WO1998034956A1

WO1998034956A1 - Non-covalent complex comprising at least an antibody and element binding with immunoglobulins associated with an active substance, method of preparing and applications

Info

Publication number: WO1998034956A1
Application number: PCT/FR1998/000227
Authority: WO
Inventors: Pascal Drevet; Michel Leonetti; André Menez
Original assignee: Commissariat A L'energie Atomique
Priority date: 1997-02-07
Filing date: 1998-02-06
Publication date: 1998-08-13
Also published as: FR2759296A1; FR2759296B1

Abstract

The invention concerns a non-covalent complex comprising at least an antibody or an antibody fragment capable of binding with a molecule expressed at a cell surface and an element binding with immunoglobulins (Igs), associated with an active substance, said complex having a specific affinity for appropriate target cells. The invention also concerns said complexes and their applications. Said non-covalent complex comprises (i) at least an antibody or an antibody fragment capable of being bound with a molecule expressed at a cell surface and (ii) an element binding with immunoglobulins, associated with an active substance, said binding element can only be bound with a single type of site on the immunoglobulin.

Description

NON-COVALENT COMPLEX COMPRISING AT LEAST ONE ANTIBODY AND AN IMMUNOGLOBULIN BINDING MEMBER ASSOCIATED WITH AN ACTIVE SUBSTANCE, ITS PREPARATION METHOD AND ITS APPLICATIONS. The present invention relates to a non-covalent complex comprising at least one antibody or an antibody fragment capable of binding to a molecule expressed on the surface of a cell and an immunoglobulin binding element (Igs), associated with an active substance, said complex having a specific affinity towards appropriate target cells. The invention also relates to compositions containing said complexes and to their applications.

The transport of molecules or active substances to particular biological sites, organs or target cells, gives these substances improved efficiency and lower toxicity for the organism. Such a process is referred to below as targeting and corresponds to the transport of the active substance to its preferential site of action.

Depending on the type of active substance, immunogenic complexes (active substance: antigen or immunogen), cytotoxic complexes (active substance: drug) or expression complexes allowing the transfer of a gene into a target cell are obtained. and its expression in this cell

(active substance: nucleic acid fragment (DNA or RNA)).

Targeting systems have already been proposed. For example :

- in the case where the active substance is an antigen, it has already been proposed to improve the immune response in vivo, by intervening in particular at the level of the presentation of the antigen to T cells by the antigen presenting cells (CPAg or APC, for Antigen Presenting Cell), such as B cells, dendritic cells or macrophages, in particular using covalent conjugates, which improve the immune response in vivo:

* covalent coniupues increasing the immune response. in the absence of adjuvants:

- In US Patent 5,283,323 in the name of Berzofsky et al., it has been proposed to target the antigen towards the immune system, at the level of stimulation of T cells, using as an immunogenic composition, a covalent antigen-anti-Ig antibody conjugate, which binds to the surface Igs of B cells.

This conjugate makes it possible in particular to obtain the stimulation of T cells in vitro, with concentrations of antigen, lower by a factor of ten compared to those used with the antigen alone;

- in European Application 245 078, in the name of Connaught Laboratories Lim., a conjugate which can be used in a new in vivo immunization procedure is described and comprises an antigen coupled to an antibody specific for the surface structure of the cells presenting the antigen and in particular an antibody to an MHC class H molecule. The antibody and the antigen are coupled by avidin and biotin: the antibodies are biotinylated and avidin is coupled to the antigen.

Such conjugates make it possible to increase the immunogenicity of antigens naturally exhibiting low immunogenicity, and are particularly advantageous for small peptides.

* covalent conjugates increasing the immune response. in the presence of adjuvants:

- European Patent Application 243 333 in the name of KabiGen AB describes a covalent antigen - IgG binding protein conjugate (fusion protein), in which the IgG binding protein is one of the following proteins: protein A, fragment Z of protein A or protein G, to allow the production of antibodies or to increase it; however, to generate antibodies, this composition is emulsified in the complete Freund's adjuvant.

* other covalent conjugates have also been described: they do not modify the specificity of the antibody and / or the activity of the conjugate: US Patent

5,204,449 in the name of Puri, for example, thus describes an antigen-antibody conjugate comprising at least one antigen and at least one antibody having specificity for MHC class I or class IL in which the antigen and the antibody can be chemically coupled as follows: (i) the monoclonal antibody can be modified by oxidation of its carbohydrates; (ii) coupling using the avidin-biotin system; (iii) coupling of an antigen having a hydrazide group and an oxidized monoclonal antibody carrying aldehyde groups; (iv) coupling through the protein A: in this case, either the antigen is chemically linked to protein A which has an affinity for the Fc portion of the antibody, which allows a high affinity protein A-antibody binding, with a minimum loss of the activity of the antibody; either the antigen carrying a hydrazide group is chemically linked to protein A and the antibody is oxidized,

- in the case where the active substance is a drug, in particular a toxin, numerous antibody conjugates specific for a type of cell-active substance (agent capable of destroying the cell) have been described. In general, a monoclonal antibody is prepared so as to have specificity for an antigen present on the surface of the target cell, so that the monoclonal antibody will bind to and when incorporated into the target cell. cell, it will transport its toxic conjugate inside it. In addition to ricin, other agents can be incorporated into immunotoxins; there may be mentioned in particular, bacterial, plant or animal toxins (or their active fragments), radioactive atoms and agents used in anticancer chemotherapy (chemical substances such as anthracyclines, substances modifying the metabolism of cancer cells, such as nucleotide sequences expressing a protein and antisense nucleotide sequences). In all cases, the immunotoxins thus formed, direct the active substance (the toxin or the anticancer agent) to the pathological domain and thus lead to the elimination of the target cells.

Other cytotoxic complexes have also been described; in PCT International Application WO 83/04026, for example, a cytotoxic agent comprising protein A of staphylococcus chemically coupled to fragment A of castor toxin is more particularly described. However, this agent, in order to function, requires prior treatment with antibodies, target cells in vitro, which is difficult to envisage in the context of therapeutic treatment.

- in the case where the active substance is a nucleic sequence, covalent conjugates comprising antibodies directed against the biotinylated gp70 retroviral envelope protein and antibody conjugates directed against specific biotinylated cell markers are linked by streptavidin and are used for infect cells with a recombinant retrovirus, carrying a recombinant gene, have summer, for example described (P. Roux et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 9079-9083).

