WO1998056363A1 - Knobby nanospheres - Google Patents

Knobby nanospheres Download PDF

Info

Publication number
WO1998056363A1
WO1998056363A1 PCT/US1998/012126 US9812126W WO9856363A1 WO 1998056363 A1 WO1998056363 A1 WO 1998056363A1 US 9812126 W US9812126 W US 9812126W WO 9856363 A1 WO9856363 A1 WO 9856363A1
Authority
WO
WIPO (PCT)
Prior art keywords
nanoparticle
polypeptide
linking molecule
gene delivery
delivery vehicle
Prior art date
Application number
PCT/US1998/012126
Other languages
French (fr)
Inventor
Hai-Quan Mao
Yan Wang
Barry Byrne
Kam W. Leong
Original Assignee
The Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Johns Hopkins University filed Critical The Johns Hopkins University
Priority to AU78365/98A priority Critical patent/AU7836598A/en
Priority to EP98926552A priority patent/EP0988030A1/en
Publication of WO1998056363A1 publication Critical patent/WO1998056363A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5161—Polysaccharides, e.g. alginate, chitosan, cellulose derivatives; Cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6939—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being a polysaccharide, e.g. starch, chitosan, chitin, cellulose or pectin
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Definitions

  • This invention is related to improved vehicles for delivering substances to the intracellular milieu.
  • the nanoparticle comprises a polymeric cation and a polyanion, wherein the polyanion consists of nucleic acids, wherein a polypeptide is attached to the surface of said nanoparticle, wherein the polypeptide comprises the knob domain of adenovirus fiber protein.
  • a method of forming solid nanoparticles for delivery to target cells comprises the steps of: forming solid nanoparticles by coacervation of a polyanion consisting of nucleic acids and a polymeric cation; adhering a molecular species to the surface of the nanoparticles wherein the molecular species is selected from the group consisting of a polypeptide comprising the knob domain of adenovirus fiber protein and a linking molecule, wherein if the molecular species is a linking molecule the method further comprises the step of binding a polypeptide comprising the knob domain of adenovirus fiber protein to the linking molecule.
  • a method for introducing genes into cells comprises the steps of: incubating (a) cells to be transfected with (b) solid nanoparticles comprising a coacervate of a polymeric cation and a polyanion consisting of nucleic acids, wherein a polypeptide is attached to said nanoparticles' surface, said polypeptide comprising the knob domain of adenovirus fiber protein.
  • a gene delivery vehicle is provided. A polypeptide is attached to the surface of the gene delivery vehicle. The polypeptide comprises the knob domain of adenovirus fiber protein.
  • FIG. 1 Improvement of transfection efficiency of DNA-chitosan nanospheres into 293 cells with Knob conjugated on the surface of the nanospheres. The DNA encoded luciferase. Luciferase activity is shown.
  • Figure 2. Improvement of transfection efficiency of DNA-chitosan nanospheres into HeLa cells with Knob conjugated on the surface of the nanospheres. The DNA encoded luciferase. Luciferase activity is shown. DETAILED DESCRIPTION
  • Knob domain of the fiber protein of adenovirus can be conjugated to nanospheres or other gene delivery vehicles and that they enhance the uptake of the gene delivery vehicles by cells.
  • the Knob domain functions as a specific ligand to a cell surface component, and that the binding of the ligand to the cell surface component effects internalization of the gene delivery vehicles.
  • Nanospheres are solid particles made by the complex coacervation of a polycation and a polyanion.
  • the polycation can be gelatin, actin, tubulin, cytochromoe C, serum albumin, or histones, or other similar positively charged protein.
  • the polycation can also be a polysaccharide such as chitosan, proteoglycan, methylcellulose, amylose, or starch.
  • the polyanion can be nucleic acids or chondroiton sulfate, for example.
  • Other components such as low molecular weight drugs, proteins, antisense oligonucleotides, and nucleic acids such as plasmid DNAs can also be encapsulated in the nanosphere.
  • Other gene delivery vehicles which may be used include protein-DNA complexes, gold particles, liposomes, and polymeric nanoparticles.
  • Fiber protein is one of the capsid components of human adenovirus. Fiber protein or a portion of fiber protein, in particular the knob domain, can be covalently attached to a nanosphere.
