WO1998035234A1 - Identifying agents for treating lentiviral infection - Google Patents

Abstract

The present invention is based on the observation that the Vpr protein of lentiviruses, and in particular the Vpr protein of HIV, induces cell stasis and death when contacted with a cell. Based on this observation, the present invention provides methods of identifying agents that can be used to treat lentiviral infection.

Description

IDENΗFYING AGENTS FOR TREATING LENTIVIRAL INFECTION

Acknowledgment of Government Support The work described herein was funded in part by a grant from the National

Institutes of Health No. C930122. The U.S. government has certain rights in this invention.

Technical Field The invention relates to methods for reducing the severity of lentiviral mediated disease. Specifically, the present invention provides methods of identifying compounds for use in presenting lentiviral mediated cell stasis and death. The present invention provides methods and compositions based on the ability of the Vpr protein, to bind to one or more cellular target(s) and block cell division, inducing cell cycle stasis and cell death.

Background Art

Based on general concepts of the mechanism of retroviral infection and the nature of the infected cell, three types of drugs to arrest the progress of AIDS have been proposed. One class contains those which block reverse transcription such as azidothymidine (AZT), another class comprises protease inhibitors that prevent maturation of the virions, and the third class comprises drugs such as soluble CD4 which prevent interaction between the virion and the CD4 receptor. The efficacy of each of these classes of drugs is limited, and there is clearly a need for more effective ways to arrest the progress of this condition.

The approach of the present invention takes advantage of the critical role of the HIV-encoded protein Vpr. Vpr is one of nine proteins known to be encoded by the HIV genome. Vpr was initially identified as an open reading frame in the HIV genome. Expression of this open reading frame was confirmed by the demonstration that individuals infected with HIV develop antibodies against the Vpr gene product

(Gras-Masse, H. et al. IntJPept Prot Res (1990) 36:219; Reiss, P. et al. J AIDS (1990) 3:115. The gene product was shown to be weak transcriptional activator by Cohen, E.A. et al. J AIDS (1990) 3:11-18 and by Ogawa, K. et al. J Virol (1990) 63:4110-4114. The protein appears to be present in virions at an equimolar amount compared to the major gag-encoded capsid proteins and has been shown to interact with the gag-encoded protein p6. Cohen, E.A. et al. J Virol (1990) 64:3097-3099, Yu, et al. J Virol (1990) 64:5688; Yuan, X. et al. AIDS Res Cum Retro (1990) 6:1265; Paxton, W. et al. J Virol (1993) 67:7229; Lavallee, C. et al. J Virol (1994) 68:1926. For interaction with p6, the carboxy terminal amino acids at positions 84-94 are required. Paxton, W. et al. J Virol (supra). The human HIV Type 2 Vpr gene has been shown as essential for productive infection of human macrophage by Hattori, N. et al. Proc Natl Acad Sci USA (1990) 87:8080-8084; however, Balotta, C. J Virol (1993) 67:4409 has shown Vpr to be unnecessary for replication of the virus in immortalized T cell lines or peripheral blood lymphocytes. The Vpr protein has been shown to provide a mechanism for nuclear localization of viral nucleic acids in nondividing cells by Heinzinger, N.K. et al. Proc Natl Acad Sci USA (1994) 91:7311-7315. In addition, Lang, S.M. et al. J Virol (1993) 67:902-912 have shown that mutations in Vpr attenuate the pathogenicity of macaques infected with SIV. Further, Tristem, M. et al. EMBO J ^'(1992) 11:3405 showed that Vpr and Vpx are highly conserved among primate lentiviruses. Levy, D.N. et al. Cell (1993) 72:541 demonstrated that Vpr induces differentiation in human rhabdomyosarcoma cells.

It is therefore known that Vpr is not a null protein with respect to infection by HIV. However, the central role played by this protein in permitting virus to multiply while effecting depletion of the very cells which are infected by the virus has not been appreciated. The present applicants have demonstrated that Vpr of HIV or other lentiviruses, arrests the development of cells in which it is contained at the G2 stage of the life cycle. Arrest at this particular point is significant since it leads to cell death. Preventing cells from entering the mitotic stage (M) prevents cells from dividing and leads to apoptosis. This activity forms the basis of the presently disclosed methods and compositions for blocking Vpr induced cell cycle stasis and death. The Vpr protein and its interaction with intracellular targets in the infected cell are crucial to the success of the infective virus. Therefore, therapeutic agents which interrupt this interaction can be used to arrest the progress of the viral disease.

In order to further elucidate the pathways utilized by Vpr to arrest cells in G2, the present invention used the yeast two-hybrid system to identify human proteins which are capable of physically associating with Vpr. Several cDNAs were isolated, including one that encodes a human homologue of the Saccharomyces cerevisiae Rad23 protein, HHR23 A, a protein thought to play a role in DNA repair. The present invention demonstrates that full-length HHR23 A protein when transiently expressed in HeLa cells, interacts physically with bacterially-expressed recombinant GSTVpr. Indirect immunofluorescence and confocal microscopy indicate that the two proteins colocalize within the same subcellular region, principally at or about the nuclear membrane. The Vpr-binding domain in HHR23A was mapped to the carboxy terminal region of the protein. A chemically synthesized peptide representing the C-terminal 45 amino acids of HHR23A was shown to bind to GSTVpr. Significantly, overexpression of HHR23A in cells leads to partial alleviation of the G2 arrest induced by Vpr. These results provide support for aspects of the present invention which are based on the interactions of the Vpr with cellular proteins.

Disclosure of the Invention

The present invention is based on the observation of the role that the Vpr protein of lentiviruses plays in arresting cell development in the G2 stage of the cell cycle. Arresting development of the cell by inducing cell cycle stasis ultimately leads to cell death. Based on this observation, the present invention provides compositions and methods to block lentiviral mediated cell cycle stasis and cell death and methods for identifying such compositions. The present invention specifically provides methods for identifying compounds that block Vpr protein induced cell cycle stasis and cell death. As demonstrated in the Examples, these methods can be used to treat HIV and other lentiviral infection. One embodiment of the present invention provides compositions and methods for blocking Vpr mediated cell cycle arrested and cell death. These methods and compositions are based on agents that block the association of a Vpr protein of lentiviruses with a cellular binding partner (s). These agents block Vpr induced cell cycle arrest when presented to cells containing and/or expressing a Vpr protein.

Further embodiments of the present invention are based on the identification of cellular targets that are bound by the Vpr protein of lentiviruses. Based on this disclosure, the present invention provides methods for screening candidate agents for the ability to block the interaction of a Vpr protein with one or more binding partners. In general, these methods are based on binding and/or competitive binding assays that are used to identify agents that bind to the same cellular targets as the Vpr proteins and/or block the binding of the Vpr protein to a cellular target.

Two of the herein disclosed protein targets that are bound by the Vpr protein, the B29-1 and B251-1 proteins, are proteins that have not been previously isolated or characterized. Based on the identification of these two proteins, further embodiments of the present invention provide the use of proteins containing the B29-1 and B251-1 amino acid sequences in the herein disclosed screening assays and methods.

Brief Description of the Drawings Figure 1 shows the G2 arrest pattern effected by HIV infection as determined by flow cytometry.

Figure 2. Amino acid sequence alignment of the yeast S. Cerevisiae Rad23 protein and the two human homologues HHR23A and HHR23B with each other and with the longest HHR23A clone isolated in the 2-hybrid screen, HHR23AB213. The HHR23A and HHR23B proteins are compared with each other and with yeast Rad23.

The highly conserved internal repeat domain is indicated by the boxed region.

Figure 3. GSTVpr binds to full-length HHR23A expressed in cells. GSTVpr or GST was mixed with lysates isolated from HeLa cells cotransfected with BSVprXThy and pXCR23A (full length HHR23A) or mock transfected cells. After a 4 hour incubation at 4°C with gentle rocking, GST-bound proteins were selectively recovered with the addition of glutathione-sepharose. Protein complexes bound to glutathione beads were subjected to polyacrylamide gel electrophoresis (PAGE) transferred to nitrocellulose and, visualized by chemiluminescence after sequential binding of a primary monoclonal antibody specific for the M2 epitope and a secondary antibody conjugated to horseradish peroxidase. Lane 1 is lysate form mock transfected HeLa cells used in the binding assay; lane 2 is lysate from mock transfected HeLa cells incubated with GSTVpr; lane 3 is lysate from mock transfected HeLa cells incubated with GST; lane 4 is lysate from HeLa cells cotransfected BSVprXThy and pXCR23A used in the binding assay; lane 5 is lysate from BSVprXThy/pXCR23A cotransfected cells incubated with GSTVpr; lane 6 is lysate from BSVprXThy/pXCR23 A cotransfected cells incubated with GST. The arrow indicates the position of the full-length M2 tagged HHR23A protein.

Figure 4. Amino acid sequence alignment of HHR23A and the 8 different cDNA clones identified in the 2-hybrid screen for proteins that interact with HIV-1 Vpr. The cDNAs encode proteins with the following lengths: B25-1 45 amino acids (aa), B236-2 46 aa, C3-1 59 aa, C16-1 62 aa, C108-1 112 aa, ClO-1 150 aa, C180-1 174 aa, B213-2 179 aa. The highly conserved internal repeat domain is indicated by the boxed region.

