WO1998054303A1 - Acyltransferase de l'acide lysophosphatidique de mammifere - Google Patents

Acyltransferase de l'acide lysophosphatidique de mammifere Download PDF

Info

Publication number
WO1998054303A1
WO1998054303A1 PCT/US1997/005360 US9705360W WO9854303A1 WO 1998054303 A1 WO1998054303 A1 WO 1998054303A1 US 9705360 W US9705360 W US 9705360W WO 9854303 A1 WO9854303 A1 WO 9854303A1
Authority
WO
WIPO (PCT)
Prior art keywords
lpaat
seq
sequence
polypeptide
sequences
Prior art date
Application number
PCT/US1997/005360
Other languages
English (en)
Inventor
David W. Leung
James W. West
Christopher K. Tompkins
Original Assignee
Cell Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cell Therapeutics, Inc. filed Critical Cell Therapeutics, Inc.
Priority to EP97936924A priority Critical patent/EP0988372A4/fr
Priority to PCT/US1997/005360 priority patent/WO1998054303A1/fr
Priority to JP50060799A priority patent/JP2002514087A/ja
Priority to CA002291516A priority patent/CA2291516A1/fr
Publication of WO1998054303A1 publication Critical patent/WO1998054303A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)

Definitions

  • This present invention provides cDNA sequences and polypeptides having the enzyme lysophosphatidic acid acyltransferase (LPAAT) activity.
  • LPAAT is also known as 1-acyl sn-glycerol-3-phosphate acyltransferase.
  • the present invention further provides for isolation and production of polypeptides involved in phosphatidic acid metabolism and signaling in mammalian cells, in particular, the production of purified forms of LPAAT.
  • phosphatidic acid PA
  • LPA lysophosphatidic acid
  • PL phospholipids
  • PA phosphatidic acid
  • DAG diacylglycerol
  • PI glycan phosphatidylinositol
  • PA Phosphatidic acids
  • Lysofylline (l-(R)-(5-hydroxyhexyl)-3,7-dimethylxanthine) (Singer et al., Exp. Opin. Invest. Drugs 3:631-643, 1994; and Rice et al., Proc. Natl. Acad. Sci. USA 91:3857- 3861, 1994) has been found to be an effective inhibitor of cellular activation by blocking the synthesis of a specific phosphatidic acid (PA) species produced by lysophosphatidic acid acyltransferase (LPAAT) in activated monocytic cells (Rice et al., Proc. Natl. Acad. Sci. USA 91:3857-3861, 1994).
  • PA phosphatidic acid
  • LPAAT lysophosphatidic acid acyltransferase
  • PA can be generated through hydrolysis of phosphatidycholine (PC) (Exton, Biochim. Biophys. Acta 1212:26-42, 1994) or glycan PI (Eardley et al., Science 251:78-81, 1991; Merida et al., DNA Cell Biol. 12:473-479, 1993), through phosphorylation of DAG by DAG kinase (Kanoh et al., Trends Biochem. Sci. 15:47-50, 1990) or through acylation of LPA at the SN2 position (Bursten et al., Am. J. Physiol. 266:C1093-C1104, 1994).
  • Compounds that would block PA generation and hence diminish lipid biosynthesis and the signal involved in cell activation may therefore be of therapeutic interest in the area of inflammation and oncology as well as obesity treatment.
  • LPAAT The genes coding for LPAAT have been isolated in bacteria (Coleman, Mol. Gen. Genet. 232:295-303, 1992), in yeast (Nagiec et al., J. Biol. Chem. 268:22156-22163, 1993) and in plants (Brown et al., Plant Mol. Biol 26:211-223, 1994; and Hanke et al., Eur J. Biochem. 232:806-810, 1995) using genetic complementation techniques. The cloning of a mammalian version of LPAAT has not been reported.
  • the present invention provides a cDNA sequence, polypeptide sequence, and transformed cells for producing isolated recombinant mammalian LPAAT.
  • the present invention provides two novel human polypeptides, and fragments thereof, having LPAAT activity.
  • the polypeptides discovered herein is novel and will be called hLPAAT with the first one discovered designated hLPAAT ⁇ and the second one discovered called hLPAAT ⁇ .
  • LPAAT catalyzes the acylation of lysophosphatidic acid (LPA) to phosphatidic acid (PA) by acylating the sn-2 position of LPA with a fatty acid acyl-chain moiety.
  • the present invention further provides nucleic acid sequences coding for expression of the novel LPAAT polypeptides and active fragments thereof.
  • the invention further provides purified LPAATs and antisense oligonucleotides for modulation of expression of the genes coding for LPAAT polypeptides.
  • Assays for screening test compounds for their ability to inhibit LPAATs are also provided.
  • Recombinant LPAAT is useful for screening candidate drug compounds that inhibit LPAAT activity.
  • the present invention provides cDNA sequences encoding a polypeptide having LPAAT activity and comprising the DNA sequence set forth in SEQ ID NO. 1 of SEQ ID NO. 7, shortened fragments thereof, or additional cDNA sequences which due to the degeneracy of the genetic code encode a polypeptide of SEQ ID NO. 2 or — SEQ. ID NO. 8 or biologically active fragments thereof or a sequence capable of hybridizing thereto under high stringency conditions.
  • the present invention further provides a polypeptide having LPAAT activity and comprising the amino acid sequence of SEQ ID NO. 2 or SEQ ID NO. 8 or biologically active fragments thereof.
  • vectors containing a DNA sequence encoding a mammalian LPAAT enzyme in operative association with an expression control sequence are also provided with the present invention.
  • the inventive vectors and transformed cells are employed in a process for producing recombinant mammalian LPAAT.
  • a cell line transformed with a DNA sequence encoding on expression for a LPAAT enzyme in operative association with an expression control sequence is cultured.
  • the claimed process may employ a number of known cells as host cells for expression of the LPAAT polypeptide, including, for example, mammalian cells, yeast cells, insect cells and bacterial cells.
  • Another aspect of this invention provides a method for identifying a pharmaceutically-active compound by determining if a selected compound is capable of inhibiting the activity of LPAAT for acylating LPA to PA.
  • a compound capable of such activity is capable of indirectly inhibiting SAPkinase and being a pharmaceutical compound useful for augmenting trilineage hematopoiesis after cytoreductive therapy and for anti-inflammatory activity in inhibiting the inflammatory cascade following hypoxia and reoxygenation injury (e.g., sepsis, trauma, ARDS, etc.).
  • the present invention further provides a transformed cell that expresses active mammalian LPAAT and further comprises a means for determining if a drug candidate compound is therapeutically active by inhibiting recombinant LPAAT activity.
  • Figure 1 shows the DNA sequence of the cDNA insert of pZplat.l 1 encoding hLPAAT ⁇ .
  • Figure 2 shows amino acid sequence alignment of the human LPAAT ⁇ coding sequence, the yeast LPAAT coding sequence, E. coli LPAAT coding sequence, and the maize LPAAT coding sequence. This comparison shows that human LPAAT ⁇ has the greatest extended homology with yeast or E. coli LPAAT than with the plant LPAAT.
  • Figure 3 shows the DNA sequence of the cDNA insert pSP.LPAT3 encoding hLPAAT ⁇ .