  • fiber protein facilitates the internalization of nanospheres by cells, perhaps by a specific interaction with a receptor protein. This internalization permits more drug or therapeutic agent to reach the intracellular target, thus permitting lower doses to be used than without the fiber protein. This provides both a cost savings and a safety benefit.
  • the surface of nanoparticles or gene delivery vehicles can be easily derivatized for the direct coupling of targeting moieties.
  • carbo- diimides can be used as a derivatizing agent.
  • spacers linking molecules and derivatizing moieties on targeting ligands
  • avidin-biotin can be used to indirectly couple targeting ligands to the nanoparticles.
  • Biotinylated antibodies and/or other biotinylated ligands can be coupled to the avidin-coated nanoparticle surface efficiently because of the high affinity of biotin (I ⁇ lO 15 M "1 ) for avidin (Hazuda, et al. , 1990, Processing of precursor interleukin 1 beta and inflammatory disease, J. Biol. Chem. , 265:6318-22; Wilchek, et al., 1990, Introduction to avidin-biotin technology, Methods In Enzymology, 184:5-13).
  • Orientation-selective attachment of IgGs can be achieved by biotinylating the antibody at the oligosaccharide groups found on the F c portion (O'Shannessy, et al., 1984, A novel procedure for labeling immunoglobulins by conjugation to oligosaccharides moieties, Immunol. Lett. , 8:273-277).
  • This design helps to preserve the total number of available binding sites and renders the attached antibodies less immunogenic to F c receptor-bearing cells such as macrophages.
  • Spacers other than the avidin-biotin bridge can also be used, as are known in the art.
  • Staphylococcal protein A can be coated on the nanoparticles for binding the F c portions of immunoglobulin molecules to the nanoparticles.
  • Cross-linking of linking molecules or targeting ligands to the nanoparticle is used to promote the stability of the nanoparticle as well as to covalently affix the linking molecule or targeting ligand to the nanoparticle.
  • the degree of cross- linking directly affects the rate of nucleic acids release from the microspheres.
  • Cross-linking can be accomplished using glutaraldehyde, carbodiimides such as EDC (l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, DCC (N,N'- dicyclohexylcarbodiimide), carboxyls (peptide bond) linkage, DSS (Disuccinimidyl suberate), SPDP (N-succinimidyl 3-[2-pyridyldithio]propionate bis (sulfosuccinimidyl) suberate), dimethylsuberimidate, etc.
  • EDC l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide
  • DCC N,N'- dicyclohexylcarbodiimide
  • carboxyls (peptide bond) linkage DSS (Disuccinimidyl suberate)
  • SPDP N-succinimidyl 3-[2-
  • the nanoparticles of the present invention have good loading properties. Typically, following the method of the present invention, nanoparticles having at least 5% (w/w) nucleic acids can be achieved. Preferably the loading is greater than 10 or 15% nucleic acids. Often nanoparticles of greater than 20 or 30%, but less than 40 or 50% nucleic acids can be achieved. Typically encapsulation efficiencies of nucleic acids into nanoparticles of greater than 95% can be achieved.
  • the method of the present invention involves the coacervation of polymeric cations and nucleic acids. Because this process depends on the interaction of the positively charged polymeric cations and the negatively charged nucleic acids it can be considered as a complex coacervation process. However, sodium sulfate (or ethanol) induces the coacervation reaction by inducing a phase transition, and therefore it could also be considered as a simple coacervation reaction. Nucleic acids are present in the coacervation mixture at a concentration of between 1 ng/ml to 500 g/ml. Desirably the nucleic acids are at least about 2-3 kb in length. Sodium sulfate is present at between 7 and 43 mM.
  • Gelatin or other polymeric cation is present at between about 2 and 7% in the coacervation mixture. Unlike viral vectors, which cannot deliver genes larger than 10 kb, the nanoparticle delivery system of the present invention does not have such size limitations. Nucleic acid molecules of greater than about 2 kb can be used, and nucleic acid molecules even greater than 10 kb may be used. Typically nucleic acids in the range of 2 to 10 kb, 5 to 15 kb, and even 10-50 kb can be encapsulated.
  • the range of possible targets is dependent on the route of injection, e.g., intravenous or intraarterial, subcutaneous, intra-peritoneal, intrathecal, etc.
