
  • test systems to study the function and interaction of gene products, the malfunction or expression of which cause vascular and/or tumorous diseases.
  • Such systems would also be suitable for drug development against such diseases.
  • a prominent example for such diseases are diseases which develop from cells in tissues that are faced with low oxygen tension under certain physiological (embryogenesis) as well as pathological (tumor growth, wound healing) conditions.
  • the compensatory mechanisms that enable these cells to survive hypoxic conditions involve activation and repression of certain genes (for review see Bunn, Physiol. Rev. 76 (1996), 839- 885). In order to restore an adequate oxygen supply, either improved oxygen transport or new vessel formation is required.
  • Neoplasias can be divided into two groups according to their VEGF expression pattern: one group constitutively expresses VEGF in all tumor cells, e.g., VHL-disease associated hemangioblastomas (Wizigmann-Voos, Cancer Res.
  • VEGF vascular endothelial growth factor
  • hypoxia-inducible factor 1 (Semenza, Mol. Cell. Biol. 12 (1992), 5447-5454).
  • This transcription factor consists of HIF 1 a and HIF 1 ⁇ (ARNT), both members of the bHLH-PAS-domain family (Wang, Proc. Natl. Acad. Sci. USA 92 (1995), 5510-5514).
  • Similarities in the hypoxic induction of EPO and VEGF suggested that VEGF expression induced by low oxygen tension is subject to regulation by the same transcription factor.
  • hypoxia gliomas The evidence on the regulation of VEGF gene expression by hypoxia in gliomas has thus far been based on the colocalization of increased VEGF mRNA expression and regions of low oxygen, and on transfection studies performed with VEGF reporter gene constructs using cultured glioma cells in vitro.
  • HIF1 binding site it is not known whether indeed the HIF1 binding site is essential and sufficient to confer full hypoxia inducible expression in vitro and in vivo or whether additional regulatory sequences are required.
  • test systems are required which closely resemble hypoxia regulated gene expression in vivo since otherwise non-informative or even false positive results may be obtained.
  • the technical problem of the present invention is to provide a means that allows studying hypoxia regulated gene expression in vivo.
  • the invention relates to a recombinant DNA molecule comprising:
  • VEGF Vascular Endothelial Growth factor
  • regulatory sequences involved in hypoxia regulated gene expression have been identified.
  • Said regulatory sequence(s) are suitable to confer hypoxia regulated expression to a heterologous DNA sequence, wherein the regulation of the expression of said heterologous DNA sequence is substantially identical with the hypoxia regulated expression the VEGF gene.
  • Experiments with stably transfected GS9L cell clones containing mouse VEGF-lacZ reporter gene constructs injected into syngeneic rats were performed in accordance with the present invention.
  • GS9L cells clonaliy selected to contain the reporter gene were used to produce the transplanted tumors such that all GS9L cells in the tumor should contain the VEGF reporter gene, only the PNP cells upregulated its expression, confirming that the special microenvironment of the PNP cells confers a distinct regulation onto the VEGF gene.
  • VEGF expression in glioma tumors growing in animals is restricted to distinctive perinecrotic palisading (PNP) cells that flank necrotic regions within the tumor.
  • PNP perinecrotic palisading
  • GS9L glioma cells form tumors with distinctive necrotic foci which are histologically similar to human gliomas.
  • the regulatory sequences of the invention are particularly suited and useful for the engineering of transgenic cells and non-human animals which can serve as a test system for the development of drugs for the treatment of vascular and tumorous diseases due to hypoxia induced gene expression.
  • the genomic DNA of the VEGF gene comprising the 5' and 3' regulatory sequences can be obtained, for example, by screening a phage library of genomic DNA in the vector ⁇ Fixll (Stratagene, La Jolla, CA) generated by conventional methods known in the art.
  • a first regulatory sequence of a promoter active in mammalian cells means a nucleotide sequence comprising binding sites of transcription factors and/or regulatory proteins.
  • a second regulatory sequence derived from the 3'-untranslated region of the VEGF gene means a nucleotide sequence of the 3'-untranslated sequences from the VEGF gene from mouse capable of regulating hypoxia induced gene expression.
  • regulatory sequence derived from the 3'-untranslated region of a gene homologous to the VEGF gene includes regulatory sequences of a gene from another species, for example, humans and other mammals such as rat which is homologous to the VEGF gene of mouse and which confers the same expression pattern.
  • figure 1a and b which compares the 3' untranslated region of the VEGF gene from mouse with that of human and rat, respectively, the nucleotide sequence of said region is highly conserved.
  • the 3' untranslated regions of the human and the rat VEGF gene function in the same fashion as that of the mouse gene does.
  • regulatory sequences are characterized by their capability of conferring hypoxia regulated expression of a heterologous DNA sequence in vivo, preferably in glioma cells.
  • regulatory sequences from other species can be used that are ' functionally homologous to the regulatory sequences of the 3'-untranslated region of the VEGF gene from mouse, or regulatory sequences of genes that display an identical pattern of expression, in the sense of being expressed under hypoxic conditions, preferably in glioma cells.
  • VEGF gene from mouse
  • corresponding genes from other species, for example, humans and other mammals.
  • This can be done by conventional techniques known in the art, for example, by using VEGF gene sequences as a hybridization probe or by designing appropriate PCR primers.
  • a reporter gene such as the luciferase or green fluorescent protein (GFP)
  • the nucleotide sequence of the human and rat VEGF genes including the 3'-UTR are described in Levy, J. Biol. Chem. 271 (1996), 25492-25497 and 2746-2753. Furthermore, the nucleotide sequence of the 3'-UTR of the human VEGF gene can be obtained from the GenBank data base (accession no. Y08736).
  • the present invention also relates to recombinant DNA molecules comprising regulatory sequences which are substantially identical to that of the VEGF 3'-UTR or to a 3'-UTR of a homologous gene or to fragments thereof and which are able to contribute to hypoxia regulated expression in vivo in mice or other mammals.
  • regulatory sequences differ at one or more positions from the above-mentioned regulatory sequences but still have the same specificity, namely they comprise the same or similar sequence motifs responsible for the above described expression pattern.
  • Preferably such regulatory sequences hybridize to one of the above- mentioned regulatory sequences, most preferably under stringent conditions.
  • regulatory sequences which share at least 85%, more preferably 90-95%, and most preferably 96-99% sequence identity with one of the above-mentioned regulatory sequences and have the regulatory properties as described above.
  • Such regulatory sequences also comprise those which are analogues or are derivatives, and differ, for example by way of nucleotide deletion(s), insertion(s), substitution(s), addition(s), and/or recombination(s) and/or any other modification(s) known in the art, either alone or in combination from the above- described nucleotide sequence.
  • a suitable inducible system is for example tetracycline-regulated gene expression which is described by, e.g., Gossen (Proc. Natl. Acad. Sci. USA 89 (1992), 5547-5551 ; Trends Biotech. 12 (1994), 58-62).
  • Further regulatory sequences comprise sequences which influence the specificity and/or level of expression, for example in the sense that they confer cell and/or tissue specificity or developmentally and/or inducibly regulated gene expression.
  • Such sequences can be located upstream of or comprising the transcription initiation site, such as a promoter, but can also be located downstream thereof, e.g., in transcribed but untranslated leader sequences.
  • promoter refers to the nucleotide sequences necessary for transcription initiation, i.e. RNA polymerase binding, and also includes, for example, the TATA box.
  • in vivo for the purpose of the present invention is used for cells in an organism as opposed to cells growing in culture (in vitro).
  • heterologous with respect to the DNA sequence being operatively linked to the promoter of the invention means that said DNA sequence is not naturally linked to the regulatory sequences comprised in the recombinant DNA molecule of the invention.
  • said second regulatory sequence is selected from the group consisting of
  • DNA sequences comprising a nucleotide sequence which hybridizes with a nucleotide sequence of (a) or (b) under stringent conditions and which is capable of regulating hypoxia induced expression in vivo;
  • DNA sequences comprising a fragment, analogue or derivative of a nucleotide sequence of any one of (a) to (d) capable of regulating hypoxia induced expression in vivo.
  • said first regulatory sequence of the invention comprises an AP-1 binding site, an SP1 binding site, or a Hypoxia Inducible Factor (HIF)1 binding site or any combination(s) thereof
  • said first regulatory sequence comprises an AP-1 and an HIF1 binding site.
  • said first regulatory sequence is derived from a promoter of hypoxia inducible genes, genes encoding growth factors or their receptors or glycolytic enzymes.
  • said growth factor is VEGF, PDGF or Fibroblast growth factor.