  • the nucleotide sequence analysis and restriction mapping of the cDNA clone revealed a 5' untranslated region of 39 base pairs and an open reading frame encoding a 278 amino acid polypeptide that spans positions 40-876. It also shows a 3' untranslated region of 480 base pairs from pSP.LPAT3. The initiation site for translation was localized at nucleotide positions 40-42 and fulfilled the requirement for an adequate initiation site (Kozak, Critical Rev. Biochem. Mol. Biol. 27:385-402, 1992).
  • Figure 4 shows the sequence of the hLPAAT ⁇ 278 amino acid open reading frame.
  • the amino acid sequence was used as the query sequence to search for homologous sequences in protein databases. Search of the database based on Genbank Release 92 from the National Center for Biotechnology Information (NCBI) using the blastp program showed that this protein was most homologous to the yeast, bacterial and plant LPAATs.
  • Figure 5 shows amino acid sequences alignment of this putative human LPAAT ⁇ coding sequence, human LPAAT ⁇ coding, the yeast LPAAT coding sequence, the bacterial (E. coli, H. infiuenzae, and S. typhimurium) LPAAT coding sequences, and the plant (L. douglassi and C. nucifera) LPAAT coding sequences, revealing that the human LPAAT coding sequences have a much more extended homology with the yeast or the bacterial LPAAT than with the plant LPAAT.
  • Figure 6 shows a comparison of LPAAT activity in A549 cells transfected with pC ⁇ 9.LPAATl DNA, or no DNA using a TLC (thin layer chromatography) assay.
  • Figures 7 and 8 show a comparison of the production of TNF (Figure 7) and IL-6 ( Figure 8) between A549 cells transfected with pCE9.LPAATl and control A549 cells after stimulation with IL-1 ⁇ and murine TNF. These data show A549 overexpressing LPAAT produces >5 fold more TNF and >10 fold more IL-6 relative to untransfected A549 cells, suggesting that overexpression of LPAAT enhances the cytokine signaling response in cells.
  • the present invention provides novel, isolated, biologically active mammalian LPAAT enzymes.
  • isolated means any LPAAT polypeptide of the present — invention, or any other gene encoding LPAAT polypeptide, which is essentially free of other polypeptides or genes, respectively, or of other contaminants with which the LPAAT polypeptide of gene might normally be found in nature.
  • the invention includes a functional polypeptide, LPAAT, and functional fragments thereof.
  • the term "functional polypeptide” refers to a polypeptide which possesses a biological function or activity which is identified through a biological assay, preferably cell-based, and which results in the formation of PA species from LPA.
  • a "functional polynucleotide” denotes a polynucleotide which encodes a functional polypeptide. Minor modification of the hLPAAT ⁇ primary amino acid sequence may result in proteins which have substantially equivalent activity as compared to the sequenced hLPAAT ⁇ polypeptide described herein. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous.
  • the hLPAAT ⁇ and hLPAAT ⁇ polypeptide of the present invention also includes conservative variations of the polypeptide sequence.
  • conservative variation denotes the replacement of an amino acid residue by another, biologically active similar residue. Examples of conservative variations include the substitution of one hydrophobic residue, such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like.
  • conservative variation also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunologically react with the unsubstituted polypeptide.
  • Polypeptides of the present invention can be synthesized by such commonly used methods as t-BOC or FMOC protection of alpha-amino groups. Both methods involve step-wise syntheses whereby a single amino acid is added at each step starting from the C terminus of the peptide (Coligan et al., Current Protocols in Immunology, Wiley Interscience, Unit 9, 1991).
  • polypeptide of the present invention can also be? synthesized by solid phase synthesis methods (e.g., Merrifield, J. Am. Chem. Soc. 85:2149, 1962; and Steward and Young, Solid Phase Peptide Synthesis, Freeman, San Francisco pp.
  • the ploypeptides can be deprotected and cleaved from the polymer by treatment with liquid HF 10% anisole for about 15-60 min at 0 °C. After evaporation of the reagents, the peptides are extracted from the polymer with 1% acetic acid solution, which is then lyophihzed to yield crude material. This can normally be purified by such techniques as gel filtration of Sephadex G-15 using 5% acetic acid as a solvent.
  • Lyophilization of appropriate fractions of the column will yield a homogeneous polypeptide or polypeptide derivatives, which are characterized by such standard techniques as amino acid analysis, thin layer chromatography, high performance liquid chromatography, ultraviolet abso ⁇ tion spectroscopsy, molar rotation, solubility and quantitated by solid phase Edman degradation.
  • polynucleotide refers to a polymer of deoxyribonucleotides or ribonucleotides in the form of a separate fragment or as a component of a larger construct.
  • DNA encoding the polypeptide of the invention can be assembled from cDNA fragments or from oligonucleotides which provide a synthetic gene which is capable of being expressed in a recombinant transcriptional unit.
  • Polynucleotide sequences of the invention include DNA, RNA and cDNA sequences.
  • the nucleotide sequence encoding hLPAAT is the sequence of SEQ ID NO.
  • DNA sequences of the present invention can be obtained by several methods.
  • the DNA can be isolated using hybridization procedures which are known in the art.
  • hybridization procedures include, for example, hybridization of probes to genomic of cDNA libraries to detect shared nucleotide sequences, antibody screening of expression libraries to detect shared structural features, such as a common antigenic epitope, and synthesis by the polymerase chain reaction (PCR).
  • Hybridization procedures are useful for screening of recombinant clones by using labeled mixed synthetic oligonucleotides probes, wherein each probe is potentially the complete complement of a specific DNA sequence in a hybridization sample which includes a heterogeneous mixture of denatured double-stranded DNA.
  • hybridization is preferably performed on either single-stranded DNA or denatured double- stranded DNA.
  • Hybridization is particularly useful for detection of cDNA clones derived from sources where an extremely low amount of mRNA sequences relating to the polypeptide of interest are present.
  • cDNA a double-stranded DNA complement of mRNA is eventually formed which is generally referred to as cDNA.
  • cDNA sequence isolation can be done, for example, by formation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA. mRNA is abundant in donor cells that have high levels of genetic expression. In the event of lower levels of expression, PCR techniques are preferred.
  • production of labeled single or double stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures, carried out on cloned copies of the cDNA (denatured into a single-stranded form) (Jay et al., Nucl Acid Res. 11:2325, 1983).