However, the covalent conjugates of the prior art are not suitable for every situation; in fact, it is advantageous to have a structure which is flexible enough to be able to adapt to any active substance and to any target, which is not the case for the covalent conjugates according to prior art.

This is why the Applicant has set itself the goal of providing a non-covalent complex, capable of increasing the local concentration of a molecule or active substance at the level of its target cell, which better meets the needs of the practice than the covalent conjugates described in the prior art, in particular in that it constitutes a simpler system than the covalent systems of the prior art, more flexible to use and is also more stable on storage; such complexes have, in fact, the advantage over the covalent complexes of the prior art that they can be used, not only in the field of immunology (immunogenic and vaccinating compositions) but also in other fields, such as oncology (cytotoxic compositions) or protein expression (compositions stimulating the expression of transgenes) and in all cases, to act only at its specific target, significantly, at lower doses - lower than those usually used. In addition, such systems are particularly suitable, when the active substance is a DNA sequence, associated with a living vector (bacteria, virus, etc.).

The subject of the present invention is a non-covalent complex, characterized in that it comprises (i) at least one antibody or an antibody fragment, capable of binding to a molecule expressed on the surface of a cell and ( ii) a binding element to an immunoglobulin or to an immunoglobulin fragment, associated with an active substance, which binding element can only bind to a single type of site or region on the immunoglobulin (Ig), such as than an Fc site or a Fab site.

According to an advantageous embodiment of said non-covalent complex, said antibody is directed against a molecule expressed on the surface of cells presenting the antigen (CPAg), selected from the group consisting in particular of the molecules of the major histocompatibility complex ( CMH), the immunoglobulins, transferrin receptors or mannose (macrophage) receptors.

According to an advantageous arrangement of this embodiment, said antibody is selected from the group consisting of anti-MHC class H molecule antibodies, .anti-IgM antibodies and anti-IgG antibodies directed against the F (ab ') region ) ₂ of an Ig.

According to another advantageous embodiment of said non-covalent complex, said antibody is directed against a molecule expressed on the surface of cancer cells. According to another advantageous embodiment of said non-covalent complex, said antibody or antibody fragment is directed against a molecule expressed on the surface of mucosal cells or muscle cells.

According to another advantageous embodiment of said non-covalent complex, said antibody or antibody fragment is capable of binding to cells expressing an Fc receptor on their surface.

Advantageously, such antibodies can be used in immunogenic complexes according to the invention.

According to another advantageous embodiment of said non-covalent complex according to the invention, the immunoglobulin binding element is selected from the group consisting of proteins or fragments of immunoglobulin binding proteins which only bind in the region Fc of an immunoglobulin (IgG, IgM, IgA, IgE or IgD, for example), and come from bacteria. These proteins or fragments of proteins can be less affinous than protein A of Staphylococcus aureus, like the fragment ZZ. These proteins or protein fragments can be a protein A fragment of at least eight amino acids (PK Ray et al., Indian J. Biochem. Biophys., 1995, 32, 372-377), proteins or protein fragments of type IL derived from group A streptococci, proteins or fragments of LLL type proteins derived from group C, group G or group L streptococci, such as protein G, preferably recombinant or one of its peptide fragments, type IV proteins or protein fragments, derived from bovine group G streptococcus, type V or type VL proteins or protein fragments derived from Streptococcus zooepidemicus or any other protein or protein fragment, derived from bacteria, protozoa or viruses and binding in the Fc region of an Ig.

Protein A includes five different IgG binding domains, namely domains E, D, A, B, and C ((M. Uhlen et al., J. Biol. Chem., 1984, 259, 3, 1695- 1702) .The Z fragment is derived from the B domain of protein A by substitution of the Asn-Gly sequence by the Asn-Ala sequence; the ZZ fragment comprises two Z sequences. The binding of the ZZ fragment to the immunoglobulins has more particularly been studied by UK Ljungberg et al. (Mol. Immunol, 1993, 30, 4, 1279-1285) and in particular its binding capacities and its affinities, compared to those of protein A: the affinity constant of the ZZ fragment for IgG is 4.8.10 ^"8 M ^{" 1} , determined by saturation and 4.3.10 ^"8 M ^{" 1} , determined by competition, while that of protein A is 26.10 ^"8 M ^{" 1} , by saturation and 25.10 ^"8 M ^{" 1} , per competition.

The ZZ fragment has a number of advantages compared to the complete protein A: although it has a significantly lower affinity for the Fc site of IgG, of about a factor of 5, it makes it possible to obtain targeting in vitro as effective as that which would be obtained, in the presence of protein A. In addition, and surprisingly, in vivo, although the binding affinity of the ZZ fragment for IgG is low, the endogenous IgG does not seem to disturb its binding with the MHC anti-molecule antibody; moreover, since it only binds to the Fc site, it does not trigger the biological activities of protein A which binds to both the Fc site and the Fab site, such as the activation of complement and network precipitation of antibodies (JJ Langone, Advances in Immunology, 1982, 32, in particular pages 211-215; A. Grov et al., Acta Path. Microbiol. Scan. Sect. C, 1976, 84, 333-336 ; C. Endresen, Acta Path. Microbiol. Scan. Sect. C, 1979, 87, 185-189). Although the ZZ fragment is less affine than protein A, it has the same level of presentation, at equal concentration and it provides as effective targeting; it therefore works in vivo, despite possible competitiveness with endogenous Ig.

Protein G (type LLI) has 3 different domains of binding to Igs, namely domains A, B and C (M. Erntell et al., Mol. Immunol, 1988, 25, 2, 121-126; M. Eliasson et al., Mol. Immunol, 1991, 28, 10, 1055-1061). The Ig binding proteins, derived from bacteria of type H, IV, V or VI and which preferentially bind in the Fc region of an Ig, are more particularly described in Bacterial Immunoglobulins binding proteins, Vol 1, 1990, Académie Press Inc ., Ed. Michael DP Boyle, for example the Arp protein of group A streptococci or the β protein of group B streptococci preferably bind in the Fc region of IgA; fragments from Branhamella catarrhalis, Haemophilus influenzae and group A, B, C and D streptococci preferably bind in the Fc region of IgD.

