WO1998044095A1 - Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin - Google Patents

Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin Download PDF

Info

Publication number
WO1998044095A1
WO1998044095A1 PCT/EP1998/001935 EP9801935W WO9844095A1 WO 1998044095 A1 WO1998044095 A1 WO 1998044095A1 EP 9801935 W EP9801935 W EP 9801935W WO 9844095 A1 WO9844095 A1 WO 9844095A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cell
transgenic animal
psoriasis
skin
Prior art date
Application number
PCT/EP1998/001935
Other languages
French (fr)
Inventor
Danny Huylebroeck
Kathleen Ongena
Olivier Lonnoy
Tom Van De Putte
Original Assignee
Vlaams Interuniversitair Instituut Voor Biotechnologie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vlaams Interuniversitair Instituut Voor Biotechnologie filed Critical Vlaams Interuniversitair Instituut Voor Biotechnologie
Priority to AU73343/98A priority Critical patent/AU7334398A/en
Publication of WO1998044095A1 publication Critical patent/WO1998044095A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0006—Skin tests, e.g. intradermal testing, test strips, delayed hypersensitivity
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/30—Animal model comprising expression system for selective cell killing, e.g. toxins, enzyme dependent prodrug therapy using ganciclovir
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0325—Animal model for autoimmune diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0331—Animal model for proliferative diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0393—Animal model comprising a reporter system for screening tests
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin.
  • the present invention relates to transgenic animals which can act as model for skin disease including hyperproliferative disease, such as psoriasis, and skin inflammation.
  • the invention relates to transgenic animals wherein the transgene comprises a nucleic acid construct wherein an epidermal cell-selective promoter, a (preferably viral) thymidine kinase gene and optionally a reporter gene is present.
  • Psoriasis is a noncontagious skin disorder that most commonly appears as inflamed swollen skin lesions covered with silvery white scale. This most common type of psoriasis is called plaque psoriasis. Psoriasis comes in many different variations and degrees of severity. Different types of psoriasis display characteristics such as pus-like blisters (pustular psoriasis), severe sloughing of the skin (erythrodermic psoriasis), drop-like dots (guttate psoriasis) and smooth inflamed lesions (inverse psoriasis). The degrees of severity of psoriasis are divided into three important categories: mild, moderate and severe.
  • Whether a person actually develops psoriasis may depend on something triggering its appearance.
  • trigger factors include systemic infections such as strep throat, injury to the skin (the Koebner phenomenon), vaccinations, certain medications, and intramuscular injections or oral steroid medications.
  • Epidermal cells in the skin are programmed to follow two possible programs: normal growth or wound healing.
  • skin cells are generated in the basal cell layer, and then move up through the epidermis to the stratum corneum, the outermost layer of the skin.
  • Dead cells are shed from the skin at about the same rate as new new cells are produced, maintaining a balance. This normal process takes about 28 days in man.
  • a wound healing program is triggered, also known as regenerative maturation, involving amongst others increased keratinocyte proliferation and migration. Cells are produced at a much faster rate, theoretically to replace and repair the wound. There is also an increased blood supply and localized inflammation.
  • psoriatic skin is similar to skin healing from a wound or reacting to a stimulus such as infection.
  • keratinocytes behave as if there is. These keratinocytes switch from the normal growth program to regenerative maturation. Cells are created and pushed to the surface in as little as 2- 4 days, and the skin cannot shed the cells fast enough. The excessive skin cells build up and form elevated, scaly lesions.
  • the white scale that usually covers the lesion is composed of dead skin cells, and the redness of the lesion is caused by increased blood supply to the area of rapidly dividing skin cells.
  • Transgenic animals are often used as model system for the identification of agents which induce or protect epidermal hyperproliferation often correlated with psoriasis or psoriasis-like phenotypes.
  • agents which induce or protect epidermal hyperproliferation often correlated with psoriasis or psoriasis-like phenotypes.
  • suprabasal expression of integrins or overexpression of growth- and differentiation polypeptides could be associated with psoriasis.
  • WO 96/27019 is disclosed a nucleic acid construct comprising a promoter capable of directing expression in the suprabasal cells of the epidermis and means to cause overexpression of an integrin subunit, a skin protein, in the suprabasal cells.
  • a promoter capable of directing expression in the suprabasal cells of the epidermis and means to cause overexpression of an integrin subunit, a skin protein, in the suprabasal cells.
  • an integrin subunit a skin protein
  • EP 633,315 is disclosed a transgenic animal whose cells contain a recombinant genetic construction formed of a detectable marker gene and a regulator region of the gene K6 keratin capable of being induced in the epidermis of the transgenic animal in response to hyperproliferative stimuli.
  • 12-O-tetra decanoylphorbol-13-acetate (TPA) or 7, 12-dimethylbenza-anthracene (DMBA) were topically applied to the skin of the transgenic animal in order to verify whether the exogenous gene (called transgene) is induced in the correct regions of the epidermis subjected to hyperproliferative stimuli agents like retinoic acid.
  • transgene the exogenous gene
  • the tail of the animals was daily topically treated for 14 days demonstrating again a very laborious and time consuming method.
  • This model only shows the proper function of the regulator region of the K6 keratin gene as such.
  • WO90/15869 is described a transgenic animal which can be used as model skin-testing system.
  • a genetic construct has been made encoding a uv- light inducible promoter in combination with a number of reporter genes.
  • a problem encountered by a person skilled in the art using this construct is that using uv-light also has a profound effect on other type of skin cells and that as a consequence thereof a proper interpretation of results thus obtained with this model is at least difficult to make.
  • an object of the present invention is to provide an inducible animal model of hyperproliferative skin cell disease and skin inflammation, means of producing such an animal model and uses for the animal model not having the disadvantages above mentioned.
  • a first aspect of the invention provides a nucleic acid construct comprising a suprabasal cell-selective promoter and a gene that can induce cell ablation. This phenomenon of cell ablation is nowhere disclosed in the prior art and hence a novel feature of the current invention.
  • a further aspect of the invention is that the construct comprises a (preferably viral) thymidine kinase gene responsible directly or indirectly for the cell ablation.
  • a reporter gene is present in said construct.
  • sirabasal cell-selective promoter is included all nucleic acid elements that direct expression selectively in the suprabasal layer of the epidermis of an animal.
  • a promoter to be expressed in all suprabasal layers of the epidermis is suitable however it is preferred if said promoter is a keratinocyte stage selective promoter.
  • the organisation of the basement membrane, basal layer and suprabasal layers, of the epidermis of a mammal is known to a person skilled in the art.
  • the epidermis in the adult organism is a stratified flat epithelium in which two cell layers are important for growth control of keratinocytes: the basal layer, formed by a single layer of cuboid cells which have the ability to divide, and the suprabasal layer, formed of cells coming from the basal layer and which have lost the ability to divide.