  • a cDNA expression library such as lambda gtl 1
  • Such antibodies can be either polyclonally or monoclonally derived and used to detect expression product indicative of the presence of hLPAAT ⁇ or hLPAAT ⁇ cDNA.
  • polynucleotide sequence can be deduced from the genetic code, however the degeneracy of the code must be taken into account.
  • Polynucleotides of this invention include sequences which are degenerate as a result of the genetic code.
  • the polynucleotides of this invention also include sequences that are degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more that one codon (a three base sequence). Therefore, as long as the amino acid sequences of hLPAAT ⁇ and hLPAAT ⁇ results in a functional polypeptide (at least, in the case of the sense polynucleotide strand), all degenerate nucleotide sequences are included in the invention.
  • the polynucleotide sequence for hLPAAT ⁇ and hLPAAT ⁇ also includes sequences complementary to the polynucleotides encoding hLPAAT ⁇ and hLPAAT ⁇ (antisense sequences).
  • Antisense nucleic acids are DNA and RNA molecules that are complementary to at least a portion of a specific mRNA molecule (Weintraub, Sci. Amer. 262:40, 1990).
  • the invention embraces all antisense polynucleotides capable of inhibiting the production of hLPAAT ⁇ and hLPAAT ⁇ polypeptide. In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule.
  • antisense nucleic acids interfere with the translation of mRNA since the cell cannot translate mRNA that is double-stranded.
  • Antisense oligomers of about 15 nucleotides are preferred, since they are easily synthesized and are less likely to cause problems than larger molecules when introduced into the target hLPAAT ⁇ and hLPAAT ⁇ -producing cell.
  • the use of antisense methods to inhibit translation of genes is known (e.g., Marcus- Sakura, ⁇ ii ⁇ /. Biochem. 172:289, 1988).
  • Ribozyme nucleotide sequences for hLPAAT ⁇ and hLPAAT ⁇ are included in this invention.
  • Ribozymes are RNA molecules possessing an ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode such RNAs, it is possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech, J. Amer. Med. Assn. 260:3030, 1988). An advantage of this approach is that only mRNAs with particular sequences are inactivated because they are sequence-specific. There are two basic types of ribozymes, tetrahymena-type (Hasselhoff, Nature
  • Tetrahymena-type ribozymes recognize sequences which are four bases in length, while "hammerhead-type” ribozymes recognize base sequences 11-18 bases in length. The longer the recognition sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating a specific mRNA species.
  • Polynucleotide sequences encoding the hLPAAT ⁇ and hLPAAT ⁇ polypeptides of the invention can be expressed in either prokaryotes or eukaryotes.
  • Hosts can include microbial (bacterial), yeast, insect and mammalian organisms. Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are known in the art.
  • Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art. Such vectors are used to incorporate DNA sequences of the invention.
  • DNA sequences encoding the inventive polypeptides can be expressed in vitro by DNA transfer into a suitable host using known methods of transfection.
  • the hLPAAT ⁇ and hLPAAT ⁇ DNA sequences may be inserted into a recombinant expression vector.
  • the term "recombinant expression vector” refers to a plasmid, virus or other vehicle that has been manipulated by insertion or inco ⁇ oration of the genetic sequences. Such expression vectors contain a promoter sequence which facilitates efficient transcription of the inserted genetic sequence of the host.
  • the expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells.
  • Vectors suitable for use in the present invention include, for example, with bacterial promoter and ribosome binding site expression vector for expression in bacteria (Gold, Meth. Enzymol.
  • the DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metallothionein I, or polyhedren promoters).
  • a promoter e.g., T7, metallothionein I, or polyhedren promoters.
  • the vector may include a phenotypically selectable marker to identify host cells which contain the expression vector.
  • markers typically used in prokaryotic expression vectors include antibiotic resistance genes for ampicillin ( ⁇ -lactamases), tetracycline and chloramphenicol (chloramphenicol acetyltransferase).
  • markers typically used in mammalian expression vectors include the gene for adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo, G418), dihydrofolate reductase (DHFR), hygromycin-B-phosphotransferase (HPH), thymidine kinase (TK), and xanthine guanine phosphoriboseyltransferase (XGPRT, gpt).
  • ADA adenosine deaminase
  • DHFR dihydrofolate reductase
  • HPH hygromycin-B-phosphotransferase
  • TK thymidine kinase
  • XGPRT xanthine guanine phosphoriboseyltransferase
  • the expression system used is one driven by the baculovirus polyhedrin promoter.
  • the gene encoding the polypeptide can be manipulated by standard techniques in order to facilitate cloning into the baculovirus vector. See Ausubel et al., supra.
  • a preferred baculovirus vector is the pBlueBac vector (Invitrogen, Sorrento, CA).
  • the vector carrying the gene for the polypeptide is transfected into Spodoptera frugiperda (Sf9) cells by standard protocols, and the cells are cultured and processed to produce the recombinant polypeptide. See Summers et al., A Manual for Methods of Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station.
  • the gene can be inserted into an appropriate expression system.
  • the gene can be expressed in any number of different recombinant DNA expression systems to generate large amounts of polypeptide. Included within the present invention are polypeptides having native glycosylation sequences, and deglycosylated or unglycosylated polypeptides prepared by the methods described below. Examples of expression systems known to the skilled practitioner in the art include bacteria such as E. coli, yeast such as Pichiapastoris, baculovirus, and mammalian expression systems such as in Cos or CHO cells.
  • the gene or gene fragment encoding the desired polypeptide can be inserted into an expression vector by standard subcloning techniques.
  • an E. coli expression vector is used which produces the recombinant protein as a fusion protein, allowing rapid affinity purification of the protein.
  • fusion protein expression systems are the glutathione S-transferase system (Pharmacia, Piscataway, NJ), the maltose binding protein system (NEB, Beverley, MA), the thiofusion system (Invotrogen, San Diego, CA), the FLAG system (IBI, New Haven, CT), and the 6xHis system (Qiagen, Chatsworth, CA).
  • fusion systems produce proteins where it is desirable to excise the fusion partner from the desired protein.
  • the fusion partner is linked to the recombinant polypeptide by a peptide sequence containing a specific recognition sequence for a protease. Examples of suitable sequences are those recognized by the Tobacco Etch Virus protease (Life