According to another advantageous embodiment of said non-covalent complex according to the invention, the immunoglobulin binding element is selected from the group consisting of proteins or fragments of immunoglobulin binding proteins which only bind in the region Fab of an Ig (IgG, IgM, IgA, IgE or IgD, for example) and are derived from bacteria such as protein L of Peptostreptococcus magnus, a fragment of protein A comprising at least one of the following domains A , B, C, D and / or E, protein G, preferably recombinant or a fragment of protein G, protein P or a fragment of protein P of Clostridium perfringens, or any other protein or fragment of protein, derived from bacteria , protozoa or virus and binding in the Fab region of an Ig.

Protein L from Peptostreptococcus magnus preferably binds to the light chain of the Fab region (B.H. Nilson et al., J. Biol. Chem., 1992, 267, 4, 2234-2239).

These different peptide fragments are described in particular in the work Bacterial Immunoglobulins binding proteins, 1990, cited above.

According to another advantageous embodiment of said non-covalent complex according to the invention, the active substance is selected from the group consisting of antigens of interest, drugs and fragments of nucleic acid of interest (DNA or RNA) .

According to an advantageous arrangement of this embodiment, when the active substance is an antigen or an immunogen, the non-covalent complex according to the invention comprises (i) an antibody or an antibody fragment directed against a molecule expressed on the surface an antigen-presenting cell, in particular an anti-MHC molecule antibody, an anti-IgM antibody or an anti-IgG antibody directed against the F (ab ') _{2 region} of an Ig and (ii) an immunoglobulin binding element as defined above, associated with an antigen.

According to an advantageous modality of this arrangement, said complex comprises (i) an antibody to MHC class H molecule and (ii) a protein or a fragment of a protein for binding to Fc of Ig, less affinous than protein A , in particular the ZZ fragment of protein A conjugated to an antigen, preferably in the form of a fusion protein.

Surprisingly, a non-covalent ZZ-antigen / anti-MHC class II molecule antibody complex is sufficiently stable and results in:. in vitro, an immune response with significantly lower amounts of antigen than those usually causing an immune response (stimulation of T cells); the decrease in the amount of antigen is between a factor 10 ² (relative to the ZZ-antigen conjugate) and a factor 10 ⁵ (relative to the unconjugated antigen), to obtain the same level of reply ; . in vivo, the production of specific antibodies and the induction of a T response (stimulation of specific helper T cells), in the absence of any adjuvant, whereas this is not possible with the ZZ- conjugate antigen;

. a relationship between T stimulation in vitro and the production of antibodies in vivo. According to another advantageous arrangement of this embodiment, when the active substance is a drug, the non-covalent complex according to the invention comprises (i) an antibody or an antibody fragment directed against a molecule expressed on the surface of a target cell (α-fetoprotein, for cancer cells, for example) and (ii) an immunoglobulin binding element, as defined above, associated with a drug which can in particular be selected from cytotoxic chemicals, toxins (animal, plant or bacterial), haptens and antisense nucleotide sequences.

Surprisingly, such non-covalent complexes according to the invention do not induce any immune response against hapten, for example, following their injection into animals.

This result indicates that the antibody and the immunoglobulin binding element do not induce an immune response against hapten; it As a result, the immunoglobulin binding element therefore does not behave like a "classical carrier protein". This implies :

- that one can increase the effectiveness of action of a haptenic drug substance (the majority of drugs are haptens) by coupling it with an anticoφs directed against its physiological target, without inducing an immune response against hapten, with a non-covalent complex according to the invention.

Such non-covalent complexes according to the invention can therefore be used to improve the efficacy of a medicament without the risk of an inappropriate immune reaction. According to yet another advantageous arrangement of this embodiment, when the active substance is a nucleic acid, the non-covalent complex according to the invention comprises (i) an anticoφs or a fragment of anticoφs directed against a molecule expressed on the surface of a target cell and (ii) an immunoglobulin binding element, as defined above, associated with a nucleic acid. The non-covalent complexes according to the invention have a certain number of advantages compared to the covalent conjugates of the prior art:

- Generally, they constitute versatile and flexible systems, because the connecting element associated with the active substance can be associated with any anticoφs, depending on the desired application; this is a big difference from the more rigid covalent systems; in addition, they have greater storage stability and can advantageously be presented in two separate bottles;

- they allow effective targeting of the active substance to increase the local concentration of the active substance at a given location and possibly its endocytosis by a target cell;

- in the case where the active substance is an antigen or an immunogen, the non-covalent complex according to the invention is able in vitro: to stimulate the auxiliary T lymphocytes specific for said antigen and in vivo: to specifically increase the T response auxiliary and to induce the production of anticoφs and the cytotoxic T response and this, in the absence of adjuvant. The increased stimulation of T helper lymphocytes can, under certain injection conditions, induce their anergy (non-response stage) and reducing or even canceling an inappropriate immune response, such as an allergic or autoimmune reaction;

- in the case where the active substance is a drug, the non-covalent complex according to the invention is capable of improving the cytotoxic power of said drug (action only at the level of specific targets and promotion of endocytosis);

- in the case where the active substance is a nucleic acid, the non-covalent complex according to the invention is capable of improving the expression of the transgenes.

According to another embodiment of the invention, the element for binding to the immunoglobulins is covalently conjugated to said active substance.

According to another embodiment of the invention, the immunoglobulin binding element is associated with said substance via a vector. According to an advantageous arrangement of this embodiment, said vector is selected from the group consisting of bacteria, viruses, “empty shell” viral particles, liposomes and polymeric microspheres.

The present invention also relates to pharmaceutical compositions comprising a non-covalent complex according to the invention and at least one pharmaceutically acceptable vehicle. Among these compositions, there may be mentioned:

. an immunogenic composition or a vaccine composition comprising a non-covalent complex according to the invention, in which the active substance is an antigen or an immunogen.

Vaccine compositions have a number of advantages.

Indeed, during a vaccination, it is important that the immune response is directed against the immunizing protein and induced by this same protein (because it is the T and B lymphocytes specific for this protein which will then be recruited during contamination by l infectious agent, not those specific to the anticoφs and the immunoglobulin binding element contained in the non-covalent complex). The absence of an immune response against an active substance of the haptenic type clearly indicates that the anticoφs and the binding element to immunoglobulins cannot induce an immune response against the active substance and only contribute to its targeting. When the active substance is a protein, the non-covalent complexes will therefore be particularly suitable since the immune response directed against the immunizing protein will be induced by this same protein.