Figure 5. GSTVpr binds to the 45 aa C-terminal portion of HHR23A and HHR23B which includes the highly conserved internal repeat domain. A) Ten micrograms of GSTVpr or GST were mixed with fifty micrograms of biotinylated HHR23A or HHR23B peptide and incubated at 4°C for one hour. GST-containing complexes were selectively recovered by using glutathione sepharose beads. Protein complexes bound to the glutathione beads were subjected to PAGE, transferred to nitrocellulose, and visualized with streptavidin conjugated to horseradish peroxidase using chemiluminescence. Lane 1 is HHR23 A peptide incubated with GSTVpr; lane

2 is HHR23 A peptide incubated with GST; lane 3 is HHR23B peptide incubated with GSTVpr; lane 4 is HHR23B peptide incubated with GST. B) The 45 amino acid C-terminal of HHR23A bound specifically to GSTVpr and could be competed with increasing amounts of unlabeled HHR23A peptide. Ten micrograms of GSTVpr or GST were mixed with fifty micrograms of biotinylated HHR23A or HHR23B peptide and incubated at 4°C for one hour. Increasing amounts of unbiotinylated HHR23A peptide were then added to the binding reactions. GST-containing complexes were selectively recovered and visualized as described above. Lanes 1-4 show binding reactions containing GSTVpr and HHR23A-biotin, with increasing amounts of unbiotinylated HHR23A peptide added as indicated. Lanes 5-8 show binding reactions containing GST and HHR23 A-biotin, with increasing amounts of unbiotinylated HHR23A peptide added as indicated.

Figure 6. Alleviation of Vpr-induced cell-cycle arrest by over-expression of the 179 aa C-terminal portion of HHR23A or the full-length HHR23A. HeLa cells were cotransfected with either BSVprThy or BSVprXThy (0.3 μg) and a 20-fold molar excess of either pCMV (3.2 μg), pXCB213 (4.0 μg), ρXCR23A (4.0 μg) or pXCR23Atrunc (4.0 μg). Forty-eight hours later, cells were stained with a monoclonal antibody to the Murine Thy 1.2 cell-surface protein directly conjugated with fluorescein isothiocyanate (FITC) using a modification of the method described by Jowett et al., 1995. After staining, cells were washed and resuspended in FACS buffer containing propidium iodide (PI) and analyzed by flow cytometry using the Lysis II software (Becton Dickson) as described (Jowett et al., 1995). The Thy 1.2- FITC fluorescence intensity is plotted on the X axis and the fluorescence intensity of the PI is plotted on the Y axis. The ratio of the Thy 1.2⁺ cells in the Gl versus G2/M phase of the cell-cycle is shown to the right of the dot blots. In panel E, the Gl versus G2/M ratio represents that of the total population. Figure 6A, Panel A) BSVprThy and pCMV; panel B) BSVprXThy and pCMV; panel C) BSVprThy and pXCB213 (Vpr protein and HHR23AB213 protein); panel D) BSVprXThy and pXCB213 (truncated Vpr protein and HHR23AB213 protein); panel E) mock transfected cells. Figure 6B, Panel A) BSVprThy and pCMV; panel B) BSVprXThy and pCMV; panel C) BSVprThy and pXCB213 ; panel D) BSVprXThy and pXCB213 ; panel E) BSVprThy and pXCR23A (Vpr and full-length HHR23A proteins); panel F) BSVprXThy and pXCR23A (truncated Vpr and full-length HHR23A proteins); panel G) BSVprThy and pXCR23 Atrunc (Vpr and truncated HHR23A proteins); panel H) BSVprXThy and pXCR23 Atrunc (truncated Vpr and HHR23A proteins). Figure 7. Comparison of the levels of HHR23A and HHR23B RNA expression in Vpr-arrested cells to that detected in the Gl and G2 phases of the cell cycle using an RT-PCR assay. To obtain RNA from Vpr-arrested cells, HeLa cells were transfected with BSVpr. Forty-eight hours after transfection, total RNA was isolated from transfected cells. At this time point approximately 70 % of the cells were Thyl .2⁺ (data not shown). To obtain RNA from cells where the majority of the cell population was in either the Gl or G2 phase of the cell cycle, RNA was isolated from HeLa cells synchronized by a double thymidine block at hours 8 2 (Gl) and hours 14 (G2) after release of the block. Cells were stained with PI and analyzed by flow cytometry to confirm that the majority of cells was in either the Gl or G2 phase of the cell cycle. Approximately 93 % of the cells harvested at hours after release of the block were in Gl and 97 % of the cells harvested at 8V2 hours after release of the block were in G2. A series of two-fold dilutions was made of total RNA isolated from the cell populations described above and analyzed by RT-PCR. Panel A shows the RT-PCR products generated using primers that detect HHR23 A RNA. Panel B shows the RT-PCR products generated using primers that detect CKShs2 RNA. Figure 8 provides the amino acid sequence identified in the yeast two hybrid system and designated B251-1 and B29-1.

Figure 9 (panels a-c) provides a structural/sequence analysis of the B-251-1 protein.

Figure 10 (panels a-c) provides a structural/sequence analysis of the B-29-1 protein.

Modes of Carrying Out the Invention

Methods to Block Vpr Induced Cell Stasis and Death The present invention is based on the observation that the Vpr protein of lentiviruses induces cell cycle stasis and cell death in a wide variety of cells, particularly those directly infected by a lentivirus. Based on this observation, the present invention provides compositions and methods for preventing the arrest in the cell cycle induced by the Vpr protein, thus blocking lentiviral mediated cell death. These methods and compositions are based on the observations obtained when the critical role played by the Vpr protein in the arrest of HIV infected cells was observed. In HIV infected cells, the Vpr protein blocks cell development at the G2 stage of the cell cycle inducing cell death.

One embodiment of the present invention provides methods for blocking Vpr induced cell death. These methods comprise the step of providing to cells expressing and/or containing a Vpr protein an agent that blocks the cell cycle stasis/cell death activity of the Vpr protein. Such agents will preferably block Vpr activity by binding to the Vpr protein or one of more of the cellular targets bound by a Vpr protein. Methods for identifying such agents are discussed in detail below.

As used herein, a Vpr protein refers to the 94-amino acid protein encoded by the HIV-1 virus as described by Cohen et al. J Virol (1990) 64:3097, the corresponding protein produced by other HIV strains, and the corresponding proteins produced by other lentiviruses. These include, but are not limited to the Vpr proteins of HIV- 1, HIV-2 and SIV and the Vpr of SIV stain AGM77.

All of the Vpr proteins of the present invention are active in arresting cell division. The test for ascertaining the activity of such proteins is straightforward; the Vpr protein need only be tested in comparison to a known active Vpr protein for its ability to arrest cell division and induce cell death when expressed in a mammalian or another eukaryotic cell.

As used herein, an agent is said to block Vpr activity if the agent is able to allow the cell to replicate or divide in the presence of the Vpr protein. As described below, such agents can block the activity of a Vpr protein by binding to the Vpr protein or by binding to one or more of the cellular target(s) that are bound by the Vpr protein. As described below, the yeast two hybrid protein system was used to identify several protein targets to which the Vpr protein binds. These targets can be used in competitive and direct binding assays to identify agents that bind to one or more of the Vpr targets so as to block Vpr binding and activity. For the sake of convenience, all of the different lentiviral Vpr proteins will hereinafter be referred to as the Vpr proteins.

The methods and compositions of the present invention can be used to block lentiviral arrest of cell division with any cell type from any organism so long as the division of the particular cell type from the particular organism is blocked because of the presence and/or activity of a Vpr protein. The most preferred cells are cells from mammalian organisms such as humans and commercially important animal such as livestock and pets. The preferred cell types are cells that cause a pathological condition because of lentiviral induced cell death. As used herein, an agent is said to block Vpr activity or Vpr induced cell stasis and death if the agent prevents the level or degree of cell stasis or cell division arrest that would normally occur in the presence of the Vpr protein. In general, the Vpr proteins act to block cell division in the G2 phase. Blocking cell division in this phase, as a result of the presence of a Vpr protein, induces cell death. An agent blocks this activity by decreasing the rate or degree of cell stasis and cell death.

A variety of methods can be employed to determine if Vpr induced cell stasis is blocked. These typically rely on the use of a marker of cell division, such as nucleotide or amino acid uptake and incorporation, or on the direct assessment of cell numbers in the presence of a Vpr protein and the presence and absence of a test agent. For example, a number of indices of cell growth can be used, such as labeled thymidine uptake, vital stains such as Alamar blue, trypan blue and the like. Alternatively, cell replication can be measured by the density of culture or with a cell counter or spectrophotometer, by using indicators of growth parameters such as pH of culture medium, by detecting cell byproducts, using kinase assays such as the immunoprecipitation of cdc2 kinase, assaying WEE 1, NIM 1, CAK, and phosphates activity and determining the level of cyclin mRNA expression, and using a microcell physiometer to measure cell metabolism and waste product evolution.