  • the specificity of this delivery system is affected by the accessibility of the target to blood borne nanoparticles, which in turn, is affected by the size range of the particles. Size of the particles is affected by temperature, component concentration, and pH in the coacervation mixture. The particles can also be size-fractionated, e.g., by sucrose gradient ultracentrifugation. Suitable sizes of nanoparticles are less than 3 ⁇ m, preferably less than 2 ⁇ m, 1 ⁇ m, and even as low as 0.1 ⁇ m.
  • Particles with size less than 150 nanometers can access the interstitial space by traversing through the fenestrations that line most blood vessels walls. Under such circumstances, the range of cells that can be targeted is extensive.
  • An abbreviated list of cells that can be targeted includes the parenchymal cells of the liver sinusoids, the f ⁇ broblasts of the connective tissues, the cells in the Islets of Langerhans in the pancreas, the cardiac myocytes, the Chief and parietal cells of the intestine, osteocytes and chondrocytes in the bone, keratinocytes, nerve cells of the peripheral nervous system, epithelial cells of the kidney and lung, Sertoli cells of the testis, etc.
  • the targetable cell types include erythrocytes, leukocytes (i.e. monocytes, macrophages, B and T lymphocytes, neutrophils, natural killer cells, progenitor cells, mast cells, eosinophils), platelets, and endothelial cells.
  • leukocytes i.e. monocytes, macrophages, B and T lymphocytes
  • neutrophils natural killer cells
  • progenitor cells i.e. monocytes, macrophages, B and T lymphocytes
  • mast cells eosinophils
  • platelets e.g., eothelial cells
  • endothelial cells e.g., endothelial cells.
  • the targetable cells include all cells that resides in the connective tissue (e.g., fibroblasts, mast cells, etc.), Langerhans cells, keratinocytes, and muscle cells.
  • the targetable cells include neurons, glial cells, astrocytes,
  • EXAMPLE 1 Expression and Purification of the Knob Domain of the Adenovirus Type 5 Fiber Protein
  • the knob domain was cloned by PCR amplification using cloned Ad5 plasmid DNA (pJM17, McGrory, et al. , 1988) as the template and specific oligonucleotides designed to facilitate the insertion of the PCR product into the bacterial expression vector pET15b (Novagen).
  • the sequences of the two primers used were CTCGAGGGTGCCATTACAGTAGGAAACAAAAATAATGATAAG (5 1 oligonucleotide) and
  • GGATCCTTATTCTTGGGC AATGTATG AAA AAGTGTAAGAGG 3 ' oligonucleotide, which are partially complementary to specific Ad5 fiber sequences (Chroboczek and Jacrot, 1987).
  • the PCR product of approximately 600 bp was purified by the PCR purification kit (Qiagen), and digested by BamHI and Xhol, then directionally ligated into BamHI-XhoI-digested pET15b.
  • BL21(DE3) cells used as the host strain.
  • a clone containing the appropriate recombinant plasmid was identified by restriction enzyme digestion.
  • the expression of the knob was induced by 0.1 mM IPTG in LB medium and characterized by Western Blot.
  • N-terminus Cells from 100 ml of culture were spun down and resuspended in 18 ml of Native Binding Buffer (20 mM phosphate, 500 mM NaCl, pH 7.8). One ml of 1 % Triton X-100TM was added to achieve good solubilization. The cells were disrupted by sonication in short bursts (20 sec/burst, total 80 seconds), and the cell debris and DNA were precipitated at 10,000 x g for 10 minutes. The pre-equilibrated resin in the column was resuspended with four 5 ml lysate aliquots and gently rocked for 10 minutes to allow for binding of the polyhistidine-containing protein. The resin was then settled by centrifugation, and the supernatant was aspirated. The column was washed three times with 4 ml of Native Binding Buffer, twice with 4 ml Native Wash Buffer (20 mM phosphate,
  • Knob-SH concentration of Knob derivative
  • the mixture was stirred at room temperature for 30 min before 50 mL of 1 M glycine was added to quench the reaction, followed by addition of 250 mg of Knob-SH. After reaction for 60 minutes, the mixture was subjected to ultracentrifugation to harvest the nanospheres.
  • Nanospheres containing 1 mg of DNA were incubated with 1.0-5.0 x 105 cells in each well (pre-plated in 12 well plate) at 37° C and 5% CO 2 in DMEM containing 1% fetal bovine serum (FBS), 2 mM L-glutamine, 50 units/mL penicillin, 50 mg/mL streptomycin, and 10 mg/ mL gentamycin for 4 hours, followed by changing the medium to fresh complete medium (DMEM containing 10% FBS). Cells were cultured for 3 days before assay. Transfection using Lipofectamine (BRL, Gaithersburg, MD, liposome method) was used as control. Luciferase gene expression levels were measured by assaying Luciferase activity in permeabilized cell extracts (Promega, Madison, WI). The light units (LU) were normalized to protein concentration in the cell extracts measured by the BCA method.
  • FBS fetal bovine serum
  • LU light units