. a cytotoxic composition comprising a non-covalent complex according to the invention, in which the active substance is a drug; and

. an expression composition comprising a non-covalent complex according to the invention, in which the active substance is a nucleic acid sequence.

Suφrenantly, both the immunogenic compositions and the vaccine compositions according to the invention can increase the production of specific anticoφs, the stimulation of specific helper T cells and the stimulation of specific cytotoxic T cells. The present invention also relates to a process for the preparation of a non-covalent complex according to the invention, characterized in that it comprises:

. the preparation of an immunoglobulin binding element, associated with an active substance and

. the incubation of said immunoglobulin binding element, associated with an active substance with an anticoφs capable of binding to a molecule expressed on the surface of a cell, preferably between 10 minutes and 3 hours.

In addition to the foregoing provisions, the invention also comprises other provisions, which will emerge from the description which follows, which refers to examples of implementation of the method which is the subject of the present invention as well as to the accompanying drawings, in which :

FIG. 1 illustrates the stimulation of T cells (cells called T1B2) by the fusion protein ZZ-toxin α from Naja nigricollis (-O-, - • -) or the toxin α (-D-, -> -), in the presence (complex according to the invention: - • -, simple mixing of the various elements, the toxin α not being conjugated to ZZ: -B-) or in the absence (-0 -, - D-) of anti-MHC class II antibodies, known as 14-4-4S; the serial dilutions of the different proteins are reincubated overnight in wells at 4 ° C., with or without 14-4-4S antibodies and the T1B2 cells and the CPAg are then added. Figure 1A: 5.10 ⁵ splenocytes are used as CPAg; Figure 1B: 5.10 ⁴ A20 cells are used as CPAg. The stimulation of T cells is assessed through the secretion of interleukin-2 (LL-2), determined by the proliferation of an cytotoxic T cell line dependent on IL-2 (CTLL test), using methyl- ³ H thymidine, 5 Ci / mmol, CEA, France); the data are expressed in cpm (ordered) and correspond to the incoφoration of tritiated thymidine in the cells: FIGS. 1A and 1B include on the abscissa the concentrations (μM) of toxin α free or conjugated to ZZ (ZZ-toxin α).

- Figure 2 illustrates the anti-toxin anti-toxin response of BALB / c mice, immunized either with the free ZZ-α conjugate (-D-) or the ZZ-α complex anticoφs 14-4-4S (- • -). The fusion protein is incubated overnight at 4 ° C with or without 14-4-4S antibodies. Groups of 4 mice are then immunized subcutaneously, at the base of the tail, without adjuvants. The mice are bled 7, 14 and 26 days after the injection and the presence of anti-toxin antibodies is evaluated, in accordance with ELISA; this figure includes on the ordinate the reverse of the title in anticoφs and on the abscissa, the number of days.

- Figure 3 illustrates the anti-toxin anti-toxin response of BALB / c mice, immunized either with the toxin α (-D-), or with the fusion protein ZZ-α (- • -). Groups of 4 mice are immunized subcutaneously, at the base of the tail, with these different proteins, previously mixed with complete Freund's adjuvant. The mice are bled 14 and 21 days after the injection and the presence of anti-toxin antibodies is evaluated by ELISA; this figure includes on the ordinate, the reverse of the title in anticoφs and on the abscissa, the number of days.

FIG. 4 illustrates the results obtained under the same conditions as those of FIG. 1. Protein A-toxin α complexes and anticoφs 14-4-4S or a mixture of toxin α, ZZ and anticoφs 14-4-4S are compared with complexes according to the invention ZZ-α and anticoφs 14-4-4S. FIG. 4 A illustrates the results obtained with toxin α alone (-D-), the mixture of toxin α, ZZ and anticoφs 14-4-4S (toxin α and the compound ZZ are not conjugated, - • -), toxin α + protein A + anticoφs 14-4-4S (-O-) (toxin α and protein A are not conjugated), conjugate ZZ-α (- • -) and complex according to the invention ZZ-toxin α and anticoφs 14-4-4S (-Δ-): the antigens are incubated overnight at 4 ° C, then the splenocytes (CPAg) and T1B2 cells are added and incubated 24h at 37 ° C. FIG. 4B illustrates tests of the same type as those carried out in FIG. 4A; however, the antigen in this case is erabutoxin a (Ea). This figure illustrates the results obtained with Ea alone (-D-), a ZZ-Ea conjugate (-B-), a complex according to the invention ZZ-Ea + anticoφs 14-4-4S (-O-), a protein A-Ea conjugate (- • -), a protein A-Ea + anticoφs 14-4-4S (-Δ-) conjugate, under the same conditions as those set out for FIG. 4A.

- Figure 5 illustrates the results obtained, under the same conditions as those set out for Figure 1, the anticoφs 14-4-4S being replaced by an anti-IgM anticoφs; this figure illustrates the stimulation of T cells (cells called T1B2) by the fusion protein ZZ-toxin α from Naja nigricollis (-O - * -) or the toxin α (-D-, -B-), in the presence (complex according to the invention: - • -, various elements in mixture: -M-) or in the absence (-0 -, - D-) of anti-IgM anticoφs (RAM-μ); the serial dilutions of the various proteins are reincubated overnight in wells at 4 ° C., with or without RAM-μ anticoφs and the T1B2 cells and the CPAg are then added (5.10 ⁵ splenocytes). The stimulation of T cells is assessed through the secretion of interleukin-2 (IL-2), determined by the proliferation of an cytotoxic T cell line dependent on IL-2 (CTLL test), using methyl- ³ H thymidine, 5 Ci / mmol, CEA, France); the data are expressed in cpm (ordinates) and correspond to the incoφoration of tritiated thymidine in the cells: on the abscissa, the concentrations (nM) of toxin α free or conjugated to ZZ (ZZ-toxin α) are represented.

- Figure 6 illustrates the increase in the induction in vivo of T helper cells specific for alpha toxin by a series of non-covalent complexes according to the invention ZZ-toxin α and anti-IgM antibodies (RAMμ), ZZ- α toxin and anti-IgGF (ab ') 2 antibodies (RAMF (ab') 2), ZZ-α toxin and anti-HCM antibodies (14-4-4S).

- Figure 7 illustrates the increase in induction in vivo of the anticoφs anti-diphtheria toxin response after injection into BALB / c mice of a non-covalent complex according to the invention: ZZ-DTR and anticoφs anti-molecule MHC class II (14-4-4S); this figure has the protocols on the abscissa immunization and challenge and on the ordinate the reverse of the title in anticoφs diphtheria antitoxin.

