WO1998046737A2 - cDNA FOR HUMAN GDNF AND PROMOTER THEREFOR WHICH ALLOWS REGULATED AND CONSTITUTIVE EXPRESSION - Google Patents

Abstract

Glial cell line-derived neurotrophic factor (GDNF) is the most potent known survival factor for substantia nigra neurons, which degenerate in Parkinson's disease, for spinal motoneurons, which die in Lou Gehrig's disease, and for Purkinje neurons, the critical outflow cells of the cerebellum. Moreover, targeted deletion of the GDNF gene results in renal dysgenesis and abnormal development of the enteric nervous system. GDNF mRNA is expressed in a complex temporospatial pattern in the central nervous system and the periphery, consistent with these observations. To elucidate mechanisms regulating the pattern of expression of GDNF, the promoter for the human gene has been cloned and characterized. The promoter is highly GC rich, and lacks canonical CCAT-box and TATA-box motifs. It contains more than twelve binding sites for known transcription factors. These cis-elements exhibit the potential to interact with factors regulating constitutive expression (Sp1) and developmental expression (bHLH). Moreover, the promoter contains sites for binding transcription factors which respond to environmental signals, including CREB, AP2, Zif/268, NFkB, and MRE-BP. Combinatorial actions of these transcription factors account for the extraordinarily complex expression patterns of the GDNF gene.

Description

cDNA FOR HUMAN GDNF AND PROMOTER THEREFOR WHICH ALLOWS REGULATED AND CONSTITUTIVE EXPRESSION

BACKGROUND OF THE INVENTION

Glial cell line-derived neurotrophic factor (GDNF), a recently discovered growth and trophic (survival) factor, acts on a remarkable array of target cells throughout the body. The molecule, distantly related to TGF-b, is the most potent known survival factor for substantia nigra dopaminergic neurons, which degenerate in Parkinson's disease (1). Moreover, it is also the most potent survival factor for spinal motorneurons which degenerate in amyotrophic lateral sclerosis (Lou Gehrig 's disease) (2); the factor also supports the survival of peripheral sensory and autonomic neurons (3). Finally, GDNF also acts as a growth factor, enhancing the development and differentiation of Purkinje cells (4). However, actions are not restricted to the nervous system.

Targeted deletion of the GDNF gene results in pleiomorphic deficits in mice. Such animals die shortly after birth with renal dysgenesis and abnormal development of the gastrointestinal tract, associated with severe deficits in the enteric nervous system. Consequently, GDNF apparently acts on somatic as well as neural cells and tissues.

Consistent with its widespread effects, GDNF exhibits an extensive and complex temporospatial pattern of expression. In the central nervous system (CNS) of the neonatal rat, GDNF mRNA has been detected in the cerebral cortex, hippocampus, striatum, cerebellum, olfactory bulb and spinal cord [5,6,7]. High levels of this messenger are also present in the periphery, notably in the skin, kidney, stomach, muscle and reproductive tract on postnatal day 1 [8] . Despite widespread spatial distribution, the GDNF gene is subject to precisely regulated temporal expression. Message is detectable as early as embryonic day 11.5 (E 11.5) in both the CNS and periphery [7]. Expression is apparently regulated by cell-specific factors, since the timing and extent of expression varies markedly by region within the CNS, and among tissues in the periphery. Although few studies have focused on expression in the adult, constitutive levels of GDNF gene expression appear to be maintained throughout life, particularly in the CNS [8,9].

While expression of the GDNF gene is tightly regulated, it is also markedly influenced by environmental perturbations. For example, sciatic nerve transection dramatically increases mRNA levels within six hours. Elevated expression is maintained for more than two weeks after injury [10]. Expression is also increased in the brain by injection with the excitotoxin kainate, suggesting that GDNF may protect against the pathological effects of associated seizures [11]. PCT Published Application WO 93/06116 discloses various characteristics of this factor, as well as methods of isolating and purifying it from glioblastoma cells.

The molecular mechanisms underlying the complex temporospatial pattern of GDNF gene expression have yet to be elucidated. The mechanisms precisely control gene expression during development, yet allow rapid increases in expression in response to injury. There is thus a need to elucidate the molecular structure and regulation of expression of the GDNF gene and its promoter in order to provide therapeutic methods for the treatment of the various disease states where the gene products are insufficiently or aberrantly expressed.

SUMMARY OF THE INVENTION

In its broadest aspect, the present invention relates to the 5' regulatory (promoter) region of the gene for human glial cell line-derived neurotrophic factor (GDNF) which contains putative cis-elements sufficiently numerous and diverse to account for the complex temporospatial pattern of expression, and for rapid upregulation by environmental stimuli. More particularly, this invention concerns the GDNF promoter, which is regulated by a chimeric promoter containing a proximal section which ensures consistent low level GDNF expression in many cell types, and a distal section designed to alter transcription during development and in response to environmental stimuli.

In a further aspect of the invention, the present invention provides a chimeric regulatory promoter region of the cDNA for GDNF, which promoter ensures consistent low level expression of GDNF in cells, particularly neural cells, and also regulates transcription during development and in response to environmental stimuli.

In a further embodiment of the invention, the nucleic acids of the present invention, containing the hGDNF promoter and regulatory regions or derivatives or analogs thereof, are operatively linked as an expression control sequence to a gene encoding a protein to be expressed which may be introduced into an appropriate host. The invention accordingly extends to unicellular hosts transformed with the vector comprising a DNA sequence encoding the present hGDNF promoter, and more particularly, the complete DNA sequence determined from the sequences set forth above and in SEQ ID NO: 1.

This invention further provides a vector, which comprises the nucleic acids of the invention that regulate and promote GDNF, and a bacterial, insect, or a mammalian expression vector, which comprises the nucleic acid molecules of the invention, operatively linked with nucleic acids encoding GDNF. Accordingly, this invention further concerns a host cell, such as a bacterial cell, yeast cell, insect cell, or a mammalian cell, transfected or transformed with an appropriate expression vector, and correspondingly, to the use of the above-mentioned constructs in the expression of GDNF. Preferably, the encoded GDNF is mammalian GDNF. Most preferably, the encoded GDNF is human GDNF.

Further, the present invention relates to a vector, which comprises the nucleic acids of the invention that regulate and promote GDNF, and a bacterial, insect, or a mammalian expression vector, which comprises the nucleic acid molecules of the invention, operatively linked with nucleic acids encoding a non-GDNF protein, wherein said non-GDNF protein is thereby expressed and regulated similar to GDNF. Accordingly, this invention further concerns a host cell, such as a bacterial cell, yeast cell, insect cell, or a mammalian cell, transfected or transformed with an appropriate expression vector, an correspondingly, to the use of the above- mentioned constructs in the expression and regulation of a non-GDNF protein.

The concept of the inducible/repressible promoter contemplates that specific factors exist for correspondingly specific sequences within the promoter, which lead to induction or repression in response to major signaling cascades, developmental cues, metal concentrations, tissue-specific information, and the like, as described herein. Accordingly, the exact nature and level of the corresponding factors, will understandably vary in distinct cell types and can be accordingly varied by administration or addition of any such factors so as to achieve binding and activity specificity. It is this specificity and the direct involvement of the factors leading to gene activation, that offers the promise of highly regulated GDNF expression.

The present invention naturally contemplates several means for preparation of the promoter, including as illustrated herein known recombinant and PCR techniques, and the invention is accordingly intended to cover such synthetic preparations within its scope. The isolation of the nucleic acid sequences disclosed herein facilitates the reproduction of the promoter, and derivatives or analogs thereof, by such recombinant techniques, and accordingly, the invention extends to expression vectors containing the disclosed DNA sequences, and derivatives or analogs thereof, for expression in host systems by recombinant DNA techniques, and to the resulting transformed hosts.

The invention includes an assay system for screening of potential compounds effective to modulate transcriptional activity of target GDNF-expressing cells by interrupting or potentiating the activity of the GDNF promoter. In one instance, the test compound, or an extract containing the compound, could be administered to a cellular sample containing the GDNF promoter operatively linked to GDNF-encoding sequences to determine the compound's effect upon the activity of the promoter, and thereby on expression of GDNF. by comparison with a control. In a further instance the test compound, or an extract containing the compound, could be administered to a cellular sample containing the GDNF promoter operatively linked to sequences encoding a reporter gene, to determine the compound's effect upon the activity of the promoter, and thereby on expression of or such reporter gene, by comparison with a control.

The assay system could more importantly be adapted to identify factors that are capable of binding to the regulatory regions of the promoter e.g. transcription factors or proteins, thereby inhibiting or potentiating transcriptional activity. Such drugs might be used therapeutically to modulate the levels of expression from the GDNF promoter.

Accordingly, it is a principal object of the present invention to provide nucleic acid constituting an isolated GDNF promoter containing a proximal section which ensures consistent low level expression in many cell types, and a distal section designed to alter transcription during development and in response to environmental stimuli.

In a particular embodiment, the nucleic acid has the sequence of SEQ ID NO: 1 ; a sequence complementary to SEQ ID NO: 1 ; or a homologous sequence which is substantially similar to SEQ ID NO:l .

A further object of the present invention is to provide a vector for the expression of a protein in a host, wherein such expression is controlled by an isolated GDNF promoter containing a proximal section which ensures consistent low level expression in many cell types, and a distal section designed to alter transcription during development and in response to environmental stimuli.

Another object of the invention is to provide a host transformed with the vector.

A still further object of the invention is to provide an isolated nucleic acid including the human GDNF promoter sequence operably positioned in proper reading frame with at least one of human, mouse and rat GDNF-encoding nucleic acid sequence. In one embodiment, the isolated nucleic acid has the sequence of: a) SEQ ID NO: 1 ; b) a sequence which is substantially homologous to SEQ ID NO: 1 ; or c) a fragment of any of (a) or (b) which retains the biological activity of SEQ ID NO: 1; or d ) nucleic acid sequences that hybridize to any of the foregoing nucleic acid sequences under standard hybridization conditions.

Another object of the invention is to provide the isolated nucleic acid molecules attached to detectable labels.

In specific embodiments, the detectable label is an enzyme, is fluorescent or radioactive.

A further object of the invention is to provide a method for detecting proteins which regulate the present promoter sequence, including the steps of: a) incubating a sample in which a regulator protein may be present with the DNA sequence of SEQ ID NO: 1 ; b) isolating any protein bound to the DNA sequences of step (a); and c) correlating the binding of the protein to the ability of the protein to regulate the promoter.