In addition to the above markers of cell division, certain genes are known to be expressed specifically in particular phases of the cell cycle such as M, Gl and S. Assessment of the level of expression of these genes can provide a measure of the status of the cells in culture. For example, the cells may be transfected with promoters associated with these specifically expressed genes, such as CDK or cyclin, wherein the promoter is operably linked to a specific reporter gene such as chloramphenicol acetyl transferase (CAT) or luciferase. Agents are identified by any of these above art known methods that reduces

Vpr mediate cell stasis and death. Preferably the agent will decrease the rate of cell death by about 50% or more, preferably about 75% or more, most preferably 90% or more leading to complete elimination of Vpr mediated cell death. Such agents can then readily be tested in an appropriate model or test system for clinical effectiveness using art known methods.

Administration of Agents that Block Vpr Activity The agents of the present invention can be administered systemically or directly to the site of action using parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, the route of administration and the nature of the effect desired. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typical dosages comprise 0.1 to 100 μg/kg body wt. The preferred dosages comprise 0.1 to 10 μg/kg body wt. The most preferred dosages comprise 0.1 to 1 μg/kg body wt.

In addition to the pharmacologically active agent, the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically for delivery to the site of action. Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oil based injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell. The pharmaceutical formulation for systemic administration according to the invention may be formulated for enteral, parenteral or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient. Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.

The agents of the present invention can be administered in a systemic or targeted form, or can be directly injected to the site of desired action. A variety of methods have been developed and are being developed to target the delivery of an agent to a particular cell or cell type. Such methods include, but are not limited to, the use of a fusion protein comprising an antibody variable region domain fused to the agent, targeting liposomes and controlled release polymeric matrixes. Such delivery systems can be used to direct the delivery of an agent to cells in which Vpr induce cell cycle stasis occurs.

The agents of the present invention can be provided alone, or in combination with other agents that are used to treat the lentiviral infection. For example, an agent that prevents Vpr induced cell cycle stasis can be used in conjunction with other antiviral agents. As used herein, two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time. Preferably, the agent of the present invention will be administered in combination with other antiviral agents.

Methods to Identify Vpr binding Partners

Another embodiment of the present invention provides methods for identifying cellular targets of a Vpr protein as herein defined. Specifically, a Vpr protein can be used to identify targets that bind the Vpr protein. The Vpr protein targets can then be used to rationally design or randomly select agents for use in blocking the activity of the Vpr protein and/or can be further used in competitive binding assays. For example, targets that are bound by a Vpr protein can be identified using a yeast two-hybrid system or using a binding-capture assay. In the yeast two hybrid system, an expression unit encoding a fusion protein made up of one subunit of a two subunit transcription factor and the Vpr protein is introduced and expressed in a yeast cell. The cell is further modified to contain 1) an expression unit encoding a detectable marker whose expression requires the two subunit transcription factor for expression and 2) an expression unit that encodes a fusion protein made up of the second subunit of the transcription factor and a cloned segment of DNA. If the cloned segment of DNA encodes a protein that binds to the Vpr protein, the expression results in the interaction of the Vpr and the encoded protein. This brings the two subunits of the transcription factor into binding proximity, allowing reconstitution of the transcription factor. This results in the expression of the detectable marker. The yeast two hybrid system is particularly useful in screening a library of cDNA encoding segments. In a binding-capture assay, a Vpr protein is mixed with an extract of a cell under conditions that allows the association of a binding target with the Vpr protein. After mixing, binding targets that have become associated with the Vpr protein are separated from the mixture. The target that bound the Vpr protein can then be removed and further analyzed. To identify and isolate a binding target, the entire Vpr protein can be used. Alternatively, a fragment of a Vpr protein can be used.

As used herein, a cellular extract refers to a preparation or fraction that is made from a lysed or disrupted cell. The preferred source of cellular extracts will be cells whose division can be blocked using the Vpr protein. The cellular extract can be prepared from cells that have been freshly isolated from a subject or from cells or cell lines that have been cultured. A variety of methods can be used to obtain an extract of a cell. Cells can be disrupted using either physical or chemical disruption methods. Examples of physical disruption methods include, but are not limited to, sonication and mechanical shearing. Examples of chemical lysis methods include, but are not limited to, detergent lysis and the enzyme lysis. A skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods. Once an extract of cells is prepared, the extract is mixed with the Vpr protein under conditions in which association of the Vpr protein with the binding target can occur. A variety of conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a cell. Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the Vpr protein with the binding target.

After mixing under appropriate conditions, the Vpr protein is separated from the mixture. A variety of techniques can be utilized to separate the mixture. For example, antibodies specific to the Vpr protein can be used to immunoprecipitate the Vpr protein and associated binding target. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used. After removal of nonassociated cellular constituents found in the extract, the binding target can be dissociated from the Vpr protein using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture.

To aid in separating associated Vpr protein/target from the mixed extract, the Vpr protein can be immobilized on a solid support. For example, the Vpr protein can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the Vpr protein to a solid support aids in separating the protein/binding target pair from other constituents found in the extract.

In the Examples, the Vpr protein of HIV- 1 was used in a yeast two hybrid system to identify seven proteins that interact with and bind to the Vpr protein. These include: two previously unknown proteins, herein denoted the B29-1 and B251-1 protein (Figures 9-11); casein kinase II (beta subunit); uracil DNA glycosylase; phosphoglycerate kinase I; ubiquitin conjugating enzyme; and pyruvate kinase.

Methods to Identify Agents that Block Vpr/Binding Partner Interactions

Once identified, Vpr protein binding targets can be used in methods to identify agents that block Vpr activity as described above. Specifically, a Vpr protein and a binding target, such as, the B29-1 and B251-1 protein (Figures 9-11); casein kinase II (beta subunit); uracil DNA glycosylase; phosphoglycerate kinase I; ubiquitin conjugating enzyme; pyruvate kinase, or a cellular extract containing the Vpr protein and target, are mixed in the presence and absence of an agent to be tested. After mixing under conditions that allow association of the Vpr protein with the target, the two mixtures are analyzed and compared to determine if the tested agent reduced or blocked the association of the Vpr protein with the binding target. Agents that block or reduce the association of the Vpr protein with the binding target will be identified as decreasing the amount of association present in the sample containing the tested agent. As used herein, an agent is said to reduce or block Vpr/binding target association when the presence of the agent decreases the extent to which or prevents the Vpr protein from becoming associated with the binding target. One class of agents will reduce or block the association by binding to the Vpr protein while another class of agents will reduce or block the association by binding to the binding target. Preferably, the agent will bind to one or more of the binding targets herein identified. The Vpr protein and/or binding target used in the above assay can either be an isolated binding partner, such as using a purified Vpr and purified HHR23 protein, or can be partially purified, such as in the use of a crude cellular extract containing the Vpr protein and an identified but uncharacterized binding target. It will be apparent to one of ordinary skill in the art that as long as the Vpr protein and binding targets have been characterized by an identifiable property, e.g., molecular weight, the present assay can be used.

In addition, either the entire protein can be used or a fragment containing the binding site can be used. In the examples, two peptide fragments of previously unknown human proteins, the B29- 1 and B251 - 1 peptides, were used.

Agents that are assayed in the above method can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the binding target with the Vpr protein. An example of randomly selected agents is the use of a chemical library or a peptide combinatorial library, or a growth broth of an organism. As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that may take into account the sequence of the target site and/or its conformation. As described above, there are two sites of action for agents that block Vpr protein/binding target interaction: the binding target contact site on the Vpr protein and the Vpr protein contact site on the binding target. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the contact sites of the Vpr/target pair. For example, a rationally selected peptide agent can be a peptide whose amino acid sequence is identical to the HH23 contact site on the Vpr protein. Such an agent will reduce or block the association of the Vpr protein with HH23 by binding to HH23.

The agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention. One class of agents of the present invention are peptide agents whose amino acid sequences are chosen based on the amino acid sequence of the Vpr protein, for example, a peptide fragment of the HIV-1 Vpr protein. Another class of agents will be peptides based on the amino acid sequence of Vpr binding partners, such as the HHR23 protein and the B29-1 and B251-1 proteins described below. The peptide agents of the invention can be prepared using standard solid phase

(or solution phase) peptide synthesis methods, as is known in the art. In addition, the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amino acids are to be included.

Another class of agents of the present invention are antibodies immunoreactive with critical positions of the Vpr protein or a Vpr binding target. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the Vpr protein intended to be targeted by the antibodies. Critical regions include the contact sites involved in the association of the binding target the Vpr protein. Antibody agents are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptide haptens alone, if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation. While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines that secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten or is the binding protein itself. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid. The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera that contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as the Fab, Fab', of F(ab')₂ fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin. The antibodies or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of the Vpr protein or binding target can also be produced in the context of chimeras with multiple species origin. Once identified, agents that block the interaction of the Vpr protein with one or more binding targets can be tested for the ability to block Vpr induced cell cycle stasis. In general, as described above, agents can be tested by expressing a Vpr protein in a cell and determining whether the agent blocks Vpr induced cell cycle stasis. As demonstrated in the examples, a fragment of the human protein HHR23A was able to block Vpr induced cell cycle stasis.

