WO1998042203A1 - Improving the availability of nutrients in a ruminant using piromyces or neocallimastix fungi - Google Patents

Abstract

A method for increasing the availability of digestible nutrients to a ruminant animal, the method comprising the step of administering to the rumen of said animal an effective amount of at least one non-indigenous fungus.

Description

IMPROVING THE AVAILABILITY OF NUTRIENTS IN A RUMINANT USING PIROMYCES OR NEOCALLIMASΗX FUNGI

Background

The present invention relates to novel fungi and a method for using non- indigenous fungi to improve the availability of digestible nutrients to a ruminant animal. More particularly, the present invention relates to fungal isolates from the Piromyces and Neocallimastix genera, and their use to improve the availability of digestible nutrients to sheep. The invention also relates to nucleic acid sequences including probes and primers and to methods for detecting fungi in ruminant animals.

The rumen or forestomach is an organ found in the digestive tract of certain herbivorous mammals. The rumen is located prior to the gastric stomach and is the site where digestion and fermentation of plant material occurs through the activity of microbial populations.

Anaerobic fungi, bacteria and protozoa represent the three major groups of microorganisms in the rumen. The anaerobic fungi make a vital contribution to the digestion of plant fibre and in particular, plant fibre in poor or low quality feed. Several different types of fungi normally exist in the rumen of ruminant animals, including sheep, and it has been established that different fungi in the rumen digest plant fibre at different rates.

When ruminant animals are fed on poor quality feed they often take less feed than is required to meet their nutritional requirements, causing a loss of productivity. In this respect, the quality of feed available to grazing animals may vary appreciably depending on the time of the year. At present, when animals are fed on low quality pasture they are often provided with feed supplements of high quality nutrients such as grain concentrates or hay. These supplements are generally provided at regular and shortly spaced intervals and are labour intensive. The present invention attempts to overcome or at least partially alleviate the problems described above and is based on the identification and isolation of non-indigenous fungi that survive and persist in the rumen of sheep. The non- indigenous fungi have been found to degrade plant fibre at a higher rate than the indigenous fungi and are useful in improving the availability of digestible nutrients to ruminant animals.

Summary of the Invention

The present invention provides a method for increasing the availability of digestible nutrients to a ruminant animal, the method comprising the step of administering to the rumen of said animal an effective amount of at least one non-indigenous fungus.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers including method steps.

Further, when the following description refers to "ruminant animals", this term will be understood to include all ruminant and ruminant-like animals, being members of the Order Artiodactyl and having a pre-gastric fermentation in a rumen (for ruminant animals), or a similar part of the digestive tract such as the paunch (for ruminant-like animals)

Preferably, the non-indigenous fungus is selected from the group comprising Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2. However, the non-indigenous fungus may be another suitable fungus readily isolated from herbivores or ruminants and identified by a person skilled in the art, provided the fungus is capable of surviving in the rumen of the animal to which it is administered. Alternatively, the method may involve the administration of a plurality of non-indigenous fungi, preferably selected from the aforementioned group. The fungi of the present invention may be obtained from a variety of sources. Preferably, Piromyces CS15 is isolated from cattle, and in particular fresh cattle faeces or the rumen of cattle. Preferably, Neocallimastix TGB1 and Piromyces TZB2 are isolated from gemsboks and zebras respectively and in particular the rumen or faeces of gemsboks and the faeces of zebras.

Deposits of Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2 were made at the Australian Government Analytical Laboratories (AGAL) of 1 Suakin Street, Pymble, New South Wales, Australia on 21 March 1997. AGAL is an International Depository Authority under the Budapest Treaty. The following accession numbers were allocated to the deposits.

The fungus may be administered to the rumen in any of a number of ways apparent to one skilled in the art. The administration may be direct to the rumen, for example by an intra-ruminal device or the like, or indirect, for example by way of oral delivery.