  • K-10 keratin whereas the thymidine kinase gene or modified forms of it originates from Herpes Simplex Virus type 1 and the reporter gene is preferably a beta- galactosidase gene from E.coli.
  • the nucleic acid construct may contain one or more suprabasal or basal keratinocyte cell-selective promoters or more than one type of suprabasal cell- selective promoter.
  • the nucleic acid constructs of the invention can readily be made using well known genetic engineering techniques such as those described in Sambrook et al,(1989) Molecular Cloning; A laboratory manual, (Cold Spring Harbor Laboratory Press,NY).
  • the host cell can either be prokaryotic or eukaryotic.
  • Bacterial cells are preferred prokaryotic host cells; preferred eukaryotic host cells include yeast and mammalian cell lines like mouse, rat, monkey or human fibroblastic cell lines.
  • Particularly preferred host cells are animal, preferably mammalian, embryo cells which can be used to generate transgenic animals.
  • the nucleic acid constructs of the invention can for instance be introduced into suitable embryo cells by transfection or in zygote stage embryos by microinjection.
  • mouse, rabbit, sheep, guinea pig, rat, pig, cow or primate embryo cells or zygotes can be used.
  • Particularly suitable are mouse embryo cells.
  • a further aspect of the invention is also a method of producing a transgenic animal comprising the steps of :
  • step (b) introducing the embryo reconstituted from the embryo cells from step (a) by introduction into an acceptor embryo or implantation of the microinjected zygote into a pseudopregnant female animal,
  • step (c) assisting the female in step (b) until the embryo has developed sufficiently to be independent of its mother and
  • a further embodiment of the current invention is a transgenic animal wherein the transgene comprises the nucleic acid construct according to the invention and wherein said transgenic animal or its offspring or germ cell line thereof carrying the transgene has or can develop a symptom of hyperproliferative skin disease, such as psoriasis, and inflammation.
  • transgenic animal The preparation of animals used in any method of the invention will utilize the recently developed technology of introducing foreign genes into the germ line of an animal.
  • transgenic animals such as microinjection, transfection of DNA, sperm transfer, virus-mediated gene transfer and electroporation.
  • transgenic animal refers to non-human animals which have incorporated a foreign gene (called transgene) into their genome; because this gene is present in germ line tissues, it is passed from parent to offspring establishing lines of transgenic animals from a first founder animal. It will be appreciated that when a nucleic acid construct according to the invention is introduced into an animal to make it transgenic the nucleic acid may not necessarily remain in the form as introduced.
  • offspring any product of the mating of the transgenic animal whether or not with another transgenic animal, provided that the offspring carries the transgene. Furthermore is included any germ cell of the transgenic animal which can be used to propagate a further animal comprising a transgene according to the invention.
  • cell ablation is meant the controllable induction of cell damage and cell death in preferably viral thymidine kinase positive cells by application, either systematic or topically, of anti-viral drugs that target the preferably thymidine kinase transgene.
  • a further aspect of the present invention includes primary or permanent basal or suprabasal keratinocyte cells and/or cell lines derived from a transgenic animal. These cells can be cultured by known techniques and provide established model systems on their own merits.
  • Another aspect of the invention is a method for inducing the development of a symptom of hyperproliferative and/or inflammatory skin disease, including psoriasis, of a transgenic animal according to the invention comprising the step of contacting said transgenic animal with an agent which induces said skin disease or psoriasis- like phenotype.
  • Agents provoking this effect are surprisingly anti-viral drugs such as ganciclovir and acyclovir as described below. It is known that ganciclovir and acyclovir are phosphorylated by thymidine kinase and converted to toxins whereafter cells of the epidermis die off.
  • the agent is administered by any route like topical administration, by injection or providing the agent in food and/or drink for the animal.
  • Part of the invention is also a method of selecting a compound which inhibits hyperproliferative and/or inflammatory skin disease including psoriasis or psoriasislike symptom comprising administering a compound to a transgenic animal obtained by the above descibed method and after a period of time (anything from four hours to twelve weeks) determining whether the compound prevents, reduces or eliminates said symptom.
  • a compound obtainable by this method is very useful in treating hyperproliferative and/or inflammatory skin disease, including psoriasis; whereas the use of said compound which modulates a basal and/or suprabasal cell function in the manufacture of a medicament for the treatment of psoriasis is included in the scope of the invention.
  • reporter gene a suitable selection marker
  • the reporter gene preferably beta-galactosidase
  • the reporter gene is placed under control of the regulator region of the K-10 keratin and introduced into the genome of transgenic animals.
  • the skin of the transgenic animal thus obtained is subjected to expression of the ⁇ -galactosidase/viral thymidine kinase gene fusion protein in the presence of X-gal, the substrate for beta-galactosidase, the epidermal suprabasal cells develop a blue color.
  • nucleic acid construct comprising as promoter a regulator region of the gene of the K-10 keratin, as the thymidine kinase gene the gene originating from Herpes Simplex Virus type 1 and as reporter gene a beta- galactosidase gene in such a concept the synthesis of the thymidine kinase activity allows ganciclovir-dependent ablation of suprabasal keratinocytes in transgenic mice.
  • thymidine kinase phosphorylates nontoxic nucleoside analogs like ganciclovir and acyclovir, which are not metabolized by cellular enzymes when used at appropriate concentrations, and converts these drugs into toxins.
  • K10 acZf/ transgenic mice demonstrated an hyperproliferative phenotype, characterized by inflammation, a disturbed differentation pattern of the keratinocytes and thickening of the epidermis as well.
  • Such a transgene model provides an inducible and reversible system for in depth study of proliferation and differentation control of skin disorders.
  • mice developed many characteristics of a psoriatic-like phenotype such as the strong induction of the genes encoding the pro-inflammatory cytokine interleukin-1 ⁇ (IL-1 ⁇ ), vascular endothelial growth factor (VEGF) and keratinocyte growth factor (KGF).
  • IL-1 ⁇ pro-inflammatory cytokine interleukin-1 ⁇
  • VEGF vascular endothelial growth factor
  • KGF keratinocyte growth factor
  • Rigorous control of cellular proliferation, differentiation and migration by cell-cell and cell-matrix interaction is essential for normal embryogenesis, tissue homeostasis and repair. Consequently, the removal of a specific cell type from a tissue or organ allows to identify certain cells as stem or progenitor cells, or as source of signals other cell types may be dependent upon for their normal function, growth or differentiation. Ablation of cells from animals relies on the introduction of so-called y toxigenes and different approaches have been used for cell knockouts in vivo.
  • HSV-tk herpes simplex virus thymidine kinase
  • this enzyme phosphorylates nontoxic nucleoside analogs like ganciclovir and acyclovir, which are not metabolized by cellular enzymes when used at appropriate concentrations, and converts these drugs into toxins.