  • Expression comprises transcription of the DNA sequence, preferably into a translatable mRNA.
  • Regulatory elements ensuring expression in eukaryotic cells are well known to those skilled in the art. They usually comprise promoters ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements may include transchptional as well as translational enhancers.
  • Preferably said further regulatory sequence is a minimal promoter; preferably derived from SV40. These promoters can be combined with the regulatory sequences of the invention in order to mediate hypoxia inducible gene expression of heterologous DNA sequences.
  • hypoxia mediated gene expression is not confined to one particular region of the VEGF gene but that regulatory sequences in the promoter and in the 3' untranslated region of the VEGF gene contribute to hypoxia mediated expression.
  • results obtained in accordance with the present invention revealed that when both, the regulatory sequence of the VEGF promoter and that of the 3' untranslated region of the gene, are operatively linked to a heterologous DNA sequence (in this case a reporter gene) this leads to an unexpected synergistic effect in that a significant upregulation of the expression of the heterologous DNA sequence is achieved under hypoxic or ischemic conditions.
  • said first regulatory sequence comprises a DNA sequence selected from the group consisting of
  • DNA sequences comprising a nucleotide sequence which hybridizes with a nucleotide sequence of (a) or (b) under stringent conditions and which is capable of regulating hypoxia induced expression in vivo;
  • DNA sequences comprising a fragment, analogue or derivative of a nucleotide sequence of any one of (a) to (d) capable of regulating hypoxia inducible expression in vivo.
  • hypoxia responsiveness of the human VEGF promoter in C6 glioma cells was attributed to a 288bp Sacl-Banl fragment, located 1 176 bp to 888 bp upstream of the transcription initiation site.
  • Experiments performed in accordance with the present invention revealed, however, that the HIF 1 binding site is not sufficient to confer full hypoxia inducibility to the reporter gene in C6 glioma cells.
  • the results obtained in accordance with the invention indicate that sequences upstream of the HIF 1 consensus site potentiate the hypoxic induction mediated by HIF 1.
  • AP 1 has been shown to be hypoxia-inducible in both its DNA-binding and transactivation capacities in, e.g., HeLa (Rupee, Eur. J. Biochem. 234 (1995), 632- 640 and Hep3B (Prabhakar, Brain Res. 697 (1995), 266-270) cells, no alterations in AP 1 function could be shown in other cell lines (Prabhakar, Brain Res. 697 (1995), 266-270). Thus, AP 1 -mediated modulation of gene expression in response to hypoxia may occur in a cell-type specific manner.
  • upstream sequences have a potentiating effect on hypoxia induction, which can be attributed to binding sites of transcription factors such as for AP1 .
  • This effect may be part of a cell-type specific modulation pathway allowing the fine-tuning of the transchptional response to hypoxia.
  • the heterologous DNA sequence of the above- described recombinant DNA molecules encodes a peptide, protein, antisense RNA, sense RNA and/or ribozyme.
  • the recombinant DNA molecule or vector of the invention can be used alone or as part of a vector to express heterologous DNA sequences, which, e.g., encode proteins other than VEGF, in cells of the blood vessel wall, i.e. endothelial cells, or in neuronal cells, for, e.g., gene therapy or diagnostics of vascular diseases such as atherosclerosis or determination of the oxygen tension of a cell, tissue or organ.
  • the recombinant DNA molecule or vector containing DNA sequence encoding a protein of interest is introduced into the cells which in turn produce the protein of interest, preferably upon hypoxia induction.
  • sequences encoding t-PA Piernica, Nature 301 (1982), 214
  • p21 cell cycle inhibitor El-Deiry, Cell 75 (1993), 817-823
  • nitric oxide synthase Bosset, Nature 347 (1990), 768-770
  • thrombolytic agents can be expressed under the control of the regulatory sequences of the invention for expression by vascular endothelial cells in blood vessels, e.g., vessels occluded by aberrant blood clots under hypoxic conditions.
  • Other heterologous proteins e.g., proteins which inhibit smooth muscle cell proliferation, e.g., interferon- ⁇ and atrial natriuretic polypeptide, may be specifically expressed in cells in the hypoxic state to ensure the delivery of these therapeutic peptides to an atherosclerotic lesion or an area at risk of developing an atherosclerotic lesion, e.g., an injured blood vessel.
  • hypoxic regulatory sequences of the invention may also be used in gene therapy to promote angiogenesis to treat diseases such as peripheral vascular disease or coronary artery disease (Isner, Circulation 91 (1995), 2687-2692).
  • the regulatory sequences of the invention can be operatively linked to sequences encoding cellular growth factors which promote angiogenesis, e.g., VEGF, acidic fibroblast growth factor, basic fibroblast growth factor and the like.
  • said protein is selected from the group consisting of Hypoxia Inducible Factor (HIF), HIF-Related Factor (HRF), tissue plasminogen activator, p21 cell cycle inhibitor, nitric oxide synthase, interferon- ⁇ , atrial natriuretic polypeptide, p53, proteins encoded by apoptosis inducing genes of the bcl2 family, and monocyte chemotactic proteins.
  • said protein is a scorable marker, preferably luciferase, green fluorescent protein or ⁇ -galactosidase.
  • glioma cells can be cultured in the presence and absence of the candidate compound in order to determine whether the compound affects the expression of genes which are under the control of regulatory sequences of the invention, which can be measured, e.g., by monitoring the expression of the above-mentioned marker.
  • marker genes may be employed as well, encoding, for example, selectable marker which provide for the direct selection of compounds which induce or inhibit the expression of said marker.
  • the regulatory sequences of the invention may also be used in methods of antisense therapy.
  • Antisense therapy may be carried out by administering to an animal or a human patient, a recombinant DNA containing the regulatory sequences of the invention operably linked to a DNA sequence, i.e. an antisense template which is transcribed into an antisense RNA.
  • the antisense RNA may be a short (generally at least 10, preferably at least 14 nucleotides, and optionally up to 100 or more nucleotides) nucleotide sequence formulated to be complementary to a portion of a specific mRNA sequence. Standard methods relating to antisense technology have been described (Melani, Cancer Res. 51 (1991 ), 2897-2901 ).
  • the antisense RNA binds to its target mRNA molecules within a cell, thereby inhibiting translation of the mRNA and down- regulating expression of the protein encoded by the mRNA.
  • an antisense sequence complementary to a portion of or all of the VEGF mRNA would inhibit the expression of VEGF, which in turn would inhibit angiogenesis.
  • Such antisense therapy may be used to treat cancer, particulariy to inhibit angiogenesis at the site of a solid tumor, as well as other pathogenic conditions which are caused by or exacerbated by angiogenesis, e.g., inflammatory diseases such as rheumatoid arthritis, and diabetic retinopathy.
  • angiogenesis e.g., inflammatory diseases such as rheumatoid arthritis, and diabetic retinopathy.
  • the expression of other proteins involved in cell proliferation and angiogenesis may also be inhibited in a similar manner, for example, cell cycle proteins (thereby inhibiting cell proliferation, and therefore, angiogenesis); coagulation factors such as von Willebrand factor; and cell adhesion factors, such as ICAM-1 and VCAM-1 (Bennett, J. Immunol. 152 (1994), 3530-3540).
  • said antisense RNA or said ribozyme are directed against a gene involved in vasculogenesis and/or angiogenesis and/or tumors which require neovascularization.
  • the invention relates to nucleic acid molecules of at least 15 nucleotides in length hybridizing specifically with a regulatory sequence as described above or with a complementary strand thereof. Specific hybridization occurs preferably under stringent conditions and implies no or very little cross-hybridization with nucleotide sequences having no or substantially different regulatory properties. Such nucleic acid molecules may be used as probes and/or for the control of gene expression. Nucleic acid probe technology is well known to those skilled in the art who will readily appreciate that such probes may vary in length. Preferred are nucleic acid probes of 17 to 35 nucleotides in length. Of course, it may also be appropriate to use nucleic acids of up to 100 and more nucleotides in length.
  • the nucleic acid probes of the invention are useful for various applications. On the one hand, they may be used as PCR primers for amplification of regulatory sequences according to the invention. Another application is the use as a hybridization probe to identify regulatory sequences hybridizing to the regulatory sequences of the invention by homology screening of genomic DNA libraries.
  • Nucleic acid molecules according to this preferred embodiment of the invention which are complementary to a regulatory sequence as described above may also be used for repression of expression of a gene comprising such regulatory sequences, for example due to an antisense or triple helix effect or for the construction of appropriate ribozymes (see, e.g., EP-B1 0 291 533, EP-A1 0 321 201 , EP-A2 0 360 257) which specifically cleave the (pre)- mRNA of a gene comprising a regulatory sequence of the invention. Selection of appropriate target sites and corresponding ribozymes can be done as described for example in Steinecke, Ribozymes, Methods in Cell Biology 50, Galbraith et al.