Preferably, the fungus is administered intra-ruminally or orally. When the fungus is administered intra-ruminally, it is preferably administered using a controlled release device such as the device described in Australian patent 555998. When the fungus is administered orally it is preferably administered as a single dose as required or as a number of doses over a predetermined time period. For example, a dose may be administered on 3 or 4 consecutive days. The fungus may be delivered in a variety of forms. For example, the fungus may be formulated into a veterinary preparation.

Thus, the present invention also provides a veterinary preparation comprising at least one biologically pure fungus selected from the group comprising Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2 and a suitable carrier. The veterinary preparation may also comprise a plurality of biologically pure fungi selected from the group comprising Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2 and a suitable carrier.

In one particular form, the fungus is administered orally as a live culture. Preferably, the culture is three to four days old and is administered in a carrier such as culture medium. Of course, other carriers may be used as required.

The effective dose may be varied and may be at least partially dependent on the type of ruminant animal receiving the dose. In this respect, it is expected that the larger the animal receiving the dose the larger the dose of the fungus required to constitute an effective amount will be. It will be appreciated that the optimum dose for a particular animal can be readily determined by one skilled in the relevant art.

Preferably, the dose contains approximately 10 to 100,000,000 propagules. Even more preferably, the dose contains approximately 10 to 10,000,000 propagules. In one particular form, the dose contains approximately 50,000 to 100,000 propagules.

When the fungus is Piromyces CS15 and the ruminant animal is a sheep, the effective dose may be approximately 50,000 to 100,000 propagules. When a plurality of fungi are administered, for example Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2 the effective dose may be approximately 50,000 to 100,000 propagules. The ratio of the various fungi in the mixed dose may be varied as required. Although the fungus of the present invention is non-indigenous, it preferably persists in the rumen and degrades plant material at an elevated rate relative to that of the indigenous fungi.

The present invention also provides a purified fungus comprising a suitable member of the genera Piromyces or Neocallimastix. The purified fungus may be varied provided it is capable of use in the method of the invention. Preferably, the purified fungus is selected from the group comprising Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2.

For the purposes of the present invention the term "purified" is intended to distinguish the fungi from their naturally occurring form. Thus, for example, "purified Piromyces CS15" is Piromyces CS15 that is at least 50% purified or even more preferable at least 75% purified. In one particular form, the Piromyces CS15 is at least 99% purified.

The present invention also provides nucleic acid sequences which may be used as probes or primers and are capable of hybridising to fungal nucleic acid.

Preferably, the nucleic acid sequence is designated AF2 and has the sequence: 5ΑTCGTTGTAAAACACTCA3'. The AF2 nucleic acid sequence may be used as a probe to detect fungal nucleic acid or as a primer for use in the amplification of fungal nucleic acid by the polymerase chain reaction.

The nucleic acid sequences of the present invention may be specific for certain fungi. Thus, the present invention also provides a nucleic acid sequence designated C1 having the sequence: 5TGGATATGAAGGAAAAGTCGT3'. Preferably, the nucleic acid sequence C1 is a probe or primer capable of hybridising to a nucleic acid sequence specific to Piromyces CS15.

The present invention also provides a nucleic acid sequence designated G1 having the sequence: 5'CTTGATTGAAAGT3'. Preferably, the nucleic acid sequence G1 is a probe or primer capable of hybridising to a nucleic acid sequence specific to Neocallimastix TGB1.

The present invention also provides a nucleic acid sequence, such as a probe or primer, capable of hybridising to a nucleic acid sequence specific to Piromyces TZB2. In one particular form, the nucleic acid sequence is selected from the group comprising Z1 , Z2 and Z3 having the nucleotide sequences: 5ΑTGGCTCGATTTTAGAGC3', 5OGTTAAGACTAAGTTG3',

5TAAGTTGATTCTCAGG3' respectively.