Isolated Protein Binding Targets of the Vpr Protein As described in the Examples, the yeast two hybrid system was used with the Vpr protein and two previously unidentified proteins were isolated that bind to the Vpr protein, herein after the B29- 1 and B251 - 1 proteins.

As used herein, the B29-1 protein refers to a protein that has the amino acid sequence depicted in Figure 9 within its amino acid sequence and the B251-1 protein refers to a protein that has the amino acid sequence depicted in Figure 9 within its amino acid sequence. These proteins include the specific fragments of human proteins disclosed herein as well as the actual complete human protein that contains the identified Vpr binding fragments herein denoted as the B29-1 and B251-1 proteins.

The B29-1 and B25-1 proteins of the present invention further include naturally occurring allelic variants, proteins that have a slightly different amino acid sequence than that specifically recited above. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the requisite ability to associate with a Vpr protein.

The B29-1 and B251-1 proteins of the present invention further include proteins isolated from organisms other than humans that are structurally similar to the herein exemplified B29-1 and B251-1 proteins and that further bind to a Vpr protein. These proteins can be isolated from any organism or cell that expresses the related B29-1 and B251-1 proteins. The preferred source is other mammalian organisms. Ordinarily, the allelic variants, the conservative substitution variants of the B29-1 and B251-1 proteins and the corresponding proteins from other organisms, will have an amino acid sequence having at least 75% amino acid sequence identity with the B29-1 or B251-1 sequences herein disclosed, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%. Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity/homology, and not considering any conservative substitutions as part of the sequence identity. N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting identity/homology. As described above, the B29-1 and B251-1 proteins can be used in assays to identify agents that block Vpr/B29-1 or Vpr/B251-1 interactions, thus preventing Vpr induced cell stasis and death.

Example 1 Verification that HIV Infection Results in G2 Arrest

Cell flow cytometric techniques were used to determine a DNA histogram for SupTl cells, both for cells that were mock-infected and those infected with the HIV-1 strain NL4-3.

SupTl cells (human CD4⁺ T cell), derived from a non-Hodgkins lymphoma (NIH, ALDS research and reference reagent program; Cat. No. 100) were passaged in

RPMI 1640 media supplemented with 10% fetal calf serum (FCS; Gemini, Calabasas CA Cat. No. 100-106), penicillin (100 U/ml), streptomycin (100 μg/ml) and 2 mM glutamine (Irvine Scientific, Santa Ana, CA Cat. No. 9316).

Viral stocks of the strain, HIV-1 NL4-3 (Adachi, A. et al. J Virol (1986) 59:284-291) were generated by elecfroporation of MT-2 cells. MT-2 cells, a human

HTLV-1 transformed T cell line (NIH AIDS research and reference reagent program Cat. No. 237), were propagated in Iscove's media (Gibco-BRL; Cat. No. 12440-038) supplemented with 10% FCS and antibiotics as above.

Briefly, 5 x 10⁶ MT-2 cells were collected mid- log phase, pelleted at 300g and resuspended in elecfroporation medium (RPMI with 20% FCS). Plasmid pNL4-3 (10 μg; Adachi, A. et al. (1986) (supra)), was added, incubated on ice for five minutes, electroporated at 960 μF and 300 V, incubated on ice for a further five minutes, and finally resuspended in 20 ml of growth medium. At six to eight days post-transfection culture supernatant was harvested and assayed for infectious virus titer by limiting dilution assay and for HIV core antigen (p24) by enzyme-linked immunoabsorbent assay (ELISA; Coulter). Viral stocks were stored at -70°C until use.

Target SupTl cells, 5 x 10⁶, were infected by suspension in viral stock and 10 μg/ml polybrene (Sigma, St. Louis, MO Cat. No. H-9268) at 37°C for one hour, with gentle agitation. Cells were washed and resuspended finally at 5 x 10⁵ cells/ml in growth medium and analyzed by flow cytometry. Cell cycle phase analysis of a bulk population of cells was determined by staining in a hypotonic citrate solution containing propidium iodide (PI, Sigma, St. Louis, MO Cat. No. P-4170) as previously described (Nicoletti, I., et al. JImmun Meth (1991) 139:271-280). Briefly, 1 x 10⁶ cells were harvested from the culture and suspended in 1 ml of the staining solution (100 μg PI in 0.1% sodium citrate plus 0.1 % Triton X-100 (Sigma, St. Louis, MO Cat. No. T-6878) and 20 μg ribonuclease A

(Sigma, St. Louis, MO Cat. No. R-5503). After incubation on ice for 1 hour, the cells were analyzed in the staining solution on a FACScan flow cytometer (Becton- Dickinson) equipped with a 15 mW air-cooled 488 nm argon-ion laser. Orange PI fluorescence was collected after a 585/42 nm band pass (BP) filter and was displayed on linear scale. Acquisition on the flow cytometer was done with either FACScan Research software or Lysis II (Becton-Dickinson). A minimum of 5000 events was collected per sample, and data analysis performed with Lysis II software. Samples were gated on low angle (forward scatter, FSC) vs. 900 angle (side scatter, SSC) to exclude debris and clumps. Additionally samples were collected using the CellFit acquisition and analysis program (Becton-Dickinson), for comparison. Figure 1 shows a comparison of the histograms obtained. As shown in Figure 1, the mock-infected cells are mostly concentrated in the Gl phase whereas those infected with HIV are concentrated in phase G2. The ratio of cells in Gl as compared to G2/M was 2.5 for mock-infected cells and 0.35 for HIV-infected cells. Because only a small percentage of the cells were actually infected with HIV, the HIV strain was modified to permit labeling of infected cells so as to distinguish them from uninfected cells in the putatively infected cell population. To this end, the amino terminal portion of the nef gene was deleted and replaced by the murine thymocyte surface antigen Thy 1.2 by inserting the cDNA of this gene at the Xhol and Mlul restriction sites, thus obtaining the plasmid pNL-Thy. Viral stocks of the marked NL-Thy virus were prepared as described except that the plasmid pNL-Thy was used for transfection. Since the surface antigen shows efficient surface expression and can be labeled with an antibody, it was a convenient marker for cells that were infected by the modified HIV-1. The successfully infected cells exhibiting Thy 1.2 surface antigen at the surface were sorted into positive and negative subpopulations and analyzed by quantitative PCR. Quantitative PCR amplification with ³²P end-labeled primers was performed as previously described (Arrigo, S J. et al. J Virol (1989) 63:4875-4881; Lee, M. et al. Science (1989) 244:431-475; Peng, S. et al. Nature (1990) 343:85-89; Zack, J.A. et al. Cell (1990) 61:213-222; Zack, J.A. et al. J Virol (1992) 66:1717- 1725). Amplification (30 cycles) was performed for HIV-1 and human β-globin sequence analysis by using radiolabeled oligonucleotide primers. The β-globin specific primers and the HIV-1 LTR-specific primers (M567 and AA55), were used as described elsewhere (Zack, J.A. et al. (1990) (supra)). Following amplification, the radiolabeled products were resolved on 6% polyacrylamide gel (PAGE) and visualized by autoradiography. HIV-1 DNA standards used to quantitate viral DNA were derived from dilutions of cloned HIV-1 JR CSF DNA (Cann, A.J. et al. J Virol (1988) 64:4735-4742) and digested with EcoRI, which does not cleave viral sequences. This DNA was diluted into PBL DNA at 10 μg/ml. Standard curves for β-globin DNA were derived from dilutions of PBL DNA. Only a small percentage of Thy 1.2^" cells appeared to be infected. The entire Thy 1.2⁺ population contained the correct amount of HIV proviral DNA. Histograms obtained using cell flow cytometry confirmed that the infected Thy 1. population was G2 arrested, while the Thy 1.2^" population was not. Detection of cells bearing the surface marker Thy 1.2 was as follows: 1 x 10⁶ cells were harvested and stained in 100 μl of Thy 1.2 FITC conjugated monoclonal antibody (Caltag, CA Cat. No. MM2001-3) diluted 1/200 in FACS buffer (PBS with 2% FCS and 0.01% sodium azide) for 20 minutes at 4°C. An additional sample of cells was stained with the isotype antibody IgG2b-FITC (Caltag, CA Cat. No. MG2B01), to control for non-specific background antibody binding. The cells were then washed and resuspended in FACS buffer containing 1 μg/ml PI and analyzed as above. Green FITC fluorescence was collected after a 530/30 nm BP filter and was displayed on a four decade log scale, while orange PI fluorescence was collected as above but displayed on a log scale. Electronic compensation was used among the fluorescence channels to remove residual spectral overlap. The use of PI as a vital dye allows dead cells to be excluded from the population during analysis reducing the background of non-specific antibody binding.