Abstract

The isolation and purification of adenovirus fiber protein Knob domain is taught, as well as its use as a ligand for intracellular delivery of bioactive agents, such as low molecular drugs, proteins, antisense oligonucleotides, and plasmid DNAs. The conjugation of Knob to the surface of DNA-nanospheres facilitates the binding of nanospheres to cell surfaces and enhances transfection efficiency of DNA-nanospheres.

Description

KNOBBY NANOSPHERES
TECHNICAL FIELD OF THE INVENTION
This invention is related to improved vehicles for delivering substances to the intracellular milieu. BACKGROUND OF THE TNVENΗQN
Delivery of therapeutic agents to cells and efficient transfer of the agents into the cells continue to be major obstacles to effective treatments. Thus some agents lose potency by degradation in the body before they reach their desired target cells or tissue. In addition, even if an agent reaches its target tissue or cells, failure to translocate the agent into the cells can prevent the agent from reaching the target molecules, thus preventing effective therapy.
Thus there is a continuing need in the art of pharmacology for vehicles for efficient delivery of drugs to their target molecules.
SUMMARY OF THE INYE ΗQN It is an object of the present invention to provide a solid nanoparticle for delivery of therapeutic agents to target cells and for cell binding.
It is another object of the present invention to provide a method of forming solid nanoparticles for delivery of therapeutic agents to target cells.
It is yet another object of the present invention to provide a method for introducing genes into cells.
These and other objects of the invention are achieved by providing a solid nanoparticle for delivery to target cells. The nanoparticle comprises a polymeric cation and a polyanion, wherein the polyanion consists of nucleic acids, wherein a polypeptide is attached to the surface of said nanoparticle, wherein the polypeptide comprises the knob domain of adenovirus fiber protein.
According to another embodiment of the invention a method of forming solid nanoparticles for delivery to target cells is provided. The method comprises the steps of: forming solid nanoparticles by coacervation of a polyanion consisting of nucleic acids and a polymeric cation; adhering a molecular species to the surface of the nanoparticles wherein the molecular species is selected from the group consisting of a polypeptide comprising the knob domain of adenovirus fiber protein and a linking molecule, wherein if the molecular species is a linking molecule the method further comprises the step of binding a polypeptide comprising the knob domain of adenovirus fiber protein to the linking molecule.
In yet another embodiment of the invention a method for introducing genes into cells is provided. The method comprises the steps of: incubating (a) cells to be transfected with (b) solid nanoparticles comprising a coacervate of a polymeric cation and a polyanion consisting of nucleic acids, wherein a polypeptide is attached to said nanoparticles' surface, said polypeptide comprising the knob domain of adenovirus fiber protein. According to yet another aspect of the invention a gene delivery vehicle is provided. A polypeptide is attached to the surface of the gene delivery vehicle. The polypeptide comprises the knob domain of adenovirus fiber protein.
These and other embodiments of the invention which will be apparent to those of skill in the art from a thorough and complete reading of the disclosure, provide the art with methods and reagents for improved delivery of therapeutic agents to target cells. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Improvement of transfection efficiency of DNA-chitosan nanospheres into 293 cells with Knob conjugated on the surface of the nanospheres. The DNA encoded luciferase. Luciferase activity is shown. Figure 2. Improvement of transfection efficiency of DNA-chitosan nanospheres into HeLa cells with Knob conjugated on the surface of the nanospheres. The DNA encoded luciferase. Luciferase activity is shown. DETAILED DESCRIPTION
It is the discovery of the present inventors that the Knob domain of the fiber protein of adenovirus can be conjugated to nanospheres or other gene delivery vehicles and that they enhance the uptake of the gene delivery vehicles by cells. Thus it appears that the Knob domain functions as a specific ligand to a cell surface component, and that the binding of the ligand to the cell surface component effects internalization of the gene delivery vehicles. Nanospheres are solid particles made by the complex coacervation of a polycation and a polyanion. The polycation can be gelatin, actin, tubulin, cytochromoe C, serum albumin, or histones, or other similar positively charged protein. The polycation can also be a polysaccharide such as chitosan, proteoglycan, methylcellulose, amylose, or starch. The polyanion can be nucleic acids or chondroiton sulfate, for example. Other components such as low molecular weight drugs, proteins, antisense oligonucleotides, and nucleic acids such as plasmid DNAs can also be encapsulated in the nanosphere. Other gene delivery vehicles which may be used include protein-DNA complexes, gold particles, liposomes, and polymeric nanoparticles. Fiber protein is one of the capsid components of human adenovirus. Fiber protein or a portion of fiber protein, in particular the knob domain, can be covalently attached to a nanosphere. Although not wishing to be bound by any particular theory or mechanism of action, applicants believe that fiber protein facilitates the internalization of nanospheres by cells, perhaps by a specific interaction with a receptor protein. This internalization permits more drug or therapeutic agent to reach the intracellular target, thus permitting lower doses to be used than without the fiber protein. This provides both a cost savings and a safety benefit.