The nucleic acid sequences of the present invention are capable of hybridising to a target nucleic acid sequence. Thus, the present invention also provides a method for detecting a fungus, such as Piromyces CS15, Piromyces TZB2 or Neocallimastix TGB1 , the method comprising the steps of contacting a nucleic acid sequence with a test sample, under conditions at which the nucleic acid sequence is capable of forming a hybridisation product with the target sequence and detecting the hybridisation product.

Preferably, the method for detecting a fungus comprises the steps of: combining the primer AF2 and another suitable primer with a sample containing fungal DNA under conditions which allow for the primers to hybridise to the fungal DNA; amplifying the fungal DNA using the polymerase chain reaction and; detecting the amplification product.

The amplification product may be detected in a variety of ways. Preferably, the amplification product is detected by hybridising a labelled probe to the amplification product and detecting said label. Alternatively, the amplification product may be separated on a gel and visualised using a DNA stain such as ethidium bromide.

The method of increasing the digestible nutrients available to an animal according to the invention makes it possible for animals to have an improved productivity. In this respect, and as will be illustrated in the examples below, animals to which the method is applied show improved voluntary feed intake and liveweight change. The improvement in these characteristics correlates with improved productivity compared to those same animals when not subjected to the method of the invention.

The present invention will now be described with reference to the following examples. The description of the examples is in no way to limit the scope of the preceding description.

Examples

Example 1: Ranking of monocentric strains of gut anaerobic fungi by relative rate of cellulose digestion in the laboratory.

To determine the digestion (solubilization) rate of ¹⁴C-labelled cellulose by cultures of anaerobic fungi, tubes containing 10 mg radioactive substrate (specific activity, around 10⁴ disintegrations per min [dpm] per mg) in 5 ml basal medium was inoculated by 1 ml syringe with 0.25 ml of a fungal culture. [See General Materials and Methods section for the preparation of [¹⁴C]cellulose and the preparation of basal medium.]

Four replicate tubes were inoculated for each fungal culture. The release of radioactivity from the insoluble substrate was determined in 0.25 ml samples of the culture liquid which were withdrawn aseptically through the rubber septum by 1 ml syringe (25 gauge needle). The contents of the tubes were mixed by a single inversion 1 h before the sample of culture liquid was removed, taking great care not to sample any of the solid substrate present in the culture tube. Samples were collected in this way from each tube immediately following inoculation and on consecutive days, at intervals of 24 h. Each sample was immediately added to 5 ml water-miscible beta-scintillant solution, and the radioactivity counted by standard liquid scintillation procedures with correction for counting efficiency by the use of an internal _r C standard

The amount of solubilized 14 C in each tube at each sampling time was calculated as dpm and the maximum solubilization rate over any period of 24 h for each tube was determined. Average values for four replicates are calculated.

Different batches of 14, C-cellulose with different specific activities were used, which explains the apparently different rates for the same fungi in Tables 1 and 2. Slight differences in the two batches of culture media also contribute to the variation. The rank of a fungus is the key factor used in selection of candidates for dosing into sheep.

Table 1

^aRelative rate of solubilisation of [¹⁴C]cellulose in four replicate cultures, given as disintegrations per minute (in thousands) per 24 h. Table 2

^* Units = radioactivity (thousands of disintegrations per minute) released from radioactive (carbon-14) cellulose per 24 hours per culture. Tables 1 and 2 give some typical results of the comparison of different strains of monocentric anaerobic fungi in the laboratory. In Table 1 , four strains from kangaroos rank the highest with the next best strain being CS15 from cattle. LM1 from sheep ranks next whereas other sheep strains rank much lower (SL2 at 8th & SL1 at 9th). Table 2 also shows that the strains of monocentric anaerobic fungi which degrade cellulose at the fastest rate come from kangaroo fore-stomach (KS13 & KS11 ). The next best strain is CS15 which is followed by a strain from sheep (Cx). Strains TZB2 and TGB1 then follow, along with CS15. The other strains in Tables 1 and 2 were not considered further because of their low ranking in this test. It is apparent that fungi belonging to the genera Piromyces and Neocallimastix are the best cellulose degraders.