The method of dual staining for surface antigen and DNA content of cells was adapted from the technique of Schmidt, et al. Cytometry (1991) 12:279-285. Briefly, 1 x 10⁶ cells were harvested and stained as above for Thy 1.2 surface antigen. After washing, the cells were fixed in PBS with 0.3% paraformaldehyde for 1 hour at 4°C. Cells were subsequently permeabilized in 0.2% Tween-20 (Bio-Rad. Cat. No. 170- 6531) in PBS at 4°C for 15 minutes, and the DNA finally stained in FACS buffer containing 10 μg/ml PI and 11.25 Kunitz units of ribonuclease A for 30 minutes at 4°C. At least 5000 events were collected as described above.

The time course for this perturbation of the cell cycle was also determined for the Thy 1.2⁺ infected cells. At day 1 postinfection the ratio of Gl to G2/M cells was 1.3 for Thy 1. cells and 2.3 for Thy 1.2^" cells; this ratio fell to 0.49 on day 2 for the Thy 1.2⁺ cells and remained at this level for the remainder of the experiment. The Thy 1.2^" cells maintained the ratio of approximately 2.0 for the remainder of the experiment as well. The time period for this experiment was four days altogether. This was true despite the fact that the percentage of Thy 1.2⁺ cells in the culture rose from 3.3% on day 1 to 59% on day 4. The noninfected subpopulation remaining still exhibited the normal cell cycle profile. The cytopathic effect exhibited in the infected cells prevented continuing the experiment for more than five days. The results are summarized in Table 1.

Similar experiments were run in the presence of anti-AIDS drugs including the reverse transcription inhibitor AZT, the protease inhibitor A77003 described by Kaplan, A. et al. J Virol (1993) 67:4050 and by Jaskolski, M. et al. Biochemistry (1991) 30:1600-1609; and soluble CD4. These drugs succeeded in preventing the spread of infection from the initially affected Thy 1.2⁺ cells through the culture. However, the cells that were Thy 1.2⁺ remained perturbed in their cell cycles wherein about 90% of these cells were in the G2 compartment over a period of three days. This experiment was repeated using CD4⁺-enriched peripheral blood lymphocytes (PBLs) rather than the leukemic SupTl cell line. PBLs were enriched to 85-90% CD4⁺ by negative selection panning and used as target cells for infection by the Thy 1.2-labeled HIV vectors. Peripheral blood lymphocytes (PBL) were obtained from normal donors by venipuncture, isolated by centrifugation over Ficoll-Hypaque (Pharmacia, Sweden; Cat. No. 17-0840-03), and depleted of macrophages by adherence to plastic for four hours. The lymphocytes were then cultured in the presence of phytohemagglutinin (PHA; HA15, 0.8 μg/ml; Wellcome) for three days prior to infection. The culture was enriched for the CD4⁺ population by negative selection panning (Wysocki, Proc Natl Acad Sci USA (1978) 75:2844-2848) using anti-CD8 (OKT8) and anti-CD 11 b (OKMl) antibodies. These antibodies were prepared from hybridoma cell lines obtained from ATCC (OKT8 Cat. No. CRL 8014 and OKMl Cat. No. CRL 8026). Levels of CD4 cells were determined pre- and post- panning by staining with anti-CD4 antibodies (Becton-Dickinson, San Jose, CA Cat. No. 347323) conjugated to fluorescein isothiocyanate (FITC), and flow cytometry as described above. Following infection, these cells were cultured in RPMI supplemented with 10% fetal calf serum and 30 U/ml of recombinant interleukin 2 (rIL-2; AMGEN, Thousand Oaks, CA Cat. No. 5724-95D) with antibiotics as above. The results are shown in Tables 2-4.

The ratio of GO/Gl to G2/M in mock-infected cultures and in the Thy 1.2^" subpopulation of the infected culture increased from 2.0 on day 1 to 5.0 on day 4. This ratio is higher than observed for the leukemic cells; however, the Thy 1.2⁺ subpopulation again demonstrated G2 arrest wherein the ratio of GO/Gl to G2/M was in the range of 0.1-0.73 during all three days of the experiment. G2 arrest occurring in PLL in vivo would prevent proliferation of an activated T cell and thus have a devastating effect on cellular immunity.

Example 2

Infection with Vpr Deficient Mutant HIV The HIV modified Thy vector contains a unique EcoRI restriction enzyme site in the Vpr open reading frame so that mutating this vector to eliminate Vpr expression was straightforward. The vector was digested with EcoRI, filled in with Klenow and religated creating a frame shift to the +1 reading frame at amino acid position 64. This deleted the carboxy terminal 33 amino acids of Vpr and added 16 additional residues before the stop codon. The resulting retroviral vector was then used to produce viral stocks of "Vpr-X Virus".

In more detail, the nef open reading frame of pNL4-3 was deleted from the Xho I to Kpn I sites and replaced with the coding sequence for the murine thymocyte surface antigen Thy 1.2 to obtain pNL-Thy (Giguere, V. et al. EMBOJ (1985) 4:2017-2024). The Vpr-X mutant virus was obtained by cleaving the pNL-Thy with EcoRI (nucleotide position 132 of the Vpr open reading frame) blunt ending by filling in with the DNA polymerase I Klenow fragment and religating according to standard procedures. The resulting frameshift replaced the carboxy terminal 33 residues of the 97 amino acid Vpr protein with the sequence: NSATTAVYPFQNWVST.

The Vpr-X virus was then used to infect SupTl cell cultures in parallel with the HIV Thy-containing virus. Infection was at an equivalent multiplicity of infection. Samples were recovered from both cultures at 24-hour intervals and assayed for the spread of the virus. The proportion of infected cells rose in cultures infected with either the HlV-containing Thy or Vpr-X infected cultures, but over days 3-5, the rate of spread was marginally higher in the Thy-containing cultures than in Vpr-X, reaching 26% and 12% respectively.

Cell flow cytometry was then used to determine the G1/G2 ratios of each infected culture. Cells infected with Vpr-X no longer exhibited the G2 arrest phenotype, as shown in Tables 5-8.

Example 3 Effect of Vpr Protein Alone on the Cell Cycle A vector was constructed containing Thy 1.2 under control of the CMV immediate early promoter as well as an expression system for the Vpr open reading frame under the control of another copy of the CMV promoter. This vector,

BSVprThy, would effect expression of both Thy and Vpr in transfected host cells. A control plasmid (BSThy) differs from BSVprThy only in lacking the Vpr open reading frame.

The expression plasmids were constructed to contain the Thy 1.2 and the Vpr (derived from HIV-1 NL4-3) open reading frames, both driven by the CMV immediate early promoter. Briefly the Thy 1.2 open reading frame was amplified by PCR from a cDNA library. A mouse thymoma cell line cDNA library obtained from Brian Seed, Harvard University, was used as a template for PCR using primers of the following sequences: 5'-CAAGTCGGAACTCGAGGCACCATGAAC-3' (sense) and 5'-CGCGGTACCACGCGTCACAGAGAAATGAAGTCTAG-3' (antisense) which are complementary to the 5' and 3' ends of the Thy-1 coding sequences and extended to include Xhol site at the 5 '-terminus and Mlul and Kpnl sites at the 3 '-terminus. The amplified DNA was digested with Xhol and Mlul and ligated into pCMV (Planelles, V. et al. AIDS Res Hum Retroviruses (1991) 7:889) expression vector flanked by the CMV immediate early promoter and the S V40 polyA sequence to provide transcriptional termination sequences and generate pCMV-Thy. The transcriptional unit was then transferred into the Bluescript^® II KS⁺ plasmid (Stratagene La Jo 11a, CA Cat. No. 212207). The Vpr open reading frame was first cloned into the pCDM8 (Invitrogen, San Diego, CA Cat. No. V308-20) expression vector from pNL4-3. The transcriptional cassette containing the CMV immediate early promoter and the HIV

3'LTR transcriptional termination sequences were transferred into the above Bluescript vector containing the thy 1.2 expression cassette. A control vector was constructed by subcloning the Thy expression cassette into CDM8 alone (lacking the Vpr open reading frame). In more detail an Spel/Xhol fragment of pCDM8 (Invitrogen, San Diego, CA) containing the CMV immediate early promoter was inserted into Spel Xhol digested NL-Thy (Plannelles et al, 1994) to obtain the plasmid NL-CMV-Thy. NL-Thy contains the open reading frame for Vpr and the Thy 1.2 open reading frame prepared as described above. Digestion of NL-CMV-Thy resulted in a fragment containing the CMV promoter, the Thy 1.2 open reading frame and the 3' LTR sequences from HIV. This fragment was transferred to PstI digested Bluescript® II KS Plus (Stratagene, La Jolla, CA) to obtain BS-CMV-Thy.

The Vpr open reading frame was obtained by digesting pNL4-3 (Adachi et al. , 1986 (supra)) with Seal and Sad. The Scal SacI fragment was cloned into Smal SacI cleaved plasmid pGEM7Zf(-) (Promega Madison, WI) to obtain pGEM-Vpr. PGEM- Vpr was digested with Xhol and Nsil and the resulting fragment cloned into XhoI/PstI digested pCDM8 to obtain CDM8-Vpr.