Further, the present invention relates to a method for treating a mammalian patient in need of such therapy to modulate levels of GDNF therein by controlling the expression of the GDNF. Such modulation may be effected by the introduction of the nucleotides in question by gene therapy into the cells of the patient or into host cells in order to control the consequences of abnormal or altered levels of GDNF. Abnormal or altered levels of GDNF may also be corrected by implanting cells that secrete GDNF into the body of the mammalian patient. Still further, the invention contemplates the use of the nucleic acid sequences of the present invention for the purposes of diagnosing patients where an abnormal or altered level of GDNF would contribute deleteriously to their overall health. Such conditions include, but are not limited to, neural degeneration in Parkinson's disease, Lou Gehrig 's disease, seizures, and the like.

Accordingly, it is a principal object of the present invention to provide genetic constructs for use in genetic therapeutic and diagnostic protocols.

It is a further object of the present invention to provide a method for the treatment of mammals wherein the levels of GDNF are abnormal or altered in order to obviate the consequences of such abnormal or altered levels.

Other objects and advantages will become apparent to those skilled in the art from a review of the following description which proceeds with reference to the following illustrative drawings.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1A is a summary of the exon/intron structure of the hGDNF gene. Exon sizes (in bp), exon/intron junction sequences, and approximate intron sizes (in Kb) are indicated.

Figure IB is a schematic representation of the hGDNF gene structure, showing exons and introns.

Figure 2 is the DNA sequence of the 5 ' flanking sequence and Exon 1. Putative cis-elements are indicated by icons above the corresponding sequence. The start site determined for the human GDNF gene is indicated by a + 1. All numbering is relative to this + 1 position. Figure 3 is a sequence comparison of the human and rat proximal promoter region and Exon 1. For reference, the cis-elements identified in Figure 2 appear above the human sequence, indicate base identity between the species. * indicate spaces inserted for maximal alignment.

Figure 4 is the DNA and amino acid sequence of human GDNF.

Figure 5 is the DNA sequence for human GDNF. including the 5' promoter.

Figure 6A is a schematic representation of nested oligonucleotides, Exon 1A and Exon IB, used in SI nuclease analysis.

Figure 6B displays the results of SI nuclease protection of T98G glioblastoma cell RNA using nested oligonucleotides Exon 1A and Exon IB. The ohgonucleotide Exon 1A is fully protected under the conditions, while ohgonucleotide Exon IB is not protected.

Figure 6C displays the results of primer extension analysis, wherein unlabeled ohgonucleotide Exon 1A was hybridized to T98G RNA and extended using MMLV reverse transcriptase. Three individual reactions contained radiolabeled dGTP, dATP and dCTP, shown in lanes labeled *G, *A and *C, respectively. A prominent extended product is seen in each of the three reaction lanes (indicated by a diamond).

Figure 7A displays the results of an Electrophoretic Mobility Shift Assay (EMSA) using radiolabeled ohgonucleotide corresponding to the putative Zif/268 site sequence, mixed with nuclear extract from cultured primary adult cortical astrocytes. Lane 1 shows binding of an abundant DNA-binding protein to the Zif/268 ohgonucleotide in untreated astrocytes. In lane 2, a significant decrease in binding is seen when astrocytes were treated for two hours with 25 mM KC1 before harvesting for nuclear extract. Figure 7B shows a similar EMSA assay using Zif/268 ohgonucleotide with extracts from T98G (lanes 1-5), NRK (lanes 6-7) and G8 cells (lanes 8-9). Results after pretreatment of cells with KC1 are indicated by a + sign and found in lanes 4 and 5. Results after pretreatment of the extract with 100 ng of cold Zif/268 ohgonucleotide competitor are shown in lanes 3, 5, 7 and 9.

Figure 7C shows the results of an EMSA assay using a labeled ohgonucleotide corresponding to the MNF binding site, or C-box, with extracts from T98G (lane 1), NRK (lane 2) and G8 cells (lane 3). The arrow indicates the presence of a shifted band, showing a transactivator recognizing this cis element, in G8 skeletal muscle cells.

Figure 7D shows results of an EMSA assay using a labeled ohgonucleotide corresponding to the novel GPR inverted repeat with extracts from T98G (lane 1), NRK (lane 2) and G8 (lane 3) cells. The presence of shifted bands in all three cell lines is indicated.

Figure 8 is a sequence comparison of the 5 ' ends of the mouse and human GDNF genes.

Figure 9 is a restriction map of a 7kb Xba/Xba subclone of a genomic phase clone isolated from the λ Fix II human genomic library . Distances in base pairs from the 5' most Xba site are indicated in parentheses.

DETAILED DESCRIPTION OF THE INVENTION

In its primary aspect, the present invention concerns the identification of the 5 ' signal responsive constitutive promoter for GDNF. In one aspect of the invention, the GDNF promoter is specific for human GDNF. The present invention, therefore provides a human GDNF promoter that regulates the expression of human GDNF. In another aspect, the present invention provides a GDNF promoter that regulates the expression of an operatively associated coding sequence in a GDNF-like manner.

In a particular embodiment, the present invention relates to all derivatives and analogs of the herein disclosed GDNF promoter.

As stated above, this invention relates to a recombinant DNA molecule or cloned nucleic acid, or a degenerate variant or allele thereof, which comprises a GDNF promoter, or a fragment thereof, preferably a nucleic acid molecule, in particular a recombinant DNA molecule, comprising the GDNF promoter, and has a nucleotide sequence or is complementary to a DNA sequence shown in FIGURE 2 (SEQ ID NO: l).

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g. , Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R. M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E. , ed. (1994)]; "Ohgonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

Therefore, if appearing herein, the following terms shall have the definitions set out below.

The terms "GDNF, " "glial cell line-derived neurotrophic factor," and any variants not specifically listed, may be used herein interchangeably, and as used throughout the present application and claims refer to proteinaceous material including single or multiple proteins, and extends to those proteins having the amino acid sequence data described herein and presented in FIGURE 4 (SEQ ID NO: 3), and the profile of activities set forth herein. Accordingly, proteins displaying substantially equivalent or altered activity are likewise contemplated. These modifications may be deliberate, for example, such as modifications obtained through site-directed mutagenesis, or may be accidental, such as those obtained through mutations in hosts that are producers of the complex or its named subunits. Also, the terms "GDNF, " and "glial cell line-derived neurotrophic factor(s)" are intended to include within their scope proteins specifically recited herein as well as all substantially homologous analogs and allelic variations.

The amino acid residues described herein are preferred to be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L- amino acid residue, as long as the desired functional property of immunoglobul in- binding is retained by the polypeptide. NH₂ refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J. Biol. Chem. , 243:3552-59 (1969), abbreviations for amino acid residues are shown in the following Table of Correspondence:

TABLE OF CORRESPONDENCE

SYMBOL AMINO ACID

1 -Letter 3 -Letter

Y Tyr tyrosine

G Gly glycine

F Phe phenylalanine

M Met methionine

A Ala alanine

S Ser serine

I He isoleucine

L Leu leucine

T Thr threonine

V Val valine

P Pro proline

K Lys lysine H His histidine

Q Gin glutamine

E Glu glutamic acid

W Trp tryptophan

R Arg arginine

D Asp aspartic acid

N Asn asparagine

C Cys cysteine

It should be noted that all amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino- terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues. The above Table is presented to correlate the three-letter and one-letter notations which may appear alternately herein.

A "replicon" is any genetic element (e.g. , plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e. , capable of replication under its own control.

A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.

A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double- stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g. , restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5 ' to 3 ' direction along the nontranscribed strand of DNA (i.e. , the strand having a sequence homologous to the mRNA).

An "origin of replication" refers to those DNA sequences that participate in DNA synthesis.

A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5 ' (amino) terminus and a translation stop codon at the 3' (carboxy 1) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.

Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3 ' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5 ' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.

A "signal sequence" can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct the polypeptide to the cell surface or secrete the polypeptide into the media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.

The term "ohgonucleotide, " as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides (most often deoxyribonucleotides), preferably more than three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the ohgonucleotide.

The term "primer" as used herein refers to an ohgonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e. , in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the ohgonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.

The primers herein are selected to be "substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the strand to hybridize therewith and thereby form the template for the synthesis of the extension product.

As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.

A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations. Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80% , and most preferably at least about 90 or 95 %) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.

It should be appreciated that also within the scope of the present invention are GDNF promoter regulated DNA sequences encoding GDNF which code for a GDNF having the same amino acid sequence as SEQ ID NO: 3, but which are degenerate to SEQ ID NO:3. By "degenerate to" is meant that a different three- letter codon is used to specify a particular amino acid. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid:

Phenylalanine (Phe or F) UUU or UUC

Leucine (Leu or L) UUA or UUG or CUU or CUC or CUA or CUG

Isoleucine (He or I) AUU or AUC or AUA Methionine (Met or M) AUG

Valine (Val or V) GUU or GUC of GUA or GUG

Serine (Ser or S) UCU or UCC or UCA or UCG or AGU or AGC

Proline (Pro or P) CCU or CCC or CCA or CCG

Threonine (Thr or T) ACU or ACC or ACA or ACG Alanine (Ala or A) GCU or GCG or GCA or GCG

Tyrosine (Tyr or Y) UAU or UAC

Histidine (His or H) CAU or CAC

Glutamine (Gin or Q) CAA or CAG

Asparagine (Asn or N) AAU or AAC Lysine (Lys or K) AAA or AAG

Aspartic Acid (Asp or D) GAU or GAC

Glutamic Acid (Glu or E) GAA or GAG

Cysteine (Cys or C) UGU or UGC Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA or AGG

Glycine (Gly or G) GGU or GGC or GGA or GGG

Tryptophan (Trp or W) UGG

Termination codon UAA (ochre) or UAG (amber) or UGA (opal)

It should be understood that the codons specified above are for RNA sequences. The corresponding codons for DNA have a T substituted for U.

Mutations can be made in SEQ ID NO: 2 such that a particular codon is changed to a codon which codes for a different amino acid. Such a mutation is generally made by making the fewest nucleotide changes possible. A substitution mutation of this sort can be made to change an amino acid in the resulting protein in a non-conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (i.e. , by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping). Such a conservative change generally leads to less change in the structure and function of the resulting protein. A non-conservative change is more likely to alter the structure, activity or function of the resulting protein. The present invention should be considered to include seguences containing conservative changes which do not significantly alter the activity or binding characteristics of the resulting protein.

Amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property. For example, a Cys may be introduced a potential site for disulfide bridges with another Cys. A His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro may be introduced because of its particularly planar structure, which induces β -turns in the protein's structure.

Two amino acid sequences are "substantially homologous" when at least about 70% of the amino acid residues (preferably at least about 80% , and most preferably at least about 90 or 95 %) are identical, or represent conservative substitutions.

A "heterologous" region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g. , a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.

The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to prevent, and preferably reduce by at least about 15 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, a clinically significant symptom of the disease or condition under treatment in the host mammal. Alternatively, a therapeutically effective amount s sufficient to cause improvement in a clinically significant condition in the host mammal.

- 1 ! A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g. , ATG) in front of the DNA sequence to be expressed and maintaining the correct reading frame to permit expression of the DNA sequence under the control of the expression control sequence and production of the desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front of the gene.

The term "standard hybridization conditions" refers to salt and temperature conditions substantially equivalent to 5 x SSC and 65 °C for both hybridization and wash. However, one skilled in the art will appreciate that such "standard hybridization conditions" are dependent on particular conditions including the concentration of sodium and magnesium in the buffer, nucleotide sequence length and concentration, percent mismatch, percent formamide, and the like. Also important in the determination of "standard hybridization conditions" is whether the two sequences hybridizing are RNA-RNA, DNA-DNA or RNA-DNA. Such standard hybridization conditions are easily determined by one skilled in the art according to well known formulae, wherein hybridization is typically 10-20°C below the predicted or determined T_m with washes of higher stringency, if desired.

The term "corresponding to" is used herein to refer to similar or homologous sequences, whether the extract position is identical or different from the molecule to which the similarity or homology is measured. The term "corresponding to" refers to the sequence similarity in nucleotide sequences in the absence of gaps in the nucleotide sequence.

The production and use of derivatives and analogs related to the hGDNF promoter of the present invention are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of controlling the transcription of a coding sequence optatively linked to the derivative or analog. For example, hGDNF promoter derivatives can be made by altering the nucleic acid sequences of the present invention by substitution, additions or deletion that provide for functionally equivalent molecules .

The nucleic acids of the present invention, and derivatives or analogs thereof, can be produced by various methods known in the art. The nucleic acid can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. Alternatively, the nucleic acids can be prepared de novo using a nucleotide synthesizer for example.

The possibilities both diagnostic and therapeutic that are raised by the existence of the GDNF, derive from the fact that the factors appear to participate in direct and causal protein-protein interaction related to the survival of substantia nigra dopaminergic neurons, spinal motoneurons, peripheral sensory and autonomic neurons, and also acts as a growth factor, enhancing the development and differentiation of Purkinje cells. Further, GDNF apparently acts on somatic as well as neural cells and tissues, since the deletion of the GDNF gene results in pleiomorphic deficits resulting in renal dysgenesis and abnormal development of the gastrointestinal tract, associated with severe deficits in the enteric nervous system. As suggested earlier and elaborated further on herein, the present invention contemplates therapeutic intervention in the cascade of reactions in which the GDNF is implicated, to modulate the activity initiated by the GDNF.

Thus, in instances where it is desired to reduce or inhibit the effects resulting from GDNF, an appropriate inhibitor of the GDNF promoter could be introduced to block the production of the GDNF. Correspondingly, in instances where insufficient GDNF is present, such could be remedied by the introduction of appropriate activators if the GDNF promoter, or, alternatively, of additional vectors which would promote the expression of the GDNF. or its fragments. The promoter and coding sequence for GDNF is a necessary starting point for the detection of GDNF sequence changes that would identify individuals at risk for diseases involving neural degeneration, such as seizures, Parkinson's disease, Lou Gehrig 's disease etc. , and various developmental defects resultant from the decreased levels of GDNF during the prenatal and neonatal stage. Since the promoter region for GDNF is responsible for varying levels of GDNF, it is likely that the mutations in this region will result in conditions affecting such levels, resulting in varying levels of disease. Accordingly, the analysis of this promoter region can reveal the presence of potential patients. Diagnostic tests by DNA analysis are more efficient and accurate than testing by enzymatic/biochemical assays. Less blood is required and the results are more quickly available. Such testing can be performed as a routine operation in any laboratory that performs molecular genetic diagnosis.

The nucleic acids of the instant invention can thus be used to detect defects associated with defects in the GDNF DNA that result in diseased phenotypes. For example, nucleic acid probes (e.g. , in Northern analysis or RT-PCR analysis) can be used to determine whether a particular nervous system degeneration is due to lack of or altered expression of GDNF mRNA, or expression of non-functional GDNF mRNA. Moreover, the nucleic acid-based diagnostic techniques of the invention can be used in conjunction with other techniques to further develop a molecular understanding of diseased phenotypes.

The nucleotide sequence containing the promoter of the present invention, or a derivative or analog thereof, can be inserted directly into an appropriate expression vector, i.e. , a vector which requires insertion of a promoter for the transcription and translation of a protein-coding sequence. The protein-encoding sequence may encode, for example, GDNF, any other neurotrophic factor such as brain-derived neurotrophic factor (BDNF) or nerve growth factor (NGF), or a reporter protein or enzyme such as B-galactosidase (lacZ), chloramphenical acetyl transferase (CAT), or green fluorescent protein (GFP). Thus, the nucleic acid containing the promoter of the present invention can be operationally associated with a coding sequence in an expression vector of the invention. An expression vector also can include a replication origin. Any additional transcriptional and translational signals can be provided on a recombinant expression vector, or they may be supplied by the native gene encoding the protein of interest. The coding sequence can then be expressed in a cell, including a mammalian cell, more particularly a neural cell, under appropriate expression control for example.

In the example below, CAT reporter constructs were generated using the vector PC AT basis. NGDNF promoter sequences to -520 and -220 (relative to the start of transcription) were subcloned into PCAT basic in frame to a CAT open reading frame to generate 520 CAT and 220 CAT respectfully.

Vectors may be introduced into the desired host cells, by methods known in the art, e.g. , transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g. , Wu et al., 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al. , Canadian Patent Application No. 2,012,311 , filed March 15, 1990).

Labels

Nucleic acids including probes that can hybridize with the hGDNF promoter and derivatives thereof, as well as assorted reagents and markers employed to monitor the TRANSCRIPTIONAL control of the GDNF, reporter gene, etc. under the control of the GDNF promoter may be appropriately labeled. Suitable labels include enzymes, fluorophores (e.g. , fluorescence isothiocyanate (FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated lanthanide series salts, especially Eu 3 + , to name a few fluorophores), chromophores, radioisotopes, chelating agents, dyes, colloidal gold, latex particles, ligands {e.g. , biotin), and chemiluminescent agents. In the instance where a radioactive label, such as the isotopes ³H, ¹⁴C, ³²P, ³⁵S, ³⁶C1, ⁵¹Cr, ⁵⁷Co, ⁵⁸Co, ⁵⁹Fe, ^9ϋY, ¹²⁵I, ¹³T, and ¹⁸⁶Re are used, known currently available counting procedures may be utilized. In the instance where the label is an enzyme, detection may be accomplished by any of the presently utilized calorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.

Direct labels are one example of labels which can be used according to the present invention. A direct label has been defined as an entity, which in its natural state, is readily visible, either to the naked eye, or with the aid of an optical filter and/or applied stimulation, e.g. U.V. light to promote fluorescence. Among examples of colored labels, which can be used according to the present invention, include metallic sol particles, for example, gold sol particles such as those described by Leuvering (U.S. Patent 4,313,734); dye sole particles such as described by Gribnau et al. (U.S. Patent 4,373,932) and May et al. (WO 88/08534); dyed latex such as described by May, supra, Snyder (EP-A 0 280 559 and 0 281 327); or dyes encapsulated in liposomes as described by Campbell et al. (U.S. Patent 4,703,017). Other direct labels include a radionucleotide, a fluorescent moiety such as a green fluorescent protein or a modified green fluorescent protein as described in US Patent 5,625,048, Issued 4/29/97 and WO 97/26333 Published 7/24/97 hereby incorporated by reference in their entireties, indirect labels comprising enzymes can also be used according to the present invention. Various types of enzyme linked immunoassays are well known in the art, for example, luciferase, alkaline phosphatase and horseradish peroxidase, lysozyme, glucose-6-phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have been discussed in detail by Eva Engvall in Enzyme Immunoassay ELISA and EMIT in Methods in Enzymology, 70. 419-439, 1980 and in U.S. Patent 4,857,453.

Suitable enzymes include, but are not limited to, alkaline phosphatase and horseradish peroxidase. Other labels for use in the invention include magnetic beads or magnetic resonance imaging labels.

Proteins can be labeled by metabolic labeling. Metabolic labeling occurs during in vitro incubation of the cells that express the protein in the presence of culture medium supplemented with a metabolic label, such as [³⁵S]-methionine or [³²P]- orthophosphate. In addition to metabolic (or biosynthetic) labeling with [³⁵S]- methionine, the invention further contemplates labeling with [¹⁴C]-amino acids and [³H]-amino acids (with the tritium substituted at non-labile positions). In addition a protein can be labeled with a FLAG-tag, an eight amino acid epitope [Pricket, et al., Biotechniques, 7:580-589 (1989)] as exemplified herein.

Gene Therapy and Trans genie Vectors Further, the instant invention contemplates the design of therapeutic protocols, for correction of GDNF deficiency. These protocols can directly involve the GDNF promoter and GDNF coding sequences, as in gene therapy trials or in the use of reagents that can modify gene expression.

In a further aspect, recombinant cells that have been transformed with the GDNF promoter and coding sequences and that express properly regulated levels thereof can be transplanted in a subject in need of GDNF. Preferably, autologous cells transformed with the GDNF promoter and coding sequences are transplanted to avoid rejection; alternatively, technology is available to shield non-autologous cells that produce soluble factors within a polymer matrix that prevents immune recognition and rejection.

The GDNF promoter and coding sequences can be introduced into human nerve cells or surrounding cells to develop gene therapy for neural degeneration. Such therapy would be expected to prevent or minimize neural degeneration. In one embodiment, a gene encoding a GDNF is introduced in vivo in a viral vector. Such vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Thus, nerve cells can be specifically targeted. Examples of particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector (Kaplitt et al. , 1991, Molec. Cell. Neurosci. 2: 320-330), an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. (1992, J. Clin. Invest. 90: 626-630), and a defective adeno-associated virus vector (Samulski et al. , 1987, J. Virol. 61 : 3096-3101 ; Samulski et al. , 1989, J. Virol. 63: 3822-3828).