EXAMPLE 2: Influence of oral dosing of sheep with selected monocentric anaerobic fungi.

All sheep were offered the diet on a free choice (ad libitum) basis with free access to water. After a period of adaptation to the diet (2 weeks), the amount of feed eaten by each sheep was recorded daily for the third week. Analyses of Dry Matter (DM) at 100°C or Organic Matter (OM) at 550°C were conducted for retained samples of refused feed to calculate the voluntary DM or OM intake of the sheep. Some of the sheep were then dosed orally with fungi on three consecutive days; the remainder of the sheep were the control (untreated) group. Two weeks after the fungal dosing, feed intake of all sheep was again monitored. The change in feed intake for each sheep between the two periods was calculated as the intake in the second period as a percentage of the intake in the first period.

Part A.

The fungal dose was Piromyces CS15 (total dose approximately 3 x 10⁵ fungi) in both experiments. Experiment 1 : Fifteen Merino crossbred wethers were housed in individual pens.

Experiment 2: Eleven Merino crossbred wethers, fitted with permanent cannulae in the rumen, were housed in metabolism crates.

Table 3

^* Intake for experiment 1 was measured as gram Dry Matter per kg Metabolic Body Weight per day whereas for experiment 2 it was measured as gram Digestible DM per kg MBW per day.

The results set forth in Table 3 show a net positive response in feed intake of a poor quality diet after the oral dosing of the sheep with cultures of an anaerobic fungus from cattle (Piromyces CS15). Previous experiments had shown that this fungus was the highest ranking culture which would establish a population in the rumen of sheep.

Part B.

Twenty-nine fine wool Merino wethers were housed in metabolism crates. The fungal dose was Piromyces CS15 (total dose approximately 5 x 10⁵ fungi over three days) and Piromyces TZB2 and Neocallimastix TGB1 (both approximately 5 x 10⁴). Baseline measurements of feed intake and liveweight were made before the sheep were divided into three treatment groups for the second period. Of the sheep that received the fungal dose (22), half of their number also received a daily oral drench (60 ml) containing MPA (0.8%, vol/vol). The other sheep (7) which were not dosed with fungi were drenched with the MPA solution. Measurements of feed intake and liveweight were made three weeks after the commencement of the treatments.

Table 4

^* Intake was estimated as gram Organic Matter per day.

The diet provided in this example incorporated a suboptimal level of sulphur (~0.07%), so a fungal dose alone would not be expected to improve feed intake by sheep. Even so, an increase of 5.2% was estimated from measurements of feed refusals during the experiment (see Table 4).

The MPA was administered twice daily by drench gun (10:00am and 4:00pm) on weekdays. On weekends, a double dose was administered at 10:00am. An increase in intake of 19.9% was estimated between two and three weeks after the drenching began. Combined drenching with MPA and dosing with the fungal mixture resulted in the greatest increase in feed intake, estimated at 22.5%. Therefore, on this diet, the MPA and fungal dose treatments were approximately additive. The sheep were fed on a poor diet and all sheep lost weight regardless of the treatment that they received. However, the sheep whose treatment resulted in the largest increase in feed intake lost the least amount of weight, reflecting the additional quantity of digestible nutrients that they were able to assimilate.

Example 3: Persistence of non-indigenous anaerobic fungi in the rumen of sheep

Animal methods

The results presented on the persistence of CS15 in sheep are derived from some of the sheep studied in Experiments 1 and 2 in Example 2 above. Three of the eight sheep dosed with CS15 in Experiment 1 were retained at pasture for 12 months following this dosing before they were fitted with rumen cannulae and kept in-doors for a further six months on a pelleted ration containing 3 parts lucerne hay and 2 parts oat grain. The first sample of rumen digesta was taken at this time for the qualitative determination of CS15 by hybridization with probe C1 of DNA extracted from the digesta samples. Two of these animals, together with four others, were dosed with CS15 as part of Experiment 2.