A Nrul to BamHI fragment of CDM8-Vpr containing the CMV promoter, Vpr open reading frame and SV40 transcription termination sequences was cloned into BS-CMV-Thy described above digested with NotI, blunt ended by filing in, and with BamHI to obtain BS-Vpr-Thy. The control plasmid BS-Thy was constructed by cloning the NruI/BamHI fragment of pCDM8 containing only the CMV promoter and SV40 transcriptional termination sequences into BS-CMV-Thy digested with NotI, blunt ended by filing in and with BamHI. All cloning steps described followed standard procedures. Plasmid DNA was prepared for transfection by purification on an anion exchange resin (Qiagen Chatsworth, CA Cat. No. 12145) following the manufacturers protocol. HeLa cells (human epithelial fibroblast; ATCC CCL 2) and COS cells (African green monkey kidney fibroblast; ATCC CRL 1651) were grown in DMEM with 10% calf serum (Gemini, Calabasas, CA Cat. No. 100-102). 10 μg of plasmid DNA was added to 5 x 10⁶ cells in elecfroporation media. Elecfroporation conditions for SupTl cells was as described above for MT2 cells, and for COS and HeLa cells was 250 V at 960 μF.

Cells were harvested at 48 hrs post transfection and stained as described above for presence of Thy 1.2 surface antigen and cell cycle phase determination. SupTl cells, COS cells and HeLa cells were transfected with either the control vector or the vector expressing Vpr. The pattern of G2 arrest in labeled Thy 1. cells transfected with the Vpr-containing vector was maintained as shown in Table 9.

These results show that Vpr is able to induce G2 cell arrest in cells generally, and this function of the protein is not dependent on HIV infection.

The above procedures were repeated using the SW480, HL-60, KG- la, J82, SAOS-2, HeLa, SupTl, Jurkat, MT-2, XP12BE, HCTl 16 and SKBR3 cell lines. The activity of the Vpr protein in blocking replication in these cell lines is provided in Table 2. The Vpr protein is able to induce G2 cell arrest in cells generally, and this function of the protein is not dependent on the cancer origin of the cell type.

Example 4 EXPERIMENTAL PROCEDURES Yeast 2-Hybrid Screen Mammalian Expression Constructs The dual expression plasmids BSVprThy and BSVprXThy (Jowett et al,

1995) contain either Vpr or, the C-terminal truncation mutant, VprX, and the Thy 1.2 coding sequences which are both expressed from tandem copies of the cytomegalovirus (CMV) immediate-early promoter unit. These vectors also contain simian virus 40 (SV 40) transcription termination sequences and an untranslated intron of the CMV immediate-early promoter. The HHR23 AB213 coding sequences (nt 589 to nt 1155) were amplified by PCR from the HeLa cDNA library plasmid recovered in the 2-hybrid screening. The sequence of the forward or sense primer used for PCR amplification is: 5'-

CCGCTCGAGATGGACTACAAAGACGATGACGATAAAAGAGCCAGCTAC AAC AAC-3 ' . This primer contains an Xho I site, a translation initiation site, and the M2 tag (boldface type) at the 5' end. The sequence of the reverse or anti-sense primer used for PCR amplification is: 5'-

CCGACGCGTGGGCTTCGGTGGCCTGGCTTCC-3'. The PCR amplified fragment was then inserted into the Xho I and Mlu I sites of the single expression plasmid pCMV (Planelles et al, 1995) to create pXCB213. The full-length HHR23 A coding sequences (nt 40 to nt 1155) were amplified by PCR from the HeLa cDNA library used in the 2-hybrid screening. The sequence of the forward or sense primer used for PCR amplification is: 5'- GAGCCGCTCGAGATGGACTACAAAGACGATGACGATAAAGCCGTCACC ATC ACGCTC-3 ' . This primer contains an JCho I site, a translation initiation site, and the M2 tag (boldface type) at the 5' end. The sequence of the reverse or anti-sense primer used for PCR amplification is as described for pXCB213. The PCR amplified fragment was inserted into the Xho I and Mlu I sites of pCMV to create pXCHHR23A-l . The DNA sequence of all inserts was confirmed by automated sequencing. Cells

HeLa cells were cotransfected with either BSVprThy or BSVprXThy (0.3 μg) and a 20-fold molar excess of either pCMV (3.2 μg), pXCB213 (4.0 μg) or pXCR23A-l (4.0 μg). Forty eight hours later cells were stained with a monoclonal antibody to the Murine Thy 1.2 cell-surface protein directly conjugated with fluorescein isothiocyanate (FITC) as described (Jowett et al, 1995). After staining, cells were washed and resuspended in FACS buffer containing propidium iodide (PI) and analyzed by flow cytometry using the Lysis II software (Becton Dickson) as described (Jowett et al., 1995). The Thy 1.2-FITC fluorescence intensity is plotted on the X axis and the fluorescence intensity of the PI is plotted on the Y axis.

Indirect Immunofluorescence and Confocal Microscopy

Images were acquired on a Zeiss confocal microscope (Model LSM 410) using a 40X/1.3 oil immersion lens. The fluorescence intensity of Vpr was coded into shades of , and that of the HHR23 A protein was coded into shades of. Since the images were acquired simultaneously at a fixed setting of the confocal microscope they may be superimposed to reveal colocalization.

Flow Cytometry HeLa cells were cotransfected with either BSVprThy or BSVprXThy (0.3 μg) and a 20-fold molar excess of either pCMV (3.2 μg), pXCB213 (4.0 μg) or pXCR23A-l (4.0 μg). Forty eight hours later cells were stained with a monoclonal antibody to the Murine Thy 1.2 cell-surface protein directly conjugated with fluorescein isothiocyanate (FITC) as described (Jowett et al, 1995). After staining, cells were washed and resuspended in FACS buffer containing propidium iodide (PI) and analyzed by flow cytometry using the Lysis II software (Becton Dickson) as described (Jowett et al, 1995). The Thy 1.2-FITC fluorescence intensity is plotted on the X axis and the fluorescence intensity of the PI is plotted on the Y axis. Identification of cellular proteins interacting with Vpr through a yeast two- hybrid screen

The yeast two-hybrid screen was used to identify cDNAs encoding human proteins capable of interacting with HIV-1 Vpr. To create the target for the two- hybrid screen, the complete coding sequence of the HIV-1_NL4.₃ vpr gene was ligated to the yeast Gal4 DNA binding domain (Gal4DB) in a plasmid that directs the expression of a Gal4DB Vpr fusion protein in yeast. The target plasmid was cotransformed into the yeast reporter strain HF7c with a yeast expression library that directs expression of fusion proteins between the Gal4 transcriptional activation domain (Gal4AD) and HeLa cDNA-encoded proteins. Of the 600,000 recombinants screened, 173 were scored as positive by their ability to grow in the absence of histidine and express β-galactosidase activity. Sequence analysis of one of the positive clones revealed that the cDNA encoded the carboxy terminal portion of a protein identical to one of the human homologues of the S. cerevisiae Rad23 protein, HHR23A. An alignment of the two human homologues of Rad23, HHR23 A and HHR23B, and the S. cerevisiae Rad23 protein is shown in Figure 2, along with the largest clone obtained in the 2-hybrid screening, designated HHR23A(B213). The yeast Rad23 protein functions in nucleotide excision repair (NER) in the global genome repair and transcription-coupled DNA repair pathways. HHR23B functions in NER in the global genome repair pathway as part of a complex with the xeroderma pigmentosum complementation group C protein (XPC). HHR23A is also found complexed with XPC in cells (personal communication, F. Hanoaka). HHR23A and B share extensive overall homo logy to each other and contain two copies of a highly conserved 50 amino acid (aa) acidic domain that is conserved among all the Rad23 homologues (see Figure 2). This acidic repeat domain shares homology to the

C-terminal extension of a bovine ubiquitin conjugating enzyme (UBC), E2(25K) that is thought to promote interaction with its substrate and/or function in cellular localization of the UBC. HHR23A(B213) encodes the C-terminal portion of HHR23 A which includes the entire C-terminal conserved repeat domain and a portion of the internal conserved repeat domain. It is noteworthy that the strain of yeast expressing the Gal4DBVpr fusion was growth impaired when compared to those expressing the Gal4DB alone or a Gal4DBSNF4 fusion. This suggested that expression of the Gal4DBVpr fusion induced growth arrest to some extent in S. cerevisiae as has been reported by other investigators. The presence of the plasmid encoding Gal4ADHHR23A(B213) resulted in the restoration of a normal growth rate. Restoration of the growth- impaired phenotype was not seen when either the Gal4AD alone or a Gal4ADSNFl fusion was coexpressed with Gal4DBVpr (data not shown).

In addition to the Rad23 homologues, the Vpr protein was shown to bind to: two previously unknown human proteins, herein denoted as B251 - 1 and B29- 1 (Figures 9-11); casein kinase II (beta subunit); uracil DNA glycosylase; phosphoglycerate kinase I; ubiquitin conjugating enzyme; and pyruvate kinase.