In another embodiment, the GDNF gene can be introduced in a retroviral vector, e.g. , as described in Anderson et al. , U.S. Patent No. 5,399,346; Mann et al., 1983, Cell 33: 153; Temin et al. , U.S. Patent No. 4,650,764; Temin et al. , U.S. Patent No. 4,980,289; Markowitz et al. , 1988, J. Virol. 62: 1120; Temin et al. , U.S. Patent No. 5,124,263; International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al. ; and Kuo et al. , 1993, Blood 82: 845.

Alternatively, the vector can be introduced in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker

(Feigner, et al. , 1987 Proc. Natl. Acad. Sci. U.S.A. 84: 7413-7417; see Mackey, et al. , 1988, Proc. Natl. Acad. Sci. U.S.A. 85: 8027-8031)). The uses of cationic lipids may promote encapsulation of negatively charged cell membranes (Feigner and Ringold, 1989, Science 337: 387-388. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as pancreas, liver, kidney and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting (see Mackey et al. , 1988, supra). Targeted peptides e.g. , hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.

It is also possible to introduce the vector in vivo as a naked DNA plasmid. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g. , transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wu et al., 1992, J. Biol. Chem. 267: 963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15,, 1990).

The present invention further provides vectors containing a GDNF promoter, or a derivative or analog thereof, of the present invention upstream of one or more coding sequences. The tissue and cell-type specificity of the GDNF promoter ensures vector gene expression in only the desired tissues and cells. The expression regulation capability of the GDNF promoter ensures vector gene expression under the desired conditions and in response to appropriate modulators of expression.

In one embodiment, a gene encoding a marker protein under the control of the GDNF promoter of the present invention, is introduced in vivo in a viral vector. Such vectors include an attenuated or defective DNA virus, such as but not limited to herpes simplex virus (HSV), papilloma virus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. Defective viruses, which entirely or almost entirely lack viral genes, are preferred. Defective virus is not infective after introduction into a cell. Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells. Thus, any designated tissue or body part can be specifically targeted (e.g. , the heart). Examples of particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1) vector [Kaplitt et al. , Molec. Cell. Neurosci. 2:320-330 (1991)], an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. [J. Clin. Invest. 90:626-630 (1992)], and a defective adeno-associated virus vector [Samulski et al. , J. Virol. 61:3096-3101 (1987); Samulski et al. , J. Virol. 63:3822-3828 (1989)]. Such administration can be used for experimental or diagnostic purposes. For example, a fluorescent or colored protein can be placed into a neural cell. Alternatively, the coding sequence can encode a therapeutic protein to be used in gene therapy.

Preferably, for ex vivo administration, an appropriate immunosuppressive treatment is employed in conjunction with the viral vector, e.g. , adenovirus vector, to avoid immuno-deactivation of the viral vector and transfected cells. For example, immunosuppressive cytokines, such as interleukin-12 (IL-12), interferon-γ (IFN-γ), or anti-CD4 antibody, can be administered to block humoral or cellular immune responses to the viral vectors [see, e.g. , Wilson, Nature Medicine (1995)]. In addition, it is advantageous to employ a viral vector that is engineered to express a minimal number of antigens.

In another embodiment the gene can be introduced in a retroviral vector, e.g. , as described in Anderson et al. , U.S. Patent No. 5,399,346; Mann et al. , 1983, Cell 33: 153; Temin et al. , U.S. Patent No. 4,650,764; Temin et al. , U.S. Patent No. 4,980,289; Markowitz et al. , 1988, J. Virol. 62: 1120; Temin et al. , U.S. Patent No. 5,124,263; International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al. ; and Kuo et al., 1993, Blood 82:845.

Targeted gene delivery is described in International Patent Publication WO 95/28494, published October 1995. Alternatively, the vector can be introduced in vivo by lipofection. For the past decade, there has been increasing use of liposomes for encapsulation and transfection of nucleic acids in vitro. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker [Feigner, et. al., Proc. Natl. Acad. Sci. U.S.A. 84:7413-7417 (1987); see Mackey, et al. , Proc. Natl. Acad. Sci. U.S.A. 85:8027-8031 (1988)]. The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes [Feigner and Ringold, Science 337:387-388 (1989)]. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting [see Mackey, et. al. , supra]. Targeted peptides, e.g. , hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules could be coupled to liposomes chemically.

It is also possible to introduce the vector in vivo as a naked DNA plasmid. Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g. , transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter [see, e.g. , Wu et al., J. Biol. Chem. 267:963-967 (1992); Wu and Wu, J. Biol. Chem. 263: 14621-14624 (1988); Hartmut et al. , Canadian Patent Application No. 2,012,311 , filed March 15, 1990] .

In a preferred embodiment of the present invention, a vector as described above employs a GDNF promoter operably associated with a the sequence for a marker protein inserted in the vector. That is, a specific expression vector of the present invention can be used in diagnostic procedures. Such an expression vector is also useful for regulating the expression of a therapeutic gene.

In one embodiment, the present invention contemplates constitutive expression of the marker or therapeutic gene, even if at low levels. Various therapeutic heterologous genes can be inserted in a gene therapy vector of the invention such as but not limited to adenosine deaminase (ADA) to treat severe combined immunodeficiency (SCID); marker genes or ]lymphokine genes into tumor infiltrating (TIL) T cells [Kasis et al., Proc. Natl. Acad. Sci. U.S.A. 87:473 (1990); Culver et al. , ibid. 88:3155 (1991)]; genes for clotting factors such as Factor VIII and Factor IX for treating hemophilia [Dwarki et al. Proc. Natl. Acad. Sci. USA, 92: 1023-1027 (19950); Thompson, Thromb. and Haemostatis , 66: 119-122 (1991)]; and various other well known therapeutic genes such as, but not limited to, β- globin, dystrophin, insulin, erythropoietin, growth hormone, glucocerebrosidase, β- glucuronidase, -antitrypsin, phenylalanine hydroxylase, tyrosine hydroxylase, ornithine transcarbamylase, apolipoproteins, and the like. In general, see U.S. Patent No. 5,399,346 to Anderson et al.

In another aspect, the present invention provides for regulated expression of the heterologous gene in concert with expression of proteins under control of the GDNF promoter. Concerted control of such heterologous genes may be particularly useful in the context of treatment for proliferative disorders, such as tumors and cancers, when the heterologous gene encodes a targeting marker or immunomodulatory cytokine that enhances targeting of the tumor cell by host immune system mechanisms. Examples of such heterologous genes for immunomodulatory (or immuno-effector) molecules include, but are not limited to, interferon-α, interferon-γ, interferon-β, interferon-ω, interferon-τ, tumor necrosis factor-α, tumor necrosis factor-β, inter leukin-2, interleukin-7, inter leukin- 12, inter leukin- 15, B7-1 T cell co-stimulatory molecule, B7-2 T cell co-stimulatory molecule, immune cell adhesion molecule (ICAM) -I T cell co-stimulatory molecule, granulocyte colony stimulatory factor, granulocyte-macrophage colony stimulatory factor, and combinations thereof.

In a further embodiment, the present invention provides for co-expression of two proteins under control of the GDNF promoter. In one embodiment, these elements are provided on separate vectors, e.g. , as exemplified infra. These elements may be provided in a single expression vector.

Screening For Modulators of the GDNF Promoter

The present invention contemplates screens for a modulator of GDNF expression, in particular, directly or indirectly through the GDNF promoter. In one such embodiment, an expression vector containing a GDNF promoter of the present invention, or a derivative or analog thereof, upstream of a coding sequence, such that such coding sequence is under the control of the promoter, is placed into a cell in the presence of at least one agent suspected of exhibiting GDNF modulator activity. The cell is preferably a mammalian cell and most preferably a human neuronal or muscle cell. The amount of expression (transcription or translation) of the coding sequence is determined and any such agent is identified as a modulator when the amount of expression of the coding sequence in the presence of such agent is different than in its absence. The vectors may be introduced by any of the methods described above.

In a related embodiment the coding sequence is transcribed and expressed and the step of determining the amount of transcription of the coding sequence is performed by determining the amount of expression of the marker protein. In this case, the coding sequence can encode a marker protein such as green fluorescent protein or luciferase or B-galactosidase. In a preferred embodiment of this type the coding sequence encodes CAT. When the amount of transcription of the coding sequence in the presence of the modulator is greater than in its absence, the modulator is identified as an agonist or activator of GDNF expression whereas when the amount of transcription of the coding sequence in the presence of the modulator is less than in its absence, the modulator is identified as an antagonist or inhibitor of GDNF expression. As any person having skill in the art would recognize, such determinations as these and those below could require some form of statistical analysis, which is well within the skill in the art.

The present invention also provides a method of identifying a transcription factor that can modulate the GDNF promoter. In one such embodiment, an expression vector containing a GDNF promoter (or derivative or analog thereof) upstream of a coding sequence, such that the coding sequence is under the control of the GDNF promoter, is placed into a cell in the presence of the potential transcription factor. The cell is cultured in an appropriate cell culture medium under conditions that require the presence of the transcription factor for transcription of the coding sequence by the cell. The transcription of the coding sequence is detected and a potential transcription factor is identified as a transcription factor that modulates the GDNF promoter. As above, the transcription of the coding sequence can also be monitored by detecting the expression of the protein encoded by the coding sequence.

The present invention further provides methods of identifying a binding partner for the cis elements of the present invention. One such embodiment includes contacting a candidate binding partner with the oligonucleotides corresponding to any such cis-element and then detecting the binding. A binding partner is identified when the binding of the candidate binding partner with the cis-element ohgonucleotide is detected. One preferred embodiment of this type utilizes an Electrophoretic Mobility Shift Assay to detect binding to the cis-element ohgonucleotide. A binding partner identified in this manner can be further tested as a potential drug or agent, or alternatively as a potential transcription factor. Natural effectors found in cells expressing GDNF can be fractionated and tested using standard effector assays as exemplified herein, for example. Thus an agent that is identified can be a naturally occurring transcription factor. Alternatively, natural products libraries can be screened using the assays of the present invention for screening such agents.