DNA methods

DNA extraction. Digesta samples were collected into ethanol (2 parts digesta to 1 part ethanol) and stored in a freezer until processed. The solids were removed from the thawed ethanol suspensions by low-speed centrifugation and the solids were extracted with alkaline detergent solution (1 % SDS, 0.2 M NaOH and 10 mM EDTA) at 100°C for 25 min. The alkaline extract was centhfuged and the supernatant fraction neutralised with an equal volume of a solution of 5M potassium acetate and 3M acetic acid. The clarified supernatant, after centrifugation of this material, contained crude DNA which was purified by elution from Celite columns with buffer (10 mM Tris pH 7.6, 0.1 M NaCI, 2.5 mM EDTA and 50% vol/vol ethanol). The concentration of purified DNA was determined by absorbance at 260 nm and the samples were stored frozen.

Polvmerase Chain Reaction (PCR) amplification of total anaerobic fungal DNA from extracted digesta DNA.

An aliquot of extracted DNA is used in a PCR reaction along with two primers specific for anaerobic fungi (TW81 and AF2). The sequence for TW81 is 5'GTTTCCGTAGGTGAACCTGC3' [Howlett, B.J., Brownlee A.G. et al (1992) Current Genetics 22: 455-461]. The product of this reaction is used for the following hybridization.

Hybridization of purified DNA with probe C1. Diluted samples of DNA were applied to Hybond-N⁺ membranes with a Biorad dot-blot apparatus and, after washing, hybridization with oligonucleotide probe C1 (labelled with ³²P) was carried out at 45°C for at least 4 hours. Further washing of the membrane followed and, after draining, the areas of hybridization were assessed by autoradiography. Appropriate blanks and controls (both positive and negative) were always included.

The oligonucleotide probe C1 allows the "tracking" of Piromyces CS15 (see Table 5).

Table 5. Hybridization of probe C1 with DNA from the rumen of sheep at various times before and after they were dosed with Piromyces CS15.

Hybridization symbols: -, none; ±, weak; +, present, ++, strong, +++, very strong

* These sheep had been dosed with CS15 in June 1994 and No.3018 which showed no hybridization on 130ct95 and was not again dosed with CS15 Fungal dosing with CS15 occurred (after sample collection) on 29Nov95 and 12Feb96

Use of the probe showed that five of the six sheep dosed with Piromyces CS15 still contained this fungus at the end of a digestion trial which lasted for three weeks. Three of these five sheep contained CS15 for the entire three months of the experiment, whereas two of the sheep contained this strain for the last month. Of the three sheep dosed with CS15 in a separate, and earlier experiment, one still retained the fungus when tested 18 months later. The other two sheep had apparently lost CS15 whereas none of the other 17 sheep in the flock gained CS15 from the dosed animals.

General Materials and Methods used in Examples

Preparation of pure r¹⁴C1cellulose

Pure [¹⁴C]cellulose was prepared from D-[U-¹⁴C]-glucose in cultures of Acetobacter xylinum growing as a pellicles on the surface of the medium described in Table 6.

Preparation:

(1 ) Aseptically dispense 150 ml sterile medium into disposable plastic tissue culture flasks with surface area of about 175 cm² (e.g. cat. no. 1-56502; A/S

Nunc, Kamstrup, DK 4000 Roskilde, Denmark).

(2) Dilute the required amount of (available from many commercial sources around the world) into sufficient glass distilled water to yield 1 ml of glucose solution for each flask. (6 μCi per flask gives a suitable [¹⁴C]cellulose product which has a specific activity of about 9,000-10,000 disintegrations per min [dpm] per mg.). Aseptically dispense 1 ml of filtered glucose solution (membrane with 0.2 μm pores) into each flask.

(3) Immediately after dispensing the medium and radioactive label into the flasks, inoculate each with a single pellicle from a 5 ml culture that has been incubated for 7-10 d. Incubate flasks in the flat position with loosened caps at 30°C for 17-18 d.