  • recombinant proteins are expressed in E. coli and in baculovirus expression systems.
  • the complete gene for the polypeptide can be expressed or, alternatively, fragments of the gene encoding antigenic determinants can be produced.
  • the gene sequence encoding the polypeptide is analyzed to detect putative transmembrane sequences. Such sequences are typically very hydrophobic and are readily detected by the use of standard sequence analysis software, such as MacDNASIS (Hitachi, San Bruno, CA). The presence of transmembrane sequences is often deleterious when a recombinant protein is synthesized in many expression systems, especially E.
  • transmembrane sequences typically does not significantly alter the conformation of the remaining polypeptide structure.
  • transmembrane sequences being by definition embedded within a membrane, are inaccessible as antigenic determinants to a host immune system. Antibodies to these sequences will not, therefore, provide immunity to the host and, hence, little is lost in terms of immunity by omitting such sequences from the recombinant polypeptides of the invention. Deletion of transmembrane-encoding sequences from the genes used for expression can be achieved by standard techniques. See Ausubel et al, supra, Chapter 8.
  • fortuitously-placed restriction enzyme sites can be used to excise the desired gene fragment, or the PCR can be used to amplify only the desired part of the gene.
  • Transformation of a host cell with recombinant DNA may be carried out by conventional techniques.
  • the host is prokaryotic, such as E. coli
  • competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phases and subsequently treated by a CaCL method using standard procedures.
  • MgCL or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell or by electroporation.
  • Eukaryotic cells can also be cotransformed with DNA sequences encoding the hLPAAT ⁇ and hLPAAT ⁇ polypeptides of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the he ⁇ es simplex thymidine kinase gene.
  • Another method uses a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus to transiently infect or transform eukaryotic cells and express the hLPAAT ⁇ and hLPAAT ⁇ polypeptides.
  • a eukaryotic viral vector such as simian virus 40 (SV40) or bovine papilloma virus to transiently infect or transform eukaryotic cells and express the hLPAAT ⁇ and hLPAAT ⁇ polypeptides.
  • Expression vectors that are suitable for production of LPAAT polypeptides typically contain (1) prokaryotic DNA elements coding for a bacterial replication origin and an antibiotic resistance marker to provide for the growth and selection of the expression vector in a bacterial host; (2) eukaryotic DNA elements that control initiation of transcription, such as a promoter; and (3) DNA elements that control the processing of transcripts, such as a transcription termination/polyadenylation sequence.
  • LPAAT polypeptides of the present invention preferably is expressed in eukaryotic cells, such as mammalian, insect and yeast cells. Mammalian cells are especially preferred eukaryotic hosts because mammalian cells provide suitable post-translational modifications such as glycosylation.
  • mammalian host cells include Chinese hamster ovary cells (CHO-Kl ; ATCC CCL61), rat pituitary cells (GH,; ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H- 4-H-E; ATCC CRL1548) SV40-transformed monkey kidney cells (COS-1; ATCC CRL 1650) and murine embryonic cells (NIH-3T3; ATCC CRL 1658).
  • CHO-Kl Chinese hamster ovary cells
  • ATCC CCL61 rat pituitary cells
  • GH rat pituitary cells
  • HeLa S3 cells ATCC CCL2.2
  • rat hepatoma cells H- 4-H-E
  • COS-1 SV40-transformed monkey kidney cells
  • NIH-3T3 ATCC CRL 1658
  • the transcriptional and translational regulatory signals may be derived from viral sources, such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
  • viral sources such as adenovirus, bovine papilloma virus, simian virus, or the like, in which the regulatory signals are associated with a particular gene which has a high level of expression.
  • Suitable transcriptional and translational regulatory sequences also can be obtained from mammalian genes, such as actin, collagen, myosin, and metallothionein genes.
  • Transcriptional regulatory sequences include a promoter region sufficient to direct the initiation of RNA synthesis.
  • Suitable eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al, J. Molec. Appl. Genet. 1 :273,1982); the TK promoter of He ⁇ es virus (McKnight, Cell 31 : 355, 1982); the SV40 early promoter (Benoist et al., Nature 290:304, 1981); the Rous sarcoma virus promoter (Gorman et al., Proc. Nat'l. Acad. Sci.
  • a prokaryotic promoter such as the bacteriophage T3 RNA polymerase promoter, can be used to control fusion gene expression if the prokaryotic promoter is regulated by a eukaryotic promoter (Zhou et al., Mol. Cell. Biol. 10:4529, 1990; Kaufinan et al, Nucl. Acids Res. 19:4485, 1991).
  • An expression vector can be introduced into host cells using a variety of techniques including calcium phosphate transfection, liposome-mediated transfection, electroporation, and the like.
  • transfected cells are selected and propagated wherein the expression vector is stably integrated in the host cell genome to produce stable transformants.
  • Techniques for introducing vectors into eukaryotic cells and techniques for selecting stable transformants using a dominant selectable marker are described, for example, by Ausubel and by Murray (ed.), Gene Transfer and Expression Protocols (Humana Press 1991).
  • Examples of mammalian host cells include COS, BHK, 293 and CHO cells. Purification of Recombinant Polypeptides.
  • the polypeptide expressed in any of a number of different recombinant DNA expression systems can be obtained in large amounts and tested for biological activity.
  • the recombinant bacterial cells for example E. coli, are grown in any of a number of suitable media, for example LB, and the expression of the recombinant polypeptide induced by adding IPTG to the media or switching incubation to a higher temperature. After culturing the bacteria for a further period of between 2 and 24 hours, the cells are collected by centrifugation and washed to remove residual media. The bacterial cells are then lysed, for example, by disruption in a cell homogenizer and centrifuged to separate the dense inclusion bodies and cell membranes from the soluble cell components.
  • This centrifugation can be performed under conditions whereby the dense inclusion bodies are selectively enriched by inco ⁇ oration of sugars such as sucrose into the buffer and centrifugation at a selective speed. If the recombinant polypeptide is expressed in the inclusion, these can be washed in any of several solutions to remove some of the contaminating host proteins, then solubilized in solutions containing high concentrations of urea (e.g., 8 M) or chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol).
  • urea e.g. 8 M
  • chaotropic agents such as guanidine hydrochloride in the presence of reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol).