Another approach uses recombinant bacteriophage to produce large libraries. Using the "phage method" [Scott and Smith, 1990, Science 249:386-390 (1990); Cwirla, et al. , Proc. Natl. Acad. Sci. , 87:6378-6382 (1990); Devlin et al. , Science, 249:404- 406 (1990)], very large libraries can be constructed (lO'-lO⁸ chemical entities). Yet another approach uses primarily chemical methods, of which the Gey sen method [Gey sen et al., Molecular Immunology 23:709-715 (1986); Gey sen et al. J. Immunologic Method 102:259-274 (1987)] and the method of Fodor et al. [Science 251:767-773 (1991)] are examples. Furka et al. [14th International Congress of Biochemistry, Volume 5, Abstract FR:013 (1988); Furka, Int. J. Peptide Protein Res. 37:487-493 (1991)], Houghton [U.S. Patent No. 4,631,211, issued December 1986] and Rutter et al. [U.S. Patent No. 5,010,175, issued April 23, 1991] describe methods to produce a mixture of peptides that can be tested.

In another aspect, synthetic libraries [Needels et al., Proc. Natl. Acad. Sci. USA 90: 10700-4 (1993); Ohlmeyer et al., Proc. Natl. Acad. Sci. USA 90: 10922-10926 (1993); Lam et al., International Patent Publication No. WO 92/00252; Kocis et al. , International Patent Publication No. WO 9428028, each of which is incorporated herein by reference in its entirety] , and the like can be used to screen for such an agent.

The invention may be better understood by reference to the following non-limiting Examples, which are provided as exemplary of the invention. The following examples are presented in order to more fully illustrate the preferred embodiments of the invention and should in no way be construed, however, as limiting the broad scope of the invention.

EXAMPLES

The following describes the method used to identify the genetic material that is exemplary of the present invention.

Screening of the Human Genomic Library.

A human genomic library constructed in λ Fix II was purchased from Stratagene and screened according to manufacturer's recommendations. The library was screened sequentially with ³²P-labeled probes corresponding to the 5' (bp 1-133) and 3 ' (bp 134-700) segments of the hGDNF cDNA, respectively. The 5 ' and 3' probes were generated in the following manner: (a) 5' oligo: 5' GGTCTACGGAGACCGG

ATCCGAGGTGC 3 ' (SEQ. ID NO: 9) AND 3' oligo: 5' TCTCTGGAGCCAGGTC AGATACATC3' (SEQ ID NO: 10) PCR oligonucleotides, corresponding to rat GDNF CDNA sequence, were used to generate a 700 bp PCR product from human genomic DNA; (b) the 700 bp PCR product was subcloned in to the PCR2 vector (Invitrogen) and sequenced using standard procedures and sequencing revealed an single Ava I site in the 700 bp of GDNF sequence; (c) the vector was then cleaved with Aval to release the insert and generate the 5 ' and 3 ' probes containing hGDNF sequence. Library screening with the 5' and 3' probes yielded two pools of non-overlapping phage isolates. Based on Southern blot analysis [12], one phage from each pool was selected for further characterization. Subsequently, a third phage was isolated via chromosome walking which lies between the 5 ' and 3 ' genomic phage. This phage contains primarily intronic sequences and allowed the approximation of the intron sizes.

PCR of Rat GDNF Promoter Rat genomic DNA was isolated from newborn heart and lung tissue using the method of Bobbeling et al. The forward and reverse PCR primers were based on the sequence of a rat GDNF genomic clone recorded in Genbank (Accession #D88350) and had the following sequences, respectively: 5' CCCCCGAGGAGGT GCAGAGTGAGG3' (SEQ ID NO: 5) and 5' CATCCGGACCGCGGGCAGGAGC 3' (SEQ ID NO:6).

DNA Sequence Analysis

All sequence analysis was performed on an ABI 373 Fluorescent Sequencing Apparatus according to manufacturer's protocols. All fragments were sequenced on both strands.

Identification of Transcription Factor Binding Sites

Genomic promoter sequences were searched for transcription factor binding sites using the UWGCG software package [14] and Mat Inspector [15].

GDNF Genomic Structure The human GDNF gene has a relatively simple structure, consisting of three small exons and two very large introns (FIGURE IB). Overall, the hGDNF gene spans more than 12 Kb, due primarily to the immense size of its introns (4.8 and > 8.0 Kb). Exon 1 is the smallest of the three hGDNF exons at 20 bp in length, and contains sequences found exclusively in the 5' UTR. An intron (Intron I) of approximately 5 Kb separates Exons 1 and 2.

Exon 2 is 178 bp in length and encodes the remainder of the 5' UTR and the first 150 bp of coding sequence. The initiator ATG lies at base 47. The coding sequence found within the second exon specifies residues found in the prepro region of the GDNF protein [1]. The 3' end of Exon 2 is the site of previously reported alternative splicing of the hGDNF message. The use of a cryptic splice site 5' to the beginning of Intron II results in an internal deletion of 78 bp in the GDNF message. At the protein level, this deletion translates into the loss of 26 amino acids (Lys²⁶-Ser⁵¹) and a Gly²⁵ to Ala substitution. Because these changes occur in the prepro region of the protein, N-terminal to the proteolytic cleavage site, the final products of both mRNA isoforms are likely to be identical. This contention is supported by earlier expression studies which failed to detect biological differences between peptides encoded by the shorter alternative transcript and the full length GDNF message [9].

Exon 3 is the largest of the three exons found in the hGDNF gene, and contains the majority of the coding sequences. It is separated from Exon 2 by a large intron of more than 8.0 Kb (Intron II). Preliminary restriction enzyme mapping suggests that Intron II may span in excess of 20Kb. The remainder of the prepro region and all of the residues found in the mature GDNF polypeptide are specified by this exon. In addition, the non-coding sequences of the 3 ' UTR are contained within Exon 3.

5 ' Regulatory Elements and Biological Function Overall Promoter Organization The sequence of the 5 ' region of the GDNF gene exhibits all the hallmarks of a promoter region. This sequence is highly GC rich ( > 72%), yet lacks canonical CCAT and TATA box motifs. This arrangement, initially associated with housekeeping genes, has now been frequently described for highly regulated, tissue-specific genes as, for example, the NGF Receptor gene [16] . Expression of the GDNF gene in many cell types within the CNS and periphery is consistent with this promoter subtype. The GDNF 5' regulatory region is extremely rich in canonical cis-elements, with more than 12 potential transcription factor binding sites clustered within 450 bp of nucleotide sequence (FIGURE 2). Consistent with the complex expression pattern of the GDNF gene, members from multiple families of transcription factors have the potential to bind to this promoter, and thereby alter expression.

The promoter region of the hGDNF gene can be roughly divided spatially into 2 segments. The proximal region of the promoter is dominated by Spl sites (a minimum of 4), which are known to direct basal transcription from 'housekeeping' gene promoters. However, the distal portion of this novel regulatory region contains multiple transactivator binding sites which potentially alter the level of transcription. The transactivators which recognize these sites have the ability to alter GDNF transcription in response to major signaling cascades such as PKA

(CREB), PKC (NFkB), and to depolarization itself (Zif/268). Other cis-elements in the distal region of the promoter could alter GDNF gene expression in response to developmental cues (bHLH), metal concentrations (MRE), and tissue-specific information (CBF40). Thus, the hGDNF gene is regulated by a chimeric promoter containing a proximal section which ensures consistent low level GDNF expression in many cell types, and a distal section designed to alter transcription during development and in response to environmental stimuli. The arrangement of the hGDNF promoter is unique, and represents a novel class of 'housekeeping' gene promoters. This promoter has been termed subtype 'signal responsive constitutive promoter' (SRCP).

The uniqueness of the human GDNF promoter is further exemplified by comparison to the homologous rat gene (FIGURE 3). Despite the overall 80% conservation seen at the nucleotide level, substitutions in the rat gene eliminate many of the putative cis-elements extant in the human promoter. However, all available data indicates that the human and rat GDNF genes are expressed in the same temporospatial pattern, suggesting that regulatory sites similar to those identified in the human promoter exist in the rat gene. It is clear, however, that these cis-elements do not occupy the homologous region of the rat promoter. Despite the elimination of several putative cis-elements identified in the human homologue, the rat gene still resembles a constimtive promoter. The 5' flanking region is highly GC rich, lacks a recognizable TATA box, and retains a canonical Spl site at the 5' end. In keeping with this promoter structure, multiple transcription start sites in the rat gene have been identified, all of which arise from polyG stretches within a 30 bp region at the 5' end of the promoter. Spl sites and constitutive expression

The 5' region of the human GDNF gene is dominated by Spl binding sites. There are at least four Spl sites within a stretch of 300 bp, and three of these are clustered in the proximal 150 bp. The prevalence of Spl cis-elements is common in genes which display a degree of constitutive expression, as has been described for the GDNF gene. In TATA-less promoters, the Spl protein is thought to anchor the transcriptional machinery to the DNA, supporting initiation [17]. The ubiquity of Spl proteins maintains a basal level of transcriptional competence in all cells. The extremely low level expression of the GDNF gene in multiple cell types may be maintained in part by Spl -regulated transcription.

Developmental and tissue specific expression

The remainder of the hGDNF 5 ' regulatory region is packed with cis-elements that may alter transcription in response to developmental, tissue-specific, and environmental cues. This change in expression is probably mediated through interaction with the basal transcriptional machinery .

The pattern of expression of the GDNF gene is highly regulated throughout development, exhibiting a distinct pattern of expression in the CNS and periphery. The lack of formation of the kidney and gut in the GDNF null mouse attests to the critical developmental role played by this molecule [5] . The promoter contains a cis-element for members of the basic helix-loop-helix (bHLH) gene family. These transactivators are known to play an important role in development, particularly in myogenesis and neurogenesis [18]. A cis-element recognized by members of the bHLH factor family lies just 5' to the distal Spl site, at bp -322. A transactivator binding to this site may act as a switch, enhancing GDNF expression during development via interaction with Spl . When high levels of GDNF are no longer required, the GDNF gene could easily return to basal transcription levels by removing the bHLH enhancement. The proximal promoter region also contains a consensus binding site (a "C-box" sequence) for the muscle-specific transcription factors CBF40 and MNF [19]. GDNF expression in muscle is precisely regulated during development. GDNF mRNA is detectable in muscle at El 5 in the mouse, the time of motoneuron innervation [20]. This finding, in conjunction with the observation of retrograde transport of GDNF by spinal motoneurons, has suggested that GDNF may serve as a target-derived neurotrophic factor [21]. The muscle specific CBF40 and MNF transcription factors may ensure adequate expression of GDNF in muscle to serve this motoneuron survival function.