The surface of nanoparticles or gene delivery vehicles can be easily derivatized for the direct coupling of targeting moieties. For example, carbo- diimides can be used as a derivatizing agent. Alternatively, spacers (linking molecules and derivatizing moieties on targeting ligands) such as avidin-biotin can be used to indirectly couple targeting ligands to the nanoparticles. Biotinylated antibodies and/or other biotinylated ligands can be coupled to the avidin-coated nanoparticle surface efficiently because of the high affinity of biotin (IςølO15 M"1) for avidin (Hazuda, et al. , 1990, Processing of precursor interleukin 1 beta and inflammatory disease, J. Biol. Chem. , 265:6318-22; Wilchek, et al., 1990, Introduction to avidin-biotin technology, Methods In Enzymology, 184:5-13).
Orientation-selective attachment of IgGs can be achieved by biotinylating the antibody at the oligosaccharide groups found on the Fc portion (O'Shannessy, et al., 1984, A novel procedure for labeling immunoglobulins by conjugation to oligosaccharides moieties, Immunol. Lett. , 8:273-277). This design helps to preserve the total number of available binding sites and renders the attached antibodies less immunogenic to Fc receptor-bearing cells such as macrophages. Spacers other than the avidin-biotin bridge can also be used, as are known in the art. For example, Staphylococcal protein A can be coated on the nanoparticles for binding the Fc portions of immunoglobulin molecules to the nanoparticles.
Cross-linking of linking molecules or targeting ligands to the nanoparticle is used to promote the stability of the nanoparticle as well as to covalently affix the linking molecule or targeting ligand to the nanoparticle. The degree of cross- linking directly affects the rate of nucleic acids release from the microspheres. Cross-linking can be accomplished using glutaraldehyde, carbodiimides such as EDC (l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, DCC (N,N'- dicyclohexylcarbodiimide), carboxyls (peptide bond) linkage, DSS (Disuccinimidyl suberate), SPDP (N-succinimidyl 3-[2-pyridyldithio]propionate bis (sulfosuccinimidyl) suberate), dimethylsuberimidate, etc.
The nanoparticles of the present invention have good loading properties. Typically, following the method of the present invention, nanoparticles having at least 5% (w/w) nucleic acids can be achieved. Preferably the loading is greater than 10 or 15% nucleic acids. Often nanoparticles of greater than 20 or 30%, but less than 40 or 50% nucleic acids can be achieved. Typically encapsulation efficiencies of nucleic acids into nanoparticles of greater than 95% can be achieved.
The method of the present invention involves the coacervation of polymeric cations and nucleic acids. Because this process depends on the interaction of the positively charged polymeric cations and the negatively charged nucleic acids it can be considered as a complex coacervation process. However, sodium sulfate (or ethanol) induces the coacervation reaction by inducing a phase transition, and therefore it could also be considered as a simple coacervation reaction. Nucleic acids are present in the coacervation mixture at a concentration of between 1 ng/ml to 500 g/ml. Desirably the nucleic acids are at least about 2-3 kb in length. Sodium sulfate is present at between 7 and 43 mM. Gelatin or other polymeric cation is present at between about 2 and 7% in the coacervation mixture. Unlike viral vectors, which cannot deliver genes larger than 10 kb, the nanoparticle delivery system of the present invention does not have such size limitations. Nucleic acid molecules of greater than about 2 kb can be used, and nucleic acid molecules even greater than 10 kb may be used. Typically nucleic acids in the range of 2 to 10 kb, 5 to 15 kb, and even 10-50 kb can be encapsulated.
In general, the range of possible targets is dependent on the route of injection, e.g., intravenous or intraarterial, subcutaneous, intra-peritoneal, intrathecal, etc. For systemic injections, the specificity of this delivery system is affected by the accessibility of the target to blood borne nanoparticles, which in turn, is affected by the size range of the particles. Size of the particles is affected by temperature, component concentration, and pH in the coacervation mixture. The particles can also be size-fractionated, e.g., by sucrose gradient ultracentrifugation. Suitable sizes of nanoparticles are less than 3 μm, preferably less than 2 μm, 1 μm, and even as low as 0.1 μm. Particles with size less than 150 nanometers can access the interstitial space by traversing through the fenestrations that line most blood vessels walls. Under such circumstances, the range of cells that can be targeted is extensive. An abbreviated list of cells that can be targeted includes the parenchymal cells of the liver sinusoids, the fϊbroblasts of the connective tissues, the cells in the Islets of Langerhans in the pancreas, the cardiac myocytes, the Chief and parietal cells of the intestine, osteocytes and chondrocytes in the bone, keratinocytes, nerve cells of the peripheral nervous system, epithelial cells of the kidney and lung, Sertoli cells of the testis, etc. The targets for particles with sizes greater than 0.2 microns will be confined largely to the vascular compartment. Here, the targetable cell types include erythrocytes, leukocytes (i.e. monocytes, macrophages, B and T lymphocytes, neutrophils, natural killer cells, progenitor cells, mast cells, eosinophils), platelets, and endothelial cells. For subcutaneous injections, the targetable cells include all cells that resides in the connective tissue (e.g., fibroblasts, mast cells, etc.), Langerhans cells, keratinocytes, and muscle cells. For intrathecal injections, the targetable cells include neurons, glial cells, astrocytes, and blood-brain barrier endothelial cells. For intraperitoneal injection, the targetable cells include the macrophages and neutrophil.