  • the toxicity of this viral tk gene is conditional and provides possibilities for targeted and timed ganciclovir-dependent ablation of cells in vivo in transgenic mice. This gene has been used previously in gene therapy and cell removal in vivo, but not as fusion with LacZ. A LacZtk fusion gene was used in this invention.
  • LacZtk fusion protein Both ⁇ -galactosidase (LacZ) and HSV-tk activities are retained within the LacZtk fusion protein, allowing easy detection of LacZ by histological staining and by cell ablation in vivo.
  • the applicability of LacZtk in vivo in a test tissue such as skin is demonstrated since it is easily accessible and houses distinct, well characterized cell populations, and LacZtk transgenic mice could offer novel approaches to the development of animal models for wound healing.
  • Vector pSK3 contains a Sail site for cloning a promoter upstream of the rabbit ⁇ -globin intron (int; 0.65 kb), followed by LacZtk (3.1 kb LacZ fused to 1.68 kb HSV1- tk: the LacZtk gene used here encodes a fusion protein between LacZ (amino acids 1-1021) and HSV1-tk (from amino acid 9)) and a transcription termination/poly- adenylation (pA) fragment from the mouse phosphoglycerate kinase (pg/ )-1 gene (0.4 kb), the mouse pgk- ⁇ promoter (0.5 kb), the neomycin phosphotransferase gene (0.9 kb) and pA(1) from the bovine growth hormone gene (0.3 kb) in pBluescriptKS (3 kb; Stratagene).
  • the human K14 promoter was isolated as a 2 kb-long fragment by two rounds of nested PCR on genomic DNA. Both nested primers contained a Xhol site to facilitate the cloning of promoters. Two different K14-like promoter sequences were obtained, reflecting the existence of multiple K14 alleles.
  • the promoter sequence that was isolated and used in this study is similar (with regard to its restriction map) to a published 3'-end sequence of a K14 promoter that includes the transcriptional start site, and which was successfully used by others in transgenesis [Vassar, R et al; Cell, 1991 , 64,365-380].
  • the bovine K10 promoter has been successfully used in other transgenic mice [Werner, S et al;EMBO J., 1993,12,2635-2643].
  • Zygotes were obtained from FVB mice and were, after injection, reimplanted at the one- or two-cell stage in pseudopregnant B6D2F1 females (F1 hybrid mice of C57BI/6 and DBA/2).
  • PCR was carried out on DNA from ear biopsies. The primers anneal to the 3'-end of LacZ (forward primer: 5'-
  • Annealing temperature for this primer set is 57°C.
  • LacZtk copy numbers were estimated by dot-blot hybridization, using dilutions of the injected fragments for calibration.
  • 189 both are Y ⁇ O-LacZtk mice
  • 13177 K14- acZf/ mouse used
  • the copy number was estimated 1 ,6 and 35, respectively.
  • Administration of ganciclovir was started 7 days after birth (P7) by i.p. injection with 100 ⁇ l Cymevene (4-6 mg/ml; Syntex) in 0.9% NaCI.
  • cryosections were fixed in 0.2% glutardialdehyde, 2 mM MgCI 2 , 5 mM EGTA in 0.1 M sodium phosphate buffer pH 7.4. After washing in 0.01% sodium deoxycholate, 0.02% NP40, 2 mM MgCI 2 in 0.1 M sodium phosphate buffer, they were stained with Xgal (Biosynth) and counterstained with eosin/hematoxylin.
  • cryosections were fixed in acetone, treated with pre-immune serum, incubated overnight with the primary antibody and for 1 hour with the second antibody (TRITC-rabbit anti-mouse or FITC-swine anti- rabbit; Dako), and then mounted.
  • Anti-human K14 Sigma
  • anti-human K10 Dako
  • anti-human K16 LL025; I. McKay and I. Leigh, ICRF, London
  • rabbit anti-mouse collagen IV Biodesign
  • Mice were injected three times with BrdU (24, 16 and 1 hours) before they were sacrificed and sections subjected to immunofluoresence.
  • Pre-immune rabbit serum was used, followed by rat monoclonal anti-BrdU antibody (Harlan Sera-lab) and FITC-rabbit anti-rat antibody (Dako).
  • the K10 and K14 promoter- acZf/ fragments were used for zygote injection to generate transgenic mice.
  • Four female and four male transgenic founders were obtained with both constructs. Three female and one male O-lacZtk founder, and two female and one male K14- acZf/ founder transmitted the lacZtk transgene.
  • LacZtk fusion gene can be used as a cell identifier, including in different keratinocyte populations in the skin.
  • Ganciclovir administration to K10 offspring was not lethal, and litters were sacrificed after 25 days of treatment.
  • the gross phenotype, and the time of its onset, in ganciclovir-treated LacZtk mice was similar, but not identical, for K10 and K14 mice.
  • the major difference is that effects appeared earlier and reached a more severe state more rapidly (within 1-2 days) in K14 than in K10 mice (after 12 versus 20-25 days).
  • the skin at the level of the tail, ears, paws and soles of the feet of all treated transgenes was affected. Internal bleeding and extensive blistering occurred in the tail before the skin became scaly. Blisters do not persist in K10-LacZ# mice and in sections from their skin no epidermal splits are seen.
  • K14-LacZ# litters showed a growth retardation when treated with ganciclovir, which might be due to expression of the transgene in the esophagus and forestomach, leading to disturbed food uptake.
  • K14 levels were strongly elevated in treated O-LacZtk mice , and K14 persisted in the upper KlO- positive layers of the thicker epidermis as well , in particular in ⁇ O-LacZtk mice.
  • the expansion of K14 into suprabasal layers in thickened epidermis is a feature found in psoriasis.
  • the differentiation-specific K10 was never detected in the basal layer , the basal cells remained intact, and the number of K10-positive layers in the epidermis of ganciclovir-treated transgenic mice was always higher as compared with control mice.
  • Intra-epidermal clefts were not detected in treated K10 mice, and limited and localized separation of epidermis from lamina densa was seen in tail sections of K14 mice only.
  • Collagen type IV is a component of the basal lamina that separates epidermis from the dermis in unwounded skin. Staining for this marker suggested that treatment of the LacZtk mice with ganciclovir and the induction of proliferation of keratinocytes did neither cause a destruction of the basal lamina, nor a significant focal increase of this collagen. In both mice, a separation below the lamina densa, i.e. in the dermis, was not detected.
  • the macroscopic phenotype of the treated animals suggested severe inflammation of the skin and this was documented by analysis of the expression of the pro-inflammatory cytokine IL-1 ⁇ .
  • RNase protection assays demonstrated upregulation of IL-1 ⁇ mRNA between day 10-15 in the treated K14-LacZf/c mice and a strikingly increased expression of this cytokine in treated K10 mice after 20 days. These time points coincide with the onset of the external phenotypes and the first histomorphological changes in the epidermis.
  • VEGF vascular endothelial growth factor
  • KGF keratinocyte growth factor
  • TGF- ⁇ 1 transforming growth factor- ⁇ 1
  • the skin of the Y ⁇ Q-LacZtk mice shows - unexpectedly - many characteristics of psoriatic skin which include hyperproliferation, epidermal thickening, an increase of dividing cell layers, suprabasal localization of K14 including the outermost layers of the skin, strong induction of K16, increased VEGF expression which likely leads to increased angiogenesis, simultaneous (pro)inflammation and hyperproliferation, leaving the basal lamina intact.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Diabetes (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Dermatology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to transgenic animals which can act as model for hyperproliferation and/or inflammatory skin diseases such as psoriasis. In particular the invention relates to transgenic animals wherein the transgene comprises a nucleic acid construct wherein a suprabasal cell-selective promoter, a gene that can induce cell ablation such as a viral thymidine kinase gene and optionally a reporter gene is present. In a preferred embodiment the promoter is a regulator region of the gene of the K-10 keratin, whereas the thymidine kinase gene originates from Herpes Simplex Virus type 1 and the reporter gene is preferably a beta-galactosidase gene from E.coli.