  • polypeptide can then be purified further and separated from the refolding mixture by chromatography on any of several supports including ion exchange resins, gel permeation resins or on a variety of affinity columns.
  • Isolation and purification of host cell expressed polypeptide, or fragments thereof may be carried out by conventional means including, but not limited to, preparative chromatography and immunological separations involving monoclonal or polyclonal antibodies.
  • These polypeptides may be produced in a variety of ways, including via recombinant DNA techniques, to enable large scale production of pure, active hLPAAT ⁇ and hLPAAT ⁇ useful for screening compounds for trilineage hematopoietic and anti- inflammatory therapeutic applications, and developing antibodies for therapeutic, diagnostic and research use.
  • the hLPAAT ⁇ and hLPAAT ⁇ polypeptides of the present invention are useful in a screening methodology for identifying compounds or compositions which affect cellular signaling of an inflammatory response.
  • This method comprises incubating the hLPAAT ⁇ and hLPAAT ⁇ polypeptides or a cell transfected with cDNA encoding hLPAAT ⁇ and hLPAAT ⁇ under conditions sufficient to allow the components to interact, and then measuring the effect of the compound or composition on hLPAAT ⁇ and hLPAAT ⁇ activity.
  • the observed effect on hLPAAT ⁇ and hLPAAT ⁇ may be either inhibitory or stimulatory.
  • the top line refers to the yeast LPAAT sequence from amino acids 169 to 220 and the bottom line refers to the homologous region from the dbest clone# 102250. Identical amino acids between these two sequences are shown in block letters with asterisks in between Accordingly, a synthetic oligonucleotide (o.BLPAT.2R), 5'-
  • TGCAAGATGGAAGGCGCC-3' was made based on the complement sequence of the conserved amino acids region, GAFHLA (SEQ ID NO. 6), of clone#102250.
  • O.BPLAT.2R was radiolabeled at its 5'-end using ⁇ - 32 P-ATP and T4 polynucleotide kinase as a probe in screening a ⁇ zap human brain cDNA library (Stratagene).
  • Figure 1 shows the DNA sequence of the cDNA insert of pZplat.l 1.
  • the nucleotide sequence analysis and restriction mapping of the cDNA clone revealed a 5'- untranslated region of >300 bp, an open reading frame capable of encoding a 283 amino acid polypeptide, and a 3 '-untranslated region of >800 bp.
  • the initiation site for translation was localized at nucleotide positions 319-321 and fulfilled the requirement for an adequate initiation site according to Kozak (Kozak, Critical Rev. Biochem. Mol Biol. 27:385-402, 1992).
  • the top line refers to the yeast LPAAT sequence from amino acids 171 to 230
  • O.LPAT3.F was used in combination with a reverse vector primer (o.sport.lR), 5'-CTAGCTTATA ATACGACTCA C-3' (SEQ ID NO. 14), for amplification of the 3'-region of potential LPAAT ⁇ sequences from a pCMV.SPORT human leukocyte cDNA library (Life Technologies, Gaithersburg, MD).
  • a 700 bp PCR fragment derived from o. sport.1 and O.LPAT3.R amplification was cut with EcoR I before inserting in between the Sma I and EcoR I of pBluescript(II)SK(-) (Stratagene, LaJolla, CA) to generate pLPAT3.5'.
  • a 900 bp PCR fragment derived from o.sport.lR and O.LPAT3.F amplification was cut with-A ⁇ I before inserting in between the Sma I and Xba I of pBluescript(II)SK(-) (Stratagene, LaJolla, CA) to generate pLPAT3.3'.
  • the 560 bp Neo I - Nar I fragment from pLPAT3.5' and the 780 bp Nar I -Xba I fragment from pLPAT3.3' were inserted into the Neo I / Xba I vector prepared from pSP-luc+ (Promega, Madison, WI) via a three-part ligation to generate pSP.LPAT3.
  • Figure 3 shows the DNA sequence ID of the cDNA insert of pSP.LPAT3.
  • the nucleotide sequence analysis and restriction mapping of the cDNA clone revealed a 5'- untranslated region of 39 bp, an open reading frame capable of encoding a 278 amino acids polypeptide that spans nucleotide positions 40 to 876 and a 3'-untranslated region of 480 bp ( Figure 3).
  • the initiation site for translation was localized at nucleotide positions 40-42 and fulfilled the requirement for an adequate initiation site according to Kozak (Kozak, Critical Rev. Biochem. Mol. Biol. 27:385-402, 1992).
  • Figure 4 The sequence of the 278 amino acid open reading frame ( Figure 4) was used as the query sequence to search for homologous sequences in protein databases. Search of the database based on Genbank Release 92 from the National Center for Biotechnology Information (NCBI) using the blastp program showed that this protein was most homologous to the yeast, bacterial and plant LPAATs.
  • Figure 5 shows amino acid sequences alignment of this putative human LPAAT ⁇ coding sequence, human LPAAT ⁇ coding, the yeast LPAAT coding sequence, the bacterial (E. coli, H. influenzae, and S. typhimurium) LPAAT coding sequences, and the plant (L. douglassi and C.
  • human LPAAT ⁇ is characterized by the 283 amino acids of SEQ ID NO. 2.
  • the present invention further includes allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) of the DNA sequences herein encoding active LPAAT polypeptides and active fragments thereof.
  • the inventive DNA sequences further comprise those sequences which hybridize under stringent conditions (see, for example, Maniatis et al, Molecular Coining (A Laboratory Manual) , Cold Spring Harbor Laboratory, pages 387-389, 1982) to the coding region (e.g., nucleotide #319 to nucleotide #1167).
  • One such stringent hybridization condition is, for example, 4 X SSC at 65 °C, followed by washing in 0.1 X SSC at 65 °C for thirty minutes.
  • another stringent hybridization condition is in 50% formamide, 4 X SSC at 42 °C.
  • the present invention further includes DNA sequences which code for LPAAT polypeptides having LPAAT activity but differ in codon sequence due to degeneracy of the genetic code.
  • isolated applied throughout the specification to polypeptides refers to that level of purity in which the polypeptide is sufficiently free of other materials endogenous to the host from which the polypeptide is isolated such that any remaining materials do not materially affect the biological properties of the polypeptide.
  • derived as used throughout the specification in relation to the polypeptides of the present invention, encompasses polypeptides obtained by isolation and purification from host cells, as well as polypeptides obtained by manipulation and expression of nucleotide sequences prepared from host cells. It also encompasses nucleotide sequences including genomic DNA, mRNA, cDNA synthesized from mRNA, and synthetic oligonucleotides having sequences corresponding to the inventive nucleotide sequences. It further encompasses synthetic polypeptide antigens prepared on the basis of the known amino acid sequences of the proteins of the present invention.