Ex vivo binding of GSTVpr and full-length HHR23A Since HHR23 A was isolated in a genetic protein interaction screen with Vpr, it seemed likely that HHR23 A and Vpr would interact physically. In order to confirm a direct physical interaction between HHR23 A and Vpr, full-length HHR23 A protein transiently expressed in Hela cells was tested for the ability to bind to a recombinant fusion protein between glutathione-S-transferase (GST) and Vpr (GSTVpr). The complete coding sequence of the HIV-1_NL4.3 vpr gene was ligated to GST sequences in a plasmid that allowed expression of a chimeric fusion protein in bacteria. GSTVpr, was purified from bacteria by affinity chromatography on glutathione-sepharose. To produce full-length HHR23 A, an expression vector containing the complete coding sequences of HHR23A with an N-terminal FLAG epitope tag was constructed to facilitate detection by Western blotting. Forty eight hours after transfection with the

HHR23 A expression plasmid, HeLa cells were lysed and lysates were used in ex vivo binding studies. GSTVpr-associated proteins were selectively recovered by affinity binding to glutathione-sepharose beads. The ability of HHR23A to bind to GSTVpr was determined by Western blot analysis of GSTVpr-associated proteins with a monoclonal antibody directed toward the M2 FLAG epitope (Figure 3). HHR23A bound to GSTVpr, but no binding was detected with HHR23 A when GST was used in the binding reaction. This result provides evidence for a direct interaction between Vpr and the full-length HHR23 A and confirms and extends the genetic data obtained through the yeast two-hybrid screen.

Subcellular localization and colocalization of Vpr and HHR23A in transfected cells

Since binding of the full-length HHR23A to GSTVpr was observed, experiments were performed to determine whether these proteins colocalized to the same subcellular compartments and whether the subcellular localization of the individual proteins, when expressed alone, was altered by the presence of the other. Vpr has previously been reported to localize in the nucleus. Similarly, indirect immuno fluorescence studies of endogenous HHR23A in HeLa cells have demonstrated nuclear localization during interphase. During metaphase however, HHR23 A was found to be present throughout the cell and did not appear to be associated with chromatin (van der Spek et al. , 1996).

To define the intracellular distribution of Vpr and HHR23A, indirect immunofluorescence in HeLa cells expressing either Vpr, HHR23 A, or the truncated form HHR23A(B213) alone or Vpr and HHR23A or HHR23AB213 together was performed and analyzed by confocal microscopy. In contrast to previously reported results, HHR23 A was found to be localized primarily in the perinuclear region. This discrepancy may be accounted for by the differences in the fixation and staining protocols. Also, confocal microscopy allows one to easily distinguish between nuclear and perinuclear localization by determining the staining pattern of proteins within sections throughout the entire cell. HHR23A(B213) was also localized primarily in the perinuclear region. As previously reported, Vpr, when expressed alone, localized primarily in the nucleus. A concentration of Vpr in the perinuclear region was also observed. In cells expressing both Vpr and HHR23A or HHR23A(B213), there was a colocalization of Vpr and HHR23A or HHR23A(B213) within the nucleus, and in particular in the perinuclear region. Coexpression of Vpr and HHR23A in cells did not appear to change the subcellular distribution of Vpr.

However, a redistribution of HHR23A and HHR23A(B213) into the nucleus when coexpressed with Vpr was seen. These results demonstrate that Vpr and HHR23 A, when coexpressed in cells, are both present within the same subcellular compartment and/or complexes.

Mapping domains of HHR23A which interact with Vpr

To further characterize the regions of HHR23A required for interaction with Vpr, a panel of positive clones identified in the two-hybrid screen were screened to identify Gal4ADHHR23A cDNA fusion proteins encoding shorter fragments of the HHR23A coding sequences which were still able to bind to Vpr. This was done by hybridizing plasmid DNA isolated from the panel of 173 positive clones identified in the two-hybrid screening with a radio-labeled fragment of HHR23A derived from the Gal4AD/HHR23A(B213) plasmid. Eight Gal4AD/HHR23A clones encoding fusion proteins of various lengths which maintained interaction with Gal4DB/Vpr in the yeast two-hybrid screen were identified. Sequence analysis of these clones identified a common 45 amino acid C-terminal region of HHR23A which was present in all clones (Figure 4). Interestingly, this minimal domain corresponds to a 50 amino acid domain identified by sequence analysis that shares homology to the C-terminal extension of a bovine ubiquitin conjugating enzyme (UBC), E2(25K) which is thought to promote interaction with its substrate and/or function in cellular localization of the UBC.

The 45 aa C-terminal portion of HHR23A is sufficient for binding to GSTVpr To further characterize the minimal HHR23A sequences required for interaction with Vpr, the ability of the 45 amino acid HHR23A domain identified in the two-hybrid system to bind to GSTVpr in vitro was examined. A chemically synthesized peptide corresponding to the 45 aa C-terminal portion of HHR23A was it for binding to the GSTVpr fusion protein (Figure 5A). To visualize the peptide following affinity binding with glutathione-sepharose and Western blotting, the peptide was synthesized with a biotin tag on the amino terminal. The peptide derived from the 45 amino acid C-terminal of HHR23A specifically bound to GSTVpr but not to GST, and binding could be competed with increasing amounts of unlabeled HHR23 A peptide (Figure 5B). These results confirm that the highly conserved carboxy terminal region of HHR23A comprises a binding domain for Vpr.

The 45 aa C-terminal portion of HHR23A comprises most of the internal 50 aa repeat element that is highly conserved between the two human homologues: the corresponding region of HHR23B differs by only 3 aa (see Figure 2). Thus, a synthetic peptide derived from the 45 aa C-terminal region of HHR23B was tested for the ability to bind to GSTVpr in the in vitro assay. The HHR23B peptide did specifically bind to GSTVpr but not to GST (Figure 5A). Thus, although not detected through the yeast two-hybrid screen, it is possible that HHR23B may also interact with Vpr in cells.

Over expression of HHR23A partially alleviates Vpr-mediated cell cycle arrest Since expression of Vpr in cells results in an arrest at the G2 phase of the cell cycle, one would predict that over-expression of a cellular protein that interacts with Vpr and that is involved in the cell cycle arrest phenotype would result in alleviation of Vpr-induced G2 arrest. This hypothesis was tested by cotransfecting HeLa cells with the Vpr and HHR23A(B213) expression plasmids. The Vpr expression plasmid, BSVprThy, also bears the thyl.2 cell surface reporter which can be used to distinguish, by flow cytometry, successfully transfected cells. An HHR23A(B213) encoding construct was cotransfected in approximately a 20-fold molar excess over BSVprThy to ensure that the majority of cells which express Vpr and Thyl.2 would also express HHR23A(B213). Cells expressing Vpr and Thyl .2 showed a G1/G2 ratio of 0.15 (Figure 6A, panel A). Coexpression of Vpr and HHR23A(B213) resulted in a significant reduction in the degree of cell cycle arrest. The G1/G2 ratio of the Thy 1.2⁺ population was approximately 1.2. (Figure 6A, panel C). Cells that were mock-transfected or transfected with a plasmid encoding a mutant form of Vpr (VprX) had a normal cell cycle profile, with G1/G2 ratios of approximately 2.8 and 2.1 respectively (Figure 6A, panels E and B). These results demonstrate that over expression of a fragment of HHR23A, which contains the minimal region required for binding to GSTVpr in vitro, results in a partial alleviation of Vpr-induced cell cycle arrest. Coexpression of full-length HHR23A and Vpr was tested for the ability to alleviate the Vpr-induced cell cycle arrest. The results demonstrate that expression of full-length HHR23A alleviated Vpr-induced cell cycle arrest (Figure 6B, panel E) although consistently to a lesser extent than that observed with HHR23A(B213) (compare panels C and E, Figure 6B). The ability of a mutant form of HHR23 A, which contains a C-terminal truncation caused by a frameshift at amino acid 346, was also tested for the ability to alleviate Vpr-induced G2 arrest. This frameshift results in expression of a protein that contains ten additional amino acids following the frameshift site and deletion of the C-terminal 17 aa of HHR23A. The absence of the 17 residues at the C-terminal of HHR23A was sufficient to abolish the alleviation of G2 arrest seen with the full-length wild-type protein (Figure 6B, panel G). This result provides further evidence for the importance of the C-terminal portion of HHR23A in Vpr binding and mediation of G2 arrest.

The level of HHR23A and HHR23B RNA expression is similar in Vpr- arrested cells to that detected in the Gl and G2 phases of the cell cycle Previous studies using Northern blot analysis of RNA isolated from synchronized HeLa cells at various stages of the cell cycle have indicated that the level of HHR23A and HHR23B RNA was not significantly different during Gl, S, G2, or mitosis (van der Spek et al, 1996). To obtain further information about the mechanism of Vpr-induced cell cycle arrest with respect to HHR23A, the level of HHR23 A RNA in Vpr-arrested cells was determined using an RT-PCR assay and compared to that detected in cell populations that were predominantly in the Gl or G2 phases of the cell cycle. By comparing RT-PCR reactions from a series of 2-fold serial dilutions of RNA, the relative levels of RNA expression for a specific gene could be quantified. RT-PCR reactions using primers that detect one of the human homologues of the yeast CKS1 RNA, CKShs2, were run in parallel as a control for the RT PCR reaction (Figure 7, panel B). The level of HHR23A RNA expression was found to be similar in Vpr-arrested cells to that detected in cells that were predominantly in Gl or G2 (see Figure 7, panel A). Thus, expression of Vpr in cells did not appear to dramatically affect the level of HHR23A expression. It was also found that the level of HHR23B expression was similar in Vpr-arrested cells to that detected in the Gl and G2 populations of cells (data not shown). These results confirm previously published results with regard to the levels of HHR23A and HHR23B RNA expression in the Gl and G2 phase of the cell cycle and extend them to the case of Vpr-arrested cells.