  • nucleic acid probe with an appropriate marker for specific applications, such as for the detection of the presence of a nucleic acid molecule of the invention in a sample derived from an organism.
  • nucleic acid molecules may either be DNA or RNA or a hybrid thereof.
  • said nucleic acid molecule may contain, for example, thioester bonds and/or nucleotide analogues, commonly used in oligonucleotide anti-sense approaches. Said modifications may be useful for the stabilization of the nucleic acid molecule against endo- and/or exonucleases in the cell.
  • Said nucleic acid molecules may be transcribed by an appropriate vector containing a chimeric gene which allows for the transcription of said nucleic acid molecule in the cell.
  • Such nucleic acid molecules may further contain ribozyme sequences which specifically cleave the (pre)-mRNA comprising the regulatory sequence of the invention.
  • oligonucleotides can be designed which are complementary to a regulatory sequence of the invention (triple helix; see Lee, Nucl. Acids Res. 6 (1979), 3073; Cooney, Science 241 (1988), 456 and Dervan, Science 251 (1991), 1360), thereby preventing transcription and the production of the encoded protein.
  • the present invention also relates to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering that comprise a recombinant DNA molecule of the invention.
  • said vector is an expression vector and/or a targeting vector.
  • Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the recombinant DNA molecule or vector of the invention into targeted cell population.
  • the present invention furthermore relates to host cells transformed with a DNA molecule or vector of the invention.
  • Said host cell may be a prokaryotic or eukaryotic cell.
  • the vector or recombinant DNA molecule of the invention which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally.
  • the recombinant DNA molecule of the invention can be used for "gene targeting" and/or “gene replacement", for restoring a mutant gene or for creating a mutant gene via homologous recombination.
  • the host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell.
  • Preferred fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae.
  • Suitable mammalian cell lines comprise Saos-2 human osteosarcoma cells (ATCC HTB-85), HeLa human epidermoid carcinoma cells (ATCC CRL-7923), HepG2 human hepatoma cells (ATCC HB-8065), human fibroblasts (ATCC CRL-1634), U937 human histiocytic lymphoma cells (ATCC CRL-7939), RD human embryonic rhabdomyosarcoma cells (ATCC CCL-136), MCF7 human breast adenocarcinoma cells (ATCC HTB-22), JEG-3 human choriocarcinoma cells (ATCC HB36), A7r5 fetal rat aortic smooth muscle cells (ATCC CRL-1444), NIH 3T3 mouse fibroblasts (ATCC CRL-1658) HEP 3B (ATCC HB 8064), C6 (ATCC CCL 107) and GS 9L obtainable from the American Type Culture Collection.
  • Primary-culture HUVEC may be obtained from Clonetics Corp. (San Diego, CA) and can be grown in EGM medium containing 2% fetal calf serum (Clonetics).
  • Primary-culture human aortic and intestinal smooth muscle cells can also be obtained from Clonetics Corp.
  • Most preferably said host cell is a glioma cell or derived therefrom, or a primary cell, tumor cell, spheroid cell, aggregate cell, stem cell or a differentiated cell although any other animal, preferably mammalian cell may be appropriate as well.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one of the aforementioned recombinant DNA molecules or vectors of the invention, either alone or in combination, and optionally a pharmaceutically acceptable carrier or excipient.
  • suitable pharmaceutical carriers include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc.
  • Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose.
  • compositions of the invention may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration.
  • the dosage regimen will be determined by the attending physician and other clinical factors.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosages will vary but a preferred dosage for intravenous administration of DNA is from approximately 10 6 to 10 22 copies of the DNA molecule.
  • the compositions of the invention may be administered locally or systemically. Administration will generally be parenterally, e.g., intravenously; DNA may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery.
  • the various recombinant DNA molecules and vectors of the invention are administered either alone or in any combination using standard vectors and/or gene delivery systems, and optionally together with an appropriate compound, for example VEGF, and/or together with a pharmaceutically acceptable carrier or excipient.
  • said recombinant DNA molecules may be stably integrated into the genome of the mammal.
  • viral vectors may be used which are specific for certain cells or tissues, preferably for the endothelium and persist in said cells. Suitable pharmaceutical carriers and excipients are well known in the art.
  • the pharmaceutical compositions prepared according to the invention can be used for the prevention or treatment or delaying of different kinds of diseases, which are related to the expression or overexpression of hypoxia regulated genes.
  • a pharmaceutical composition of the invention which comprises a recombinant DNA molecule or vector of the invention in gene therapy.
  • Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses,-. adenoviruses, and adeno-associated viruses, among others. Delivery of nucleic acids to a specific site in the body for gene therapy or antisense therapy may also be accomplished using a biolistic delivery system, such as that described by Williams (Proc. Natl. Acad. Sci. USA 88 (1991 ), 2726-2729).
  • Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the art of molecular biology, see, e.g., WO 94/29469.
  • Gene therapy and antisense therapy to prevent or decrease the development of atherosclerosis or inhibit angiogenesis may be carried out by directly administering the recombinant DNA molecule or vector of the invention to a patient or by transfecting endothelial cells with the recombinant DNA molecule or vector of the invention ex vivo and infusing the transfected cells into the patient.
  • research pertaining to gene transfer into cells of the germ line is one of the fastest growing fields in reproductive biology.
  • Gene therapy which is based on introducing therapeutic genes into cells by ex-vivo or in-vivo techniques is one of the most important applications of gene transfer. Suitable vectors and methods for in-vitro or in-vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., WO94/29469, WO 97/00957 or Schaper (Current Opinion in Biotechnology 7 (1996), 635-640) and references cited therein.
  • the DNA molecules and vectors comprised in the pharmaceutical composition of the invention may be designed for direct introduction or for introduction via liposomes, or viral vectors (e.g. adenoviral, retroviral) containing said recombinant DNA molecule into the cell.
  • said cell is a germ line cell, embryonic cell, or egg cell or derived therefrom.
  • the pharmaceutical compositions according to the invention can be used for the treatment of diseases hitherto unknown as being related to hypoxia regulated gene expression.
  • the introduced recombinant DNA molecules and vectors of the invention express the heterologous DNA sequence after introduction into said cell and preferably remain in this status during the lifetime of said cell.
  • cell lines which stably express the heterologous DNA under the control of the regulatory sequence of the invention may be engineered according to methods well known to those skilled in the art .
  • host cells can be transformed with the recombinant DNA molecule or vector of the invention and a selectable marker, either on the same or separate vectors.
  • engineered cells may be allowed to grow for 1 -2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows for the selection of cells having stably integrated the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines which express the heterologous DNA sequence under the control of the regulatory sequence of the invention, and which respond to VEGF and/or hypoxia mediated signal transduction. Such engineered cell lines are particularly useful in screening compounds capable of modulating hypoxia mediated gene expression.
  • a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, Cell 1 1 (1977), 223), hypoxanthine-guanine phosphoribosyltransferase (Szybaiska, Proc. Natl. Acad. Sci. USA 48 (1962), 2026), and adenine phosphoribosyltransferase (Lowy, Cell 22 (1980), 817) in tk “ , hgprt " or aprt " cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, Proc. Natl.
  • trpB which allows cells to utilize indole in place of tryptophan
  • hisD which allows cells to utilize histinol in piace of histidine
  • ODC ornithine decarboxylase
  • DFMO 2-(difluoromethyl)-DL-ornithine
  • the person skilled in the art may also use the regulatory sequences of the invention to "knock out" an endogenous gene comprising identical or similar regulatory sequences, for example, by gene targeting, cosuppression, triple helix, antisense or ribozyme technology.
  • the present invention also relates to compositions comprising at least one of the aforementioned recombinant DNA molecules or vectors, and in the case of diagnostic compositions, optionally suitable means for detection.
  • Said compositions may further contain compounds such as further plasmids, antibiotics and the like for screening transgenic animals and/or animal cells useful for the genetic engineering of non-human animals, preferably mammals and most preferably mouse.