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.
EXAMPLE 1 Expression and Purification of the Knob Domain of the Adenovirus Type 5 Fiber Protein The knob domain was cloned by PCR amplification using cloned Ad5 plasmid DNA (pJM17, McGrory, et al. , 1988) as the template and specific oligonucleotides designed to facilitate the insertion of the PCR product into the bacterial expression vector pET15b (Novagen). The sequences of the two primers used were CTCGAGGGTGCCATTACAGTAGGAAACAAAAATAATGATAAG (51 oligonucleotide) and
GGATCCTTATTCTTGGGC AATGTATG AAA AAGTGTAAGAGG (3 ' oligonucleotide), which are partially complementary to specific Ad5 fiber sequences (Chroboczek and Jacrot, 1987). The PCR product of approximately 600 bp was purified by the PCR purification kit (Qiagen), and digested by BamHI and Xhol, then directionally ligated into BamHI-XhoI-digested pET15b. E. coli
BL21(DE3) cells used as the host strain. A clone containing the appropriate recombinant plasmid was identified by restriction enzyme digestion. The expression of the knob was induced by 0.1 mM IPTG in LB medium and characterized by Western Blot.
EXAMPLE 2
Isolation and purification of the knob domain of adenovirus fiber protein Purification of the recombinant knob domain from an E. coli cell lysate was accomplished using ProBond™ resin (Invitrogen), which has a high affinity for six tandem histidine residues. The pET15b vector used to clone the know domain carries the sequence encoding polyhistidine residues followed by the BamHI-XhoI cloning site, therefore the recombinant knob protein contains a His-Tag in the
N-terminus. Cells from 100 ml of culture were spun down and resuspended in 18 ml of Native Binding Buffer (20 mM phosphate, 500 mM NaCl, pH 7.8). One ml of 1 % Triton X-100™ was added to achieve good solubilization. The cells were disrupted by sonication in short bursts (20 sec/burst, total 80 seconds), and the cell debris and DNA were precipitated at 10,000 x g for 10 minutes. The pre-equilibrated resin in the column was resuspended with four 5 ml lysate aliquots and gently rocked for 10 minutes to allow for binding of the polyhistidine-containing protein. The resin was then settled by centrifugation, and the supernatant was aspirated. The column was washed three times with 4 ml of Native Binding Buffer, twice with 4 ml Native Wash Buffer (20 mM phosphate,
500 mM NaCl, pH 6.0), then several times with 4 ml Imidazole Buffer (200 mM imidazole, 20 mM phosphate, 500 mM NaCl, pH 6.0), until the OD280 was less than 0.01. The recombinant Knob was eluted by 50 mM EDTA, dialyzed and concentrated, yielding approximate one mg.
EXAMPLE 3
Conjugation of Knob to DNA-nanospheres
Free sulfhydryl groups were introduced into Knob protein by 2-iminothiolane method [Hermanson, 1996] with the following modification: a cold solution of 5 mg of knob protein in 2.5 mL of 0.1 M sodium phosphate buffer (pH7.6, 5mM EDTA) was mixed with 120 mL of 2-iminothiolane solution
(5 mg/ mL in water). The mixture was kept on ice for 2 hours, and pooled over a PD-10 column. The column was eluted with phosphate buffered saline (PBS) at room temperature, the peak fractions were collected and the concentration of Knob derivative, hereafter called Knob-SH, was determined by absorbance at 280nm. For Knob conjugation, DNA-chitosan nanospheres were mixed with 5mL of DSS solution (10 mM in DMSO), 10 mL of SPDP solution (10 mM in DMSO) and 100 mL of PBS buffer under vertexing. The mixture was stirred at room temperature for 30 min before 50 mL of 1 M glycine was added to quench the reaction, followed by addition of 250 mg of Knob-SH. After reaction for 60 minutes, the mixture was subjected to ultracentrifugation to harvest the nanospheres.
EXAMPLE 4 In vitro Transfection
Nanospheres containing 1 mg of DNA were incubated with 1.0-5.0 x 105 cells in each well (pre-plated in 12 well plate) at 37° C and 5% CO2 in DMEM containing 1% fetal bovine serum (FBS), 2 mM L-glutamine, 50 units/mL penicillin, 50 mg/mL streptomycin, and 10 mg/ mL gentamycin for 4 hours, followed by changing the medium to fresh complete medium (DMEM containing 10% FBS). Cells were cultured for 3 days before assay. Transfection using Lipofectamine (BRL, Gaithersburg, MD, liposome method) was used as control. Luciferase gene expression levels were measured by assaying Luciferase activity in permeabilized cell extracts (Promega, Madison, WI). The light units (LU) were normalized to protein concentration in the cell extracts measured by the BCA method.
References
Chroboczek, J., and B. Jacrot. 1987. The sequence of adenovirus fiber: similarities and differences between serotype 2 and 5. J. Virol. 161:549-554.
Henry, L. J., D. Xia, M. E. Wilke, J. Deisenhofer, and R. D. Gerard. 1994. Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli. J. Virol. 68:5239-5246.
G. T. Hermanson, Bioconjugate Techniques, Academic Press, Inc. (San Diego, California) 1996.
McGrory, W. J., D. S. Bautista, and F. L. Graham. 1988. A simple technique for the rescue of early region 1 mutations into infectious human adenovirus type 5. J.
Virol. 163:614-617.
Philipson, L., K. Lonberg-Holm, and U. Pettersson. 1968. Virus-receptor interaction in an adenovirus system. J. Virol. 2: 1064-1075.