DISCUSSION

The present results demonstrate that Vpr binds directly to a human cellular protein, HHR23A. Using the yeast 2-hybrid system to screen for cDNAs encoding cellular proteins that interact with HIV-1 Vpr, a cDNA which partially encodes one of the human homo logs of the yeast Rad23 gene, HHR23A was isolated. The binding of full-length HHR23 A from cell lysates with a recombinant GST- Vpr fusion protein was shown. The interaction between Vpr and HHR23 A in vitro was confirmed using recombinant proteins and synthetic peptides. The Vpr-interaction domain was mapped to the C-terminal repeat domain of HHR23A. Colocalization of HHR23A and Vpr in Hela cells transiently expressing immunotagged HHR23A and Vpr by indirect immunofluorescence and confocal microscopy. Most significantly, overexpression of HHR23A was shown to lead to a partial alleviation of Vpr-induced G2 arrest. This finding provides functional evidence that Vpr and HHR23 A interact in cells and that this interaction has biological consequences with regards to Vpr- mediated cell cycle arrest.

Cellular Function of HHR23A

HHR23A is one of two human homo logs of the S. cerevisiae Rad23 gene. The Rad23 gene encodes a 42 kDa acidic protein that functions in nucleotide excision repair (NER) in both the global genome repair and transcription-coupled DNA repair pathways in yeast. Ex vivo coimmunoprecipitation studies have demonstrated that Rad23 is one component of a higher order protein complex consisting of the multisubunit transcription factor TFIIH and Rad 14, a zinc metalloprotein that binds specifically to UV-damaged DNA. Rad23 facilitates complex formation between Radl4 and TFILH via interaction with Radl4 and the Rad25 and TFB1 components of TFIIH.

HHR23A and its counterpart HHR23B encode acidic proteins of 40 and 43 kDa respectively that share extensive overall homology to each other (57 % identity and 76 % similarity) and with the Rad23 gene of S .cerevisiae (30-34 % identity, 41% similarity). All of the yeast Rad23 homologues identified to date, including human and mouse, share the following structure: a basic N-terminal ubiquitin-like domain followed by a highly conserved 50 amino acid (aa) acidic domain that is repeated at the C-terminal. The function of the N-terminal ubiquitin-like domain is unknown. In S. cerevisiae, it is essential for biological function of Rad23 but does not appear to mediate proteolytic degradation. The 50 aa internal repeat domain shares homology with a C-terminal extension of a bovine ubiquitin conjugating enzyme (E2(25K)) and is fully conserved between the human and murine homologues suggesting a functional role for this region. HHR23 A and B do not display significant differences in RNA levels during the mitotic cell cycle. The present results confirm this observation. There was not a significant difference between HHR23 A and HHR23B RNA expression in Vpr-G2- arrested cells and in cells where the predominant population is in the Gl or G2 phase of the cell cycle. HHR23A and B do not exhibit the UV-inducible phenotype of their yeast counterpart where induction of mRNA levels is seen upon UV exposure and during meiotic prophase. The murine Rad23 homologues are expressed in a wide variety of tissues, with increased RNA expression seen in testis tissue suggesting a role in meiotic recombination.

The cellular function of HHR23A and HHR23B is less well characterized than that of Rad23. HHR23B was originally identified in association with the XPC protein, the putative homologue of the yeast Rad4 protein. XPC and HHR23B form a protein complex that corrects the genome DNA repair defects of human cells from patients with xeroderma pigmentosum complementation group C (XPC). In vitro reconstitution studies have demonstrated that HHR23B exhibits a stimulatory effect on the correcting activity of XPC. These results indicate that HHR23B functions in one NER pathway known as the global genome repair pathway, the mode of repair that is defective in XPC cells. More recently it has been shown that like HHR23B, HHR23A also binds to XPC (personal communication, Fumio Hanaoka). Unlike XPC, which exhibits a high affinity for single-stranded DNA, neither HHR23A or B exhibits an affinity for single-stranded or double-stranded DNA, indicating that it is unlikely that either protein plays a direct role in DNA damage recognition. From the data available to date, it is not clear what the cellular function of HHR23A is and whether the HHR23 A and HHR23B homologues are functionally related.

Identification of the Vpr interacting domain of HHR23A The eight different HHR23 A cDNAs isolated in the two-hybrid screen enabled the localization of the region of HHR23A required for interaction with Vpr. Peptides comprising a region as small as 45 amino acids of the C-terminal are sufficient to bind to GST- Vpr. The corresponding 45 amino acids of HHR23B also binds to GSTVpr. The minimal binding region of HHR23A corresponds to an internal repeat domain of the Rad23 homologues that shares homology with the C-terminal extension of a bovine ubiquitin conjugating enzyme, E2(25K). The E2(25K) protein is a class 2 ubiquitin conjugating enzyme (UBC). Class 2 UBCs contain a highly conserved catalytic domain followed by unrelated C-terminal extensions that vary in length and which are thought to promote interaction with the substrate and/or function in cellular localization of the UBC. The other class of UBCs, class I enzymes, lack C-terminal extensions and require auxiliary proteins (E3 proteins) for substrate recognition. E3 proteins catalyze the isopeptide bond formation between ubiquitin and the substrate and thus play a key role in the selection of proteins for ubiquination and their subsequent proteolytic degradation.

Claims

Claims

1. A method to identify an agent for use in treating lentiviral infection comprising the steps of: contacting a cellular target for the Vpr protein and the Vpr protein with an agent to be tested; and assessing the ability of the agent to block the interaction of the Vpr protein with said target; wherein an agent that blocks the binding of said target to said Vpr protein is identified as an anti-lentiviral agent.

2. The method of claim 1 further comprising assessing the ability of said agent to reduce the ability of said Vpr protein to induce cell cycle stasis.

3. The method of claim 1 wherein the cellular target is selected from the group consisting of the HHR23A protein, a fragment of the HHR23A protein that binds to the Vpr protein, uracil DNA glycosylase, a fragment of uracil DNA glycosylase that binds to the Vpr protein, casein kinase II (beta-subunit), a fragment of casein kinase II (beta-subunit) that binds to the Vpr protein, phosphoglycerate kinase 1 , a fragment of phosphoglycerate kinase that binds to the Vpr protein, pyruvate kinase, a fragment of pyruvate kinase that binds to the Vpr protein, the B29- 1 protein, a fragment of the B29-1 protein that binds to the Vpr protein, a protein that contains the B29-1 protein that binds to the Vpr protein, the B251-1 protein, a fragment of the B251-1 protein that binds to the Vpr protein and a protein that contains the B251 - 1 protein that binds to the Vpr protein.

4. The method of claim 2 wherein the cellular target is selected from the group consisting of the HHR23A protein, a fragment of the HHR23A protein that binds to the Vpr protein, uracil DNA glycosylase, a fragment of uracil DNA glycosylase that binds to the Vpr protein, casein kinase II (beta-subunit), a fragment of casein kinase II (beta-subunit) that binds to the Vpr protein, phosphoglycerate kinase 1, a fragment of phosphoglycerate kinase that binds to the Vpr protein, pyruvate kinase, a fragment of pyruvate kinase that binds to the Vpr protein, the B29- 1 protein, a fragment of the B29-1 protein that binds to the Vpr protein, a protein that contains the B29-1 protein that binds to the Vpr protein, the B251-1 protein, a fragment of the B251-1 protein that binds to the Vpr protein and a protein that contains the B251-1 protein that binds to the Vpr protein.

5. A method to identify an agent for use in treating lentiviral infection comprising the steps of providing an agent to a cell expressing a Vpr protein under conditions in which said Vpr protein would induce cell cycle stasis in the absence of said agent and determining whether said agents blocks Vpr induced cell cycle stasis.

6. The method of claim 5 wherein the cellular target is selected from the group consisting of the HHR23A protein, a fragment of the HHR23A protein that binds to the Vpr protein, uracil DNA glycosylase, a fragment of uracil DNA glycosylase that binds to the Vpr protein, casein kinase II (beta-subunit), a fragment of casein kinase II (beta-subunit) that binds to the Vpr protein, phosphoglycerate kinase 1, a fragment of phosphoglycerate kinase 1 that binds to the Vpr protein, pyruvate kinase, a fragment of pyruvate kinase that binds to the Vpr protein, the B29- 1 protein, a fragment of the B29-1 protein that binds to the Vpr protein, a protein that contains the B29-1 protein that binds to the Vpr protein, the B251-1 protein, a fragment ofthe B251-l protein that binds to the Vpr protein and a protein that contains the B251-1 protein that binds to the Vpr protein.