It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention, of which they do not in any way constitute a limitation.

Example 1: In vitro increase in presentation to T cells by a non-covalent complex according to the invention ZZ-toxin α and anti-MHC antibody.

Material and methods

* Synthetic proteins and peptides: erabutoxin a and toxin α were purified respectively from the venoms of Laticauda semifasciata and Naja nigricollis, as described in Fryklund L. et al. (Biochem, 1975, 14, 2865). The purity of the toxin is checked using a reverse phase HPLC.

* Construction, expression and purification of fusion proteins The cDNA coding for erabutoxin a (Ea) from the Seentent Laticauda semifasciata was cloned and expressed in the form of a fusion protein, either with the ZZ fragment (B. Lowenadler et al., EMBO J, 1986, 5, 2393-2398), either with protein A.

The procedures followed to construct and express these two hybrids have been described in detail in F. Ducancel et al. {Prot. Engineer, 1989, 3, 139) and L. Pillet et al., (J. Biol Chem., 1993, 268, 909).

The Na toxin nigricollis α toxin was expressed, fused with the ZZ fragment, using a synthetic gene of 195 bp constructed from 10 oligomers having sizes ranging from 26 to 61 nucleotides according to standard procedures (J. Sambrook et al. , 1989, Cold Spring Harbor, Molecular cloning, a laboratory manual, Cold Spring Harbor Laboratory Press).

Both the secretion vectors and the expression vectors are Pharmacia vectors. The fusion proteins are purified as described in F. Ducancel et al., 1989, and L. Pillet et al., 1993, cited above. * T cell stimulation test

T cell hybridomas: the different antigens are serially diluted in microculture wells and 5.10 ⁴ of T1B2 cell hybridomas are added. teas per well with antigen presenting cells, ie 5.10 ⁴ cells

A20, i.e. with 5.10 ⁵ splenocytes.

The cells are cultured for 24 hours at 37 ° C. in a humidified atmosphere containing 7% CO ₂ . The presence of IL-2 in the culture supernatants of T cell hybridomas and the mass cultures is evaluated by determining the proliferation of a cytotoxic LL-2 dependent T cell line, using methyl H thymidine,

5 Ci / mmol. The data are expressed in cpm, according to the protocol described in detail in M. Léonetti (J. Immunol., 1990, 145, 4214). * Cells used

- the hybridoma B producing the anti-CMH anticoφs 14-4-4S was obtained by K. OZATO {J. Immunol, 1980, 124, 533) and is available under the number ATCC HB-32;

- B lymphoma, called A20, was obtained by K.j. Kim; the procedure followed for obtaining it is described in detail in J. Immunol., 1979, 122, 549 and is available under the number ATCC TLB-208;

- the hybridoma T, specific for the toxin α and erabutoxin a, called T1B2, was obtained by B. Maillère; the procedure followed for obtaining it is described in detail in J. Immunol., 1993, 150, 5270. Results

* Stimulation of antigen-specific T helper cells in vitro

A non-covalent complex according to the invention comprising a ZZ-toxin conjugate and a monoclonal anticoφs 14-4-4S, which specifically recognizes the substance IE ^d of class II of the major murine histocompatibility complex, is evaluated for its presentation capacity. to T cells in vitro.

As illustrated in FIG. 1, a remarkable increase in the presentation to T cells of the fusion toxin is observed. More specifically, using A20 cells such as CPAg (FIG. 1A), the ZZ-toxin / 14-4-4S complex is 10 "and 10 times more powerful, respectively, in stimulating T1B2 cells compared to an incubated ZZ-toxin conjugate. alone and with non-fused toxin. Similar results are obtained using splenocytes such as CPAg (Figure IB). No increase in immunogenicity is observed when the unfused toxin is incubated either with the free ZZ domain or with the antico l'ants 14-4-4S (FIGS. 1A and B). These results show that the significant increase in immunogenicity observed with the complex according to the invention ZZ-toxin and anticoφs 14-4-4S is associated with a capacity of the anticoφs 14-4-4S to target the ZZ-toxin conjugate. and therefore the toxin itself to the class II molecule of the major histocompatibility complex.

Example 2: Production of antibodies in vivo, in the absence of adjuvants, with a non-covalent complex according to the invention ZZ-α toxin and anti-MHC antibody.

Material and methods

* Mouse immunization

For the evaluation of the immune response in vivo to the toxin α and to the conjugate ZZ-α, BALB / c mice (LFFA CREDO, France) are injected, at the base of the tail, 100 μl of an emulsion d complete Freund's adjuvants containing 0.5 nmole, either of toxin α or of ZZ-α.

Blood samples are taken 14 and 21 days after the injection. For the T cell experiments, the spleens are removed 10 days after the immunization of the mice. For the evaluation of the anticoφs response against the 14-4- complex

4S / ZZ-α: BALB / c mice are injected, at the base of the tail, with 100 μl of a 0.1 M phosphate buffer solution, pH 7.2 containing 0.1 nmole of ZZ-α or of complex ZZ- α 14-4-4S. Blood samples are taken 7, 14 and 26 days after immunization. * T cell stimulation test

The test is carried out under the same conditions as those set out in Example 1.

However, in this case, it is the cells of immunized mice which are used (mass culture): the test carried out corresponds to the protocol described in M. Léonetti et al. (J. Immunol, 1990, 145, 4214). More specifically, the spleens are removed and suspended in a proliferation medium. The cells (10 ⁶ cells / well) are cultured for 24 hours at 37 ° C. in a humid atmosphere at 7% CO ₂ with serial dilutions of antigens. The presence of IL-2 in mass culture supernatants is evaluated by determining the proliferation of an IL-2 dependent cytotoxic T cell line, using methyl H thymidine, 5 Ci / mmol. The data are expressed in cpm, under the conditions specified above.

* Titration in anticoφs by immunoassay ELISA microtitration plates are covered with native toxin (0.1 μg / well) in 0.05 M phosphate buffer pH 7.4 and incubated overnight at 4 ° C, then saturated with 0.1 M phosphate buffer pH 7.4 containing 0.3 bovine serum albumin. The antisera are diluted in series in the same buffer containing 0.1% bovine serum albumin and incubated overnight at 4 ° C. Anticoφs binding is evaluated using an anticoφs goat anti-mouse-peroxidase conjugate and 2,2 ', - azino-bis (3-ethylbenz-thiazoline-6-sulfonic) acid (ABTS).