  • the diagnostic compositions of the invention may be used for methods of detecting and isolating regulatory sequences which are a functionally equivalent to regulatory sequences of the invention capable of modulating hypoxia inducible gene expression.
  • the present invention also relates to a method for the production of a transgenic animal, preferably transgenic mouse, comprising introduction of a recombinant DNA molecule or vector of the invention into a germ cell, an embryonic cell or an egg or a cell derived therefrom.
  • the non-human animal to be used in the method of the invention may be a no ⁇ -transge ⁇ ic healthy animal, or may have a disease or disorder, preferably a disease or disorder which is dependent on neovascularization, such as a solid tumor, retinopathy, arthritis or psoriasis.
  • Said disease or disorder may be an inborn insufficiency or naturally developed or caused by genetic engineering, for instance by the expression of a DNA sequence encoding a protein involved in neuronal development and/or diseases as described above, preferably under the control of the regulatory sequence of the invention.
  • the invention also relates to transgenic non-human animals such as transgenic rats, hamsters, dogs, monkeys, rabbits or pigs comprising a recombinant DNA molecule or vector of the invention or obtained by the method described above, preferably wherein said recombinant DNA molecule is stably integrated into the genome of said non-human animal, preferably such that the presence of said recombinant DNA molecule or vector leads to the transcription and/or expression of the heterologous DNA sequence by the regulatory sequence of the invention.
  • transgenic non-human animals such as transgenic rats, hamsters, dogs, monkeys, rabbits or pigs comprising a recombinant DNA molecule or vector of the invention or obtained by the method described above, preferably wherein said recombinant DNA molecule is stably integrated into the genome of said non-human animal, preferably such that the presence of said recombinant DNA molecule or vector leads to the transcription and/or expression of the heterologous DNA sequence by the regulatory sequence of the invention.
  • hypoxia induced gene expression has different functions in different stages of physiological and pathological conditions, it is now possible to determine further regulatory sequences which may be important for the up- or down-regulation of hypoxia inducible genes, for example in specific tumors.
  • hypoxia inducible genes for example in specific tumors.
  • in vivo study mutations which affect different functional or regulatory aspects of hypoxia regulated gene expression.
  • Heart cardiac infarction, stroke and peripheral artery disease are the most common diseases of the Western world.
  • the functional integrity and formation (angiogenesis) of blood vessels is regulated by tissue hormones and growth factors which themselves are activated by local hypoxia, ischemia or injury , .
  • tissue hormones and growth factors which themselves are activated by local hypoxia, ischemia or injury , .
  • Short periods of experimental ischemia which by themselves have no detrimental effects in organs such as the heart have been shown to have beneficial effects. This effect is known as preconditioning.
  • the regulating sequences described herein account for hypoxia inducible upregulation of a heterologous DNA sequence (here reporter gene) involved in the regulation of hypoxia and ischemia, and thus in the preconditioning response.
  • recombinant DNA molecule comprising a readout system operatively linked to at least one regulatory sequence capable of mediating or regulating hypoxia and/or ischemia inducible expression of said readout system, preferably the recombinant DNA molecules of the invention can be used to identify new lead compounds which trigger the preconditioning response or support the survival functions of the organ in the absence of hypoxia/ischemia prior to an anticipated life-threatening infarction or stroke.
  • the present invention further relates to a method for the identification of an agonist/activator and antagonist/inhibitor of genes or gene products involved in hypoxia and/or ischemia comprising the steps of:
  • read out system in context with the present invention means a DNA sequence which upon transcription and/or expression in a cell, tissue or organism provides for a scorable and/or selectable phenotype.
  • read out systems are well known to those skilled in the art and comprise, for example, recombinant DNA molecules as described above.
  • plurality of compounds in a method of the invention is to be understood as a plurality of substances which may or may not be identical.
  • Said plurality of compounds may be comprised in, for example, samples, e.g., cell extracts from, e.g., plants, animals or microorganisms. Furthermore, said compounds may be known in the art but hitherto not known to be capable of suppressing or activating and/or enhancing the transcription of a hypoxia inducible gene.
  • the plurality of compounds may be, e.g., added to the culture medium or injected into the animals.
  • a sample containing a plurality of compounds is identified in the method of the invention, then it is either possible to isolate the compound from the original sample identified as containing the compound capable of suppressing or activating and/or enhancing the transcription of a hypoxia regulated gene, or one can further subdivide the original sample, for example, if it consists of a plurality of different compounds, so as to reduce the number of different substances per sample and repeat the method with the subdivisions of the original sample. It can then be determined whether said sample or compound mimics or suppresses the cellular effects of hypoxia.
  • the steps described above can be performed several times, preferably until the sample identified according to the method of the invention only comprises a limited number of or only one substance(s).
  • said sample comprises substances of similar chemical and/or physical properties, and most preferably said substances are identical.
  • said recombinant DNA molecule comprising said read out system is a recombinant DNA molecule as described in the embodiments hereinbefore.
  • said animal or human cell, tissue or non-human animal is a cell, tissue or transgenic non-human animal described in the embodiments hereinbefore.
  • said recombinant DNA molecule comprised in said animal or human cell, tissue or non- human transgenic animal is introduced into the genome by transfection, transformation, electroporation, infection or particle bombardment.
  • Determining whether a compound is capable of suppressing or activating and/or enhancing the transcription of a hypoxia regulated gene can be done, for example, in mice by monitoring the reporter gene. It can further be done by monitoring the behavior of the transgenic non-human animals of the invention contacted with the compounds and compare it to that of wild-type animals. In an additional embodiment, said behavior may be compared to that of a transgenic non-human animal contacted with a compound which is either known to be capable or incapable of suppressing or activating and/or enhancing the transcription of a hypoxia regulated gene of said transgenic non-human animal of the invention. Furthermore, the person skilled in the art can monitor the physical behavior.
  • the compounds identified according to the method of the invention are expected to be very beneficial since for the treatment of heart ischemia and peripheral artery diseases so far only approaches using bolus injections or infusions of recombinant VEGF or, alternatively, gene therapy have been used and there is only limited success due to the high turnover of the protein or limited expressivity of transduced genes.
  • the present invention provides methods for identifying compounds which modulate hypoxia inducible gene expression.
  • activators of hypoxia inducible expression may be used in processes such as wound healing; in contrast, antagonists of expression may be used in the treatment of tumors that rely on vascularization for growth.
  • Compounds found to downregulate expression of a VEGF gene can be used in methods to inhibit angiogenesis, while compounds found to enhance hypoxia mediated expression can be used in methods to promote angiogenesis, for example, to promote wound healing (e.g., healing of broken bones, burns, diabetic ulcers, and traumatic or surgical wounds) or to treat peripheral vascular disease, atherosclerosis, cerebral vascular disease, hypoxic tissue damage (e.g., hypoxic damage to heart tissue), diabetic pathologies such as chronic skin lesions, or coronary vascular disease. These compounds can also be used to treat patients who have, or have had, transient ischemic attacks, vascular graft surgery, balloon angioplasty, frostbite, gangrene, or poor circulation. Compounds identified as having the desired effect (i.e. modulating hypoxia inducible expression) can be tested further in appropriate models of angiogenesis which are known to those skilled in the art.
  • the induction of hypoxia is performed by modulation of O 2 partial pressure, or conferred by a compound capable of mimicking the oxygen-sensing and signal transducing mechanism in a cell, preferably cobaltous chloride, desferrioxamine, glucose and nutrient deprivation.
  • said compound used for inducing mimicking effects of hypoxia is a hypoxia-inducible factor (HIF) or a HIF-related factor (HRF) or a nucleic acid molecule encoding either of said factors operatively linked to regulatory elements allowing expression of said nucleic acid molecules in said mammalian cell.
  • HIF hypoxia-inducible factor
  • HRF HIF-related factor
  • the invention relates to a compound obtained or identified according to the method of the invention said compound being an agonist/activator of hypoxia inducible gene expression and/or function or an antagonist/inhibitor of hypoxia inducible gene expression and/or function.