Description

Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin.
The present invention relates to transgenic animals which can act as model for skin disease including hyperproliferative disease, such as psoriasis, and skin inflammation. In particular the invention relates to transgenic animals wherein the transgene comprises a nucleic acid construct wherein an epidermal cell-selective promoter, a (preferably viral) thymidine kinase gene and optionally a reporter gene is present.
Psoriasis is a noncontagious skin disorder that most commonly appears as inflamed swollen skin lesions covered with silvery white scale. This most common type of psoriasis is called plaque psoriasis. Psoriasis comes in many different variations and degrees of severity. Different types of psoriasis display characteristics such as pus-like blisters (pustular psoriasis), severe sloughing of the skin (erythrodermic psoriasis), drop-like dots (guttate psoriasis) and smooth inflamed lesions (inverse psoriasis). The degrees of severity of psoriasis are divided into three important categories: mild, moderate and severe. No one knows what causes psoriasis, though it is generally accepted that it has a genetic component, and a recent study has established that it is an autoimmune skin disorder. Scientists believe that a person is born genetically predisposed to psoriasis. One in three people report a family history of psoriasis, but there is no pattern of inheritance. There are many cases in which children with no apparent family history of the disease will develop psoriasis.
Whether a person actually develops psoriasis may depend on something triggering its appearance. Examples of trigger factors include systemic infections such as strep throat, injury to the skin (the Koebner phenomenon), vaccinations, certain medications, and intramuscular injections or oral steroid medications.
Once something triggers a person's genetic tendency to develop psoriasis, it is thought that in turn, the immune system triggers the excessive skin cell reproduction. Epidermal cells (keratinocytes) in the skin are programmed to follow two possible programs: normal growth or wound healing. In a normal growth pattern, skin cells are generated in the basal cell layer, and then move up through the epidermis to the stratum corneum, the outermost layer of the skin. Dead cells are shed from the skin at about the same rate as new new cells are produced, maintaining a balance. This normal process takes about 28 days in man.
When skin is wounded, a wound healing program is triggered, also known as regenerative maturation, involving amongst others increased keratinocyte proliferation and migration. Cells are produced at a much faster rate, theoretically to replace and repair the wound. There is also an increased blood supply and localized inflammation. In many ways, psoriatic skin is similar to skin healing from a wound or reacting to a stimulus such as infection.
Lesional psoriasis is characterized by cell growth in the alternate growth program. Although there is no wound at many psoriatic lesions keratinocytes behave as if there is. These keratinocytes switch from the normal growth program to regenerative maturation. Cells are created and pushed to the surface in as little as 2- 4 days, and the skin cannot shed the cells fast enough. The excessive skin cells build up and form elevated, scaly lesions. The white scale that usually covers the lesion is composed of dead skin cells, and the redness of the lesion is caused by increased blood supply to the area of rapidly dividing skin cells.
There is definitely a need for improved treatment for psoriasis. However no easy and adequate model system exists for testing potential treatments. Transgenic animals are often used as model system for the identification of agents which induce or protect epidermal hyperproliferation often correlated with psoriasis or psoriasis-like phenotypes. On some occasions there has been found that suprabasal expression of integrins or overexpression of growth- and differentiation polypeptides could be associated with psoriasis.
In WO 96/27019 is disclosed a nucleic acid construct comprising a promoter capable of directing expression in the suprabasal cells of the epidermis and means to cause overexpression of an integrin subunit, a skin protein, in the suprabasal cells. However the means to test whether the integrin indeed is expressed and in order to correlate such expression as useful model in transgenic animals for psoriasis is at least laborious. To analyze the assumed expression of the gene several skin tissues from transgenic mice were either examined by histological, in situ hybridisation or immunofluorescence studies. In addition this method is not inducible and hence uncontrollable.
In EP 633,315 is disclosed a transgenic animal whose cells contain a recombinant genetic construction formed of a detectable marker gene and a regulator region of the gene K6 keratin capable of being induced in the epidermis of the transgenic animal in response to hyperproliferative stimuli. 12-O-tetra decanoylphorbol-13-acetate (TPA) or 7, 12-dimethylbenza-anthracene (DMBA) were topically applied to the skin of the transgenic animal in order to verify whether the exogenous gene (called transgene) is induced in the correct regions of the epidermis subjected to hyperproliferative stimuli agents like retinoic acid. For this the tail of the animals was daily topically treated for 14 days demonstrating again a very laborious and time consuming method. This model only shows the proper function of the regulator region of the K6 keratin gene as such.
In WO90/15869 is described a transgenic animal which can be used as model skin-testing system. To this effect a genetic construct has been made encoding a uv- light inducible promoter in combination with a number of reporter genes. A problem encountered by a person skilled in the art using this construct is that using uv-light also has a profound effect on other type of skin cells and that as a consequence thereof a proper interpretation of results thus obtained with this model is at least difficult to make.
Therefore an object of the present invention is to provide an inducible animal model of hyperproliferative skin cell disease and skin inflammation, means of producing such an animal model and uses for the animal model not having the disadvantages above mentioned.
A first aspect of the invention provides a nucleic acid construct comprising a suprabasal cell-selective promoter and a gene that can induce cell ablation. This phenomenon of cell ablation is nowhere disclosed in the prior art and hence a novel feature of the current invention.
A further aspect of the invention is that the construct comprises a (preferably viral) thymidine kinase gene responsible directly or indirectly for the cell ablation.
Optionally a reporter gene is present in said construct. By "suprabasal cell-selective promoter" is included all nucleic acid elements that direct expression selectively in the suprabasal layer of the epidermis of an animal. A promoter to be expressed in all suprabasal layers of the epidermis is suitable however it is preferred if said promoter is a keratinocyte stage selective promoter. The organisation of the basement membrane, basal layer and suprabasal layers, of the epidermis of a mammal is known to a person skilled in the art.
Briefly the epidermis in the adult organism is a stratified flat epithelium in which two cell layers are important for growth control of keratinocytes: the basal layer, formed by a single layer of cuboid cells which have the ability to divide, and the suprabasal layer, formed of cells coming from the basal layer and which have lost the ability to divide.
In a preferred embodiment the promoter is a regulator region of the gene of the
K-10 keratin, whereas the thymidine kinase gene or modified forms of it originates from Herpes Simplex Virus type 1 and the reporter gene is preferably a beta- galactosidase gene from E.coli.
The nucleic acid construct may contain one or more suprabasal or basal keratinocyte cell-selective promoters or more than one type of suprabasal cell- selective promoter. The nucleic acid constructs of the invention can readily be made using well known genetic engineering techniques such as those described in Sambrook et al,(1989) Molecular Cloning; A laboratory manual, (Cold Spring Harbor Laboratory Press,NY).
Another aspect of the invention is a host cell transformed with the nucleic acid construct according to the first aspect of the invention. The host cell can either be prokaryotic or eukaryotic. Bacterial cells are preferred prokaryotic host cells; preferred eukaryotic host cells include yeast and mammalian cell lines like mouse, rat, monkey or human fibroblastic cell lines.
Particularly preferred host cells are animal, preferably mammalian, embryo cells which can be used to generate transgenic animals. The nucleic acid constructs of the invention can for instance be introduced into suitable embryo cells by transfection or in zygote stage embryos by microinjection. For this purpose mouse, rabbit, sheep, guinea pig, rat, pig, cow or primate embryo cells or zygotes can be used. Particularly suitable are mouse embryo cells.
A further aspect of the invention is also a method of producing a transgenic animal comprising the steps of :
(a) introducing into an embryo cell or zygote stage embryo of said animal a nucleic acid construct according to the invention,
(b) introducing the embryo reconstituted from the embryo cells from step (a) by introduction into an acceptor embryo or implantation of the microinjected zygote into a pseudopregnant female animal,
(c) assisting the female in step (b) until the embryo has developed sufficiently to be independent of its mother and
(d) assisting the said independent transgenic animal
A further embodiment of the current invention is a transgenic animal wherein the transgene comprises the nucleic acid construct according to the invention and wherein said transgenic animal or its offspring or germ cell line thereof carrying the transgene has or can develop a symptom of hyperproliferative skin disease, such as psoriasis, and inflammation.
The preparation of animals used in any method of the invention will utilize the recently developed technology of introducing foreign genes into the germ line of an animal. The animal carrying in its germ line a foreign piece of DNA, termed a transgene, is called a transgenic animal.
Any method known in the art may be used to produce transgenic animals such as microinjection, transfection of DNA, sperm transfer, virus-mediated gene transfer and electroporation.