Environmental Regulation Impulse Activity

Recent studies have indicated that GDNF mRNA is upregulated in the striatum in response to pilocarpine-induced seizures. This response is tightly regulated, peaking 6 hours after the onset of seizures, and re rning to basal levels within 24 hours. This finding has lead to speculation that the GDNF gene is responsive to excitatory inputs from the cortex . A potential candidate for mediating this upregulation in response to electrical activity is the transcription factor Zif/268. The mRNA for this transactivator is known to be upregulated by many signals, including depolarization. There is a Zif/268 cis-element in the hGDNF promoter at bp -194 (FIGURE 2). This site is believed to increase GDNF mRNA transcription in response to depolarization.

Metal Response Elements

The responsive region of the GDNF promoter (the distal promoter region) contains three Metal Response Elements (MRE) within 220 bp. MREs are known to upregulate transcription in response to elevated concentrations of certain metals (cadmium, zinc, copper), and in response to oxidative stress [24] [25], and are often present in multiple copies in responsive promoters. The release of copper ions and free radicals consequent to cellular damage caused by ischemia or trauma is believed to increase transcription of the GDNF gene through these MREs. The expressed GDNF protein may in torn limit further damage to surrounding cells.

PKA and PKC Signaling Cascades Sandwiched between the two 5'-most MRE's are an NFkB site and a cAMP response- element binding site (CREB). These two elements may connection GDNF gene expression to the major intracellular signaling pathways. Protein Kinase C (PKC), and Protein Kinase A (PKA), respectively. The decrease in GDNF gene expression observed in cultured human astrocytes treated with PKC inhibitors may be mediated via this NFkB site at the 5'-end of the promoter. In addition, cAMP analogs increase the survival of midbrain dopaminergic, retinal and spinal cord neurons, populations known to the GDNF responsive. It is plausible that the survival effects of cAMP analogs are mediated at least in part by up regulation of the GDNF gene.

An NFkB binding site lies just 5' to the outermost MRE (bp -443). NFkB responds to a variety of extracellular (mitogens, cytokines, viruses) and intracellular (cAMP, free radicals, etc.) cues. Many of these signals act through the Protein Kinase C (PKC) pathway. Activation of PKC leads to the translocation of NFkB to the nucleus, where it can bind to its cognate cis-element in target genes. The relA component of NFkB interacts with many transactivators, including Spl . Through this interaction the GDNF gene is rapidly upregulated via linkage to the downstream basal transcriptional machinery.

Eight bp upstream of the NFkB site is a canonical cAMP response element. The presence of this element suggests possible regulation of the GDNF gene by myriad ligands which activate adenylate cyclase and the Protein Kinase A (PKA) signaling cascade. Additional evidence suggests that both MRE-BPs and Spl are also capable of responding to increased intracellular cAMP. The presence of all these elements in the GDNF 5 ' regulatory region strongly suggests that the GDNF gene will prove to be cAMP responsive. cAMP analogs have been demonstrated to increase the survival of midbrain dopaminergic neurons in culture, and retinal and spinal cord neurons, populations known to be GDNF responsive. The survival effects of cAMP analogs are thus believed to mediated, at least in part, by upregulation of the GDNF gene.

In addition, Zif/268 and AP2 are both upregulated via PKA and PKC signaling pathways, further increasing the likelihood that these signaling cascades play a role in controlling GDNF gene expression.

The Zif/268 site located at -232 defines the border between the proximal and distal promoter regions. The rnRNA for this transactivator is known to be unregulated by many signals, including depolarization [23]. Recent studies have indicated that GDNF mRNA is unregulated in the striatum in response to pilocarpine-induced seizures. This response is tightly regulated, peaking 6 hours after the onset of seizures, and returning to basal levels within 24 hours. This finding has lead to speculation that the GDNF gene is responsive to excitatory inputs from the cortex [22]. A candidate for mediating this up regulating of the GDNF gene in response to electrical activity is the Zif/268 transcription factor.

Undefined Putative Regulatory Site

We have identified a novel putative cis-element at bp-179, which we have named

GDNF Prometer Repeat (GPR). This putative element is represented by an inverted repeat. The half site of this repeat is 12 bp in length and has the sequence (GGQ. The mirror image of this site lies 10 bp to the 3' end, and contains a single mismatch. The two half sites of this repeat are separated by 10 bp, a single turn of the DNA helix. This spacing places both half sites on the same side of the DNA, facilitating interaction between proteins occupying each site. It is interesting to note that the two half sites of this inverted repeat are 100% conserved between human and rat, while the intervening spacer nucleotides show only 30% conservation (FIGURE 3). While the function of this repeat remains to be defined, preservation of this site across species indicate that it plays a role in GDNF gene regulation. EXAMPLE 1

This Example describes identification of initiation of transcription of human GDNF and provides further analysis of human GDNF promoter cis-elements.

Methods

Maintenance of cultured cells

All cell lines were purchased from ATCC and maintained in 90% DMEM / 10%FBS.

Techniques

Protocols for RNA isolation, S 1 analysis, primer extension and EMSA as further detailed below were based on those described in "Short Protocols in Molecular Biology" (Ausubel et al., 1992) [15].

RNA isolation

RNA was isolated from cultured cells using the guanidinium method. Cultured cells were lysed with guanidinium solution (4M guanidinium isothiocyanate / 20mM sodium acetate PH 5.2 / 0.1 mM DTT / .05% Sarkosyl), and the DNA sheared with a syringe fitted with a 20 gauge needle. The whole mix was layered over a 5.7 M CsCl cushion and centrifuged at 35,000 rpm overnight. The RNA pellet was then collected, resuspened and quantitated.

SI analysis The oligonucleotides Exon 1 A and Exon IB were 32P end-labeled.

Approximately 50,000 cpm of each labeled ohgonucleotide was added, in separate reactions, to 25 micrograms of T98G cell total RNA. ethanol precipitated, and resuspended in 20 μl SI buffer (80% formamide/ 40 mM Pipes pH 6.4/ 400 mM NaCl/ ImM EDTA). The mix was then heated to 65°C for 5 minutes, and hybridized overnight at 30°C. 300μl of S 1 digestion buffer (280 mM NaCl/50mM Na acetate / 4.5 mM ZnSO₄ / 6μg salmon sperm DNA / 300 units SI nuclease) was then added and digestion allowed to proceed 30-60 minutes at 60°C. Digestion products were separated on a 5% aceylamide / 7M urea gel and autoradiographed.

Primer extension Unlabeled ohgonucleotide Exon 1 A was hybridized to T98G cell total RNA as described above for S 1 analysis. After overnight hybridization, the RNA and ohgonucleotide mix was ethanol precipitated and the pellet resuspended in reverse transcriptase buffer + dNTP + radiolabeled nucleotide, dGTP, dATP or dCTP (in each of three separate reactions) + reverse transcriptase. Primer extension was then performed in a PCR machine under temperature conditions as follows: 25°C for 5 min, 10 min ramp to 35°C, hold for 5 min, ramp for 5 min to 37°C, hold for 15 min, 10 min ramp to 42°C. hold for 15 min, 5 min ramp to 45°C, hold for 5 min. The extended product was separated on a 5% acylamide / 7M urea gel and autoradiographed.

Nuclear extract preparation and Electrophoretic Mobility Shift Assay (EMSA)

Nuclear extracts were prepared and EMSA was performed as described in "Short Protocols in Molecular Biology" (Ausubel et al., (1992) [15].

Results and Discussion

The overall organization of the hGDNF gene resembles that recently reported for the murine homolog. The mouse gene is also composed of three exons and two introns, but significant species differences exits, particularly at the 5'-end of the gene. We have determined that Intron I is 5.0 kb in length. This finding was facilitated by the isolation of a single human genomic subclone of 6.0 kb which contains sequences from both Exon 1 and Exon 2. In contrast, Matsushita et al. [] report that Intron I in the mouse GDNF (mGDNF) gene spans a minimum of 30 kb, with Exons 1 and 2 existing in separate, non-overlapping phage clones. Further evidence of species differences between humans and rodents lies in the overall length of Exon 1. Based on the longest clone generated via 5 'RACE, the first exon in the mouse GDNF gene is than 1 kb in length. In marked contrast, we demonstrate that the first exon in the hGDNF gene spans just 20bp. The interspecies differences in genomic organization of the GDNF gene, particularly at the 5'-end, suggest that different regulatory regions control GDNF gene expression in rodents and humans (see below).

Identification of initiation of transcription of the hGDNF gene.

To identify the imitation of transcription of the HGDNF gene, we employed a two pronged approach, consisting of S 1 nuclease analysis and primer extension. A pair of nested oligonucleotides, Exon 1A, 5' CTCGGATCGGGTCTCCG 3' (SEQ ID NO:l 1) and Exon IB, 5' TCGGGTCTCCGCAGACC 3' (SEQ ID NO: 12), corresponding to the minus strand of Exon 1 of the hGDNF gene were synthesized. The nucleotide composition and theoretical melting temperature (Tm) of this oligo pair is identical. Each ohgonucleotide was ³²P end-labeled, hybridized to T98G glioblastoma RNA, and subjected to SI nuclease digestion. As shown in Figure 6B. the probe Exon 1 A is fully protected under the conditions, while probe Exon IB is not protected. This finding indicates that the initiation of transcription of the GDNF gene in the T98G glioblastoma cell line lies within the 6 bp non-overlapping region that defines the 3'- ends of these nested probes.

To more precisely determine the initiation of transcription we performed primer extension analysis. The Exon 1A ohgonucleotide was hybridized to T98G RNA and extended using MMLV reverse transcriptase. In this case the ohgonucleotide was unlabeled, and three separate primer extension experiments were performed in parallel. The three individual reactions contained radio labeled dGTP, dATP, and dCTP, respectively. As shown in Figure 6C, a prominent extended product of 20 bases is generated in each of the three reaction lanes (indicated by the diamond), demonstrating that the primary initiation site used by the hGDNF gene lies 3 bp 3' to the end of the Exon 1A ohgonucleotide. This result agrees with data generated via SI nuclease protection, and defines the length of hGDNF Exon 1 as 20 bp.