  • the present invention also relates to a method for the production of a pharmaceutical composition comprising the steps of the method of the invention and a step of formulating the so identified compound in a pharmaceutically acceptable form.
  • the therapeutically useful compounds identified according to the method of the invention may be administered to a patient by any appropriate method for the particular compound, e.g., orally, intravenously, parenterally, transdermally, transmucosally, or by surgery or implantation (e.g., with the compound being in the form of a solid or semi-solid biologically compatible and resorbable matrix) at or near the site where the effect of the compound is desired.
  • a salve or transdermal patch that can be directly applied to the skin so that a sufficient quantity of the compound is absorbed to increase vascularization locally may be used. This method would apply most generally to wounds on the skin. Salves containing the compound can be applied topically to induce new blood vessel formation locally, thereby improving oxygenation of the area and hastening wound healing. Therapeutic doses are determined to be appropriate by one skilled in the art.
  • identification of transacting factors which interact with the regulatory sequences of the invention can form the basis for the development of novel therapeutics for modulating hypoxic conditions associated with, for example ischemia, angiogenesis, vascular disease, and wound healing. Identification of transacting factors is carried out using standard methods in the art (see, e.g., Sambrook, supra, and Ausubel, supra) or methods as described in the appended examples. To determine whether a protein binds to the regulatory sequences of the invention, standard DNA footprinting and/or native gel-shift analyses can be carried out. In order to identify a transacting factor which binds to the regulatory sequence of the invention, the regulatory sequence can be used as an affinity reagent in standard protein purification methods, or as a probe for screening an expression library.
  • transacting factor modulation of its binding to the regulatory sequences of the invention can be pursued, beginning with, for example, screening for inhibitors of transacting factor binding.
  • Enhancement of hypoxia inducible expression in a patient, and thus enhancement of angiogenesis may be achieved by administration of the transacting factor, or the gene encoding it (e.g., in a vector for gene therapy).
  • the active form of the transacting factor is a dimer, dominant-negative mutants of the transacting factor could be made in order to inhibit its activity.
  • further components in the pathway of hypoxia signal transduction can be identified. Modulation of the activities of these components can then be pursued, in order to develop additional drugs and methods for modulating cell growth and angiogenesis.
  • the present invention also relates to an antibody specifically recognizing the compound of the present invention.
  • Monoclonal antibodies can be prepared, for example, by the techniques as originally described in Kohler and Milstein, Nature 256 (1975), 495, and Galfre, Meth. Enzymol. 73 (1981 ), 3, which comprise the fusion of mouse myeloma cells to spleen cells derived from immunized mammals. Furthermore, antibodies or fragments thereof to the aforementioned MCPs or their receptors can be obtained by using methods which are described, e.g., in Harlow and Lane “Antibodies, A Laboratory Manual", CSH Press, Cold Spring Harbour, 1988. These antibodies may be monoclonal antibodies, polyclonal antibodies or synthetic antibodies as well as fragments of antibodies, such as Fab, Fv, or scFv fragments etc.
  • the present invention relates to a pharmaceutical or diagnostic composition
  • a pharmaceutical or diagnostic composition comprising the above-described compounds which are agonists/activators or antagonists/inhibitors and/or antibodies and optionally a pharmaceutically acceptable carrier or suitable means for detection, respectively; see supra.
  • the present invention relates to the use of the recombinant DNA molecule, vector, cell, pharmaceutical compositions, diagnostic compositions or a transgenic non-human animal of the invention for the identification of a chemical and/or biological substance capable of suppressing or activating and/or enhancing the transcription, expression and/or activity of hypoxia regulated genes and/or its expression products.
  • the chemical or biological substance used in the methods and uses of the present invention is selected from the group consisting of peptides, proteins, nucleic acids, antibodies, small organic compounds, hormones, neural transmitters, peptidomimics, and PNAs (Milner, Nature Medicine 1 (1995), 879-880; Hupp, Cell 83 (1995), 237-245; Gibbs, Cell 79 (1994), 193-198).
  • the present invention further relates to a method of inhibiting a vascular disease in a subject, comprising contacting an artery of said subject with the recombinant DNA molecule or vector of the invention, wherein said protein reduces or prevents the development of the vascular disease, and wherein preferably said protein reduces proliferation of smooth muscle cells.
  • the present invention relates to the use of a recombinant DNA molecule, vector, nucleic acid molecule of the invention, compound and/or antibody of the invention for the preparation of a composition for directing and/or preventing expression of genes specifically during or after hypoxia induction and/or for the preparation of a pharmaceutical composition for treating, preventing and/or delaying a vascular disease, cardiac infarct or stroke, for ischemic preconditioning of organs and/or tissues, for enhancing angiogenesis, arteriogenesis, collateral growth of arteries and/or ischemic tolerance or for the stimulation of hypoxia function, and/or for treating, preventing and/or delaying a tumorous disease in a subject.
  • the present invention relates to the use of a recombinant DNA molecule, vector, nucleic acid molecule compound and/or antibody of the invention for the preparation of a pharmaceutical composition for inducing a vascular disease in a non-human animal or in a transgenic non-human animal described above.
  • the vascular disease is selected from the group consisting of arteriosclerosis, coronary artery diseases, cerebral occlusive diseases, peripheral occlusive diseases, visceral occlusive diseases, renal artery diseases, mesenterial arterial insufficiency, opthalmic and retinal occlusions and the tumorous disease is selected from the group consisting of colon carcinoma, sarcoma, carcinoma in breast, carcinoma in the head/neck, mesothelioma, glioblastoma, lymphoma and meningeoma.
  • the recombinant DNA molecules, vectors, nucleic acid molecules, compounds, uses and methods of the invention can be used for the treatment of all kinds of disorders and diseases hitherto unknown as being related to or dependent on hypoxia regulated genes or genes involved in ischema genes.
  • the recombinant DNA molecules, vectors, nucleic acid molecules, compounds, antibodies, methods and uses of the present invention may be desirably employed in humans, although animal treatment is also encompassed by the methods and uses described herein.
  • the present invention provides for the use of a regulatory sequence as defined above for enhancing and/or directing hypoxia regulated gene expression in cells in any kind of eucaryotic organism.
  • VEGF Vascular Endothelial Growth Factor
  • hVEGF human VEGF
  • EPO Erythropoietin
  • HIF Hypoxia-inducible factor
  • AP 1 Activator protein 1
  • ATF Activating transcription factor
  • bZIP basic leucine zipper
  • bHLH basic helix-loop- helix
  • PAS period-ARNT-singleminded
  • AhR Arylhydrocarbon-Receptor
  • ARNT AhR Nuclear Translocator
  • TCDD 2,3,7,8,-tetrachlorodibenzo-p-dioxin
  • XRE xenobiotic response element
  • aa amino acid, UTR, untranslated region
  • VHL von Hippel-Lindau
  • PNP perinecrotic palisading.
  • Figure 1 (a) Alignments for mouseVEGF 3' untranslated region vs humanVEGF 3'-UTR. (b) Alignment for mouseVEGF 3' untranslated region vs ratVEGF 3'- UTR.
  • FIG. 2 LacZ reporter gene constructs used in the analysis of mechanisms upregulating VEGF expression in vivo.
  • the length of the mouse VEGF 5' flanking region in the construct names is given relative to the transcription start site.
  • Figure 3 Expression of the lacZ reporter gene in experimental GS9L gliomasJ ⁇ - galactosidase histochemical staining is shown for tumors derived from GS9L cells stably transfected with the constructs P915 (a), P1 130 (b), PsvUTR (c) and P1 130UTR (d). Sections were counterstained with neutral red. Necrosis - N. The bars represent 20mm.
  • Figure 4 In situ hybridization of a wild-type GS9L tumor.
  • Sections were hybridized with antisense riboprobes for VEGF (a, b) and HIF 1 a (c-f). Brightfield and darkfield images of necrotic areas of the same sections are shown in a and b and c and d. A higher magnification of a non-necrotic area is shown in e and f. Control hybridizations with a sense probe for HIF 1 a are shown in g and h. Arrowheads point to the palisading cells surrounding necrosis (N). T- viable tumor tissue. The bars represent 20mm.
  • Figure 5 ⁇ -galactosidase histochemical staining and EF 5 immunostaining of a tumor derived from P1 130UTR transfected GS9L glioma cells. Serial sections were stained for expression of the lacZ reporter gene (a) and for the presence of hypoxic regions with an antibody directed against EF 5 (b). Necrosis - N. The bars represent 20mm.
  • FIG. 6 Potentiating sequences for hypoxia induction of the human VEGF gene are present between bp -1 176 and -1015.