(4) Remove pellicles from the flasks and wash with distilled water until the washes are colourless. Boil the pellicles in 2M KOH for 20 min and wash them with distilled water until the washes are neutral. Macerate the washed pellicles in suitably small quantities in a kitchen blender at high speed for 30 sec. Recover the [¹⁴C]cellulose after freeze-drying the slurry and store the dry r [14, C]cellulose in a desiccator at ambient temperature.

The specific activity of [¹⁴C]cellulose is determined from the radioactivity solubilized after treatment (at 39°C for 72 h) with solutions containing crude cellulase (4 units/ml; from Trichoderma viride; Sigma Chemical Co., St. Louis, Missouri, U.S.A.) carried out in 25 mM sodium acetate buffer (pH 5.2) with antibiotics and sodium azide (0.1 mM) added to prevent microbial growth.

Table 6. Composition of Acetobacter Medium

Component Amount (g/l)

Yeast extract (Difco) 5.0

Peptone (Difco) 5.0

KH₂P0₄ 6.8

glucose 10.0

The pH of the solution is adjusted to 6.3 before sterilization in the autoclave (120°C for 15 min.)

Method for preparation of Basal Medium

Mix the solutions and ingredients of basal medium in the order given in Table 7 and dissolve the solids. Boil the mixture for 5 min in a suitable glass vessel with a narrow neck (e.g. a 150-ml heat-resistant conical flask for a 100 ml quantity of medium), add 1 ml fresh reducing solution (see footnote to Table 7 for composition) for each 100 ml medium. Bubble a gentle stream of C0₂ through the medium with the vessel in an ice bath until the liquid is cold, i.e. 0 - 4°C. About 15 min is adequate for 100 ml but a longer time is required to cool larger volumes of media. The colour of the medium will change from pink (oxidized resazurin) to colourless (reduced). At this stage, the pH of the medium is measured and should be in the range 6.4 - 6.8 before dispensing the medium. A medium with a pH of greater than 6.8 will probably respond to continued bubbling with C0₂. Medium with a pH value that is much below 6.4 is likely to be faulty and should be remade. Reduced medium is dispensed into Hungate tubes (Bellco, Vineland, New Jersey, U.S.A.) or other appropriate vessels and seal with butyl rubber septa and screw caps. Sterilize the medium by autoclave at 120°C for 15 min.

Table 7. Composition of liquid basal medium for anaerobic fungi.

Oxoid, Basingstoke, U.K.

Reducing solution: Dissolve 0.625 g cysteine-HCI in 24 ml distilled water, adjust pH to 11 with 10 M NaOH. Add 0.625 g Na₂S.9H₂0, dissolve, and boil immediately before use. Make fresh reducing solutions for each batch of basal medium. Culture medium for anaerobic fungi to be used for oral dosing

The composition of the medium is modified from basal medium given in Appendix 2 by omitting haemin and "Tryptone", and by adding 10% (vol/vol) centhfuged rumen fluid. The medium (50 ml) is dispensed under C0₂ into serum bottles which already contain 0.25 g milled wheat straw. Seal each bottle with a butyl rubber septum and a aluminium crimp cap as it is fitted. Sterilize by autoclave at 121°C for 15 min.

Centhfuged rumen fluid

Rumen digesta is collected from a cannulated sheep just prior to the daily meal. Strain digesta through nylon cloth and incubate fluid at 39°C for an hour. Chill on ice. Centrifuge at 5,000xg for 20 min, decant supernatant and centrifuge again at 9,000xg for 20 min. Either use clarified rumen fluid immediately or store it frozen. Centrifuge thawed fluid at 5,000xg for 20 min prior to use in medium.

The present invention includes within its scope adaptations and modifications apparent to one skilled in the art.

Claims

THE CLAIMS defining the invention are as follows:

1. A method for increasing the availability of digestible nutrients to a ruminant animal, the method comprising the step of administering to the rumen of said animal an effective amount of at least one non-indigenous fungus.