Utilizing radio labeled nucleotide incorporation in primer extension (as opposed to using an end-labeled primer) has both advantages and disadvantages. The primary advantage is the relative increase in specific activity enjoyed by longer extended products. This facilitates the identification of relatively minor transcripts which may initiate from upstream sequences. We did not detect any longer transcripts originating from upstream sequences in the T98G cell line. In contrast, studies of the mGDNF gene indicate that transcripts originate from sequences more than 1.Okb upstream from the region homologous to the Exon 1 A ohgonucleotide sequences. The disadvantage of relying on incorporation of radiolabled nucleotides in these analyses is the potential to generate labeled products that do not originate from the added primer. To overcome this deficit we performed three primer extension reactions in parallel, utilizing a different radio labeled nucleotide in each reaction. Only that extended product seen in each reaction was considered as genuinely initiating from the Exon 1 A primer.

Clearly, the murine and human GDNF genes initiate transcription at different sites, and most likely utilize different promoters. Our observations suggest that insights into human diseases, including Parkinson's Disease and amyotrophic lateral sclerosis, must rely on study of the human gene, and not the very different rodent homologous.

Functional analysis of representative GDNF promoter cis-elements by Electrophoretic Mobility Shift Assays.

We have identified in excess of a dozen known and novel putative cis- elements in the promoter of the GDNF gene. To begin defining the role of these in the trancriptional regulation of the GDNF gene we have undertaken analysis of representative elements from three functional groups. Employing Electrophoretic Mobility Shift Assays (EMSA), we have looked at transactivator binding to the Zif/268 site (signal-responsive element), MNF site (tissue-specific element), and the

GPR site (novel element).

The majority of our EMSA studies have focused on the signal-responsive Zif/268 transactivator. In our initial study an ohgonucleotide corresponding to the sequence of the putative Zif/268 site was radio labeled and mixed with nuclear extract from cultured primary adult cortical astrocytes. As shown in Figure 7A, an abundant

DNA-binding protein found in cortical astrocytes recognizes and binds to the Zif/268 ohgonucleotide (lane 1). The Zif/268 transactivator is known to be unregulated by many extracellular signals, including depolarization. To address the signal responsive nature of this transactivator, astrocytes were treated for two hours with 25 mM KCI before harvesting for nuclear extract. As shown in lane 2, this treatment causes a significant decrease in the amount of probe recognized and bound by its cognate transactivator. This decrease in transactivator binding contrasts with expectations result, but illustrates that binding to the Zif/268 site in cultured astrocytes is not static, and an be altered by external stimuli. In addition, a protein of lesser MW (indicated by) now binds to the probe and produces a distinct shift. This interchange of transactivators at the Zif/268 cis-element may serve to alter GDNF gene expression.

This finding was replicated in the T98G cell line (Figure 7B). T98G extract also contains a transactivator which recognizes the Zif/268 site. One hundred ng of cold oligo deceases the amount of readiolabeled probe shifted. When T98G ells are pretreated with KCI. following the same procedure as described above for the primary astrocytes, the amount of probe shifted decreases. Under this treatment protocol, 100 ng of cold ohgonucleotide all but eliminates binding to the radio labeled probe, indicative of a significant decrease in transactivator binding following KCI treatment. This experiment also demonstrates that there is very little transactivator which recognizes the Zif/268 site in NRK cells (lane 6). Moreover, the small amount of probe that is shifted by NRK extract migrates at a different rate, indicating that it is due to a transactivator distinct from that responsible for the T98G shift. Analysis for the G8 cell line demonstrates that a Zif/268 site DNA-binding protein, distinct from that present in T98G cells, found in a low concentrations in these cells (lane 8).

To gain insight into the muscle-specific expression of the hGDNF gene we performed EMSA with using the CB40/MNF binding site, or C-box (Figure 7C). This probe, based on the C-box sequence extant in the hGDNF promoter, was mixed with nuclear extract from T98G, NRK and G8 cells (lanes 1, 2, and 3 respectively). As indicated by the arrow, the skeletal muscle derived G8 cells contain a low abundance transactivator which recognizes this cis-element and generates a shifted band. This is consistent with the identification of two unique C-box binding proteins in myocytes,

CB40 and MNF. Based on the apparent size of the muscle-specific factor which binds to the c-box probe, it is more likely that this factor is MNF in G8 cells and not CB40. The T98G and NRK cell lines do not produce nuclear proteins capable of binding to the C-box probe. This finding suggests that the C-box identified in the hGDNF promoter may help regulate the expression of the GDNF gene in muscle.

Lastly, we focused on the novel GPR inverted repeat located in the proximal GDNF promoter. In the hGDNF promoter the GPR sequence encompasses a consensus Spl binding site (Splc in Figure 3) to avoid the complication of Spl binding to the GPR probe, we based the sequence of this ohgonucleotide probe on the homologous region of the rat GDNF gene. There is 100% conservation of the GPR half-sites in the rat gene, but the intervening sequences differ significantly (only 30% conservation). These nucleotide changes eliminate the Splc site identified in the hGDNF promoter. As shown in Figure 7D, this putative cis-element is recognized by nuclear proteins extant in glioblastoma (T98G), kidney (NRK), and skeletal muscle (G8) cell lines, however, the transactivator(s) which recognize this element varies from cell line to cell line, as evidenced by the differential shift pattern produced. The role of the GPR in GDNF gene regulation, and the identify of the factors which recognize this cis-element remains to be determined.

Sequence comparison of the human GDNF promoter

In an effort to understand the utilization of distinct promoters in the expression of the mouse and human GDNF genes, we performed sequence comparison of the 5' end of both genes (Figure 8). This region represents the promoter of the hGDNF gene, and the untranslated Exon 1 sequences of the mouse gene (SEQ ID NO:13). Of the 13 putative cis-elements identified in the hGDNF promoter, seven are retained unaltered in the homologous mouse gene. For example, all three MREs are preserved, as is the CREB site and 3'most Spl site. In addition, the two half sites of the GPR are 100%) conserved, and observation which also holds true for the rat GDNF homologous

(data not shown). In contrast, the signal-responsive Zif/268 site contains three nucleotide changes, likely rendering it non-functional. The same holds true for the MNF site, with two substitutions, and the bHLH cis-element, with three mismatches. These changes in nucleotide sequence may decrease the ability of the mouse gene to serve the signal responsive promoter function of this human counterpart, and create the need to employ upstream sequences in transcriptional regulation. EXAMPLE 2

This Example describes expression studies of the GDNF promoter and demonstrates the ability of GDNF promoter sequences of the present invention to promote expression of operatively linked coding sequences.

A 6.0 Kb Xba/Xba subclone of a genomic phage clone isolated from the λ Fix II human genomic library, screened with the 5' probe described in the above example, was selected for further study. A restriction map of the Xba/Xba subclone is shown in Figure 9, with distances indicated in base pairs in parentheses from the 5' most Xba site. This 6.0 Kb subclone contains, from 5' to 3', 520 bp of promoter, the 20 bp Exon I, the ~4.8 Kb Intron I, the 7 bp Exon 2. and a small portion (approximately 300 bp) of Intron II.

In order to further study the hGDNF promoter, and assess the ability of portions (i.e., fragments) of the promoter to direct expression of a chloramphenicol acetyl transferase (CAT) encoding reporter gene, two portions of the promoter were amplified by PCR, one containing promoter sequences to -520 and the second containing promoter sequences to -220. The oligonucleotides used in PCR introduced a Kpnl restriction site at the 5' end, and a Bgll site at the 3' end of the PCR product, in order to facilitate cloning into a CAT reporter vector pCATbasic (Promega).

The 5' plus strand oligonucleotides for each were as follows: 520 Kpn: 5' agatctggtaccGACCAGCTCGCTCC3' (SEQ ID NO: 14) and 220 Kpn: 5' agatctggtaccGCCGGCAGCCCTCGCC3' (SEQ ID NO: 15) Upper case bases match those in the hGDNF promoter, while lower case bases introduce a Kpn I restriction site. The above 5' oligonucleotides were each paired individually with a common 3' minus strand oligonucleotides with the following sequence:

3' Bgll: 5'CGGATCaGaTCTCCGCAGACCCTAG3' (SEQ ID NO: 16)

In this case, two bp within the GDNF sequence (indicated by lower case bases) to create a Bgl II site. All upper case bases match with the hGDNF promoter. PCR products generated using these ohgonucleotide pairs were cloned upstream of the CAT gene in the vector pCAT basic, yielding 520 CAT and 220 CAT instructs.

U373 MG cells, a human glioblastoma / astrocytoma (grade III) cell line (ATCC HTB17) were transfected with the 520 CAT and 220 CAT instructs. In three representative experiments, the 220 CAT constructed demonstrated CAT expression 30%), 60%) and 80%> above background. Results with the 520 CAT construct were more variable, with activity ranging from 2.5 fold over background to expression at background levels. The CAT expression demonstrated with the 220 CAT conduct, suggests that this hGDNF promoter fragment is capable of specific, although low level expression when operatively linked to protein coding sequence.

The following is a list of references related to the above Examples and particularly to the experimental procedure and discussions.

1.. Lin, L.F.; Doherty, D.; Lile, J.; Bektesh, S. and Collins, F. (1993) Science 260: 1130-1132.

2. Henderson, C.E.; Phillips, R.A.; Pollock, A.M.; Davies, A.M. and Lemeulle,

M. (1994) Science 266: 1062-1064.

3. Mount, H.T.J.; Dean, D.O.; Alberch, J.; Dreyfus, CF. and Black, LB. (1995) Proc. Natl. Acad. Sci. U.S.A. 92: 9092-9096.

4. Moore, M.W.; Klein, R.D.; Farinas, I.; Sauer, H.; Armanini, M.; Phillips, H.; Reichardt, L.F.; Ryan, A.M.; Carver-Moore, K. and Rosenthal, A. (1996) Nature 382:

76-79.

5. Schaar, D.G.; Sieber, B.A.; Dreyfus, CF. and Black, LB. (1993) Exp. Neurol. 124: 368-371. 6. Springer, J.E.; Mu, X.; Bergmann, L.W. and Trojanowski, J.Q. (1994) Exp. Neurol. 127: 167-170.

7. Choi-Lundberg, D.L. and Bohn. M.C. (1995) Dev. Brain Res. 85: 80-88.

8. Nosrat, C.A.; Tomac, A.; Lindqvist, E.; Lindskog, S.; Humpel, C; Stromberg, I.; Ebendal, T.; Hoffer, B.J. and Olson, L. (1996) Cell Tissue Res. 286: 191-207.