  • Purified polypeptides prepared by the methods described above can be sequenced using methods well known in the art, for example using a gas phase peptide sequencer (Applied Biosystems, Foster City, CA). Because the proteins of the present invention may be glycosylated, it is preferred that the carbohydrate groups are removed from the proteins prior to sequencing. This can be achieved by using glycosidase enzymes. Preferably, glycosidase F (Boehringer-Mannheim, Indianapolis, IN) is used. To determine as much of the polypeptide sequence as possible, it is preferred that the polypeptides of the present invention be cleaved into smaller fragments more suitable for gas-phase sequence analysis.
  • polypeptides can be achieved by treatment of the polypeptides with selective peptidases, and in a particularly preferred embodiment, with endoproteinase lys-C (Boehringer).
  • endoproteinase lys-C Boehringer
  • the fragments so produced can be separated by reversed-phase HPLC chromatography.
  • Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and are designed to modulate one or more properties of the polypeptides such as stability against proteolytic cleavage. Substitutions preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge.
  • Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparigine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparigine; glutamate to aspartate; glycine to proline; histidine to asparigine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
  • Insertional variants contain fusion proteins such as those used to allow rapid purification of the polypeptide and also can include hybrid polypeptides containing sequences from other proteins and polypeptides which are homologues of the inventive polypeptide.
  • an insertional variant could include portions of the amino acid sequence of the polypeptide from one species, together with portions of the homologous polypeptide from another species.
  • Other insertional variants can include those in which additional amino acids are introduced within the coding sequence of the polypeptides. These typically are smaller insertions than the fusion proteins described above and are introduced, for example, to disrupt a protease cleavage site.
  • Antibodies to human LPAAT protein can be obtained using the product of an LPAAT expression vector or synthetic peptides derived from the LPAAT coding sequence coupled to a carrier (Pasnett et al., J. Biol. Chem. 263:1728, 1988) as an antigen.
  • the preparation of polyclonal antibodies is well-known to those of skill in the art. See, for example, Green et al., "Production of Polyclonal Antisera,” in Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press 1992).
  • an LPAAT antibody of the present invention may be derived from a rodent monoclonal antibody (MAb).
  • Rodent monoclonal antibodies to specific antigens may be obtained by methods known to those skilled in the art. See, for example, Kohler and Milstein, Nature 256:495, 1975, and Coligan et al. (eds.), Current Protocols in Immunology, 1:2.5.1-2.6.7 (John Wiley & Sons 1991).
  • monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, verifying the presence of antibody production by removing a serum sample, removing the spleen to obtain B-lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
  • MAbs can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography. See, for example, Coligan at pages 2.7.1-2.7.12 and pages 2.9.1-2.9.3. Also, see Baines et al., "Purification of Immunoglobulin G (IgG)," in Methods in Molecular Biology, 10:79-104 Humana Press, Inc. 1992.
  • An LPAAT antibody of the present invention may also be derived from a subhuman primate antibody. General techniques for raising therapeutically useful antibodies in baboons may be found, for example, in Goldenberg et al., international patent publication No. WO 91/11465 (1991), and in Losman et al., Int. J. Cancer 46:310, 1990.
  • a therapeutically useful LPAAT antibody may be derived from a "humanized" monoclonal antibody.
  • Humanized monoclonal antibodies are produced by transferring mouse complementary determining regions from heavy and light variable chains of the mouse immunoglobulin into a human variable domain, and then, substituting human residues in the framework regions of the murine counte ⁇ arts.
  • the use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of murine constant regions. General techniques for cloning murine immunoglobulin variable domains are described, for example, by the publication of Orlandi et al., Proc. Nat'l Acad. Sci. USA 86:3833, 1989.
  • an LPAAT antibody of the present invention may be derived from human antibody fragments isolated from a combinatorial immunoglobulin library.
  • Cloning and expression vectors that are useful for producing a human immunoglobulin phage library can be obtained, for example, from STRATAGENE Cloning Systems (La
  • an LPAAT antibody of the present invention may be derived from a human monoclonal antibody.
  • Such antibodies are obtained from transgenic mice that have been "engineered” to produce specific human antibodies in response to antigenic challenge.
  • elements of the human heavy and light chain locus are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of the endogenous heavy chain and light chain loci.
  • the transgenic mice can synthesize human antibodies specific for human antigens, and the mice can be used to produce human antibody-secreting hybridomas. Methods for obtaining human antibodies from transgenic mice are described by Green et al., Nature Genet. 7:13, 1994; Lonberg et al., Nature 368:856, 1994, and Taylor et al, Int. Immun. 6:579, 1994.
  • This example illustrates an experiment to determine if the human LPAAT ⁇ clone encodes a protein with LPAAT activity, an E. coli vector expressing the human LPAAT ⁇ as a fusion protein with ⁇ -galactosidase was transformed into a LPAAT minus strain of E. coli to see if it would complement the defect in E. coli.
  • the 840 bp Bgl II- Nco I fragment, which spans the coding region of human LPAAT ⁇ from amino acid 68 to beyond the stop codon, derived from pZplat.11 was inserted into a Bgl II / Neo I digested cloning vector pLitmus28 (Evans et al., BioTechniques 19:130-135, 1995) to generate the plasmid p28BgN.
  • This plasmid is expected to express the human LPAAT ⁇ as a fusion protein containing the first 16 amino acids of ⁇ -galactosidase and the last 216 residues of the human LPAAT ⁇ coding sequence using the lac promoter in pLitmus28.
  • JC201 transformed with p28BgN was able to grow normally at 44 °C when compared to the wild type strain JC200 (plsC + ), while JC201 transformed with pLitmus28 vector was not able to support growth at 44 °C.
  • an E. coli vector expressing this human LPAAT ⁇ as a direct product was transformed into a LPAAT minus strain of E. coli to see if it would complement the defect in E. coli.
  • the 1350 bp Neo I - Xba I fragment from pSP.LPAT3 which spans the entire coding region from amino acid 1 to beyond the stop codon, was inserted into a Neo I / Xba I digested cloning vector pKK388-l (Clontech, Palo Alto, CA) to generate the plasmid pTrc.LPAT3.
  • This plasmid was transformed into the E. coli strain JC201