Claims

1. A solid nanoparticle for delivery to target cells, said nanoparticle comprising a polymeric cation and a polyanion, wherein the polyanion consists nucleic acids, wherein a polypeptide is attached to the surface of said nanoparticle, wherein the polypeptide comprises the knob domain of adenovirus fiber protein.
2. The nanoparticle of claim 1 wherein the polypeptide is attached to said nanoparticle via a linking molecule.
3. The nanoparticle of claim 1 wherein the polypeptide is directly attached to said nanoparticle.
4. The nanoparticle of claim 2 wherein the linking molecule is covalently attached to said nanoparticle by means of glutaraldehyde cross-linking.
5. The nanoparticle of claim 2 wherein the linking molecule is covalently attached to said nanoparticle by means of SPDP cross-linking.
6. The nanoparticle of claim 2 wherein said linking molecule is avidin.
7. The nanoparticle of claim 2 wherein said linking molecule is polyethylene glycol.
8. The nanoparticle of claim 2 wherein the polypeptide is covalently coupled to the linking molecule.
9. The nanoparticle of claim 1 wherein said polymeric cation is gelatin.
10. The nanoparticle of claim 1 wherein said polymeric cation is chitosan.
11. The nanoparticle of claim 1 which comprises from 5% to 30% (w/w) nucleic acids.
12. The nanoparticle of claim 1 wherein said nanoparticle comprises 20% to 30% (w/w) nucleic acids.
13. The nanoparticle of claim 6 wherein a biotinylated knob domain is coupled to the linking molecule.
14. The nanoparticle of claim 1 wherein said nucleic acids comprises a gene of 10 to 50 kb.
15. A method of forming solid nanoparticles for delivery to target cells, the method comprising the steps of: forming solid nanoparticles by coacervation of a polyanion consisting of nucleic acids and a polymeric cation; adhering a molecular species to the surface of the nanoparticles wherein the molecular species is selected from the group consisting of a polypeptide comprising the knob domain of adenovirus fiber protein and a linking molecule, wherein if the molecular species is a linking molecule the method further comprising the step of binding a polypeptide comprising the knob domain of adenovirus fiber protein to the linking molecule.
16. The method of claim 15 further comprising the steps: conjugating the molecular species to the nanoparticles.
17. The method of claim 15 wherein the coacervation is performed in the presence of sodium sulfate.
18. The method of claim 15 wherein the polymeric cation is gelatin.
19. The method of claim 15 wherein the linking molecule is avidin.
20. The method of claim 15 wherein the linking molecule is polyethyleneglycol.
21. The method of claim 15 wherein the polypeptide is modified with a moiety which binds to the linking molecule.
22. The method of claim 18 wherein the gelatin is present at a concentration of about 2-7% in the step of coacervation.
23. The method of claim 15 wherein the nucleic acids are present in a concentration of 1 ng/ml to 500 ╬╝g/ml in the step of coacervation.
24. The method of claim 17 wherein the concentration of sodium sulfate is between about 7 and 43 mM in the step of coacervation.
25. A method for introducing genes into cells comprising the steps of: incubating (a) cells to be transfected with (b) solid nanoparticles, said nanoparticles comprising a coacervate of a polymeric cation and a polyanion consisting of nucleic acids, wherein a polypeptide is attached to said nanoparticles' surface, said polypeptide comprising the knob domain of adenovirus fiber protein.
26. The method of claim 25 wherein the polypeptide is attached to said nanoparticle' s surface by means of a linking molecule.
27. The method of claim 26 wherein the linking molecule is avidin.
28. The method of claim 25 wherein the polymeric cation is gelatin.
29. The method of claim 25 wherein the nucleic acid is DNA.
30. The method of claim 25 wherein the nucleic acid is RNA.
31. The nanoparticle of claim 1 wherein said nucleic acids comprise a gene of 2 to 10 kb.
32. A gene delivery vehicle, wherein a polypeptide is attached to the surface of said gene delivery vehicle, wherein the polypeptide comprises the knob domain of adenovirus fiber protein.
33. The gene delivery vehicle of claim 32 wherein the polypeptide is attached to said vehicle via a linking molecule.
34. The gene delivery vehicle of claim 32 wherein the polypeptide is directly attached to said gene delivery vehicle.
35. The gene delivery vehicle of claim 33 wherein the linking molecule is covalently attached to said gene delivery vehicle by means of glutaraldehyde cross- linking.
36. The gene delivery vehicle of claim 33 wherein said linking molecule is avidin.
37. The gene delivery vehicle of claim 32 which is a liposome.
38. The gene delivery vehicle of claim 32 which is a protein-DNA complex.
39. The gene delivery vehicle of claim 32 which is a gold particle.
PCT/US1998/012126 1997-06-13 1998-06-11 Knobby nanospheres WO1998056363A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU78365/98A AU7836598A (en) 1997-06-13 1998-06-11 Knobby nanospheres
EP98926552A EP0988030A1 (en) 1997-06-13 1998-06-11 Knobby nanospheres

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US4949697P 1997-06-13 1997-06-13
US60/049,496 1997-06-13

Publications (1)

Publication Number Publication Date
WO1998056363A1 true WO1998056363A1 (en) 1998-12-17

Family

ID=21960134

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/012126 WO1998056363A1 (en) 1997-06-13 1998-06-11 Knobby nanospheres

Country Status (3)

Country Link
EP (1) EP0988030A1 (en)
AU (1) AU7836598A (en)
WO (1) WO1998056363A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999029307A1 (en) * 1997-12-12 1999-06-17 Massachusetts Institute Of Technology SUB-100nm BIODEGRADABLE POLYMER SPHERES CAPABLE OF TRANSPORTING AND RELEASING NUCLEIC ACIDS
WO2000033886A1 (en) * 1998-12-04 2000-06-15 Genzyme Corporation Dry powder complexes for gene delivery
EP1450751A2 (en) * 2001-07-10 2004-09-01 North Carolina State University Nanoparticle delivery vehicle
EP2360275A1 (en) * 2000-11-15 2011-08-24 Minerva Biotechnologies Corporation Oligonucleotide identifiers
WO2012136734A1 (en) * 2011-04-05 2012-10-11 Tracesa Ltd. Fluid identification system and production and use thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997028817A1 (en) * 1996-02-09 1997-08-14 Cheng Pi Wan Receptor ligand-facilitated delivery of biologically active molecules
WO1998001162A2 (en) * 1996-07-09 1998-01-15 The Johns Hopkins University Gene delivery system

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997028817A1 (en) * 1996-02-09 1997-08-14 Cheng Pi Wan Receptor ligand-facilitated delivery of biologically active molecules
WO1998001162A2 (en) * 1996-07-09 1998-01-15 The Johns Hopkins University Gene delivery system