  • Deletion analysis of the human VEGF promoter was performed and the constructs were tested in transient transfection assays in C6 glioma cells. Transfection and hypoxic incubations were carried out as described in Example 3.
  • the position of the human VEGF promoter fragments relative to the transcription initiation site is indicated on the left side.
  • the -fold induction by hypoxia summarized on the right side represents the ratio of reporter gene activity obtained under hypoxic versus normoxic conditions. Each bar represents the mean value + SD of at least three independent transfections.
  • FIG. 7 Potentiating sequences are not able to confer hypoxia responsiveness to a heterologous promoter.
  • Figure 8 The potentiating effect of sequences between -1176 and -1015 on hypoxia induction is due an AP 1 consensus binding site.
  • Site directed mutagenesis was performed on a luciferase fusion construct containing - 1176 bp of human VEGF 5' flanking sequence to create internal deletions and point mutations of putative binding sites for the AhR- complex (Xenobiotic Response Element- XRE) or AP 1 -transcription factors.
  • the resulting expression vectors were tested in transient transfection assays in C6 glioma cells. Levels of induction by hypoxia are given relative to that obtained for the wildtype (-1176) construct.
  • FIG. 9 Mutations interfering with the "potentiating" function prevent formation of a distinct DNA-protein-complex. Electrophoretic mobility shift assay was performed as described in Example 5. Nuclear extracts were prepared from hypoxic C6 cells. The AP 1 complex is indicated by an arrowhead. The point mutations introduced are shown on the right.
  • FIG. 10 An AP 1 consensus binding site competes for DNA-protein-complex formation at the "potentiating" sequences. Competition analysis of the hVEGF oligonucleotide was performed as described in Example 6. Nuclear extracts were prepared from hypoxic C6 cells. The AP 1 complex is indicated by an arrowhead.
  • FIG 11 The protein complex at the "potentiating" element consists of members of the Fos- and Jun-families of transcription factors,
  • Example 1 Construction of reporter gene constructs comprising the 3'-UTR of the VEGF gene
  • U41383 were obtained from pV5NBgl63, a subclone resulting from a screen of a ⁇ FIXII genomic library (PCC4 teratocarcinoma cell line, Stratagene) with a mouse VEGF cDNA probe according to the standard methods described in Sambrook, supra.
  • a 530bp fragment of genomic sequence, including the binding site for HIF 1 was amplified by PCR from 129SVJ mouse liver genomic DNA using the oligonucleotide primers 5'-CCTGGTGGGAGCTCTGGGCAG-3' (human sequence, SEQ ID NO. 3) and 5'-GACTTTGAG-CTCCCAAATAATTG-3' (SEQ ID NO.
  • Fusion to the stop-codon was achieved by in vitro mutagenesis using the last 30bp of the lacZ gene and the first 137bp of the mouse VEGF 3'-UTR as the mutated oligome ⁇ CATTACCAGTTGGTCTGGTGTCAAAAATAAGCCAGGCTGGCAGGAAG GAGCCTCCCTCAGGGTTTCGGGAACCAGACCTCTCACCGGAAAGACCGATTAA CCATGTCACCACCACGCCATCATCGTCACCGTTGACAGAACAGTCCTTAATCCA GAAAGCCTGACAT (SEQ ID NO. 17).
  • Mutagenesis was performed using the M13 in vitro mutagenesis kit (BIORAD) according to the manufacturers instructions.
  • the SV40 promoter was derived from the pGL2 promoter vector (Promega). All plasmid constructions were verified by dideoxy sequencing according to standard procedures known in the art.
  • the reporter constructs P1130 and P915 were designed to investigate the role of the 5' regulatory region, and in particular the HIF 1 enhancer binding site.
  • P1130 includes the consensus binding site for the Hypoxia-inducible factor 1
  • P915 lacks this site but contains more proximal 5' sequences. Both of these constructs utilize the polyadenylation site from SV 40. Two other constructs addressed the contribution of the 3' untranslated region of VEGF.
  • PsvUTR utilizes a generic 5' promoter region, derived from the SV40 early region, linked to the lac-Z gene, followed by the 3' untranslated region of the VEGF gene.
  • P1130UTR utilizes the VEGF 5' regulatory region, including the HIF 1 site, along with the VEGF 3' region.
  • Example 2 Characterization of hypoxia mediated expression in vitro and in vivo
  • GS9L glioma cells (Tom Budd, St. Lawrence University New York State) were cultured in RPMI 1640 supplemented with 10% fetal calf serum. 5x10 ⁇ cells were transfected by electroporation with 10 ⁇ g of linearized lacZ reporter plasmid and 1 ⁇ g of selection plasmid (pSV2Neo) containing the npt gene allowing the selection for G418 resistance. After 48 hours, cells were split into RPMI 1640/ 10% fetal calf serum containing 0.5mg/ml G418. Selection was performed on 96 well plates and arising clones were expanded.
  • Clones showing hypoxia-inducible expression of ⁇ -gal were inoculated into syngeneic rats and the resultant tumors analyzed histologically for reporter gene expression. Subcutaneous transplantation into syngeneic Fischer 344 rats, excision of tumors and embedding were performed as described (Plate, Cancer Res. 53 (1993), 5822-5827). For detection of ⁇ -galactosidase activity, 10mm cryostat sections of the tumors were fixed in 2% paraformaldehyde in PIPES-buffer (0.1 M PIPES, 0.5M MgCI 2 , 0.2M EGTA, pH 6.9) for 5 minutes at room temperature.
  • PIPES-buffer 0.1 M PIPES, 0.5M MgCI 2 , 0.2M EGTA, pH 6.9
  • EF 5 (Waleh, Cancer Res. 55 (1995), 6222-6226) was given intravenously as a 10mM solution in PBS. Three hours after injection the animal was narcotized, the tumor was removed, immediately cooled in cold PBS and embedded in Tissue-Tek (Miles Scientific). EF 5 and the corresponding antibody can be obtained from Dr. Cameron J. Koch, Department of Radiation Oncology, University of Pennsylvania, Philadelphia.
  • the analysis of tumors derived from P1130 transfected cells revealed weak ⁇ -gal expression only in PNP cells, indicating that this part of the VEGF 5' flanking region is sufficient to drive the expression of the reporter gene to this distinct cell population, albeit at a low level.
  • Table 1 Association of reporter based ⁇ -galactosidase staining with perinecrotic palisading (PNP) cells in experimental GS9L gliomas. Staining of palisading cells was visually evaluated over the necrotic areas of several sections, the overall appearance of the staining of palisading cells is indicated by - (no staining); + (weak staining, only part of the PNP cells stained); ++ (strong staining of many PNP cells) and +++ (intense staining of all PNP cells).
  • the cRNA probe for mouse HIF 1a was obtained by reverse transcription PCR on cytoplasmic RNA prepared from L929 cells which had been exposed to hypoxic conditions for 2 hours. Cytoplasmatic RNA was prepared according to Sambrook, reverse transcription using super-scriptTM reverse transcriptase (Life Technologies) and oligo dT 17 X-primers was performed according to the instructions of the manufacturer. A 591 bp fragment containing the PAS A and B domains of the protein was amplified using the degenerate primers PAS B3' (5 * -KGTGGTSACTTGTCCTT-3'; SEQ ID NO. 8) and PAS A 5' (5'-GATGGYRAMATGATYTACAT-3'; SEQ ID NO.
  • HIF 1 activity depends on the stabilization of its ⁇ subunit (Huang, J. Biol. Chem., 271 (1996), 32253-32259).
  • the weak ⁇ -galactosidase staining observed in the P1 130 tumors is in accordance with the moderate transchptional activation of VEGF gene expression observed in response to hypoxia in C6 glioma cells in vitro (Ikeda, J. Biol. Chem. 270 (1995), 19761 -19766). This result is, however, in clear contrast to the high level of VEGF mRNA detected in PNP cells of solid tumors. Thus additional mechanisms are implicated in the upregulation of VEGF gene expression in the PNP cells of gliomas.
  • Example 3 Deletional analysis of the human VEGF 5' hypoxia regulatory element
  • hypoxia induction was significantly decreased (p ⁇ 0.001 ) by shortening to bp -1015 (Pvull) (Fig. 6), although the HIF 1 binding consensus remained intact. Induction of the reporter gene expression was completely abolished when the HIF 1 site was destroyed (-973; BsaA I) (Fig. 6).
  • enhancer fragments comprising bp -1168 to -1015; -1015 to -888, and -1176 to -888 were subcloned and tested in front of the (non hypoxia responsive) SV40 promoter.
  • hypoxia induction of the subfragments -1176/-888; -1168/-1015 and -1015/-888 were subcloned in front of the minimal SV40 promoter of the pGL2 promoter vector (Promega). Transfection experiments were performed as described in Example 3.
  • the -1015/ -888 fragment containing the HIF 1 binding site showed a significantly (p ⁇ 0.05) diminished hypoxic response compared to that of the -1 176/-888 fragment.
  • the fragment potentiating the HIF 1 mediated effect (-1 168/-1015) was not able to confer hypoxia responsiveness to the SV40 promoter on its own (Fig. 7).
  • hVEGF 5'-TGGCGGGTAGGTTTGAATCATCACGCAGGC-3' SEQ ID NO.10
  • hVEGF 5' DEL 5'-TGGCGGGTAGGTCACGCAGGC-3' SEQ ID NO. 1 1
  • AP1 M1 5'-TGGCGGGTAGGTTAGAATCATCACGCAGGC-3' SEQ ID NO. 12
  • AP1 M2 5'-TGGCGGGTAGGTTTGGTTCATCACGCAGGC-3' SEQ ID NO.
  • p300 is known to provide physical links between enhancer bound transcription factors and the RNA polymerase II complex (Janknecht, Curr. Biol. 6 (1996), 951-954). Recently, it has been reported that p300 is part of the hypoxia-inducible HIF 1 complex (Arany, Proc. Natl. Acad. Sci. USA 93 (1996), 12969-12973). To date, the partner to which p300 bridges in this complex is unknown. Jun constitutively bound to an upstream sequence would be an attractive partner.
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • MOLECULE TYPE DNA (genomic)
  • HYPOTHETICAL NO
  • AAATTCTCTC CAGAGAAGCC TCTCTGGAAA CTTCCCAGAG GATCCCATTC ACCCCAGGGC 360
  • CAAGAATCAA CTCTCACCCC CTTTCCAAGA CCCGTGCCAT TTGAGCAAGA GTTGGGGTGT 600
  • GCATAATGTA GTCACTAGGG GGCGCTCGGC CATCACGGGG GAGATCGTGA ACTTGGGCGA 660