  • JC201 (Coleman, Mol. Gen. Genet. 232:295-303, 1992) is deficient in LPAAT activity due to mutation in the plsC locus. This mutation leads to a temperature-sensitive phenotype that causes JC201 to grow slowly at 37 °C, almost not at all at 42 °C, and not at all at 44 °C. JC201 transformed with pTrc.LPAT3 was able to grow normally at 44 °C when compared to the wild type strain JC200 (plsC + ), while JC201 transformed with pKK388-l vector was not able to support growth at 44 °C. These data suggest that the putative human LPAAT ⁇ cDNA isolated here does possess LPAAT activity, as the putative protein product of this cDNA is able to complement the defective LPAAT gene (plsC) in JC201.
  • Example 3 This example illustrates a group of experiments to see if overexpression of this human LPAAT ⁇ would have any effect on mammalian cells.
  • the entire cDNA insert (-2,300 bp) from pZplat.l 1 was cleaved with Asp718 I and Xho I for insertion into the mammalian expression vector pCE9 to generate pCE9.LPAATl.
  • pCE9 was derived from pCE2 with two modifications. The 550 bp BstY I fragment within the elongation factor- la (EF-la) intron of pCE2 was deleted.
  • the multiple cloning region of pCE2 between the Asp718 I and BamH I site was replaced with the multiple cloning region spanning the Asp718 I and Bgl II sites from pLitmus28.
  • the plasmid pCE2 was derived from pREP7b (Leung, et al., Proc. Natl Acad. Sci. USA, 92: 4813-4817, 1995) with the RSV promoter region replaced by the CMV enhancer and the elongation factor- la (EF-la) promoter and intron.
  • the CMV enhancer came from a 380 bp Xba I-Sph I fragment produced by PCR from pCEP4 (Invitrogen, San Diego, CA) using the primers 5'-GGCTCTAGAT ATTAATAGTA ATCAATTAC-3' and 5'-CCTCACGCAT GCACCATGGT AATAGC- 3'.
  • the EF-la promoter and intron came from a 1200 bp Sph I-Asp718 I fragment produced by PCR from human genomic DNA using the primers 5'-GGTGCATGCG TGAGGCTCCG GTGC-3' and 5'-
  • pCE9.LPAATl DNA was transfected into several mammalian cell lines, including A549 cells, ECV304 cells (American Type Culture Collection, Rockville, MD), two human cell line that would produce IL-6 and TNF upon stimulation with IL-lb and murine TNF and 293-EBNA cells (Invitrogen, San Diego, CA).
  • pCE9.LPAATl was digested with BspH I before electroporating into these cell lines with a Cell-PoratorTM (Life Technologies, Gaithersburg, MD) using conditions described previously (Cachianes, et al., Biotechniques 15:255-259, 1993).
  • Hyg-resistant clones that expressed LPAAT m-RNA at a level more than 20 fold higher relative to untranfected cells based on Northern Blot analysis (Kroczek, et al, Anal. Biochem. 184: 90-95, 1990) were selected for further study.
  • Figure 6 compares the LPAAT activity in A549 cells and in A549 cells transfected with pCE9.LPAATl DNA using aTLC assay. This screening assay for LPAAT activity in cell extracts was based on a fluorecent assay using fluorecent lipid substrates (Ella, et al., Anal. Biochem. 218: 136-142, 1994).
  • BPC Molecular Probes, Eugene, OR
  • a synthetic PC that contains an ether linkage at the SN1 position with a fluorescent Bodipy moiety inco ⁇ orated into the end of the alkyl-chain at the SN1 position
  • BPC was converted to Bodipy-PA using cabbage phospholipase D (Sigma, St. Louis, MO).
  • Bodipy-PA was then converted to Bodipy-LPA using snake venom phospholipase A2.
  • the Bodipy-LPA obtained was purified by preparative TLC for use in the LPAAT assay. The assay was carried out in total cell extracts resuspended in lysis buffer (Ella, et al., Anal. Biochem.
  • Lane 1 refers to Bodipy LPA incubated with buffer only without any cell extract added.
  • Lane 9 refers to BPC treated with cabbage phospholipase D for generateing a Bodipy-PA marker.
  • Lanes 2 and 4 refer to to Bodipy LPA incubated with control A549 cell extracts with or without lipid A, respectively.
  • Lanes 3 and 5 refer to Bodipy LPA incubated with A549 cell extracts transfected with pCE9.LPAATl DNA with or without lipid A, respectively.
  • Figure 3 shows A549 cells transfected with the LPAAT cDNA (lanes 3 and 5) contain much more LPAAT activity than those of control cells (lanes 2 and 4) as evidenced by the increased conversion of Bodipy-LPA to Bodipy-PA. Addition of lipid A to the cell extracts has little effect on LPAAT activity (lanes 2 vs 4 and 3 vs 5).
  • A549 cell extract also contains a phosphohydrolase activiity that converts Bodipy-LPA to Bodipy-monoalkylglycerol (lanes 2 to 5).
  • A549 cells overexpressing LPAAT (lanes 3 and 5) have less of this activiity compared to control cells (lanes 2 and 4), suggesting this phosphohydrolase prefers LPA to PA as substrate.
  • DAG DAG in transfected cells (lanes 3 and 5) compared to control cells (lanes 2 and 4) possibly due to partial conversion of the PA formed to DAG from this endogenous phosphohydrolase.
  • Example 4 To see if the expressed LPAAT cDNA clone described here would also use other glycerol-lipids that contain a free-hydroxyl group at the SN2 position, the cell extracts were incubated with the substrates NBD-lysoPC (lanes 6 and 7) and NBD- monoacylglycerol (MAG) (lanes 10 and 11) to see if there is increased conversion to lysoPC and DAG, respectively. Lane 8 and 12 refer, respectively, to NBD-lysoPC and NBD-MAG incubated with buffer only without any cell extract added.
  • Example 5 pCE9.LPAATl DNA was transfected into A549 cells (American Type Culture Collection, Rockville, MD), a human cell line that would produce IL-6 and TNF upon stimulation with IL-l ⁇ and murine TNF.
  • pCE9.LPAATl was digested with BspHI before electroporating into A549 cells with a Cell-PoratorTM (Life Technologies, Gaithersburg, MD) using conditions described previously (Cachianes, et al., Biotechniques 15:255-259, 1993).
  • A549 cells transfected with pCE9.LPAATl and control A549 cells after stimulation with IL-l ⁇ and murine TNF shows A549 overexpressing LPAAT produces >5 fold more TNF and >10 fold more IL-6 relative to untransfected A549 cells, suggesting that overexpression of LPAAT would enhance the cytokine signaling response in cells. Development of compounds that would modulate LPAAT activity should therefore be of therapeutic interest in the field of inflammation.
  • ADDRESSEE Cell Therapeutics, Inc.
  • MOLECULE TYPE cDNA to mRNA
  • HYPOTHETICAL no
  • ANTI-SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • NAME/KEY hLPAAT ⁇ (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 : 1 GGAAGTCAGCAGGCGTTGGGGAGGGGTGGCGGGGGAATAGCGGCGGCAGC
  • MOLECULE TYPE polypeptide
  • HYPOTHETICAL no
  • ANTI-SENSE NO
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE polypeptide
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE oligonucleotide fragment
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE polypeptide
  • HYPOTHETICAL no
  • MOLECULE TYPE polypeptide
  • HYPOTHETICAL no
  • ANTI -SENSE NO
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE polypeptide
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE oligonucleotide
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE oligonucleotide
  • MOLECULE TYPE oligonucleotide
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:
  • MOLECULE TYPE oligonucleotide
  • HYPOTHETICAL no
  • ANTI -SENSE no
  • FRAGMENT TYPE (vi) ORIGINAL SOURCE:

Abstract

L'invention concerne des séquences d'ADNc et des polypeptides ayant une activité actyltransférase de l'acide lysophosphatidique (LPAAT). Cette enzyme est également connue sous le nom de 1-acyl-sn-glycérol-3-phosphate acyltransférase.
PCT/US1997/005360 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere WO1998054303A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP97936924A EP0988372A4 (fr) 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere
PCT/US1997/005360 WO1998054303A1 (fr) 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere
JP50060799A JP2002514087A (ja) 1997-05-27 1997-05-27 哺乳類のリゾホスファチジン酸アシルトランスフェラーゼ
CA002291516A CA2291516A1 (fr) 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1997/005360 WO1998054303A1 (fr) 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere

Publications (1)

Publication Number Publication Date
WO1998054303A1 true WO1998054303A1 (fr) 1998-12-03

Family

ID=22260640

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/005360 WO1998054303A1 (fr) 1997-05-27 1997-05-27 Acyltransferase de l'acide lysophosphatidique de mammifere

Country Status (4)

Country Link
EP (1) EP0988372A4 (fr)
JP (1) JP2002514087A (fr)
CA (1) CA2291516A1 (fr)
WO (1) WO1998054303A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7855321B2 (en) 2003-03-31 2010-12-21 University Of Bristol Plant acyltransferases specific for long-chained, multiply unsaturated fatty acids
WO2011161093A1 (fr) 2010-06-25 2011-12-29 Basf Plant Science Company Gmbh Acyltransférases et leurs applications dans la production d'acides gras
EP2821492A2 (fr) 2009-05-13 2015-01-07 BASF Plant Science Company GmbH Acyltransférases et leurs utilisations dans la production d'acide gras
WO2016075327A2 (fr) 2014-11-14 2016-05-19 Basf Plant Science Company Gmbh Production d'agpi dans des plantes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995027791A1 (fr) * 1994-04-06 1995-10-19 Calgene Inc. Acyltransferases vegetales de l'acide lysophosphatidique
US5563058A (en) * 1994-04-06 1996-10-08 Calgene, Inc. Plant lysophosphatidic acid acyltransferases
US5652243A (en) * 1992-03-04 1997-07-29 Cell Therapeutics, Inc. Methods of using enantiomerically pure hydroxylated xanthine compounds

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652243A (en) * 1992-03-04 1997-07-29 Cell Therapeutics, Inc. Methods of using enantiomerically pure hydroxylated xanthine compounds
WO1995027791A1 (fr) * 1994-04-06 1995-10-19 Calgene Inc. Acyltransferases vegetales de l'acide lysophosphatidique
US5563058A (en) * 1994-04-06 1996-10-08 Calgene, Inc. Plant lysophosphatidic acid acyltransferases

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BROUGH C. ET AL.: "Towards the genetic engineering of triacylglycerols of defined fatty acid composition: major changes in erucic acid content at the sn-2 position affected by the introduction of a 1-acyl-sn-glycerol-3-phosphate acyltransferase from Limnanthes douglasii into oil seed rape", MOLECULAR BREEDING: NEW STRATEGIES IN PLANT IMPROVEMENT., KLUWER ACADEMIC PUBLISHERS., NL, vol. 02., no. 02., 1 January 1996 (1996-01-01), NL, pages 133 - 142., XP002109007, ISSN: 1380-3743, DOI: 10.1007/BF00441428 *
J. COLEMAN.: "CHARACTERIZATION OF THE ESCHERICHIA COLI GENE OR 1-ACYL-SN-GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE (PLSC).", MOLECULAR AND GENERAL GENETICS., SPRINGER VERLAG, BERLIN., DE, vol. 232., 1 January 1992 (1992-01-01), DE, pages 295 - 303., XP002000904, ISSN: 0026-8925 *
KNUTZON D.S., ET AL.: "CLONING OF A COCONUT ENDOSPERM CDNA ENCODING A 1-ACYL-SN-GLYCEROL-3-PHOSPHATE ACYLTRANSFERASE THAT ACCEPTS MEDIUM-CHAIN-LENGHT SUBSTRATES.", PLANT PHYSIOLOGY., AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD., US, vol. 109., no. 03., 1 January 1995 (1995-01-01), US, pages 999 - 1006., XP000907268, ISSN: 0032-0889, DOI: 10.1104/pp.109.3.999 *
See also references of EP0988372A4 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7855321B2 (en) 2003-03-31 2010-12-21 University Of Bristol Plant acyltransferases specific for long-chained, multiply unsaturated fatty acids
EP2365063A1 (fr) 2003-03-31 2011-09-14 University Of Bristol Nouvelles acyltransférases végétales spécifiques aux acides gras insaturés multiples à chaîne longue
EP2390313A1 (fr) 2003-03-31 2011-11-30 University Of Bristol Nouvelles acyltransférases végétales spécifiques aux acides gras insaturés multiples à chaîne longue
US8354569B2 (en) 2003-03-31 2013-01-15 University Of Bristol Plant acyltransferases specific for long-chained, multiply unsaturated fatty acids
EP2821492A2 (fr) 2009-05-13 2015-01-07 BASF Plant Science Company GmbH Acyltransférases et leurs utilisations dans la production d'acide gras
US9212371B2 (en) 2009-05-13 2015-12-15 Basf Plant Science Company Gmbh Acyltransferases and uses thereof in fatty acid production
US9828589B2 (en) 2009-05-13 2017-11-28 Basf Plant Science Company Gmbh Acyltransferases and uses thereof in fatty acid production
WO2011161093A1 (fr) 2010-06-25 2011-12-29 Basf Plant Science Company Gmbh Acyltransférases et leurs applications dans la production d'acides gras
WO2016075327A2 (fr) 2014-11-14 2016-05-19 Basf Plant Science Company Gmbh Production d'agpi dans des plantes

Also Published As

Publication number Publication date
CA2291516A1 (fr) 1998-12-03
JP2002514087A (ja) 2002-05-14
EP0988372A4 (fr) 2003-01-02
EP0988372A1 (fr) 2000-03-29

Similar Documents

Publication Publication Date Title
US20060211102A1 (en) Human lysophosphatidic acid acyltransferase gamma-1 polypeptide
Benovic et al. β-Adrenergic receptor kinase: primary structure delineates a multigene family
US20030166212A1 (en) Alpha1,3-fucosyltransferase
US20050158797A1 (en) Mammalian CDP-diacylglycerol synthase
US6500653B1 (en) Nucleic acids and polypeptides which resemble RHO and which interact with cell signaling pathways and proteins
EP0988372A1 (fr) Acyltransferase de l'acide lysophosphatidique de mammifere
US6060263A (en) Mammalian lysophosphatidic acid acyltransferase
US6649377B1 (en) Human aggrecanase and nucleic acid compositions encoding the same
US5859222A (en) Human phosphatidylcholine phospholipase D
US6200769B1 (en) Mammalian CDP-diacylglycerol synthase
EP1141323A1 (fr) Acide lysophosphatidique acyltransferase de mammifere
WO1998000550A9 (fr) Synthetase mammalienne du cdp-diacylglycerol
US6274363B1 (en) Phosphatidylcholine phospholipase D
EP0904101B1 (fr) Acides nucleiques codant pour la gdp-fucose pyrophosphorylase
WO1997037682A1 (fr) Acides nucleiques codant une guanosine diphospho-fucose pyrophosphorylase
WO2001034782A1 (fr) ACIDE LYSOPHOSPHATIDIQUE ACYLTRANSFERASE-ε HUMAIN
US20020187540A1 (en) Cloning and characterization of a human adenylyl cyclase
WO2000000635A1 (fr) Phosphatidylcholine phospholipase d
US6841372B2 (en) Cloning and characterization of a human adenylyl cyclase
US5349058A (en) Nucleic acid encoding human mevalonate kinase
EP0986638A2 (fr) Clonage et caracterisation d'une adenyl cyclase a des enylcyclase humaines

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP MX

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2291516

Country of ref document: CA

Ref country code: CA

Ref document number: 2291516

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997936924

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997936924

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997936924

Country of ref document: EP