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
C.K. GOLDMAN ET AL.: "TARGETED GENE DELIVERY TO KAPOSI'S SARCOMA CELLS via THE FIBROBLAST GROWTH FACTOR RECEPTOR.", CANCER RESEARCH, vol. 57, no. 8, 15 April 1997 (1997-04-15), MD US, pages 1447 - 1451, XP002079943 *
DATABASE MEDLINE US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; DOUGLAS J T ET AL: "Targeted gene delivery by tropism-modified adenoviral vectors.", XP002079945 *
DOUGLAS J T ET AL: "Strategies to accomplish targeted gene delivery to muscle cells employing tropism-modified adenoviral vectors.", NEUROMUSCULAR DISORDERS, (1997 JUL) 7 (5) 284-98. REF: 98 JOURNAL CODE: BJS. ISSN: 0960-8966., ENGLAND: United Kingdom, XP002079944 *
MAO H.-Q. ET AL: "DNA-chitosan nanospheres: Derivatization and storage stability.", PROCEEDINGS OF THE CONTROLLED RELEASE SOCIETY, (1997) -/24 (671-672). REFS: 4 ISSN: 1022-0178 CODEN: 58GMAH, United States, XP002079941 *
NATURE BIOTECHNOLOGY, (1996 NOV) 14 (11) 1574-8. JOURNAL CODE: CQ3. ISSN: 1087-0156., United States *
ROGERS B E ET AL: "USE OF A NOVEL CROSS-LINKING METHOD TO MODIFY ADENOVIRUS TROPISM", GENE THERAPY, vol. 4, no. 12, December 1997 (1997-12-01), pages 1387 - 1392, XP002069405 *
ROY, KRISHNENDU ET AL: "DNA - chitosan nanospheres: transfection efficiency and cellular uptake", PROC. INT. SYMP. CONTROLLED RELEASE BIOACT. MATER. (1997), 24TH, 673-674 CODEN: PCRMEY;ISSN: 1022-0178, 1997, XP002079942 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999029307A1 (en) * 1997-12-12 1999-06-17 Massachusetts Institute Of Technology SUB-100nm BIODEGRADABLE POLYMER SPHERES CAPABLE OF TRANSPORTING AND RELEASING NUCLEIC ACIDS
US6254890B1 (en) 1997-12-12 2001-07-03 Massachusetts Institute Of Technology Sub-100nm biodegradable polymer spheres capable of transporting and releasing nucleic acids
WO2000033886A1 (en) * 1998-12-04 2000-06-15 Genzyme Corporation Dry powder complexes for gene delivery
EP2360275A1 (en) * 2000-11-15 2011-08-24 Minerva Biotechnologies Corporation Oligonucleotide identifiers
EP1990040A1 (en) * 2001-07-10 2008-11-12 North Carolina State University Nanoparticle delivery vehicle
US7332586B2 (en) 2001-07-10 2008-02-19 North Carolina State University Nanoparticle delivery vehicle
EP1450751A4 (en) * 2001-07-10 2006-03-22 Univ North Carolina State Nanoparticle delivery vehicle
EP1450751A2 (en) * 2001-07-10 2004-09-01 North Carolina State University Nanoparticle delivery vehicle
WO2012136734A1 (en) * 2011-04-05 2012-10-11 Tracesa Ltd. Fluid identification system and production and use thereof
EP2942405A1 (en) * 2011-04-05 2015-11-11 Tracesa Ltd Fluid identification system and production and use thereof
US9322056B2 (en) 2011-04-05 2016-04-26 Tracesa, Ltd. Fluid identification system and production and use thereof
AU2012238638B2 (en) * 2011-04-05 2017-06-08 Tracesa Ltd. Fluid identification system and production and use thereof
US9926591B2 (en) 2011-04-05 2018-03-27 Tracesa, Ltd. Fluid identification system and production and use thereof
EP3382038A1 (en) * 2011-04-05 2018-10-03 Tracesa Ltd Fluid identification system and production and use thereof

Also Published As

Publication number Publication date
EP0988030A1 (en) 2000-03-29
AU7836598A (en) 1998-12-30

Similar Documents

Publication Publication Date Title
US5972707A (en) Gene delivery system
US6025337A (en) Solid microparticles for gene delivery
AU749032B2 (en) Therapeutic nanospheres
US5994316A (en) Method of preparing polynucleotide-carrier complexes for delivery to cells
Guy et al. Delivery of DNA into mammalian cells by receptor-mediated endocytosis and gene therapy
Garnett Gene-delivery systems using cationic polymers
US5728399A (en) Use of a bacterial component to enhance targeted delivery of polynucleotides to cells
TWI267380B (en) Nucleic acid-containing complex
JP2004516809A (en) Molecular transport vehicles for transporting selected compounds to targets
Khondee et al. Calcium condensed LABL-TAT complexes effectively target gene delivery to ICAM-1 expressing cells
JP2002537318A (en) Antibody-targeted fragment immunoliposomes for systemic gene delivery
KR20080100376A (en) Agent-enriched nanoparticles based on hydrophilic proteins
JP2003530360A (en) Peptide conjugates for drug delivery
EP1098632A1 (en) Charge reversal of polyion complexes
WO2000061190A2 (en) Treatment of intracellular infection
EP0988030A1 (en) Knobby nanospheres
Mok et al. Functional polymers for targeted delivery of nucleic acid drugs
US8202544B2 (en) High capacity non-viral vectors
JP2000506388A (en) Use of viral cis-acting post-transcriptional regulatory sequences to increase expression of intronless genes with near common splice sites
CA2198361A1 (en) Intracellular delivery of chemical agents to a specific cell type
CN114081965B (en) Exosome delivery carrier and preparation method and application thereof
WO1999015687A1 (en) Multicomponent polynucleotide complex for high efficiency cell transfection

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1998926552

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1999503204

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1998926552

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

WWR Wipo information: refused in national office

Ref document number: 1998926552

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998926552

Country of ref document: EP