The titer is defined as being the highest dilution of serum giving a difference in absorbance compared to the negative control greater than or equal to 0.6. For this control, a pool of sera collected before the immunization of the mice is used. Results

* Increase in the T response and production of anticoφs in vivo, in the absence of adjuvants Anticoφs 14-4-4S is incubated with the ZZ-toxin conjugate and injected into the BALB / c mouse. Immunizations are performed in the absence of adjuvants. One week after immunization, an immune response is observed, which gradually increases over the following 3 weeks (Figure 2).

This result is particularly interesting since (i) the obtaining of an immune response in the absence of adjuvants is not observed with the ZZ-toxin hybrid and (ii) the amount of fused toxin injected into the non-covalent complex according to the invention can be reduced to 0.1 nmol / mouse, a value which is 5 times lower than that used in the presence of adjuvants, as illustrated in FIG. 3.

It should be noted that at this dose and in the absence of an adjuvant, the free toxin is still lethal and therefore cannot be used as a reference in this experiment.

Example 3 Comparison between a Complex According to the Invention Comprising a ZZ Fragment and a Complex Comprising Protein A

The conditions are identical to those set out in Example 1.

The results are illustrated in FIG. 4, which shows a remarkable increase in the presentation to T cells of both the toxin α (FIG. 4A) and the erabutoxin a (FIG. 4B). More precisely, by using splenocytes such as CPAg, the ZZ-toxin / anticoφs complex is more powerful in stimulating T1B2 cells than a ZZ-toxin conjugate incubated alone or than the free toxin. Suφrenantly, the ZZ-Ea / anticoφs complex is as effective as the protein A-Ea / anticoφs complex, in stimulating T1B2 cells (FIG. 4B). The increase effects are not observed when the unfused toxin is incubated with free ZZ and the anticoφs 14-4-4S or with free protein A and the anticoφs 14-4-4S (FIG. 4A). This last point indicates, moreover, that the increase in T stimulation is not due to a mitogenic effect linked to the joint presence of the free toxin, ZZ and anticoφs, in the medium.

Example 4: In vitro increase in presentation to T cells by a non-covalent complex according to the invention ZZ-toxin α and anti-IgM antibodies. The conditions are identical to those set out in Example 1. The results are illustrated in FIG. 5. As can be seen in this figure, the incubation of rabbit anticoφs anti mouse IgM μ (Jackson product), in the presence of ZZ-α conjugate considerably increases the stimulating power T of the toxin. Indeed, this complex is respectively 45 times and 800 times more effective than the ZZ-α conjugate incubated alone and that the toxin α incubated alone. EXAMPLE 5 Increase in the induction in vivo of T helper cells specific for alpha toxin by a series of non-covalent complexes according to the inventions ZZ-toxin α and anti-IgM antibodies (RAMμ), ZZ-toxin α and anti antibodies - IgGF (ab ') 2 (RAMF (ab') 2), ZZ-toxin α and anti-HCM antibody (14-4-4S). A series of non-covalent complexes has been prepared to assess whether some of them are capable of increasing the induction of T helper cells specific for alpha toxin in vivo. ZZ-α was respectively complexed with the following antibodies: mouse IgG2a, anti-mouse rabbit antibodies specific for the μ chain of IgM (RAMμ) (Jackson product), anti-mouse rabbit antibodies specific for the F region (ab ') ₂ IgG (RAMF (ab')) (Jackson product), rabbit anticoφs (IgG) (SIGMA product), and MHC class II anti-molecule (14-4-4S). Different batches of BALB / c mice are then injected, in the absence of an adjuvant, with the ZZ-α hybrid alone or complexed with the above-mentioned anticoφs. The induction of helper T cells, specific for the toxin α in vivo, is evaluated 36 days later. For this, the rats of the animals are collected and the spleen cells are incubated for 24 hours at 37 ° C. with the native alpha toxin (1 μM final), the peptide 24-41, which is the immuno-dominant T peptide of the toxin. alpha (1.5 μM final), or the chicken egg lysozyme (1 μM final). The presence of interleukin 2 in the culture supernatants is then tested by measuring their capacity to stimulate the incoφoration of tritiated thymidine in a JJL2-dependent line.

As illustrated in FIG. 6, only the helper T cells of animals immunized with the non-covalent complexes ZZ-toxin α and anticoφs anti-IgM (RAMμ), ZZ-toxin α and anticoφs anti-IgGF (ab ') ₂ (RAMF) (ab ') ₂ ), ZZ toxin α and anticoφs antiCMH (14-4-4S) are capable of producing 1TL2 in the presence of alpha toxin or peptide 24-41. These three non-covalent complexes therefore represent effective vehicles for the induction of specific T cells in animals. Example 6: Production of antibodies in vivo with a complex according to the invention ZZ-DTR and anti-MHC antibody.

Material and methods

* Construction and expression of the fusion protein A ZZ-DTR fusion protein is prepared in which ZZ has the same meaning as above and DTR corresponds to fragment 382-535 of the diphtheria toxin (DT) sequence, comprising the domain R (MJ BENNETT et al., Protein Sel, 1994, 3, 1444-1463; MJ BENNETT et al., Protein Sci., 1994, 3, 1464-1475; JM. ROLF et al., 1993, Infect. Immun ., 1993, 61, 994-1003; JM. ROLF et al., Mol. Microbiol, 1993, 7, 585-591).

The diphtheria toxin receptor domain (DTR), corresponding to amino acids 382-535, was expressed, fused with the ZZ fragment. For this, the sequence coding for the DTR fragment was amplified by PCR, using the plasmid pK5DT, coding for diphtheria toxin, as template. The amplified fragment was cloned into the plasmid pCP (P. Drevet et al., Protein Expression Purif., 1997, 10, 293-300).

This plasmid allows the production of a ZZ-DTR protein in the cytoplasm.

All genetic manipulations are carried out in accordance with Sambrook et al. (1989, Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).

More specifically, a PCR is carried out to create SalI and BamHI restriction sites respectively at the 5 ′ and 3 ′ ends of the nucleotide sequence corresponding to the DTR domain. Plasmid pK5DT is used as template and the following oligonucleotides are used as primers: Sali site: 5'GGGACTGCAGGTACCGTCGACGCCGGGTCACA AAACGCAA3 'BamHI site: 5'GGGACTGCAGGATCCTTATAAGCTTCCGCTT TTGATTTCAAAAAATAG3.