The term "transgenic animal" refers to non-human animals which have incorporated a foreign gene (called transgene) into their genome; because this gene is present in germ line tissues, it is passed from parent to offspring establishing lines of transgenic animals from a first founder animal. It will be appreciated that when a nucleic acid construct according to the invention is introduced into an animal to make it transgenic the nucleic acid may not necessarily remain in the form as introduced.
By "offspring" is meant any product of the mating of the transgenic animal whether or not with another transgenic animal, provided that the offspring carries the transgene. Furthermore is included any germ cell of the transgenic animal which can be used to propagate a further animal comprising a transgene according to the invention.
By "cell ablation" is meant the controllable induction of cell damage and cell death in preferably viral thymidine kinase positive cells by application, either systematic or topically, of anti-viral drugs that target the preferably thymidine kinase transgene.
A further aspect of the present invention includes primary or permanent basal or suprabasal keratinocyte cells and/or cell lines derived from a transgenic animal. These cells can be cultured by known techniques and provide established model systems on their own merits.
Another aspect of the invention is a method for inducing the development of a symptom of hyperproliferative and/or inflammatory skin disease, including psoriasis, of a transgenic animal according to the invention comprising the step of contacting said transgenic animal with an agent which induces said skin disease or psoriasis- like phenotype. Agents provoking this effect are surprisingly anti-viral drugs such as ganciclovir and acyclovir as described below. It is known that ganciclovir and acyclovir are phosphorylated by thymidine kinase and converted to toxins whereafter cells of the epidermis die off.
Conveniently the agent is administered by any route like topical administration, by injection or providing the agent in food and/or drink for the animal. Part of the invention is also a method of selecting a compound which inhibits hyperproliferative and/or inflammatory skin disease including psoriasis or psoriasislike symptom comprising administering a compound to a transgenic animal obtained by the above descibed method and after a period of time (anything from four hours to twelve weeks) determining whether the compound prevents, reduces or eliminates said symptom.
A compound obtainable by this method is very useful in treating hyperproliferative and/or inflammatory skin disease, including psoriasis; whereas the use of said compound which modulates a basal and/or suprabasal cell function in the manufacture of a medicament for the treatment of psoriasis is included in the scope of the invention.
Of great importance for the invention is the use of a suitable selection marker (called reporter gene) coding for an easily identifiable product.
For visualizing the induction of cell ablation of the epidermis the reporter gene, preferably beta-galactosidase, is placed under control of the regulator region of the K-10 keratin and introduced into the genome of transgenic animals.
When the skin of the transgenic animal thus obtained is subjected to expression of the β-galactosidase/viral thymidine kinase gene fusion protein in the presence of X-gal, the substrate for beta-galactosidase, the epidermal suprabasal cells develop a blue color.
It is our invention that using a nucleic acid construct comprising as promoter a regulator region of the gene of the K-10 keratin, as the thymidine kinase gene the gene originating from Herpes Simplex Virus type 1 and as reporter gene a beta- galactosidase gene in such a concept the synthesis of the thymidine kinase activity allows ganciclovir-dependent ablation of suprabasal keratinocytes in transgenic mice. o
It is well known that thymidine kinase phosphorylates nontoxic nucleoside analogs like ganciclovir and acyclovir, which are not metabolized by cellular enzymes when used at appropriate concentrations, and converts these drugs into toxins.
As a consequence thereof the suprabasal cells of the epidermis are expected to die off.
Unexpected so-called K10 acZf/ transgenic mice demonstrated an hyperproliferative phenotype, characterized by inflammation, a disturbed differentation pattern of the keratinocytes and thickening of the epidermis as well. Such a transgene model provides an inducible and reversible system for in depth study of proliferation and differentation control of skin disorders.
It is for the first time demonstrated that as a consequence of treatment by ganciclovir or acyclovir the epidermal cells do not die but surprisingly show a hyperproliferation and/or inflammation of the skin. In the same model a return to the original state of the epidermal cells is feasible after the ganciclovir or acyclovir treatment has stopped. Ganciclovir ablated postmitotic suprabasal keratinocytes in YΛQ-LacZtk mice, resulted in transient blister formation and severe inflammation. Unexpectedly, these mice developed many characteristics of a psoriatic-like phenotype such as the strong induction of the genes encoding the pro-inflammatory cytokine interleukin-1 β (IL-1β), vascular endothelial growth factor (VEGF) and keratinocyte growth factor (KGF). These results demonstrate that a defect in the epidermis, without breach of the basal lamina, is sufficient for inflammation and suggest that suprabasal keratinocytes exert negative growth control on basal cells in unwounded skin. Similar, but more severe phenotypes were observed in λΛ-LacZtk mice in which LacZtk is under control of the promoter of a heterologous K14 gene. The results illustrate the feasibility of controlled in vivo cell ablation based on LacZtk. Both strains of mice represent useful new models for studying proliferation and differentiation control in the skin.
Rigorous control of cellular proliferation, differentiation and migration by cell-cell and cell-matrix interaction is essential for normal embryogenesis, tissue homeostasis and repair. Consequently, the removal of a specific cell type from a tissue or organ allows to identify certain cells as stem or progenitor cells, or as source of signals other cell types may be dependent upon for their normal function, growth or differentiation. Ablation of cells from animals relies on the introduction of so-called y toxigenes and different approaches have been used for cell knockouts in vivo. These genes encode a non-secretory protein that itself is a toxin (A-chain of Corynebacte um diphteria and Ricinus communis toxins) or an enzyme, such as herpes simplex virus thymidine kinase (HSV-tk), but neither one represents an easy- to-detect marker transgene (such as LacZ from E. coli) for experimental purposes in organisms such as the mouse. HSV-tk, and engineered forms of it, can substitute for cellular tk and allows positive and negative selection of HSV-tk-producing cells. As mentioned above this enzyme phosphorylates nontoxic nucleoside analogs like ganciclovir and acyclovir, which are not metabolized by cellular enzymes when used at appropriate concentrations, and converts these drugs into toxins. Unlike the bacterial toxins, the toxicity of this viral tk gene is conditional and provides possibilities for targeted and timed ganciclovir-dependent ablation of cells in vivo in transgenic mice. This gene has been used previously in gene therapy and cell removal in vivo, but not as fusion with LacZ. A LacZtk fusion gene was used in this invention. Both β-galactosidase (LacZ) and HSV-tk activities are retained within the LacZtk fusion protein, allowing easy detection of LacZ by histological staining and by cell ablation in vivo. The applicability of LacZtk in vivo in a test tissue such as skin is demonstrated since it is easily accessible and houses distinct, well characterized cell populations, and LacZtk transgenic mice could offer novel approaches to the development of animal models for wound healing. Expression has been performed of LacZtk genes in suprabasal and/or basal keratinocytes in the epidermis of transgenic mice, using the previously characterized promoter region of K-10 and -14 genes, respectively.The effects of ganciclovir-dependent cell ablation in the epidermis by immunohistochemical analysis of structural marker proteins and mRNA analysis of selected cytokines were analyzed.
Examples
Vector pSK3 for LacZtk transgenesis and isolation of human K14 promoter sequences
Vector pSK3 contains a Sail site for cloning a promoter upstream of the rabbit β-globin intron (int; 0.65 kb), followed by LacZtk (3.1 kb LacZ fused to 1.68 kb HSV1- tk: the LacZtk gene used here encodes a fusion protein between LacZ (amino acids 1-1021) and HSV1-tk (from amino acid 9)) and a transcription termination/poly- adenylation (pA) fragment from the mouse phosphoglycerate kinase (pg/ )-1 gene (0.4 kb), the mouse pgk-λ promoter (0.5 kb), the neomycin phosphotransferase gene (0.9 kb) and pA(1) from the bovine growth hormone gene (0.3 kb) in pBluescriptKS (3 kb; Stratagene). The human K14 promoter was isolated as a 2 kb-long fragment by two rounds of nested PCR on genomic DNA. Both nested primers contained a Xhol site to facilitate the cloning of promoters. Two different K14-like promoter sequences were obtained, reflecting the existence of multiple K14 alleles. The promoter sequence that was isolated and used in this study is similar (with regard to its restriction map) to a published 3'-end sequence of a K14 promoter that includes the transcriptional start site, and which was successfully used by others in transgenesis [Vassar, R et al; Cell, 1991 , 64,365-380]. The bovine K10 promoter has been successfully used in other transgenic mice [Werner, S et al;EMBO J., 1993,12,2635-2643].
Transgenesis and in vivo treatment with ganciclovir
Zygotes were obtained from FVB mice and were, after injection, reimplanted at the one- or two-cell stage in pseudopregnant B6D2F1 females (F1 hybrid mice of C57BI/6 and DBA/2). To identify transgenic mice, PCR was carried out on DNA from ear biopsies. The primers anneal to the 3'-end of LacZ (forward primer: 5'-
TGGCGATTACCGTTGATGTTGA) and the 5'-end of tk (reverse primer: 5'-
GGCGGTCGATGTGTCTGTCC). Annealing temperature for this primer set is 57°C.
LacZtk copy numbers were estimated by dot-blot hybridization, using dilutions of the injected fragments for calibration. For female founders 43.3 (used extensively) and 189 (both are YΛO-LacZtk mice), and 13177 (K14- acZf/ mouse used, the copy number was estimated 1 ,6 and 35, respectively. Administration of ganciclovir was started 7 days after birth (P7) by i.p. injection with 100 μl Cymevene (4-6 mg/ml; Syntex) in 0.9% NaCI.