9. Schaar, D.G.; Sieber, B.A.; Sherwood, A.C.; Dean, D.O. and Mendoza G. (1994) Exp. Neurol. 130: 387-393.

10. Trupp, M.; Ryden, M.; Jornvall, H.; Funakoshi, H.; Timmusk, T.; Arenas, Ε. and lbanez, CF. (1995) Journal Cell Biology 130: 137-148.

1 1. Humpel, C; Hoffer, B.; Stromberg, I.; Bektesh, S.; Collins, F. and Olson, L. (\994) Neuroscience 59: 791-795.

12. Sambrook, J.; Fritsch, Ε.F. and Manitais, T. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

13. Devereux, J; Haeberli, P. and Smithies, O. (1984) Nucleic Acids Res. 12: 387- 395.

14. Quandt, K.; Freeh, K.; Karas, H; Wingender, E. and Werner, T. (1995) Nucleic Acids Research 23: 4878-4884.

15. Ausubel, F.M.; Brent, R.; Kingston, R.E.; Moore, D.D.; Seidman, J.G.; Smith, J.A. and Struhl, K. (1992) Short Protocols in Molecular Biology, Greene Publishing Associates and John Wiley and Sons, Brooklyn, New York. 16. Matsushita, N.; Fugita, Y.; Tanaka, M.; Nagatsu, T. and Kiuchi, K. (1997) Gene 203: 149-157.

17. Sehgal, A.; Patil, N. and Chao, M. (1988) Molecular and Cellular Biology 8: 3160-3167.

18. Pugh, B.F. and Tijan R. (1990) Cell 61 : 1187-1197.

19. Black, B.L., Ligon, K.L., Zhang, Y. and Olson, E.N. (1996) J. Biol. Chem. 271 : 26659-26663.

20. Bassel-Duby, R.; Hernandez, M.D.; Gonzalez, M.A.; Krueger, J.K. and Williams, R.S. (1992) Mol. Cell Biol. 12: 5024-5032.

21. Wright, D.E. and Snider, W.D. (1996) Cell Tissue Res. 286: 209-217.

22. Yan, Q.; Matheson, C and Lopez, O.T. (1995) Nature 373: 341-344.

23. Nguyan, Q.T.; Parsadanian, A.S.; Snider, W.D. and Lichtman, J.W. (1998) Science 279:1725-1729.

24. Thiele, D.J. (1992) Nucleic Acids Research 20: 1183-1191.

25. Dalton, T.P.; Li, Q.; Bittel, D.; Liang, L. and Andrews, G.K. (1996) J. Biol. Chem. 271 : 26233-26241.

26. Moretto, G.; Walker, D.G.; Lanteri, P.; Taioli, F.; Zaffagnini, S.; Xu, R.Y. and Rizzuto, N. (1996) Cell Tissue Research 286: 257-262.

27. Hartikka, J.; Staufenbiel, M. and Lubbert, H. (1992) J. Neurosci. Res. 32: 190- 201. 28. Christy, B.; Lau, L.F.; and Nathans, D. (1988) Proc. Natl. Acad. Sci. USA 86:7857-7861.

29. Schmidt-Kastner R.; Tomac, A.; Hoffer, B.; Bektesh, S.; Rosenzweig. B. and Olsen, L. (1994) Mol. Brain Res. 26:325-330.

This invention may be embodied in other forms or carried out in other ways without departing from the spirit or essential characteristics thereof. The present disclosure is therefore to be considered as in all respects illustrative and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.

Various references are cited throughout this specification, each of which is incorporated herein by reference in its entirety.

Claims

WHAT IS CLAIMED IS:

1. An isolated nucleic acid molecule which comprises a GDNF promoter containing a proximal section which ensures consistent low level GDNF expression in multiple cell types, and a distal section designed to alter transcription during development and in response to environmental stimuli, said nucleic acid molecule selected from the group consisting of:

(A) the DNA sequence of FIGURE 2 (SEQ ID NO: 1).

(B) DNA sequences that hybridize to the foregoing DNA sequence under standard hybridization conditions;

(C) degenerate variants thereof;

(D) alleles thereof; and

(E) hybridizable fragments thereof.

2. A vector, which comprises the nucleic acid molecule of Claim 1.

3. An expression vector, which comprises the nucleic acid molecule of Claim 1 , operatively linked to protein coding sequence.

4. A probe capable of screening for a nucleic acid comprising a GDNF promoter, which probe comprises the nucleic acid molecule of Claim 1 with a label.

5. A unicellular host transformed with a recombinant DNA molecule comprising a DNA sequence, which comprises a GDNF promoter, or a fragment thereof, which DNA sequence is selected from the group consisting of:

(A) the DNA sequence of FIGURE 2 (SEQ ID NO: 1).

(B) DNA sequences that hybridize to the foregoing DNA sequence under standard hybridization conditions;

(C) degenerate variants thereof;

(D) alleles thereof; and (E) hybridizable fragments thereof.

6. The unicellular host of Claim 5 wherein the unicellular host is selected from the group consisting of E. coli, Pseudomonas, Bacillus, Streptomyces, Pichia yeasts, CHO, Rl . l, B-W, L-M, COS 1, COS 7, BSCl, BSC40, and BMTIO cells, plant cells, insect cells, and human cells in tissue culture.

7. A recombinant virus transformed with the nucleic acid molecule of Claim 1.

8. A DNA molecule comprising a DNA sequence, which comprises a GDNF promoter, said DNA sequence selected from the group consisting of:

(A) the DNA sequence of FIGURE 2 (SEQ ID NO: 1).

(B) DNA sequences that hybridize to the foregoing DNA sequence under standard hybridization conditions;

(C) degenerate variants thereof;

(D) alleles thereof; and

(E) hybridizable fragments thereof.

9. A recombinant DNA molecule comprising a DNA sequence in accordance with claim 8.

10. An isolated nucleic acid molecule, which nucleic acid molecule comprises the GDNF promoter of claim 1 operatively linked to a protein coding sequence, such that the expression of said protein coding sequence is controlled by said GDNF promoter.

11. The isolated nucleic acid molecule of claim 10, wherein said protein coding sequence is GDNF.

12. The isolated nucleic acid molecule of claim 10, wherein said protein coding sequence is selected from the group consisting of B-galactosidase, luciferase, chloramphenical acetyl transferase, and green fluorescent protein.

13. A vector, which comprises the nucleic acid molecule of claim 10.

14. The vector of claim 10, which is an expression vector.

15. A method for creating a cell line which exhibits increased expression of GDNF, comprising transfecting a GDNF-producing cell line with a vector of claim 14, wherein said protein coding sequence is GDNF.

16. A method of treating patients in need of GDNF which comprises administering via gene therapy the vector of claim 14, wherein said protein coding sequence is GDNF.

17. A unicellular host transformed with a recombinant DNA molecule comprising the GDNF promoter of claim 1 operatively linked to a protein coding sequence, such that the expression of said protein coding sequence is controlled by said GDNF promoter.

18. The unicellular host of Claim 17 wherein the unicellular host is selected from the group consisting of E. coli, Pseudomonas, Bacillus, Streptomyces, Pichia yeasts, CHO, Rl. l, B-W, L-M, COS 1 , COS 7, BSCl , BSC40, and BMTIO cells, plant cells, insect cells, and human cells in tissue culmre.

19. A method of expressing a protein coding sequence in a cell containing the expression vector of Claim 14 comprising culturing the cell in an appropriate cell culmre medium under conditions that provide for expression of the coding sequence by the cell.

20. A method of expressing GDNF in a cell containing the expression vector of Claim 14, wherein said protein coding sequence is GDNF, comprising culmring the cell in an appropriate cell culmre medium under conditions that provide for expression of GDNF by the cell.

21. A method of identifying a modulator of a GDNF promoter comprising:

(A) placing the expression vector of Claim 14 into a cell in the presence of at least one agent suspected of exhibiting GDNF promoter modulating activity; and

(B) determining the amount of transcription of the protein coding sequence; wherein an agent is identified as a modulator when the amount of transcription of the protein coding sequence in the presence of such agent is different than in its absence.

22. The method of Claim 21 wherein the agent identified is a transcription factor.

23. The method of Claim 21 wherein when the amount of transcription of the protein coding sequence in the presence of the agent is greater than in its absence, the agent is identified as an activator of the GDNF promoter.

24. The method of Claim 21 wherein when the amount of transcription of the protein coding sequence in the presence of the agent is less than in its absence, the agent is identified as an inhibitor of the GDNF promoter.

25. A method of identifying a modulator of GDNF expression comprising:

(A) placing the expression vector of Claim 14 into a cell in the presence of a at least one agent suspected of exhibiting GDNF expression modulator activity; and (B) determining the amount of transcription of the protein coding sequence; wherein an agent is identified as a modulator when the amount of transcription of the protein coding sequence in the presence of such agent is different than in its absence.

26. A method of identifying a transcription factor that modulates the GDNF promoter comprising

(a) placing the expression vector of Claim 14 into a cell, under conditions in which the transcription of the protein coding sequence requires the presence of the transcription factor; and

(c) detecting the transcription of the protein coding sequence; wherein a potential transcription factor is identified as a transcription factor that modulates the GDNF promoter when the transcription of the protein coding sequence is detected in the presence of the potential transcription factor.

27. A method of identifying a binding partner for the nucleic acid molecule of Claim 1 comprising:

(a) contacting a candidate binding partner with said nucleic acid molecule; and

(b) detecting the binding of the candidate binding partner with said nucleic acid molecule; wherein a candidate binding partner is identified as a binding partner when the binding of the candidate binding partner with said nucleic acid molecule is detected.

28. A method of identifying a binding partner for the nucleic acid molecule of Claim 1 comprising:

(a) placing said nucleic acid molecule on a solid support;

(b) contacting the solid support with a candidate binding partner under conditions in which a binding partner can bind to the recombinant nucleic acid;

(c) washing the solid support; wherein a candidate binding partner that does not bind the recombinant nucleic acid is removed; and (d) detecting the candidate binding partner bound to the solid support; wherein a candidate binding partner is identified as a binding partner if it is bound to the solid support.

29. The method of Claim 28 wherein the candidate binding partner is a potential transcription factor for a gene comprising the nucleic acid molecule, and wherein the binding partner that is identified is a transcription factor for the gene comprising the nucleic acid molecule.