The oligonucleotides were designed to adjust the reading frame of the DT domain with that of the ZZ fragment. The SalI and BamHI sites are used to subclone the DTR fragment amplified in M13mP18, in which it has been sequenced.

The DTR fragment is then excised using the enzymes Sac1 and BamHI and introduced into the vector pCP (P. Drevet et al., Protein Expression Purif., 1997, 10, 293-300).

E. coli BL21 (DΕ3) Lys bacteria are used to express the ZZ-DTR protein.

Transformed cells are cultured in 100 ml of Broth medium (trypsinized soybeans, Difco) supplemented with glucose (5 g / liter), ampicillin (200 mg / ml) and chloramphenicol (30 mg / ml).

60 ml of cells incubated overnight at 37 ° C. are used to inoculate a fermenter comprising 3 l of the same medium as that of the preculture.

The cells are incubated at 37 ° C. with aeration until an optical density at 600 nm of between 0.5 and 1 is obtained. ÎTPTG (isopropyl-β-D-thiogalactopyranoside) is then added

0.5 mM (final concentration); after 3 h of induction, the cells are recovered by centrifugation (5,000 xg for 15 min), resuspended in a lysis buffer (Tris 30 mM, mDTA 5 mM, glucose 20%, pH 8) and exploded with a Εaton press. The supernatant containing the fusion protein is purified on an IgG-Sepharose 4B column (Pharmacia Biotech); 10 ml of crude extract are incubated overnight at 4 ° C with 10 ml of IgG-Sepharose balanced with a buffer comprising: 50 mM Tris-HCl, pH 7.6, 150 mM NaCl and 0.05% Tween 20.

After washing with 10 volumes of equilibration buffer, 2 volumes of 5 mM ammonium acetate are added to the column. The bound protein is thus eluted with 0.5 M acetic acid (pH 3.4) and immediately neutralized with 1 M Tris-HCl buffer (pH 8).

The fraction containing the ZZ-DTR protein is concentrated to 4 mg / ml by ultrafiltration on Microsop 30 (Filtron). Results

The response in anti-diphtheria toxin antibodies is increased when BALB / c mice are pre-simulated with the non-covalent complex according to the invention ZZ-DTR and anti-MHC class II molecule antibodies (14-4-4S). The ZZ-DTR fusion protein is complexed with the MHC class H (14-4-4S) antimolecule anticoφs. Different batches of BALB / c mice are then injected either with physiological saline, or with physiological saline containing the non-covalent complex (0.01 nmole per mouse), or with physiological saline containing ZZ-DTR alone (0.01 nmol by mouse). A challenge is achieved 31 days later by the injection of a mutant of the diphtheria toxin CRM197 (Mekada et al., J. Biol Chem., 1985, 260, 12148-12153) (SIGMA product) (0, 1 nmol per mouse). The blood of the animals is taken 14 days later and the presence of anti-diphtheria toxin antibodies in the sera is evaluated by an immunoenzymatic assay test. As illustrated in FIG. 7, a single injection of non-covalent complex (14-4-4SZZ-DTR / 0) makes it possible to induce a production of anti-diphtheria toxin antibodies almost 6 times greater than a double immunization with ZZ-DTR (ZZDTR / ZZDTR). In addition, following the challenge with the CRM 197 mutant, the animals pre-simulated with 14-4-4SZZ-DTR (14-4-4SZZ-DTR / CRM197) have a titre of anti-diphtheria toxin antibodies 8 to 10 times higher than that animals pre-simulated with ZZ-DTR alone (ZZ-DTR / CRM197) or injected with physiological saline (0 / CRM197). The non-covalent complex therefore constitutes an immunogen making it possible to increase the anticoφs anti-diphtheria toxin response during a challenge with a mutant of the diphtheria toxin. As is apparent from the above, the invention is in no way limited to those of its modes of implementation, embodiment and application which have just been described more explicitly; on the contrary, it embraces all the variants which may come to the mind of the technician in the matter, without departing from the framework, or the scope, of the present invention. LIST OF SEQUENCES

(1) GENERAL INFORMATION:

(i) DEPOSITOR

(A NAME: ATOMIC ENERGY COMMISSIONER (B RUE: 31-33 rue de la Fédération (C CITY: PARIS (E COUNTRY: FRANCE (F POSTAL CODE: 75015

(A NAME: DREVET Pascal (B RUE: 13 Grande Rue (C CITY: PECQUEUSE (E COUNTRY: FRANCE (F POSTAL CODE: 91470

(A NAME: LEONETTI Michel (B RUE: 18 rue du Colonel de Bange (C CITY: VERSAILLES (E COUNTRY: FRANCE (F POSTAL CODE: 78000

(A NAME: MENEZ André (B RUE: 109 avenue Claude Nicolas Ledoux - Magny les

Hamlets

(CITY: SAINT REMY LES CHEVREUSE (E COUNTRY: FRANCE (F POSTAL CODE: 78470

(ii) TITLE OF THE INVENTION: NON-COVALENT COMPLEX COMPRISING AT LEAST ONE ANTIBODY AND AN IMMUNOGLOBULIN BINDING MEMBER ASSOCIATED WITH AN ACTIVE SUBSTANCE, ITS PREPARATION METHOD AND ITS APPLICATIONS.

(iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER-DETACHABLE FORM:

(A) TYPE OF SUPPORT: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPO)

(vi) DATA FROM THE PREVIOUS APPLICATION:

(A) REQUEST NUMBER: FR 97 01420

(B) DEPOSIT DATE: 07-FEB-1997

(2) INFORMATION FOR SEQ ID NO: 1:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 40 base pairs

(B) TYPE: nucleotide

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:

GGGACTGCAG GTACCGTCGA CGCCGGGTCA CAAAACGCAA 40 (2) INFORMATION FOR SEQ ID NO: 2: -

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 48 base pairs

(B) TYPE: nucleotide

(C) NUMBER OF STRANDS: single

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: Other nucleic acid (A) DESCRIPTION: / desc = "PRIMER"

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: GGGACTGCAG GATCCTTATA AGCTTCCGCT TTTGATTTCA AAAAATAG 48

Claims

1 °) CLAIMS Non-covalent complex, characterized in that it comprises (i) at least one anticoφs or a fragment of anticoφs capable of binding to a molecule expressed on the surface of a cell and (ii) an element of binding to an immunoglobulin or to an immunoglobulin fragment, associated with an active substance, which binding element can only bind to a single type of site on the immunoglobulin.