Histological analysis
For histological analysis, cryosections were fixed in 0.2% glutardialdehyde, 2 mM MgCI2, 5 mM EGTA in 0.1 M sodium phosphate buffer pH 7.4. After washing in 0.01% sodium deoxycholate, 0.02% NP40, 2 mM MgCI2 in 0.1 M sodium phosphate buffer, they were stained with Xgal (Biosynth) and counterstained with eosin/hematoxylin. For immunofluorescence, cryosections were fixed in acetone, treated with pre-immune serum, incubated overnight with the primary antibody and for 1 hour with the second antibody (TRITC-rabbit anti-mouse or FITC-swine anti- rabbit; Dako), and then mounted. Anti-human K14 (Sigma), anti-human K10 (Dako), anti-human K16 (LL025; I. McKay and I. Leigh, ICRF, London) and rabbit anti-mouse collagen IV (Biodesign) were used. Mice were injected three times with BrdU (24, 16 and 1 hours) before they were sacrificed and sections subjected to immunofluoresence. Pre-immune rabbit serum was used, followed by rat monoclonal anti-BrdU antibody (Harlan Sera-lab) and FITC-rabbit anti-rat antibody (Dako).
Summary of results
Vector pSK3, which allows insertion of a promoter upstream of LacZtk, was constructed. A K10 and K14 promoter which have been shown to target expression of transgenes to suprabasal and basal keratinocytes, respectively, were cloned into pSK3 (plasmids pK10SK3 and pK14SK3). LacZtk synthesis in cultured human (Ha- cat) and mouse (BALB/MK) keratinocytes, stably transformed with vectors pK10SK3 or pK14SK3, was confirmed by staining for vector-encoded LacZ protein and RNase protection analysis to detect expression of the keratin promoter-driven LacZtk transcript, and the cells were shown to be sensitive to ganciclovir. The K10 and K14 promoter- acZf/ fragments were used for zygote injection to generate transgenic mice. Four female and four male transgenic founders were obtained with both constructs. Three female and one male O-lacZtk founder, and two female and one male K14- acZf/ founder transmitted the lacZtk transgene. Most of the male founders did not transmit the LacZtk transgene, as observed previously with tk mice. To document synthesis of LacZ, cryosections from tail, ear, back skin and liver (negative control) were incubated with Xgal. Transgenic offspring of two female λQ-LacZtk and one female K14- acZ / founder stained positive for LacZ in the epidermis. In the KIO- acZf/ mice, LacZ was confined to the suprabasal cell layers, which is identical to endogenous. Expression of the transgene in λA-LacZtk mice was found in the basal cells and in the outer root sheath of the hair follicles, again in accordance with the expression pattern of K14. Weak positive staining of LacZ in the suprabasal layers of the skin of YΛA-LacZtk mice, seen as a columnar pattern, reflects the stability of the LacZtk fusion protein in differentiated cells that have left the basal cell layer. These results demonstrate that the LacZtk fusion gene can be used as a cell identifier, including in different keratinocyte populations in the skin.
Offspring of K14- and O-LacZtk mice were then used for cell ablation and the phenotypes characterized. Most surprising, instead of reducing cell numbers upon ganciclovir treatment, the reverse was seen and the mice developed first blisters, followed by a psoriasis-like phenotype. In the K Q-LacZtk mice, this involves likely killing of postmitotic cells. In these studies, transgenic and non-transgenic littermates were injected daily with ganciclovir (0.6 or 0.4 mg/day/mouse for K10- or YΛA-LacZtk mice, respectively) from day 7 after birth. The majority of K14 mice died after 15 days. Ganciclovir administration to K10 offspring was not lethal, and litters were sacrificed after 25 days of treatment. The gross phenotype, and the time of its onset, in ganciclovir-treated LacZtk mice was similar, but not identical, for K10 and K14 mice. The major difference is that effects appeared earlier and reached a more severe state more rapidly (within 1-2 days) in K14 than in K10 mice (after 12 versus 20-25 days). The skin at the level of the tail, ears, paws and soles of the feet of all treated transgenes was affected. Internal bleeding and extensive blistering occurred in the tail before the skin became scaly. Blisters do not persist in K10-LacZ# mice and in sections from their skin no epidermal splits are seen. Consequently it is assumed that the blistering relates to the initial destruction of K10-positive cells before they are replaced with K16-positive cells which may be ganciclovir-insensitive. The trunk skin appeared affected only in K14-LacZtk mice, but was never as drastic as in tail, ears and feet. In contrast to nontransgenic treated littermates, K14-LacZ# litters showed a growth retardation when treated with ganciclovir, which might be due to expression of the transgene in the esophagus and forestomach, leading to disturbed food uptake.
Further analysis of the phenotypes was done in cryosections made from different regions of the LacZtk mice at day 15 (K14 mice) and 21 (K10 mice) of treatment. The tail skin of the mice was further documented by immunostaining of four marker proteins, i.e. K14, K10, K16, and collagen type IV. This analysis showed very similar results for K10 and K14 mice but, in the latter, the spinous layers were reduced in number or - in the most dramatic cases - were no longer forming an organized reticular cell staining pattern after 15 days of treatment . K14 levels were strongly elevated in treated O-LacZtk mice , and K14 persisted in the upper KlO- positive layers of the thicker epidermis as well , in particular in λO-LacZtk mice. The expansion of K14 into suprabasal layers in thickened epidermis is a feature found in psoriasis. The differentiation-specific K10 was never detected in the basal layer , the basal cells remained intact, and the number of K10-positive layers in the epidermis of ganciclovir-treated transgenic mice was always higher as compared with control mice. Intra-epidermal clefts were not detected in treated K10 mice, and limited and localized separation of epidermis from lamina densa was seen in tail sections of K14 mice only. Collagen type IV is a component of the basal lamina that separates epidermis from the dermis in unwounded skin. Staining for this marker suggested that treatment of the LacZtk mice with ganciclovir and the induction of proliferation of keratinocytes did neither cause a destruction of the basal lamina, nor a significant focal increase of this collagen. In both mice, a separation below the lamina densa, i.e. in the dermis, was not detected. The observed differences in keratin staining minimalize the contribution of previously documented bystander effects to the phenotypes in both LacZtk mice, since the phenotypes would otherwise be identical. Further evidence for keratinocyte proliferation in LacZtk transgenes came from injections with BrdU, followed by analysis of cryosections by immunofluorescence with an anti-BrdU antibody. After 21 days, a significant increase in positive nuclei in the basal and, to a lesser extent, in the suprabasal epidermis was seen in the K10- LacZtk mice. So destruction of postmitotic keratinocytes in the suprabasal cell layers of the epidermis in YΛO-LacZtk mice induced hyperproliferation of basal cells. In K14- LacZtk mice, very few positive nuclei were found after 15 days, as a result of extensive cell killing of keratinocytes in the basal layer , but the effects are moderate in hair follicles. Their skin is maintained, which suggests that epidermal cells are replaced by other cells derived from stem cells of the hair follicle bulge.
The macroscopic phenotype of the treated animals suggested severe inflammation of the skin and this was documented by analysis of the expression of the pro-inflammatory cytokine IL-1 β. RNase protection assays demonstrated upregulation of IL-1β mRNA between day 10-15 in the treated K14-LacZf/c mice and a strikingly increased expression of this cytokine in treated K10 mice after 20 days. These time points coincide with the onset of the external phenotypes and the first histomorphological changes in the epidermis. Expression levels of IL-1 β correlated with the expression of vascular endothelial growth factor (VEGF), keratinocyte growth factor (KGF) and transforming growth factor-β1 (TGF-β1) , which have been shown to be upregulated by IL-1 β in vitro. VEGF is a potent stimulator of angiogenesis and vascular permeability and is produced at high levels in macrophages and keratinocytes after injury. The increased VEGF expression upon ganciclovir treatment might be responsible for the severe bleeding seen in these animals. KGF is produced by mesenchymal cells, particularly during wound healing, and acts as a potent mitogen for epithelial cells. Consequently inflammation caused by ablation of keratinocytes is sufficient to induce KGF expression in the dermis, although to a significantly lesser extent as compared with wound healing models where the dermis is distorted. This increased KGF expression could be at least partially responsible for the increased keratinocyte proliferation seen in YΛQ-LacZtk mice.
In summary the applicability of a novel LacZtk fusion gene in transgenesis and in vivo cell ablation has been demonstrated. For the first time ganciclovir-inducible phenotypes in the skin have been generated which are characterized by inflammation, defects in the balance between keratinocyte proliferation and differentiation, and hyperproliferation, similar to many pathological skin disorders. While ablation of cells from the basal layer in the epidermis in K14- acZf/ mice gave the predicted dramatic effects, the controlled ablation of cells from
Figure imgf000017_0001
mice was less drastic but resulted unexpectedly in a psoriasis-like phenotype which clearly exposes hyperproliferation of epidermal cells and skin inflammation. Another feature is that the ganciclovir effects on suprabasal cells (in the YΛQ-LacZtk mice), which have been proposed to exert a negative control on basal keratinocytes, could eliminate this inhibitory signal, which results in keratinocyte proliferation either directly and/or through the inflammatory response. The skin of the YΛQ-LacZtk mice shows - unexpectedly - many characteristics of psoriatic skin which include hyperproliferation, epidermal thickening, an increase of dividing cell layers, suprabasal localization of K14 including the outermost layers of the skin, strong induction of K16, increased VEGF expression which likely leads to increased angiogenesis, simultaneous (pro)inflammation and hyperproliferation, leaving the basal lamina intact.