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur des molécules d'ADN de recombinaison comprenant les séquences régulatrices du gène du facteur de croissance des cellules endothéliales vasculaires (VEGF) ou d'un gène homologue, ces molécules pouvant moduler l'expression induisant l'hypoxie d'une séquence d'ADN hétérologue in vivo. L'invention porte également sur des vecteurs comprenant ces molécules d'ADN de recombinaison, sur des compositions pharmaceutiques et diagnostiques comprenant ces molécules d'ADN de recombinaison et ces vecteurs, et d'autre part, sur des cellules et des animaux transgéniques comprenant les molécules D'ADN de recombinaison ou les vecteurs précités qui sont intégrés de manière stable dans leur génome, et sur leur utilisation dans l'identification de substances capables de supprimer ou d'activer la transcription d'un gène pouvant induire l'hypoxie. L'invention porte de plus sur l'utilisation des molécules d'ADN de recombinaison et les vecteurs précités, utilisés dans la préparation de compositions pharmaceutiques destinées à traiter, prévenir et/ou retarder l'apparition d'une maladie vasculaire ou tumorale chez un sujet, et également dans la préparation de compositions pharmaceutiques destinées à induire une maladie vasculaire ou tumorale chez un animal. L'invention porte encore sur des procédés d'identification d'agonistes/activateurs ou d'antagonistes/inhibiteurs de gènes ou produits géniques impliqués dans l'hypoxie et/ou l'ischémie, sur des composés identifiables par ce procédé, sur des anticorps dirigés contre ces composés, ainsi que sur des compositions pharmaceutiques et diagnostiques comprenant ces agonistes/activateurs, ces antagonistes/inhibiteurs et/ou ces anticorps. Ces compositions peuvent être utilisées dans le traitement ou la prévention ou le diagnostic de maladies vasculaires.
PCT/EP1998/003517 1997-06-10 1998-06-10 Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations WO1998056936A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU85369/98A AU8536998A (en) 1997-06-10 1998-06-10 Regulatory sequences involved in hypoxia regulated gene expression and uses thereof
EP98936322A EP0990042A1 (fr) 1997-06-10 1998-06-10 Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP97109418 1997-06-10
DE97109418.0 1997-06-10