2) non-covalent complex according to claim 1, characterized in that said anticoφs or fragment of anticoφs is directed against a molecule expressed on the surface of the cells presenting the antigen. 3 °) non-covalent complex according to claim 2, characterized in that said anticoφs is selected from the group consisting of anticoφs MHC class π antimolecule, anti-IgM anticoφs or anti-IgG anticoφs directed against the F region (ab ') ₂ of an Ig.

4 °) non-covalent complex according to claim 1, characterized in that said anticoφs or fragment of anticoφs is directed against a molecule expressed on the surface of cancer cells.

5 °) non-covalent complex according to claim 1, characterized in that said anticoφs or fragment of anticoφs is directed against a molecule expressed on the surface of mucosal cells or muscle cells. 6 °) non-covalent complex according to claim 1, characterized in that said anticoφs or fragment of anticoφs binds to a cell expressing an Fc receptor on its surface.

7 °) non-covalent complex according to any one of claims 1 to 6, characterized in that the binding element to an immunoglobulin or to an immunoglobulin fragment is selected from the group consisting of proteins or fragments of immunoglobulin binding proteins, which bind only in the Fc region of an immunoglobulin, which are derived from bacteria and which are less affine than protein A, such as peptides derived from protein A of Staphylococcus aureus, such as fragment ZZ. 8 °) non-covalent complex according to any one of claims 1 to 6, characterized in that the binding element to an immunoglobulin or to an immunoglobulin fragment is selected from the group consisting of proteins or fragments of immunoglobulin binding proteins, which only bind in the Fc region of an immunoglobulin and which are derived from bacteria, such as a fragment of protein A of at least eight amino acids, protein G, preferably recombinant or one of its peptide fragments, or any other protein or protein fragment, derived from bacteria, protozoa or viruses and binding in the Fc region of an Ig.

9 °) non-covalent complex according to any one of claims 1 to 6, characterized in that the immunoglobulin-binding element is selected from the group consisting of proteins or fragments of immunoglobulin-binding proteins which do not link that in the Fab region of an immunoglobulin and are derived from bacteria, such as protein L of Peptostreptococcus magnus, a fragment of protein A comprising at least one of the following domains A, B, C, D and or E, protein G, preferably recombinant or a fragment of protein G, protein P or a fragment of protein P of Clostridium perfringens, or any other protein or fragment of protein, derived from bacteria, protozoa or viruses and binding in the Fab region of an Ig.

10 °) non-covalent complex according to any one of claims 1 to 9, characterized in that the active substance is selected from the group consisting of antigens of interest, drugs and nucleic acid fragments of interest .

11 °) non-covalent complex according to claim 10, characterized in that when the active substance is an antigen or an immunogen, it comprises (i) an anticoφs or a fragment of anticoφs directed against a molecule expressed on the surface of an antigen presenting cell, in particular an anti-MHC anti-molecule antibody, an anti-IgM antibody or an anti-IgG antibody directed against the F (ab ') _{2 region} of an Ig and (ii) a binding element to immunoglobulins which bind to only one type of site of said immunoglobulin, associated with an antigen.

12 °) non-covalent complex according to claim 11, characterized in that it comprises (i) an anticoφs anti-MHC molecule of class JJ and (ii) a protein or a fragment of an Fc binding protein of Ig, in particular the ZZ fragment of protein A conjugated to an antigen, preferably in the form of a fusion protein. 13 °) non-covalent complex according to claim 10, characterized in that when the active substance is a drug, it comprises (i) an anticoφs or a fragment of anticoφs directed against a molecule expressed on the surface of a target cell (α-fcetoprotein, for cancer cells, for example) and (ii) an immunoglobulin binding element which binds only to one type of site of said immunoglobulin, associated with a drug which can in particular be selected from cytotoxic chemicals, toxins (animal, plant or bacterial), haptens and antisense nucleotide sequences.

14 °) non-covalent complex according to claim 10, characterized in that when the active substance is a nucleic acid, it comprises (i) an anticoφs or a fragment of anticoφs directed against a molecule expressed on the surface of a cell target and (ii) an immunoglobulin binding element which binds only to one type of site of said immunoglobulin, associated with a nucleic acid.

15 °) Non-covalent complex according to any one of claims 1 to 14, characterized in that the element for binding to the immunoglobulins is covalently conjugated to the said active substance.

16 °) non-covalent complex according to claim 15, characterized in that the active substance is associated with the binding element in the form of a fusion protein. 17 °) non-covalent complex according to any one of claims 1 to 14, characterized in that the immunoglobulin-binding element is associated with said substance via a vector.

18 °) non-covalent complex according to claim 17, characterized in that said vector is selected from the group consisting of bacteria, viruses, viral particles "empty shell", liposomes and polymeric microspheres.

19 °) Immunogenic composition, characterized in that it comprises a non-covalent complex according to any one of claims 1 1, 12 and 15 to 18 and at least one pharmaceutically acceptable vehicle. 20 °) vaccine composition, characterized in that it comprises a non-covalent complex according to any one of claims 11, 12 and 15 to 18 and at least one pharmaceutically acceptable vehicle. 21 °) Cytotoxic composition, characterized in that it comprises a non-covalent complex according to any one of claims 13 and 15 to 18 and at least one pharmaceutically acceptable vehicle.

22 °) Expression composition, characterized in that it comprises a non-covalent complex according to any one of claims 14 to 18 and at least one pharmaceutically acceptable vehicle.

23 °) Composition according to any one of claims 19 to 22, characterized in that the anticoφs directed against a molecule expressed on the surface of a cell and the immunoglobulin binding element associated with an active substance are in separate containers, prior to use.

24 °) Process for the preparation of a non-covalent complex according to any one of Claims 1 to 18, characterized in that it comprises:

. the preparation of an immunoglobulin binding element, associated with an active substance and. the incubation of said immunoglobulin binding element, associated with an active substance with an anticoφs or a fragment of anticoφs capable of binding to a molecule expressed on the surface of a cell, preferably between 10 minutes and 3 hours.