Claims

Claims
1. A nucleic acid construct comprising a suprabasal cell-selective promoter and a gene that can induce cell ablation.
2. A nucleic acid construct according to claim 1 wherein the gene is a thymidine kinase gene and/or fragments or variants thereof.
3. A nucleic acid construct according to claim 1 or 2 wherein in addition a reporter gene is present.
4. A nucleic acid construct according to claim 3 wherein the promoter is a regulator region of the gene of the K-10 keratin, the thymidine kinase gene is herpes simplex virus type 1 thymidine kinase gene and the reporter gene is a beta- galactosidase gene.
5. Host cell transformed with a construct according to any of the claims 1 to 4.
6. Method of producing a transgenic animal comprising the steps of :
(a) introducing into an embryo cell or embryo of said animal a nucleic acid construct according to any of the claims 1 to 4 ,
(b) introducing the embryo from step (a) into a pseudopregnant female animal,
(c) assisting the female in step (b) until the embryo has developed sufficiently to be independent of its mother and
(d) assisting the said independent transgenic animal
7. A transgenic animal obtainable by the method according to claim 6 wherein the transgene comprises the nucleic acid construct of any of the claims 1 to 4.
8. A transgenic animal according to claim 7 which has or can develop a skin disease including hyperproliferative and/or inflammatory disease such as psoriasis. Λ _,
1 7
9. A transgenic animal according to any of the claims 7 or 8 wherein the animal is an offspring of the said animal, or a germ cell line thereof carrying the transgene.
10. A basal or suprabasal cell and/or cell line derived from a transgenic animal according to any of the claims 7 to 9.
11. Method for inducing the development of a symptom of hyperproliferative and/or inflammatory skin disease including psoriasis or enhancing the psoriasis-like phenotype of a transgenic animal according to claim 9 comprising the step of contacting said transgenic animal with an agent which induces said development or said phenotype.
12. Transgenic animal obtainable by the method according to claim 11.
13. Method of selecting a compound which inhibits hyperproliferative and/or inflammatory skin disease including psoriasis or psoriasis-like symptom comprising
(a) administering a compound to a transgenic animal according to claim 12
(b) after a period of time determining whether the compound prevents, reduces or eliminates said symptom.
14. Compound obtainable by the method according to claim 13.
15. Use of a compound which modulates a basal and/or suprabasal cell function in the manufacture of a medicament for the treatment of hyperproliferative and/or inflammatory epidermal cell disease.
PCT/EP1998/001935 1997-04-03 1998-03-30 Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin WO1998044095A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU73343/98A AU7334398A (en) 1997-04-03 1998-03-30 Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP97200974 1997-04-03
EP97200974.0 1997-04-03