Publications (2)

Publication Number Publication Date
WO1998056936A1 WO1998056936A1 (fr) 1998-12-17
WO1998056936A9 true WO1998056936A9 (fr) 1999-04-08

Family

ID=8226900

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1998/003517 WO1998056936A1 (fr) 1997-06-10 1998-06-10 Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations

Country Status (3)

Country Link
EP (1) EP0990042A1 (fr)
AU (1) AU8536998A (fr)
WO (1) WO1998056936A1 (fr)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2249762T3 (es) 1994-03-08 2006-04-01 Human Genome Sciences, Inc. Factor de crecimiento del endotelio vascular 2.
US7186688B1 (en) 1994-03-08 2007-03-06 Human Genome Sciences, Inc. Methods of stimulating angiogenesis in a patient by administering vascular endothelial growth factor 2
US5932540A (en) 1994-03-08 1999-08-03 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US6040157A (en) 1994-03-08 2000-03-21 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US6608182B1 (en) 1994-03-08 2003-08-19 Human Genome Sciences, Inc. Human vascular endothelial growth factor 2
US7153827B1 (en) 1994-03-08 2006-12-26 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 and methods of use
US6734285B2 (en) 1994-03-08 2004-05-11 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 proteins and compositions
US7109308B1 (en) 1994-03-08 2006-09-19 Human Genome Sciences, Inc. Antibodies to human vascular endothelial growth factor 2
CA2311643C (fr) 1997-12-04 2009-04-07 Genzyme Corporation Compositions et procedes induisant l'expression genique
US7223724B1 (en) 1999-02-08 2007-05-29 Human Genome Sciences, Inc. Use of vascular endothelial growth factor to treat photoreceptor cells
FR2801319A1 (fr) * 1999-11-18 2001-05-25 Inst Nat Sante Rech Med Construction d'acide nucleique porteuse d'un systeme regulant l'expression d'un gene
NZ518077A (en) 2000-08-04 2003-11-28 Human Genome Sciences Inc Biologically active fragments, analogues and derivatives of VEGF-2 for the treatment of peripheral artery diseases such as critical limb ischemia and coronary disease
US7402312B2 (en) 2001-04-13 2008-07-22 Human Genome Sciences, Inc. Antibodies to vascular endothelial growth factor 2 (VEGF-2)
EP2228389B1 (fr) 2001-04-13 2015-07-08 Human Genome Sciences, Inc. Anticorps contre facteur de croissance endothéliale vasculaire 2
WO2003045440A1 (fr) * 2001-11-28 2003-06-05 Angiogenetics Sweden Ab Regulation de l'expression d'un gene inductible par hypoxie au moyen de la proteine de domaine pas inhibiteur antisens
AU2003284382A1 (en) * 2002-11-01 2004-06-07 Mayo Foundation For Medical Education And Research Methods and vectors for controlling gene expression
WO2006084210A2 (fr) * 2005-02-04 2006-08-10 Regents Of The University Of California, San Diego Composes modulant le hif et methodes d'utilisation associees

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5580722A (en) * 1989-07-18 1996-12-03 Oncogene Science, Inc. Methods of determining chemicals that modulate transcriptionally expression of genes associated with cardiovascular disease
US5641756A (en) * 1993-07-27 1997-06-24 Hybridon, Inc. Modified VEGF oligonucleotides
US5882914A (en) * 1995-06-06 1999-03-16 The Johns Hopkins University School Of Medicine Nucleic acids encoding the hypoxia inducible factor-1

Also Published As

Publication number Publication date
WO1998056936A1 (fr) 1998-12-17
EP0990042A1 (fr) 2000-04-05
AU8536998A (en) 1998-12-30

Similar Documents

Publication Publication Date Title
US7053062B2 (en) Compositions and methods for inducing gene expression
AU723325B2 (en) Transcriptional regulation of genes encoding vascular endothelial growth factor receptors
WO1998056936A9 (fr) Sequences regulatrices impliquees dans l'expression genique regulee par l'hypoxie et leurs utilisations
García-Moruja et al. Functional characterization of SDF-1 proximal promoter
EP1007714B1 (fr) Sequences regulatrices capables de commander l'expression d'une sequence d'adn heterologue dans des cellules endotheliales in vivo et leurs utilisations
Von Harsdorf et al. Identification of a cis-acting regulatory element conferring inducibility of the atrial natriuretic factor gene in acute pressure overload.
US20030032609A1 (en) Methods of modulating of angiogenesis
US5888765A (en) Endothelial-cell specific promoter
MXPA04010711A (es) Promotores que exhiben especificidad de celulas endoteliales y metodo para usarlos.
Datta et al. Expression of the jun-B gene during induction of monocytic differentiation
EP1443970A2 (fr) Promoteurs presentant une specificite pour des cellules endotheliales et leurs procedes d'utilisation
Thatikunta et al. Reciprocal Id expression and myelin gene regulation in Schwann cells
US6514935B1 (en) Methods of treating hypertension
Ardekani et al. Two repressor elements inhibit expression of the von Willebrand factor gene promoter in vitro
EP1139750A1 (fr) Therapie genique toxique a base de sialoproteine osseuse permettant de traiter les tissus et les tumeurs calcifies
US6825035B1 (en) Compositions and methods for modulating expression within smooth muscle cells
US6258557B1 (en) Smooth muscle cell LIM promoter
AU2002224002C1 (en) Promoters exhibiting endothelial cell specificity and methods of using same
Chang The identification of transcriptional regulatory regions of the human apolipoprotein E gene and the characterization of an apo-E gene enhancer element and its associated factors
MXPA00005516A (es) Composiciones y metodos para inducir la expresion de genes
AU2002224002A1 (en) Promoters exhibiting endothelial cell specificity and methods of using same
IL155940A (en) Promoters unique to endothelial cells and methods of using them

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/14-14/14, DRAWINGS, REPLACED BY NEW PAGES 1/15-15/15; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 1998936322

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: CA

NENP Non-entry into the national phase in:

Ref country code: JP

Ref document number: 1999501616

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1998936322

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09445777

Country of ref document: US

WWW Wipo information: withdrawn in national office

Ref document number: 1998936322

Country of ref document: EP