2. A method according to claim 1 wherein the non-indigenous fungus is a suitable member of a genus selected from the group of genera comprising Piromyces and Neocallimastix.

3. A method according to claim 1 or claim 2 wherein the non-indigenous fungus is selected from the group comprising Piromyces CS15, Neocallimastix TGB 1 and Piromyces TZB2.

4. A method according to claim 3 wherein Piromyces CS15 is NM97/04860.

5. A method according to claim 3 wherein Neocallimastix TGB1 is NM97/04859.

6. A method according to claim 3 wherein Piromyces TZB2 is NM97/04858.

7. A method according to any one of claims 1 to 6 wherein a plurality of non- indigenous fungi are administered.

8. A method according to any one of the preceding claims wherein the fungus is administered to the rumen directly, such as with an intra-ruminal device

9. A method according to claim 8 wherein the fungus is administered using a controlled release intra-ruminal device.

10. A method according to any one of claims 1 to 7 wherein the fungus is administered to the rumen indirectly, such as orally.

11. A method according to claim 10 wherein the fungus is administered as a single dose.

12. A method according to claim 10 wherein the fungus is administered as a number of doses over a predetermined period of time.

13. A method according to claim 12 wherein the fungus is administered on 3 or 4 consecutive days.

14. A method according to any one of claims 10 to 13 wherein the fungus is administered as a live culture.

15. A method according to claim 14 wherein the culture is three to four days old and is administered in a carrier such as culture medium.

16. A method according to any one of the preceding claims wherein the effective dose comprises approximately 10 to 100,000,000 propagules.

17. A method according to any one of the preceding claims wherein the effective dose comprises approximately 10 to 10,000,000 propagules.

18. A method according to any one of the preceding claims wherein the effective dose comprises approximately 50,000 to 100,000 propagules.

19. A method according to claim 1 wherein the fungus is Piromyces CS15, the ruminant animal is a sheep and the effective dose is approximately 50,000 to 100,000 propagules.

20. A method according to claim 1 wherein the fungi Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2 are administered and the effective dose is approximately 50,000 to 100,000 propagules.

21. A purified fungus comprising a suitable member of the genera Piromyces or Neocallimastix.

22. A purified fungus according to claim 21 selected from the group comprising Piromyces CS15, Neocallimastix TGB1 and Piromyces TZB2.

23. A purified fungus according to claim 21 or claim 22 selected from the group comprising NM97/04860, NM97/04859, NM97/04858.

24. A veterinary preparation comprising a purified fungus according to any one of claims 21 to 23 and a suitable carrier.

25. A nucleic acid molecule comprising a sequence selected from the group comprising: 5ΑTCGTTGTAAAACACTCA3',

5TGGATATGAAGGAAAAGTCGT3', 5OTTGATTGAAAGT3',

5ΑTGGCTCGATTTTAGAGC3', 5OGTTAAGACTAAGTTG3' and

5 AAGTTGATTCTCAGG3' .

26. A method for detecting a fungus, such as Piromyces CS15, Piromyces TZB2 or Neocallimastix TGB1 , the method comprising the steps of contacting a nucleic acid molecule according to claim 25 with a test sample, under conditions at which the nucleic acid molecule is capable of forming a hybridisation product with the target sequence and detecting the hybridisation product.

27. A method for detecting a fungus, such as Piromyces CS15, Piromyces TZB2 or Neocallimastix TGB1 , the method comprising the steps of amplifying fungal DNA by combining a nucleic acid molecule comprising the AF2 nucleotide sequence and another suitable primer with a sample containing fungal DNA under conditions which allow for the primers to hybridise to the fungal DNA; amplifying the fungal DNA using the polymerase chain reaction and; detecting the amplification product.

28. A method according to claim 27 wherein the amplification product is detected by hybridising it with a nucleic acid molecule comprising a sequence selected from the group comprising C1 , G1 , Z1 , Z2 and Z3.