Publications (1)

Publication Number Publication Date
WO1998044095A1 true WO1998044095A1 (en) 1998-10-08

Family

ID=8228165

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1998/001935 WO1998044095A1 (en) 1997-04-03 1998-03-30 Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin

Country Status (2)

Country Link
AU (1) AU7334398A (en)
WO (1) WO1998044095A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2352929A1 (en) * 2009-08-14 2011-02-24 Centro De Investigaciones Energeticas. Medioamb Ientales Y Tecnologicas (Ciemat) Humanised psoriasis model

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0494776A1 (en) * 1991-01-11 1992-07-15 University Of Edinburgh Method of altering the metabolic state of non-dividing cells and obtained transgenic animals
WO1993022430A1 (en) * 1992-04-30 1993-11-11 Baylor College Of Medicine Development of a vector to target gene expression to the epidermis of transgenic animals
EP0633315A2 (en) * 1993-03-29 1995-01-11 Centro De Investigaciones Energeticas Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Transgenic animals for the determination of agents which stimulate or repress epidermal hyperproliferation and hair growth
WO1996014420A1 (en) * 1994-11-04 1996-05-17 Cancer Research Campaign Technology Limited Inducible cell ablation
WO1996027019A1 (en) * 1995-02-25 1996-09-06 Imperial Cancer Research Technology Limited Transgenic animals as model of psoriasis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0494776A1 (en) * 1991-01-11 1992-07-15 University Of Edinburgh Method of altering the metabolic state of non-dividing cells and obtained transgenic animals
WO1993022430A1 (en) * 1992-04-30 1993-11-11 Baylor College Of Medicine Development of a vector to target gene expression to the epidermis of transgenic animals
EP0633315A2 (en) * 1993-03-29 1995-01-11 Centro De Investigaciones Energeticas Medioambientales Y Tecnologicas (C.I.E.M.A.T.) Transgenic animals for the determination of agents which stimulate or repress epidermal hyperproliferation and hair growth
WO1996014420A1 (en) * 1994-11-04 1996-05-17 Cancer Research Campaign Technology Limited Inducible cell ablation
WO1996027019A1 (en) * 1995-02-25 1996-09-06 Imperial Cancer Research Technology Limited Transgenic animals as model of psoriasis

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BAILLEUL, B. ET AL.: "Skin hyperkeratosis and papilloma formation in transgenic mice expressing a ras oncogene from a suprabasal keratin promoter", CELL, vol. 62, 24 August 1990 (1990-08-24), NA US, pages 697 - 708, XP002040265 *
BLESSING, M. ET AL.: "Enhancer elements directing cell-type-specific expression of cytokeratin genes and changes of the epithelial cytoskeleton by transfections of hybrid cytokeratin genes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 8, no. 1, 1989, WASHINGTON US, pages 117 - 126, XP002040268 *
BLESSING, M. ET AL.: "Overexpression of bone morphogenetic Protein-6 (BMP-6) in the epidermis of transgenic mice: inhibition or stimilation of proliferation depending on the pattern of transgene expression and formation of psoriatic lesions", JOURNAL OF CELL BIOLOGY, vol. 135, no. 1, October 1996 (1996-10-01), pages 227 - 239, XP002040264 *
CHENG, J. ET AL.: "Cachexia and graft-vs.-host-disease-type skin changes in keratin promoter-driven TNFalpha transgenic mice", GENES & DEVELOPMENT, vol. 6, no. 8, August 1992 (1992-08-01), pages 1444 - 1456, XP002040267 *
KRUEGER, G.G. ET AL.: "Psoriasis", JOURNAL OF THE AMERICAN ACADEMY OF DERMATOLOGY, vol. 11, no. 5 part 2, November 1994 (1994-11-01), pages 937 - 947, XP002040269 *
ROTHNAGEL, J.A. ET AL.: "Development of an epidermal-specific expression vector for targeting gene expression to the epidermis of transgenic mice", CLINICAL RESEARCH, vol. 38, no. 2, April 1990 (1990-04-01), pages 688a, XP002040266 *
SHECHTER, H. & BRENNER, S.: "Research models for psoriasis: "Great expectations"", INTERNAL JOURNAL OF DERMATOLOGY, vol. 34, no. 7, July 1995 (1995-07-01), pages 448 - 455, XP002040263 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2352929A1 (en) * 2009-08-14 2011-02-24 Centro De Investigaciones Energeticas. Medioamb Ientales Y Tecnologicas (Ciemat) Humanised psoriasis model
WO2011018545A3 (en) * 2009-08-14 2011-07-07 Centro De Investigaciones Energéticas, Medioambientales Y Tecnológicas (Ciemat) Humanised psoriasis model

Also Published As

Publication number Publication date
AU7334398A (en) 1998-10-22

Similar Documents

Publication Publication Date Title
Overbeek et al. Lens-specific expression and developmental regulation of the bacterial chloramphenicol acetyltransferase gene driven by the murine alpha A-crystallin promoter in transgenic mice.
Leighton et al. An enhancer deletion affects both H19 and Igf2 expression.
AU683227B2 (en) Tetracycline repressor-mediated binary regulation system for control of gene expression in transgenic animals
Liu et al. Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development.
Shani et al. Expression of human serum albumin in the milk of transgenic mice
US20040250300A1 (en) Expression of proteins in milk
Fujiwara et al. Position‐independent and high‐level expression of human α‐lactalbumin in the milk of transgenic rats carrying a 210‐kb YAC DNA
WO1994004672A9 (en) Tetracycline repressor-mediated binary regulation system for control of gene expression in transgenic animals
Yoshida et al. Neural and skin cell‐specific expression pattern conferred by steel factor regulatory sequence in transgenic mice
JPH08504562A (en) Production of recombinant polypeptides by bovine species and transgenic methods
US5917123A (en) Transgenic mice containing a nucleic acid encoding tumor necrosis factor-α under the control of a cardiac specific regulatory region
US6087554A (en) Transgenic animals for the determination of agents which stimulate or repress epidermal hyperproliferation and hair growth
US20130131317A1 (en) Expression of secreted human alpha-fetoprotein in transgenic animals
US20050160483A1 (en) Transgenically produced decorin
DiSepio et al. Characterization of loricrin regulation in vitro and in transgenic mice
AU2001259465A1 (en) Transgenically produced decorin
Pondel et al. The developmental regulation of the human ζ-globin gene in transgenic mice employing β-galactosidase as a reporter gene
Yang et al. Transgenic farm animals: applications in agriculture and biomedicine
WO1998044095A1 (en) Transgenic animal with controllable hyperproliferation and inflammation phenotype in the skin
Asante et al. Tissue specific expression of an α-skeletal actin-lacZ fusion gene during development in transgenic mice
US20020148000A1 (en) HS-40 enhancer-containing vector in transgenic animals
US5548075A (en) DNA cassette and transgenic organisms carrying lytic peptide-encoding genes
JPH10507070A (en) IKAROS transgenic cells and animals
Soulier et al. Introduction of a proximal stat5 site in the murine α-lactalbumin promoter induces prolactin dependency in vitro and improves expression frequency in vivo
JP5274015B2 (en) Saspace knockout animal

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998541176

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: CA